Composition for preventing or treating chronic kidney disease comprising a compound that induces the expression of the anti-aging gene KLOTHO

Abstract

The present invention relates to a method for preventing chronic kidney disease (CKD) comprising administering to a patient a compound that induces the expression of the anti-aging gene klotho. The compound represented by Chemical Formula 1 according to the present invention is capable of inhibiting aging-related The present invention has an excellent effect of increasing the expression level of the Klotho gene, which is a gene that inhibits chronic kidney disease, and can be usefully used as a pharmaceutical composition or food composition for preventing, improving, or treating chronic kidney disease.

Description

Detailed Description of the Invention

[0001] [Technical field] This application claims priority to Korean Patent Application No. 10-2021-0042955 filed on April 1, 2021, and Korean Patent Application No. 10-2022-0040453 filed on March 31, 2022, and The entire specification is incorporated by reference into this application.

[0002] The present invention provides a method for preventing chronic kidney disease (CKD) comprising a compound that induces the expression of the anti-aging gene klotho. or therapeutic compositions. [Background technology] Chronic kidney disease (CKD) refers to a condition in which kidney damage persists for more than three months or kidney function declines, and is recognized as a serious disease worldwide. Chronic kidney disease is increasing with the aging of the population and the increase in chronic diseases, and in many countries it is a major health issue due to its high prevalence and incidence, complications such as stroke, heart disease, diabetes, and infections, and increased medical costs.

[0003] Meanwhile, the fact that genes capable of regulating aging in animals exist was first discovered in 1981 with the discovery of senescence-accelerated mice (SAM). These mice, which were accidentally created during the breeding of mice, aged much faster than their inbred counterparts. It was confirmed that these mice carried mutations in various genes. The discovery of a single group of aging-related genes was subsequently reported in the 1990s. The reported gene was a member of the RecQ family, which expresses an enzyme called DNA helicase. Mutations in this gene were reported to cause premature aging and cancer, which is known to occur by affecting DNA repair. The klotho gene, discovered in 1997, is a single gene associated with aging. The klotho gene was discovered by chance while creating a genetically modified animal model of hypertensive mice. Mice lacking this gene expression exhibited premature aging and a shortened lifespan. Even more interesting is that mice with increased expression of this gene subsequently showed a 20.0-30.8% increase in lifespan in males and an 18.8-19.0% increase in lifespan in females. This marked the first time that the public was made aware of the fact that the expression of a single gene can either increase or decrease the lifespan of mice. It was also reported that the base sequence of the Klotho gene is highly similar between animals, with approximately 98% identity between mice and humans. This indicates that lifespan can also be regulated by the expression of the Klotho gene in humans.

[0004] In humans, the klotho gene is located on chromosome 13 and shares the same base sequence as β-glucosidase. It has been reported that Klotho protein is mainly expressed in renal tubular epithelial cells and the choroid plexus of the brain, with some expression in the parathyroid gland. The Klotho gene is a gene associated with various aging phenotypes, and mice lacking the Klotho gene develop syndromes similar to the aging process, including reduced lifespan, decreased activity, growth retardation, atherosclerosis, arterial calcification, osteoporosis, genital immaturity, infertility, skin atrophy, and emphysema. Klotho mutant mice develop Monckeberg-type arteriosclerosis, which occurs with aging in humans, and Similar patterns of arteriosclerosis are observed in all arteries, from the aorta to the small arteries, and angiogenesis and vasculogenesis are impaired.

[0005] Klotho mRNA is expressed significantly higher in kidney tissue than in other tissues, but is not expressed in hypertension, 2 In the kidneys of disease model mice with type 2 diabetes, diabetic nephropathy, and chronic renal failure, klotho mRNA was expressed. In mice with reduced Klotho expression, the expression of vascular endothelium-derived relaxing factor NO(N It reduces the production of thiamin mononitrate (HbO) and has many risk factors for cardiovascular disease. The klotho gene was introduced into Otsuka Long-Evans Tokushima fatty rat (OLETF) mice. Injection of klotho using a gene carrier improves vascular endothelial dysfunction, increases NO production, inhibits vascular hypertrophy and fibrosis, and lowers blood pressure. The klotho gene also affects glucose and insulin metabolism in mice, and statins, a popular antihypercholesterolemia drug, increase klotho mRNA expression in renal proximal tubule cells. Klotho-deficient mice develop osteopenia with low bone turnover due to impaired differentiation of both osteoblasts and osteoclasts, similar to age-related bone loss and senile osteoporosis in humans. Furthermore, klotho mutant mice exhibit abnormal elongation of trabecular bone at the epiphyseal region and abnormal trabecular organization on microcomputerized tomography, which is attributed to impaired bone resorption. The clinical phenotypes observed in humans due to klotho gene mutations are diverse. The KL-VS (functional variant of klotho), which has a mutation in three sites in exon 2 of the Klotho gene, has been associated with lipid metabolism, blood pressure, lifespan, cognitive function, coronary artery disease, and cerebrovascular disease. Microsatellite polymorphisms and single-nucleotide polymorphisms in the Klotho gene have been associated with bone mineral density, and single-nucleotide polymorphisms in the Klotho gene have been associated with cardiovascular disease risk factors and bone mineral density in healthy adult women. Recently, the association between the Klotho gene and Alzheimer's disease has been reported in various papers. Overexpression of klotho in a mouse model of Alzheimer's dementia has been shown to increase lifespan by 30% and suppress cognitive decline. Furthermore, klotho expression has been observed to reduce amyloid beta protein production in the brain by 50%. In humans, klotho expression levels are inversely correlated with the progression of Alzheimer's disease, and klotho protein has been shown to reduce the amount of inflammatory cytokines in the blood of patients with Alzheimer's disease.

[0006] Efforts have been ongoing to develop substances that can induce the expression of the klotho gene, which has clear anti-aging effects. Known substances that have been reported to be able to induce klotho expression include rapamycin, vitamin D, and statins. In 2012, a research team at Boston University screened a compound library totaling 150,000 compounds for compounds that can induce klotho gene expression, and reported three compounds.

[0007] The inventor selected compound H from these compounds, which has a structure that is highly likely to be developed as a drug, and confirmed through actual experiments that this compound can express the klotho gene in cells, and published the research results on its mechanism of action in a paper. After that, he conducted an experiment to analyze the structure of compound H (Comparative Example 1) and found that it induces klotho expression. The inventors then identified the structural characteristics of compounds that could be induced and used them to create new compounds with more than 10-fold increased activity. Furthermore, the inventors experimentally confirmed that novel compounds that induce the expression of the anti-aging gene klotho are useful for the prevention or treatment of chronic kidney disease, thereby completing the present invention. [Summary of the Invention]

[0008] [Problem to be solved by the invention] The object of the present invention is to provide a chronic kidney disease treatment agent comprising a compound represented by formula 1 or a pharmaceutically acceptable salt thereof. The object of the present invention is to provide a pharmaceutical composition for preventing or treating a disease.

[0009] Another object of the present invention is to provide a chronic inflammatory bowel disease treatment comprising a compound of formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a functional health food composition or a food composition for preventing or improving chronic kidney disease.

[0010] [Means for solving the problem] In order to achieve the above purpose, The present invention relates to a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient. The present invention provides a pharmaceutical composition for preventing or treating chronic kidney disease, comprising:

[0011] [ka]

[0012] (In the above Chemical Formula 1, L 1 is a single bond or

[0013] [ka]

[0014] and; R 1 and R 2 are -H, -OH, and C, respectively. 1-10 or a straight or branched chain alkyl C 6-8 wherein the aryl of said arylamide is selected from the group consisting of halogen, —NO2 and C 1-10 One or more of the linear or branched alkyl halides are substituted. can be; R 1 and R 2 are C together with the carbon atoms to which they are connected. 6-8 can form an aryl of; R 3 , R 4 , R 5 , R 6 and R 7 are -H, halogen, -NO2 or C, respectively. 1-10 (straight or branched chain alkyl).

[0015] The present invention also provides a compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a functional health food composition for preventing or improving chronic kidney disease, which contains the active ingredient. Furthermore, the present invention provides a compound represented by the above Chemical Formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a food composition for preventing or ameliorating chronic kidney disease, which contains the compound as an active ingredient.

[0016] Furthermore, the present invention provides a compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a method for preventing or treating chronic kidney disease, which comprises administering or taking to an individual a composition containing the compound as an active ingredient.

[0017] Furthermore, the present invention provides a compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a composition containing the compound as an active ingredient for use in the prevention or treatment of chronic kidney disease. [Effects of the invention] The compound represented by Chemical Formula 1 according to the present invention inhibits the Klotho gene, which is an aging-related gene. The compound has an excellent effect of increasing the expression level of the compound, and can be usefully used as a pharmaceutical composition or food composition for preventing, improving or treating chronic kidney disease. [Brief explanation of the drawings]

[0018] [Figure 1] Figure 1a shows the results of luciferase expression experiments using reporter genes comprising a promoter extending from the start site of the human klotho gene to 1.7 kbp before the gene in Comparative Examples 1 to 4. Figure 1b shows the results of luciferase expression experiments using reporter genes comprising a promoter extending from the start site of the human klotho gene to 240 bp before the gene in Comparative Examples 1 to 4. [Figure 2] FIG. 2 shows the results of luciferase expression experiments using a reporter gene containing a promoter spanning up to −2.1 kb upstream of the human klotho gene in Examples 1 to 6. [Figure 3]FIG. 3 shows the results of luciferase expression experiments using a reporter gene containing a promoter spanning up to −2.1 kb upstream of the human klotho gene in Examples 1 to 3. [Figure 4] FIG. 4 shows the results of confirming the mRNA expression level of the klotho (KL) gene by RT-PCR in Examples 1 and 2. [Figure 5] FIG. 5 shows the results of confirming the expression of the klotho gene in RPTEC cells treated with the compounds of Examples 1 to 2 and Examples 7 to 10. [Figure 6] FIG. 6 shows the results of confirming the cytotoxicity of HK2 cells treated with the compounds of Examples 1, 9, and 10. [Figure 7a] FIG. 7a is a diagram showing a schematic diagram of a protocol for preparing a disease model by treating HK-2 cells (human kidney cells) with cisplatin. [Figure 7b] FIG. 7b shows the results of analyzing the expression level of Klotho protein in HK-2 cells obtained by the protocol of FIG. 7a. [Figure 8a] FIG. 8a is a schematic diagram showing the protocol for injecting KS1 compound into an animal model of unilateral ureteral obstruction and obtaining experimental samples. [Figure 8b] FIG. 8b shows the results of analyzing the degree of renal hypertrophy using the experimental samples obtained according to the protocol of FIG. 8a. [Figure 9] FIG. 9 shows the results of H&E staining to confirm changes in the nucleus and cytoplasm in a unilateral ureteral obstruction model. [Figure 10] FIG. 10 shows the results of Sirius Red staining to confirm the degree of fibrosis progression in a unilateral ureteral obstruction model. [Figure 11a] FIG. 11 shows the results of examining the degree of cell death in a unilateral ureteral obstruction model through TUNEL staining. [Figure 11b] FIG. 11 shows the results of examining the degree of cell death in a unilateral ureteral obstruction model through TUNEL staining. [Figure 12]FIG. 12 shows the results of analyzing changes in Klotho protein expression in a unilateral ureteral obstruction model. [Figure 13] FIG. 13 shows the results of analyzing changes in MMP-9 protein expression in a unilateral ureteral obstruction model. [Figure 14] FIG. 14 shows the results of analyzing changes in Klotho protein expression in a chronic kidney disease model. [Figure 15] FIG. 15 shows the results of analyzing changes in Klotho protein expression in a chronic kidney disease model. [Figure 16] FIG. 16 shows the results of analyzing the changes in microalbumin values ​​in a chronic kidney disease model. [Figure 17] FIG. 17 shows the results of analyzing the changes in blood urea nitrogen (BUN) values ​​in a chronic kidney disease model. DETAILED DESCRIPTION OF THE INVENTION

[0019] [Best Mode for Carrying Out the Invention] The present invention will be described in detail below. The present invention relates to a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient. The present invention relates to a composition for preventing or treating / ameliorating chronic kidney disease (CKD), comprising:

[0020] Chronic kidney disease (CKD) is defined as structural or functional abnormalities of the kidneys (e.g., proteinuria) present for 3 months or longer. , hematuria, or pathological abnormalities), i.e., whether "renal damage" is present or not. The glomerular filtration rate remains at 60 mL / min / 1.73 m for more than 3 months. 2 Cardiovascular disease is defined as a decrease in It is a disease accompanied by various complications such as vascular disease, mineral gall metabolism, and anemia.

[0021] The compound represented by the following formula 1 according to the present invention binds to the Klotho gene, which is a gene related to aging. It has an excellent effect of improving the expression level of genes and can be usefully used as a pharmaceutical composition or food composition for preventing, improving or treating chronic kidney diseases.

[0022] Pharmaceutical composition for preventing or treating chronic kidney disease (CKD) The present invention relates to a chronic inflammatory bowel disease comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof: A pharmaceutical composition for preventing or treating kidney disease is provided.

[0023] [ka]

[0024] In the above Chemical Formula 1, L 1 is a single bond or

[0025] [ka]

[0026] and; R 1 and R 2 are -H, -OH, and C, respectively. 1-10 or a straight or branched chain alkyl C 6-8 wherein the aryl of said arylamide is selected from the group consisting of halogen, —NO2 and C 1-10 One or more of the linear or branched alkyl halides are substituted. can be; R 1 and R 2 are C together with the carbon atoms to which they are connected. 6-8 can form an aryl of; R 3 , R 4 , R 5 , R 6 and R 7 are -H, halogen, -NO2 or C, respectively.1-10 of It can be a straight or branched chain alkyl.

[0027] In one embodiment according to the present invention, Said L 1 is a single bond or

[0028] [ka]

[0029] and; R 1 and R 2 are -H, -OH, and C, respectively. 1-5 straight or branched chain alkyl, or C 6-7 wherein the aryl of said arylamide is selected from the group consisting of halogen, —NO2 and C 1-5 wherein one or more of the linear or branched alkyl halides may be substituted; R 1 and R 2 can form a C6-7 aryl together with the carbon atom to which they are attached; R 3 , R 4 , R 5 , R 6 and R 7 are -H, halogen, -NO2 or C, respectively. 1-5 It can be a straight or branched chain alkyl.

[0030] In one embodiment according to the present invention, Said L 1 is a single bond or

[0031] [ka]

[0032] and; R 1 and R 2 are -H, -OH, -CH3, or phenylamide, respectively, The phenyl of the phenylamide may have one of -Cl, -NO2 and -CH2Cl. More than one species can be substituted; R 1 and R 2 can form a phenyl together with the carbon atom to which they are attached; R 3 , R 4 , R 5 , R 6 and R 7 can each be -H, -F, -Cl, -NO2, or -CH2CH3.

[0033] In one embodiment according to the present invention, Said L 1 is a single bond or

[0034] [ka]

[0035] and; R 1 are -H, -OH, -CH3,

[0036] [ka]

[0037] and; R 2 is -H; R 1 and R 2 can form a phenyl together with the carbon atom to which they are attached; R 3 is -H or -Cl; R 4 is -H, -F or -Cl; R 5 is -F, -Cl, -NO2, or -CH2CH3; R 6 is -H; R7 can be -H.

[0038] Preferred examples of the compound represented by Chemical Formula 1 according to the present invention include the following compound group: can be done. 1) N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide; 2) 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole; 3) 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol; 4) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide; 5) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4- Dichlorobenzamide; 6) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloroisothiazolinone) (chloromethyl)benzamide; 7) 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole; 8) N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine; 9) N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine; and 10) N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.

[0039] In one embodiment of the present invention, a preferred embodiment of the compound represented by Chemical Formula 1 is An example is a compound represented by the following chemical formula 1-1.

[0040] [ka]

[0041] (In the formula 1-1, L 1 is a single bond; R 1 and R 2 are -H or C, respectively. 1-10 is a straight or branched chain alkyl; R 3 , R 4 , R 5 , R 6 and R 7 are, -H, or halogen, respectively).

[0042] The compound of the present invention represented by Chemical Formula 1 may be used in the form of a pharmaceutically acceptable salt. As the salt, an acid addition salt formed with a pharmaceutically acceptable free acid is useful. The term "pharmaceutically acceptable salt" refers to a salt that is relatively non-toxic to patients and has an effective concentration that is harmless, and the side effects caused by the salt are not an advantage of the base compound of Chemical Formula 1. It refers to any organic or inorganic addition salt of the base compound of formula 1 that does not reduce its potency. These salts can be made from inorganic or organic acids as free acids. Examples of inorganic acids that can be used include hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, and phosphoric acid. Examples of organic acids that can be used include citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, succinic acid, and thiazolinone. Glutaric acid, galacturonic acid, embonic acid, glutamic acid, aspartic acid, oxalic acid, ( (D) or (L) malic acid, maleic acid, methanesulfonic acid, ethanesulfonic acid, 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid, or malonic acid can be used. In addition, salts of these acids include alkali metal salts (sodium salt, potassium salt, etc.) and alkaline earth metal salts (calcium salt, magnesium salt, etc.). For example, acid addition salts include acetate, aspartate, benzoate, besylate, bicarbonate / carbonate, bisulfate / sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hyphenate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malate, maleate, malonate, mesylate, methylsulfate, naphthylate, 2-naphthylate, nicotinate, nitrate, iolotate, oxalate, palmitate, and the like. These may include tate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, saccharate, stearate, succinate, tartrate, tosylate, trifluoroacetate, aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine, zinc salts, and the like, of which the hydrochloride or trifluoroacetate is preferred.

[0043] In addition, the compound represented by Chemical Formula 1 of the present invention may be used in the form of a pharmaceutically acceptable salt, All salts, isomers, hydrates and solvates which can be prepared by conventional methods are included. The addition salts according to the present invention can be prepared by conventional methods, for example by reacting a compound of formula 1 In order to prepare the salt, the compound (I) is dissolved in a water-miscible organic solvent such as acetone, methanol, ethanol, or acetonitrile, and an excess amount of an organic acid or an aqueous solution of an inorganic acid is added, followed by precipitation or crystallization. The solvent or excess acid is then evaporated from the mixture, followed by drying to obtain the addition salt, or the precipitated salt is filtered off under suction.

[0044] Method 1 for producing the compound The present invention relates to a method for producing a compound of formula (I) as shown in the following reaction scheme 1: Step 1: dissolving compound 2 in an organic solvent, adding compound 3, and reacting at 10-50°C for 12-20 hours to obtain compound 4; and Step 2: adding dropwise the organic solvent in which the compound 4 obtained in Step 1 is dissolved to an organic solvent in which potassium superoxide is dissolved, and then reacting the mixture at 15 to 30°C for 10 to 16 hours to obtain compound 1A; The present invention provides a method for preparing a compound represented by formula 1A, comprising:

[0045] [ka]

[0046] In the reaction formula 1, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 is the same as defined in Chemical Formula 1 of Claim 1 represents the The compound 1A is included in the formula 1 of claim 1.

[0047] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO), and dioxane, which can be used alone or in combination.

[0048] In the production method of the present invention, examples of compounds that can be produced by the production method include 8 -methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine, N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine or N-(3,4-difluorophenyl)benzo It may be a zo[d]oxazol-2-amine.

[0049] Method 2 for producing the compound The present invention relates to a method for producing a compound of formula (I) comprising the steps of: Step 1: dissolving compound 5 in an organic solvent, adding compound 3, and reacting at 10 to 50°C for 12 to 20 hours to obtain compound 6; Step 2: Dropwise adding the organic solvent containing the compound 6 obtained in step 1 to an organic solvent containing potassium superoxide, and then reacting for 12 to 24 hours to obtain compound 7; and Step 3: dissolving compound 7 in an organic solvent, adding boron tribromide (BBr3), and reacting at room temperature for 20-28 hours to obtain compound 1B; The present invention provides a method for preparing a compound represented by formula 1B, comprising:

[0050] [ka]

[0051] In the reaction scheme 2, R 3 , R 4 , R 5 , R 6 and R 7 represents the same as that defined in Chemical Formula 1 of Claim 1. death, The compound 1B is included in the formula 1 of claim 1.

[0052] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), Dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO) or dioxane can be used alone or in mixture.

[0053] In the production method of the present invention, examples of compounds that can be produced by the production method include: -((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol.

[0054] Method 3 for producing the compound The present invention provides a method for producing a compound of formula (I) comprising the steps of: Compound 8, carbon disulfide, iodomethane, and sodium hydride were dissolved in an organic solvent. After dissolving, reacting at 10-50°C for 2-8 hours to obtain compound 9 (Step 1); and Compound 9 and compound 2 are dissolved in an organic solvent and reacted for 2 to 8 hours to obtain compound 1C. Stage (Stage 2); The present invention provides a method for preparing a compound represented by formula 1C, comprising:

[0055] [ka]

[0056] In the reaction formula 3, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 is the same as defined in Chemical Formula 1 of Claim 1 represents the The compound 1C is included in the formula 1 of claim 1.

[0057] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO), and dioxane, which can be used alone or in combination.

[0058] In the production method of the present invention, an example of a compound that can be produced by the production method is N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide. do.

[0059] Method 4 for producing the compound The present invention provides a method for producing a compound of formula (I) comprising the steps of: Compound 10 and compound 3 are dissolved in an organic solvent and reacted at 10 to 50°C for 20 to 28 hours to form the compound. Obtaining Compound 11 (Step 1); The organic solvent in which the compound 11 obtained in step 1 is dissolved is added dropwise to the organic solvent in which potassium superoxide is dissolved, and the mixture is then heated at 10 to 50°C for 12 to 24 hours. reacting to obtain compound 12 (Step 2); Step 3: Adding compound 12 to an organic solvent together with a catalyst, and then injecting hydrogen gas and reacting at 10-50°C for 12-20 hours to obtain compound 13; and Step 4: dissolving Compound 13 and Compound 14 in an organic solvent and then reacting them at 10 to 50°C for 12 to 24 hours to obtain Compound 1D; The present invention provides a method for preparing a compound represented by Compound 1D, which comprises:

[0060] [ka]

[0061] In the reaction formula 4, R 3 , R 4 , R 5 , R 6 and R 7 represents the same as that defined in Chemical Formula 1 of Claim 1. death; R 8 are halogens, -NO2 and C 1-10 and one or more of the linear or branched alkyl halides: The compound 1D is included in the formula 1 of claim 1.

[0062] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO), and dioxane, which can be used alone or in combination.

[0063] In the production method of the present invention, examples of compounds that can be produced by the production method include N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-methyl-2-benzo[d]oxazol-5-yl -Nitrobenzamide, N-(2-(4-ethylphenylamino)benzo[d]oxazole -5-yl)-3,4-dichlorobenzamide or N-(2-(4-ethylphenylamino)benzamide It may be benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide.

[0064] In the present invention, the composition can increase the expression level of the Klotho gene. In the present invention, the chronic kidney disease is defined as a kidney disorder lasting for 3 months or more or a decrease in kidney function. It can be defined as a disease state that causes a decline in kidney function.Specifically, chronic kidney disease is comprised of chronic nephritis, chronic pyelonephritis, renal syndrome, chronic pyelonephritis, urinary tract infection, diabetic nephropathy, chronic glomerulonephritis, nephrotic syndrome, microglomerulosclerosis, membranous nephropathy and membranoproliferative glomerulonephritis.It can comprise, but is not limited to, one or more nitrogens selected from the group.

[0065] The compound of the present invention can be administered in various oral and parenteral dosage forms when clinically administered, and when formulated, it is produced using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc.

[0066] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, lozenges, etc., and such solid preparations are prepared by mixing one or more compounds of the present invention with at least one or more excipients, such as starch, calcium carbonate, sucrose, lactose, or gelatin. In addition to simple excipients, Lubricants such as magnesium, stearate, talc, etc. are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., which may contain various excipients such as wetting agents, sweeteners, flavoring agents, preservatives, etc. in addition to water and liquid paraffin, which are frequently used simple diluents.

[0067] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Examples of non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Examples of suppository bases include witepsol. l), macrogol, tween 61, cocoa butter, lauric butter, glycerol, Lathin etc. can be used.

[0068] The effective dose of the compound of the present invention for the human body varies depending on the age, weight, sex, dosage form, health condition and degree of disease of the patient, but is generally about 0.001 to 100 mg / kg. The dose is 0.01 to 35 mg / kg / day, preferably 0.01 to 35 mg / kg / day. When used as a standard, it is generally 0.07 to 7000 mg / day, preferably 0.7 to 2500 mg / day. The dosage may be divided into one or several doses per day at regular intervals according to the doctor's or pharmacist's discretion.

[0069] Food composition or functional health food composition for preventing or improving chronic kidney disease The present invention relates to a chronic inflammatory bowel disease comprising a compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof. A food composition or functional health food composition for preventing or ameliorating kidney disease is provided.

[0070] In the present invention, the composition can increase the expression level of the Klotho gene. In the present invention, the chronic kidney disease is defined as a kidney disorder lasting for 3 months or more or a decrease in kidney function. Can be defined as a disease state that causes kidney failure.Specifically, chronic kidney disease can include, but is not limited to, one or more diseases selected from the group consisting of chronic nephritis, chronic pyelonephritis, renal syndrome, chronic pyelonephritis, urinary tract infection, diabetic nephropathy, chronic glomerulonephritis, nephrotic syndrome, microglomerulosclerosis, membranous nephropathy and membranoproliferative glomerulonephritis.

[0071] There are no particular limitations on the type of food, and examples of foods to which the active substance of the present invention can be added include drinks, meat, sausages, bread, biscuits, mochi, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, alcoholic beverages, vitamin complexes, dairy products and dairy processed products, etc., which include all health foods and health functional foods in the usual sense.

[0072] The health food and health functional food compositions containing the active substances according to the present invention can be added to food directly or used together with other foods or food ingredients, and can be used appropriately in a conventional manner. The amount of the active substance to be mixed can be determined appropriately depending on the purpose of use (prevention or improvement). Generally, the amount of the composition in health foods and health functional foods is 0.01% of the total food weight. However, for health maintenance or other purposes, In the case of long-term intake for the purpose of health regulation, the amount may be less than the above range without any safety issues, and the active substance may be used in an amount greater than the above range.

[0073] The health food and health functional food compositions of the present invention contain the active substance of the present invention as an essential ingredient in the indicated ratio, but other ingredients are not particularly limited, and may contain various flavoring agents or natural carbohydrates as additional ingredients along with ordinary beverages. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, etc.; and polysaccharides such as ordinary sugars such as dextrin, cyclodextrin, etc., and xylitol, sorbitol, erythritol, etc. Other flavoring agents include natural flavorings (sodium nitrate, maltodextrin, thiamin ... Natural carbohydrates, such as maltodextrin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (e.g., saccharin, aspartame, etc.) can be advantageously used. The ratio of the natural carbohydrates is generally about 1 to 20 g, preferably about 5 g, per 100 g of the health functional food composition of the present invention. ~12g.

[0074] In addition to the above, the health food and health functional food compositions containing the active substances of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectinic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated drinks, etc. In addition, the health food and health functional food compositions of the present invention may contain fruit pulp for producing natural fruit juices and fruit juice drinks and vegetable drinks.

[0075] These ingredients can be used independently or in combination. The ratio of these additives is not particularly important, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the health food and functional health food composition containing the active substance of the present invention. do.

[0076] The present invention will be described in more detail with reference to the following examples, but the following examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention.

[0077] Example 1: Preparation of N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (FCCS-17064)

[0078] [ka]

[0079] Step 1: Preparation of Dimethyl(2-chloro-4-nitrobenzoyl)carbonimidodithioate (17064-2-1) 2-Chloro-4-nitrobenzamide de) (500 mg, 2.49 mmol), carbon disulfide (CS2) (759 mg, 9.97 mmol), iodomethane (1.13 g, 7.97 mmol), dimethylformamide (7m L), 60% sodium hydride (200 mg, 4.98 mmol) was added, and the mixture was stirred at room temperature for 5 hours.

[0080] Ice-cold water was slowly added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography ( Silica-gel column chromatography)(10% Eth The product was purified with dimethyl (2-chloro-4-nitrobenzoyl) carbonimidodithioate (Dimethyl ... (robenzoyl)carbonimidodithioate, 17064-2-1) pale yellow This was obtained as a coloured solid (160 mg, 21%).

[0081] 1 H NMR (400MHz, acetone-d6); δ8.34 (d, 1H, J=2.0Hz), 8.29 (dd, 1H, J=2.4, 8.8Hz), 8.20 (d, 1H, J=8.4Hz), 2.65 (s, 6H).

[0082] Step 2: Preparation of N-(Benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (FCCS-17064) Dimethyl(2-chloro-4-nitrobenzoyl)carbonimide dithiocarbamate obtained in step 1 Dimethyl(2-chloro-4-nitrobenzoyl)carbo nimidodithioate, 17064-2-1) (150 mg, 0.49 mmol) was dissolved in dimethylformamide (N,N-dimethylformamide) (15 mL), and then 2- Aminophenol (2-aminophenol) (53 mg, 0.49 mmol) was added.

[0083] The reaction mixture was refluxed for 6 hours, and then the solvent was removed under reduced pressure. Diethyl ether was added, and the precipitated solid was filtered. The solid obtained was then subjected to silica gel column chromatography. aphy) (40% Ethyl acetate / n-hexane) Compound N-(Benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide zamide, FCCS-17064) was obtained as a brown solid (70 mg, 30%).

[0084] 1 H NMR (400MHz, acetone-d6); δ8.36 (d, 1H, J=2.0Hz), 8.33 (dd, 1H, J=2.0, 8.4Hz), 8.09 (d, 1H, J=8.4Hz), 7.62-7.56 (m, 2H), 7.40-7.33 (m, 2H).

[0085] Example 2: 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazo (8-Methyl-2-[N-(3,4-dichlorophenyl)]amino benzoxazole (FCCS-17065)

[0086] [ka]

[0087] Step 1: 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thio Production of urea (1-(3,4-Dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea, 17065-2-1) 2-Amino-p-cresol (300 mg, 2.44 mm ol) was dissolved in methanol (12 mL) and then 3,4-dichlorophenyl Isothiocyanate (3,4-dichlolrophenyl isothiocyan The mixture was stirred at room temperature for 18 hours. After confirming the completion of the reaction by ray chromatography, store in a refrigerator (0-4°C). After cooling, the precipitated solid was filtered to give 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea as a white solid (346 mg). (enyl)thiourea, 17065-2-1), which was then carried on to the next step without further purification. Used for the top.

[0088] 1H NMR (400MHz, acetone-d6); δ7.98(dd, 1H, J=0.4,2.0Hz), 7.55-7.50(m, 2H), 7.43(br s, 1H), 6.94-6.90(m, 1H), 6.85(d, 1H, J=8.4Hz) 2.24(s, 3H).

[0089] Step 2: Preparation of 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065) Potassium superoxide (KO2) (375 mg, 5.29 mmol) in acetonitrile (MeCN) (15 mL) was added to the solution. 1-(3,4-Dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (1-(3,4-Dichlorophenyl)-3-(2-hydroxy-5 A solution of (-methylphenyl)thiourea (17065-2-1) (346 mg, 1.06 mmol) in acetonitrile (MeCN) (25 mL) was stirred. After adding the mixture, the mixture was stirred at room temperature for 18 hours.

[0090] The reaction mixture was extracted with dichloromethane and water. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica-gel column chromatography. The desired product was purified with 10% ethyl acetate / n-hexane. The compound 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole oxazole, FCCS-17065) as a white solid (170 mg, 24%, 2 steps).

[0091] 1 H NMR (400MHz, acetone-d6); δ8.29(d, 1H, J=2.8Hz), 7.73(dd, 1H, J=2.8, 8.8Hz), 7.76(d, 1H, J=8.8Hz), 7.32-7.20(m, 1H), 7.28(d, 1H, J=8.0Hz), 7.00-6.970(m, 1H), 2.41(s, 3H).

[0092] Example 3: 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol Production of (2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol, FCCS-17066)

[0093] [ka]

[0094] Step 1: 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thio Production of thiourea (1-(3,4-Dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea, 17066-3-1) 2-Amino-4-methoxyphenol (1.13 g, 8.12 mmol) was dissolved in methanol (40 mL) and then 3,4-dichlorophenyl isothiocyanate was added. To the mixture was added 1.99 g (9.74 mmol) of 2-amino-3-methyl-2-benzothiocyanate, and the mixture was stirred at room temperature for 18 hours. After confirming the completion of the reaction by TLC (thin layer chromatography), the mixture was cooled in a refrigerator (0-4°C). The precipitated solid was filtered to obtain 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea (1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea (1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea) as a brown solid (2 g). (methoxyphenyl)thiourea (17066-3-1) is obtained and further purified. It was used in the next step without further purification.

[0095] 1 H NMR (400MHz, methanol-d4); δ7.82 (d, 1H, J=2.4Hz) , 7.48-7.44(m, 2H), 7.39(dd, 1H, J=1.4, 8.8Hz), 6.81(d, 1H, J=8.8Hz), 6.66(dd, 1H, J=1.6, 8.8Hz), 3.73(s, 3H).

[0096] Step 2: N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazole-2- Preparation of amine (N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine, 17066-3-2) Potassium superoxide (KO2) (540 mg, 7.6 (mmol) in acetonitrile (MeCN) (20 mL) 17066-3-1 (525 mg, 1.52 mmol) obtained in step 1 was dissolved in acetonitrile After slowly adding a solution of 100 ml of nitrile and MeCN (30 mL), the mixture was stirred at room temperature for 18 hours. The reaction mixture was extracted with dichloromethane and water. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was then chromatographed using a silica-gel column. Purified by fluorography (20% ethyl acetate / n-hexane). N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (17066-3-2) was obtained as a brown solid (230 mg, 35%).

[0097] 1 H NMR (400MHz, acetone-d6); δ8.29(d, 1H, J=2.4Hz), 7.70(dd, 1H, J=2.4, 8.8Hz), 7.55(d, 1H, J= 8.8Hz), 7.30(d, 1H, J=8.8Hz), 7.08(d, 1H, J=2.8Hz), 7.74(dd, 1H, J=2.4, 8.8Hz), 3.84(s, 3H).

[0098] Step 3: 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (2 -((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol, FCCS-17066 Under an Ar gas atmosphere, 17066-3-2 (200 mg, 0.65 mmol) obtained in Step 2 was dissolved in dichloromethane (15 mL, anhydrous) and cooled in an ice bath. Boron tribromide (BBr3) (3.23 mL, 1.0 M in dichloromethane) was slowly added, and the mixture was allowed to warm to room temperature and stirred for 24 hours. Sodium hydroxide (NaOH) solution (8 mL, 1.0 M in water) was slowly added to terminate the reaction, and the mixture was transferred to a separatory funnel to separate the organic and aqueous layers. The aqueous layer was extracted with ethyl acetate, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture The substance was separated by silica gel column chromatography. The desired product was purified with 40% ethyl acetate / n-hexane. The compound 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol ol, FCCS-17066) was obtained as a brown solid (97 mg, 50%).

[0099] 1 H NMR (400MHz, acetone-d6); δ8.29(br s, -OH), 8.26(d, 1H, J=2.4Hz), 7.72(dd, 1H, J=2.4, 8.8Hz), 7.56(d, 1H, J =8.8Hz), 7.21(dd, 1H, J=2.0, 7.2Hz), 6.95(d, 1H, J=2.0Hz) , 6.66(dd, 1H, J=2.4, 8.8Hz).

[0100] Example 4: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (FCCS-17067)

[0101] [ka]

[0102] Step 1: 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea l) Production of thiourea, Interm-3-1) 2-Amino-4-nitrophenol (1.88 g, 12.25 mmol) and 4-ethylphenyl isothiocyante (2 g, 12.25 mmol) were dissolved in methanol. After dissolving in 1) (80 mL), the mixture was stirred at room temperature for one day. After removing the solvent under reduced pressure, The product was purified by silica gel column chromatography (20% ethyl acetate / n-hexane) to give 1-(4-ethylphenyl)-2-propanol. The resulting product was 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (Interm-3-1) as a brown solid (2.9 g, 65%).

[0103] 1 H NMR (400MHz, methanol-d4); δ9.24(d, 1H, J=2.8Hz) , 7.88(dd, 1H, J=2.0, 9.2Hz), 7.36(d, 2H, J=8.4Hz), 7.25(d, 2H, J=8.8Hz), 6.94(d, 1H, J=9.2Hz), 2.66(q, 2H, J=7.6Hz), 1.24(t, 3H, J=7.6Hz).

[0104] Step 2: N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2-amine ( N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2- amine, Interm-3-2) A solution of potassium superoxide (KO2) (2.8 g, 39.38 mmol) and acetonitrile (MeCN) (130 mL) was cooled in an ice bath, and the Inter 1 obtained in Step 1 was added. A solution of m-3-1 (2.5 g, 7.88 mmol) in acetonitrile (MeCN) (170 mL) was slowly added and stirred at room temperature for 18 hours. The reaction mixture was extracted with dichloromethane and water. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10% ethyl acetate / n-hexane) to obtain compound Interm-3-2 as a brown solid (1.78 g, 80%).

[0105] 1 H NMR (400MHz, methanol-d4); δ8.20 (d, 1H, J=1.0Hz) , 8.08(dd, 1H, J=0.8, 9.6Hz), 7.59(d, 2H, J=8.8Hz), 7.51(d, 1H, J=8.8Hz), 7.22(d, 2H, J=8.8Hz), 2.64(q, 2H, J=7.6Hz), 1.24(t, 3H, J=7.6Hz).

[0106] Step 3: N-(4-ethylphenyl)benzo[d]oxazole-2,5-diamine (N-(4 -ethylphenyl)benzo[d]oxazole-2,5-diamine, Production of Interm-3-3) Pd / C(Palladium on carbon)(1.70g, 0.80mmol, 10w t.%, wet support) into a round flask. After the addition, the mixture was purged with Ar gas. A solution of nterm-3-2 (1.58 g, 5.30 mmol) dissolved in methanol (80 mL) was slowly added, and then the atmosphere was replaced with H2(g). The mixture was stirred at room temperature for 18 hours while bubbling H2(g). After confirming the completion of the reaction by phy), the mixture was filtered through a Celite pad and the solvent was removed under reduced pressure. The reaction mixture was then subjected to chromatography (Silica-gel column The crude product was purified by chromatography (40% ethyl acetate / n-hexane) to give compound Interm-3-3 as a pale brown solid (1.21 g, 90%).

[0107] 1 H NMR (400MHz, Acetone-d6); δ7.71 (m, 2H), 7.19 (m, 2H) , 7.03(dd, 1H, J=0.8, 8.4Hz), 6.75(dd, 1H, J=0.8, 2.0Hz), 6 .44(dd, 1H, J=2.0, 8.4Hz), 2.60(q, 2H, J=7.6Hz), 1.19(t, 3H, J=7.6Hz).

[0108] Step 4: N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2 -Chloro-5-nitrobenzamide (N-(2-(4-Ethylphenylamino)b enzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzam ide, FCCS-17067) Interm-3-3 (253 mg, 1 mmol) obtained in Step 3, 2-chloro-5-nitrobenzoate 2-chloro-5-nitrobenzoyl chloride de) (220 mg, 1 mmol) was dissolved in dimethylformamide (N,N-dimethylformamide, DMF) (4 mL), and then diisomethylpropylethylamine (dii isopropylethylamine (DIPEA) (129 mg, 1 mmol) was placed in the chamber. The mixture was stirred at room temperature for 18 hours. After 18 hours, 0.5 equivalents each of 2-chloro-5-nitrobenzoyl chloride and diisopropylethylamine (DIPEA) were added, and the mixture was stirred for another 8 hours. 10% HCl (aq.) was added to the reaction mixture, which was then extracted with ethyl acetate. The organic layer was washed successively with saturated aqueous NaHCO3 and brine. The organic layer was dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was then purified by silica gel column chromatography. graphy) (40% Ethyl acetate / n-hexane) The target compound N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (N-(2-(4-Ethylphenylamino)benz[d]oxazol-5-yl) nzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide, FCCS-17067) was obtained as a pale yellow solid (120 mg, 27%).

[0109] 1 H NMR (400MHz, DMSO-d6); δ10.71(s, 1H), 10.53(s, 1H), 8.48(d, 1H, J=2.8Hz), 8.34(dd, 1H, J=2.4, 8.8Hz), 7.90(d, 1H, J=8.8Hz), 7.82(d, 1H, J=2.0 Hz), 7.64(d, 2H, J=8.8Hz), 7.46(d, 1H, J=8.8Hz), 7.40(dd, 1H, J=2.0, 8.4Hz), 7.21(d, 1H, J=8.8Hz), 2.58(q, 2H, J=7.6Hz), 1.18(t, 3H, J=7.6Hz).

[0110] Example 5: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide (FCCS-17068)

[0111] [ka]

[0112] Interm-3-3 (253 mg, 1 mmol) obtained in Step 3 of Example 4 and 3,4-dichlorobenzoyl chloride (209 mg, 1 mmol) were dissolved in N,N-dimethylformamide. After dissolving in diisomethylpropylethylamine (DMF) (4 mL), ropylethylamine, DIPEA) (129 mg, 1 mmol) was added and the mixture was stirred at room temperature for 18 The reaction mixture was stirred for 1 hour. 10% HCl (aq.) was added to the reaction mixture, and ethyl acetate (ethy After extraction with 1,000 ml of acetate, the organic layer was washed with saturated aqueous NaHCO3 and brine in turn. The organic layer was dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (chromatography). hy) (40% Ethyl acetate / n-hexane) to obtain the target compound. FCCS-17068 was obtained as an off-white solid (270 mg, 64%).

[0113] 1H NMR (400MHz, Acetone-d6); δ8.18(d, 1H, J=2.4Hz), 7.99(t, 1H, J=2.4Hz), 7.97(d, 1H, J=2.0Hz), 7.80-7.20(m, 3 H), 7.70-7.50(m, 1H), 7.35(d, 1H, J=8.8Hz), 7.24(d, 1H, J=8.8Hz), 2.63(q, 2H, J=7.6Hz), 1.22(t, 3H, J=7.6Hz).

[0114] Example 6: N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide enzo[d]oxazol-5-yl)-3-(chloromethyl)benzam ide, FCCS-17069)

[0115] [ka]

[0116] Interm-3-3 (253 mg, 1 mmol) obtained in Step 3 of Example 4, 3-(chloromethyl)benzoyl chloride ride) (189 mg, 1 mmol) was dissolved in dimethylformamide (N,N-dimethylformamide, DMF) (4 mL), and then diisomethylpropylethylamine (d Isopropylethylamine (DIPEA) (129 mg, 1 mmol) The mixture was stirred at room temperature for 18 hours. 10% HCl (aq.) was added to the reaction mixture, which was then extracted with ethyl acetate. The organic layer was then washed with saturated aqueous NaHCO3 solution and The organic layer was dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography. ography) (30% Ethyl acetate / n-hexane) and purified. The target compound FCCS-17069 was obtained as a pale white solid (170 mg, 40%).

[0117] 1 H NMR (400MHz, Acetone-d6); δ8.08(t, 1H, J=1.2Hz), 8.03(d, 1H, J=2.0Hz), 7.98(dt, 1H, J =1.2, 7.6Hz), 7.80-7.75(m, 2H), 7.69-7.65(m, 1H), 7.57-7.52(m, 3H), 7.34(d, 1H, J=8.8 Hz), 7.26-7.22(m, 2H), 2.62(q, 2H, J=7.6Hz), 1.22(t, 3H, J=7.6Hz).

[0118] Example 7: 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCC Manufacturing of S-17065-A

[0119] [ka]

[0120] Step 1: Preparation of 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-17065-A-2-1) Under an Ar gas atmosphere, 2-aminophenol (300 mg, 2.749 mmol) was dissolved in anhydrous MeOH (8 mL), and then 3,4-dichlorophenyl isothiocyanate (3,4-dichlorophenyl isothiocyanate) was added. Sothiocyanate (0.47 mL, 3.299 mmol) was slowly added dropwise and stirred at room temperature for 14 hours. After confirming that the starting material had completely disappeared by TLC (thin layer chromatography), the solvent was removed under reduced pressure, and the crude was adsorbed on silica gel and subjected to silica gel flash column chromatography (Sil ica-gel Flash Column Chromatography) (30% EtOAc / hexane, R f =0.4), 1-(3,4-dichlorophenoxy) The obtained product was 793 mg of 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-17065-A-2-1) (light brown foamy solid, 92%).

[0121] 1 H NMR (400MHz, CD3OD); δ7.82(d, 1H, J=2.8Hz), 7.63(d, 1H, J=7.6Hz), 7.45(d, 1H, J=8.8Hz), 7.39(d d, 1H, J=8.6, 2.2Hz), 7.11-7.06(m, 1H), 6.90(dd, 1H, J=8.0, 1.2Hz), 6.85(td, 1H, J=7.6, 1.2Hz).

[0122] Step 2: Preparation of 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065-A) Under an Ar gas atmosphere, FCCS-17065-A-2-1 (400 mg, 1.277 mmol) obtained in step 1 and potassium superoxide (KO2) (454 mg, 6.386 mmol) were added, and acetonitrile (MeCN) (48 mL) was added and stirred at room temperature for 14 hours. After confirming that all the starting material had disappeared by TLC (thin layer chromatography), the crude was sili Add ca. to adsorb and reduce pressure. Silica-gel flash column chromatography ( Silica-gel Flash Column Chromatography) (20% EtOAc / hexane, R f =0.4 to obtain the target compound, 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (2-[N-(3,4-dichlophenyl)]aminobenzoxazole). 231 mg (white solid, 65%) of benzoxazole (FCCS-17065-A) was obtained.

[0123] 1 H NMR (400MHz, CD3OD); δ8.06(d, 1H, J=2.8Hz), 7.55(dd , 1H, J=8.6,2,6Hz), 7.48-7.45(m, 2H), 7.39(d, 1H, J=8.0Hz) , 7.24(td, 1H, J=7.6, 1.2Hz), 7.16(td, 1H, J=7.8, 1.2Hz).

[0124] Example 8: N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine l-2-amine (FCCS-17065-B)

[0125] [ka]

[0126] Step 1: 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl)thio Urea(1-(3,4-dichlorophenyl)-3-(3-hydroxynapht) Production of (halen-2-yl)thiourea, FCCS-17065-B-2-1 Under an Ar gas atmosphere, 3-amino-2-naphthol (350 mg, 2.119 mmol) was added to anhydrous methanol (7 mL) and chloroform (CHCl3) (2 mL), and stirred at room temperature for 5 minutes. -Dichlorophenyl isothiocyanate (3,4-dichlorophenyl iso thiocyanate (0.38 mL, 2.638 mmol) was slowly added dropwise and stirred at room temperature for 13 hours. After confirming that the starting material had completely disappeared by TLC (thin layer chromatography), the solvent was removed under reduced pressure, and dichloromethane (di Add 8 mL of chloromethane, stir for 5 minutes, and filter the insoluble solids. 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl)thiourea (alen-2-yl)thiourea, FCCS-17065-B-2-1), 792 mg (white solid, 99%) was obtained.

[0127] 1 H NMR (400MHz, DMSO-d6); δ10.48(s, 1H), 10.34(s, 1H), 9.57(s, 1H), 8.59(s, 1H), 8.05(d, 1H, J=2.0Hz), 7.73(d, 1H, J=8 .0Hz), 7.67(d, 1H, J=7.6Hz), 7.60(d, 1H, J=8.4Hz), 7.52(dd, 1H, J=8.6, 2.2Hz), 7.35(t, 1H, J=7.2Hz), 7.27(t, 1H, J=7.6Hz), 7.24(s, 1H).

[0128] Step 2: N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine ( Production of N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B) Under an Ar gas atmosphere, FCCS-17065-B-2-1 (400 mg, 1.101 mmol) obtained in step 1 and potassium superoxide (KO2) (391 mg, 5.505 mmol) were added, and acetonitrile (MeCN) (42 mL) was added and stirred at room temperature for 14 hours. After confirming that all the starting material had disappeared by TLC (thin layer chromatography), the crude was sili Add ca. to adsorb and reduce pressure. Silica-gel flash column chromatography ( Silica-gel Flash Column Chromatography) (20% EtOAc / hexane, R f =0.5) to obtain 236 mg of the target compound, N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B), a white solid (65%).

[0129] 1 H NMR (400MHz, DMSO-d6); δ11.22(s, 1H), 8.20(d, 1H, J=2 .0Hz), 7.98-7.95(m, 4H), 7.72(dd, 1H, J=8.8,2.4Hz), 7.66( d, 1H, J=8.4Hz), 7.47-7.41(m, 2H).

[0130] Example 9: N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine d]oxazol-2-amine (FCCS-17065-C)

[0131] [ka]

[0132] Step 1: 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thio Production of thiourea (1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea, FCCS-17065-C-2-1) Under an Ar gas atmosphere, 2-amino-p-cresol (300 mg, 2.436 mmol) was dissolved in anhydrous MeOH (8 mL), and then 3,4-difluorophenyl isothiocyanate (3,4-difluorophenyl isothiocyanate) was added. phenyl isothiocyanate (0.37 mL, 2.923 mmol) was slowly added dropwise and the mixture was stirred at room temperature for 13 hours. aphy) to make sure that all the starting material has disappeared, remove the solvent under reduced pressure, and then The rude was adsorbed onto silica gel and subjected to silica-gel flash column chromatography. hy) (30% EtOAc / hexane, R f =0.4), 1-(3,4- Difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (1-(3,4- difluorophenyl)-3-(2-hydroxy-5-methylpheny l)thiourea, FCCS-17065-C-2-1), 710mg(white foamy solid, 99%).

[0133] 1 H NMR (400MHz, CD3OD); δ7.57-7.52(m, 1H), 7.40(s, 1H), 7 .25-7.13(m, 2H), 6.91(dd, 1H, J=8.0, 1.6Hz), 6.79(d, 1H, J=8.0Hz), 2.25(s, 3H).

[0134] Step 2: N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazole-2- Preparation of amine (N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine, FCCS-17065-C) Under an Ar gas atmosphere, FCCS-17065-C-2-1 (400 mg, 1.359 mmol) obtained in step 1 and potassium superoxide (KO2) (483 mg, 6.795 mmol) were added, and acetonitrile (MeCN), Add MeCN (52 mL) and stir at room temperature for 14 hours. After checking by TLC (thin layer chromatography) that all the starting material has disappeared, Add silica gel to the column to adsorb the sample, then reduce the pressure. raphy) (20% EtOAc / hexane, R f=0.45), the target compound, N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (FCCS-17065-C), 224 mg (white solid, 6 3%) was obtained.

[0135] 1 H NMR (400MHz, CD3OD); δ=7.83-7.78(m, 1H), 7.33-7.29(m , 1H), 7.27-7.20(m, 3H), 6.97-6.95(m, 1H), 2.41(s, 3H).

[0136] Example 10: N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine Synthesis of ne, FCCS-19025

[0137] [ka]

[0138] Step 1: Preparation of 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-19025-2-1) 2-Aminophenol (150 mg, 1.37 mmol) was dissolved in methanol (8 mL) under an Ar gas atmosphere, and then 3,4-difluoromethane was added. 3,4-difluorophenyl isothiocyanate Anate) (224 μl, 1.65 mmol) was slowly added, and the mixture was stirred at room temperature for 13 hours. After confirming the completion of the reaction by LC (thin layer chromatography), the methanol was removed under reduced pressure. The compound was purified by silica gel column chromatography (20% acetone / n-hexane) to give 1-(3,4-difluorophenyl)-3-(2-hydroxybenzoyl)- The compound (1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea, FCCS-19025-2-1) was obtained as a pale yellow solid (354 mg, 92%).

[0139] 1 H-NMR (400MHz, MeOH-d4) δ7.62(d, J=8.0Hz, 1H), 7.55(d dd,J=2.4Hz, 1H), 7.25-7.13(m, 2H), 7.11-7.05(m, 1H), 6.92-6.82(m, 2H);ESI-(+)281.3[M+H] + .

[0140] Step 2: Preparation of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025) FCCS-19025-2-1 (224 mg, 0.80 mmHg) obtained in Step 1 was placed under an Ar gas atmosphere. 284 mg (4.00 mmol) and potassium superoxide (KO2) (284 mg, 4.00 mmol) were dissolved in acetonitrile (MeCN) (25 mL) and stirred at room temperature for 14 hours. After confirming the completion of the reaction by aphy, acetonitrile (MeCN) was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10-20% ethyl acetate / n-hexane) to obtain the target compound, N-(3,4-difluorophenyl)benzo[d ]oxazol-2-amine (N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine, FCCS-19025) was obtained as a white solid (160 mg, 82%).

[0141] 1 H-NMR (400MHz, MeOH-d4) δ7.82 (ddd, J=2.8Hz, 1H), 7.42 (d, J=7.6Hz, 1H), 7.36 (d, J=8.0Hz, 1H), 7.34-7.29 (m, 1H), 7 .28-7.18(m, 2H), 7.16-7.10(m, 1H);ESI-(+)247.2[M+H] + .

[0142] Table 1 below shows the chemical structural formulas of Examples 1 to 10.

[0143] [Table 1]

[0144] <Comparative Example 1> N-(2-chlorophenyl)-1H-indole-3-carboxamide was used as Comparative Example 1. Used.

[0145] [ka]

[0146] <Comparative Example 2> Purchase 2'-Chloroacetanilide (C0621) The resulting mixture was used as Comparative Example 2.

[0147] [ka]

[0148] <Comparative Example 3> N-methyl-1H-indole-3-carboxamide (FCCS-16030) was purchased and used as Comparative Example 3.

[0149] [ka]

[0150] Comparative Example 4: Preparation of N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (FCCS-16031) Construction

[0151] [ka]

[0152] Step 1: Preparation of methyl 2-(1H-indole-3-carboxamido)acetate (CCS-16031-3-1) Indole-3-carboxylate was placed under an Ar gas atmosphere. Dissolve glycine methyl ester (467 mg, 3.72 mmol) and glycine methyl ester (600 mg, 3.72 mmol) in chloroform (11 mL) and cool in an ice bath. Triethylamine (1.04 mL, 7.446 mmol) and N,N-diethylamine After adding N,N-diisopropylcarbodiimide, the mixture was stirred at 0°C for 14 hours. After washing with 10% NaHCO3 aqueous solution, the mixture was diluted with 5% H The mixture was washed with aqueous Cl solution, passed through an anhydrous Na2SO4 pad to remove residual water, and then the solvent was removed under reduced pressure. Methyl 2-(1H-indole-3-carboxamido)acetate was obtained by Ca-gel Flash Column Chromatography (70% ethyl aceate / n-hexane). rboxamido)acetate,CCS-16031-3-1)430mg(white so The resulting mixture was used in the next step without further purification. ESI-MS: 231.2 [MH] -

[0153] Step 2: 2-(1H-indole-3-carboxamido)acetic acid (2-(1H-indole-3- Manufacture of (carboxamido)acetic acid (FCCS-16031-3-2) 2-(1H-indole-3-carboxamide)acetate (meth) obtained in step 1 yl 2-(1H-indole-3-carboxamido)acetate, CCS-16031-3-1 (220 mg, 0.947 mmol) in tetrahydrofuran uran) (6 mL), and then lithium hydroxide hydrate (LiOH monohydrate A solution of 131 mg of methyl ester (3.126 mmol) dissolved in 2 mL of water was added and stirred at room temperature for 1 hour. After adjusting the pH to 2 with 1.0 N aqueous HCl, the mixture was extracted with ethyl acetate. The mixture was passed through an anhydrous Na2SO4 pad to remove the remaining water. After that, the solvent was removed under reduced pressure. ilica-gel Flash Column Chromatography)(10% 2-(1H-indole-3-carboxamido)acetic acid was synthesized by the reaction of 2-(1H-indole-3-carboxamido)acetic acid with methanol / dichloromethane. do)acetic acid, FCCS-16031-3-2)147mg(yellow foa My solid, 71%).

[0154] 1 H NMR (400MHz, CD3OD); δ8.10-8.08(m, 1H), 7.92(s, 1H), 7 .43(dt, J=8.0, 1.2Hz, 1H), 7.17(quint d, J=7.2, 1.6Hz, 2H), 4.12(s, 2H).

[0155] Step 3: N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole -3-carboxamide (N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide, FCCS-16031) Construction Under an Ar gas atmosphere, 2-(1H-indole-3-carboxamido)acetic acid (FCCS-16031-3-2) (200 mg, 0.917 mmol) obtained in Step 2 and TSTU (N,N,N',N'-Tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate) (290 mg, 0.962 mmol) were dissolved in dimethylformamide (N,N- Dissolve in 2-chloroaniline (0.29 mL, anhydrous dimethylformamide), add N,N-diisomethylpropylethylamine (DIEA) (0.4 mL, 2.293 mmol), and stir at room temperature for 3 hours. , 2.751 mmol) and N,N-diisomethylpropylethylamine (DIEA) (0.64 mL , 3.668 mmol) and heat at 60°C for 4 hours. After removing the solvent under reduced pressure, dichloromethane and saturated aqueous NH4Cl solution are added for extraction, and the organic layer is The layer was collected and passed through an anhydrous Na2SO4 pad to remove residual water, and then the solvent was removed under reduced pressure. The target compound, N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide, was isolated by flash column chromatography (70% ethyl acetate / n-hexane). 20 mg (white solid, 6.6%) of 1-3-carboxamide (FCCS-16031) was obtained.

[0156] 1 H NMR (400MHz, CD3OD); δ8.15-8.12(m, 1H), 8.04(dd,J=8 .0, 1.2Hz, 1H), 7.97(s, 1H), 7.46-7.41(m, 2H), 7.33-7.28(m, 1H), 7.23-7.12(m, 3H), 4.26(s, 2H).

[0157] <Experimental Example 1-1> Luciferase expression experiment (Comparative Examples 1 to 4) To evaluate the expression of the klotho gene through luciferase activity, human renal proximal tubule epithelial cells (RPTECs) were used. Cells (ATCC CRL-4031) were purchased from Lonza, USA. and used it.

[0158] For culture, Renal Epithelial Growth Medium (REGM) from the same company, Lonza, was used. TM The cells were cultured at 37°C and 5% CO2 using a Bulletkit. The plasmid used for luciferase expression was one in which the promoter region of the human KL (klotho) gene was positioned to regulate the expression of the firefly luciferase gene.

[0159] Plasmids were transfected using Roche's X-treme GENE transfection The compounds were introduced into cells using a reagent. Luciferase activity expressed in the cells was measured using a Promega Dual-Luciferase reporter assay system. Cultured cells were treated with the indicated concentrations of each compound for 24 hours, and then luciferase activity was measured. High luciferase activity indirectly indicates increased klotho gene expression.

[0160] Comparative Examples 1 to 4 were treated at a concentration of 5 μM with RPTEC cells to induce the expression of the human klotho gene. Using a reporter gene containing the promoter up to 1.7 kbp before the start site or a reporter gene containing the promoter up to 240 bp before the start site of the human klotho gene, The expression of the reporter gene was confirmed.

[0161] As a result, as shown in FIG. 1, it was confirmed that the compound of Comparative Example 1 had the highest luciferase activity. <Experimental Example 1-2> Luciferase expression experiment (Examples 1 to 6) Based on the results of Experimental Example 1-1, Examples 1 to 6 having a chemical structure similar to that of Comparative Example 1 were prepared. was synthesized and Experimental Example 1-2 was carried out.

[0162] The epithelium of the proximal tubule of the human kidney m) Treating RPTEC cells with Examples 1 to 6 at concentrations of 0.5, 1 and 5 μM, respectively; In Comparative Example 1, the cells were treated with 5 μM of the reporter gene (pHKP-luc) containing a promoter extending up to -2.1 kb upstream of the human klotho gene. The results are shown in Figures 2 and 3.

[0163] As shown in FIG. 2, it was confirmed that the reporter gene expression levels of the compounds of Examples 1 and 2 were similar to those of Comparative Example 1. As shown in FIG. 3, Comparative Example 1 and Examples 1 to 3 were treated at a concentration of 5 μM to RPTEC cells. The reporter gene expression was confirmed using a reporter gene (pHKP-luc) containing a promoter including up to -2.1 kb upstream of the human klotho gene. As a result, it was confirmed that the compound of Example 2 had a similar level to that of Comparative Example 1.

[0164] <Experimental Example 2> Real-time PCR analysis of klotho (KL) gene expression levels Quantitative evaluation The proximal tubules of human kidneys treated with the compounds of Comparative Example 1 and Examples 1 and 2 for 6 hours were RPTEC cells, which are epithelial cells of the mal tubule, The RNeasy kit from Qiagen was used to extract RNA. The extracted RNA was used to prepare cDNA using the Superscript II kit from Thermo, and the KL (klotho) gene-specific kit was used for Taqman Gene Expression assays from Applied Biosystems. The results are shown in Figure 4.

[0165] As shown in Figure 4, it was confirmed that the compound of Example 2 had a similar level to that of Comparative Example 1. did. Based on the results of Experimental Example 2, compounds of Examples 7 to 10 having a similar chemical structure to the compound of Example 2 were prepared. The compound was synthesized and used in the following Experimental Example 3.

[0166] <Experimental Example 3> Quantitative evaluation of klotho (KL) gene expression using a general PCR experiment Examples 7 to 10 were administered at 2.5 μM each to the proximal tubules of human kidney for 6 hours. After treatment with RPTEC cells, which are epithelial cells of the A was extracted, and the extracted RNA was used to prepare cDNA using Thermo's Superscript II kit, followed by general PCR.

[0167] The information on the primers used in the experiment is as follows: KL-F GATAGAGAAAAATGGCTTCCCTCC (SEQ ID NO: 1) KL-R GGTCGGTAAACTGAGACAGAGTGG (SEQ ID NO: 2) GAPDH-F TGACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 3) GAPDH-R AGGGATGATGTTCTGGAGAGCC (SEQ ID NO: 4) The PCR-amplified DNA was electrophoresed on an agarose gel and then purified with ethidium bromide ( The amount of DNA in the band was confirmed by staining with Sp Quantitative comparison was performed using the eedyQuant program and is shown in Figure 5 .

[0168] As shown in FIG. 5, the expression level of the klotho (KL) gene in Examples 8 to 10 was higher than that in Comparative Example 1. It was confirmed that the efficiency was high, and in particular, Example 10 showed an improvement of about 10 times compared to Comparative Example 1. .

[0169] <Experimental Example 4> Toxicity test Cultured HK2 (Human kidney-2) cells were treated with Comparative Example 1, Example 2, and Examples 9 and 10 at a concentration of 25 μM or 12.5 μM, and cytotoxicity was measured using the EZ-Cytox kit after 24 hours. EZ-Cytox produces formazan, which has an absorbance at 450 nm, by the mitochondrial enzymes of living cells. Live cells show a higher absorbance at 450 nm. Add a volume of D equal to the amount of compound used. If the toxicity of MSO-treated cells is considered to be 1, how much toxicity is caused by compound sample treatment? The cells were examined to see if they were toxic and the results are shown in FIG.

[0170] As shown in FIG. 6, when treated at a concentration of 12.5 μM or 25 μM, the compound of Example 10 showed the least toxicity, and the toxicity was improved by more than 20% compared to Comparative Example 1. did.

[0171] <Experimental Example 5> Analysis of Klotho protein expression level in HK-2 cells As in the protocol in Figure 7a, HK-2 cells (human kidney cells) were treated with cisplatin (Cisplatin). After preparing a disease model by treating the mice with 20 μM of KS1 compound (Example 10) (3 μM), After 24 hours, the cells were harvested and the expression level of Klotho protein was confirmed. As shown, it was confirmed that Klotho protein expression in HK-2 cells was decreased in the group treated with cisplatin and increased in the group treated with the KS1 compound (Example 10).

[0172] Experimental Example 6: Analysis of the effect of KS1 compound (Example 10) in a unilateral ureter obstruction (UUO) model The unilateral ureteral obstruction model was performed using 5-week-old male C56BL / 6 mice. To create the unilateral ureteral obstruction model, the right ureter was ligated with a suture, and 24 hours later, KS1 compound (20 mg / kg / day) was administered intraperitoneally daily. The mice were then sacrificed on days 7 and 14, and samples were collected for further experiments (Figure 8a).

[0173] Check for kidney enlargement The experimental results showed that the kidneys were enlarged in the unilateral ureteral obstruction model, and the administration of KS1 compound The treated kidneys showed no difference in size (Fig. 8b).

[0174] Confirmation of nuclear and cytoplasmic changes To examine the changes in the nucleus and cytoplasm in the unilateral ureteral obstruction model, H&E staining was performed, and the results are shown in Figure 9. In the 1-week sample from the unilateral ureteral obstruction model without KS1 treatment, It was found that the number of nuclei increased significantly, and the cytoplasm was destroyed in the 2-week sample. However, the KS1-treated samples showed significantly reduced tissue destruction (Fig. 9).

[0175] Check for progression of fibrosis We also performed Sirius Red staining to examine changes associated with the progression of fibrosis in the unilateral ureteral obstruction model. In the 1-week tissue samples from the KS1-untreated unilateral ureteral obstruction model, the progression of fibrosis was evident in red, and in the 2-week samples, fibrosis was more advanced than in the 1-week samples. However, the KS1-treated group showed less fibrosis than the KS1-untreated unilateral ureteral obstruction model (Figure 10).

[0176] Check for cell death To examine the degree of cell death in the unilateral ureteral obstruction model, TUNEL staining was performed. Cell death occurred in the 1-week tissue samples from the unilateral ureteral obstruction model without KS1 treatment, and in the 2-week samples. The KS1-treated group showed a significant decrease in cell death compared to the 1-week-old sample. (Figure 11).

[0177] Confirmation of Klotho protein expression level The results of examining changes in Klotho protein expression in the 1-week samples from the unilateral ureteral obstruction model showed that Klotho protein was reduced in the 1-week samples from the unilateral ureteral obstruction model without KS1 treatment, but was significantly reduced in the KS1 compound-treated samples. The results showed that when treated, Klotho protein expression increased (FIG. 12).

[0178] MMP-9 protein expression analysis Changes in MMP-9 protein, an inflammation marker, were confirmed in a unilateral ureteral obstruction model. The results showed that MMP-9 increased in the 1-week and 2-week samples from the unilateral ureteral obstruction model without KS1 treatment, but that MMP-9 expression levels were significantly reduced when KS1 was treated (Figure 13).

[0179] Experimental Example 7: Analysis of the effect of KS1 compound (Example 10) in a chronic kidney disease model The chronic kidney disease model was prepared using 20 db / m mice (10 5-week-old and 10 6-week-old) from Jackson Lab in the United States. Fifty db / db mice (25 5-week-old and 25 6-week-old) and 50 db / db mice (25 5-week-old and 25 6-week-old) were imported and, after a one-week adaptation period, the experiment was initiated (mouse model number JAX 000642 - BKS.Cg-Dock7m + / + Leprdb / j 5W / M Wildtype for Dock7m, BKS.Cg-Dock7m + / + Leprdb / j 5W / M Heterozygous for Dock7m). Because the number of individuals was large, the experiment was divided into set 1 and set 2. Set 2 (set 2) was conducted one week later, and all mice participated in the experiment from 6 weeks of age. After measuring the body weight, the animals were evenly distributed among the groups, and then the normal diet (ND) and The rats were fed a high protein diet (HPD). The high protein diet was administered for 3 weeks. After the high-protein diet, urine was collected for 2 hours via metabolic cages and used for analysis. The total protein and microalbumin levels increased in the dietary group. From the fifth week, when the rats were confirmed to be healthy, the drug (KS1) was administered orally through gavage at different concentrations (2, 10, 50 mg / kg) every day. After 12 weeks of drug administration, the mice were sacrificed, and blood and organs were collected for blood and tissue analysis. Urine analysis was conducted at the SCL Healthcare Center. Results were obtained, and blood analysis was performed using an I-STAT cartridge (CHEM 8+).

[0180] immunohistochemistry After anesthetizing the experimental animals with an anesthetic, they were perfused with a fixative (Periodate-Lysine-2% paraformaldehyde) through the heart for 8 minutes. They were then further fixed in the same fixative at 4°C for 16 hours or more. After dehydration through an alcohol series, the tissue was embedded in wax and cut to 5 μm to prepare tissue slides. The sections were immersed in a pH 6 citric acid solution and heated to retrieve aldehyde-fixed proteins. Then, the sections were treated with 1.7% H2O2 in methanol for 30 minutes to block endogenous peroxidase, and then treated with 0.5% Triton X-100 in PBS for 15 minutes to enhance antibody penetration. After blocking with normal serum, the sections were treated with a primary antibody and incubated overnight. The primary antibody used was Klotho (Abcam, ab181373). The next day, the sections were washed with PBS and then incubated with a secondary antibody (vector, impress kit). After treatment, the cells were stained with DAB. After staining, the cells were counterstained with hematoxylin. After that, the specimen is dehydrated, mounted, and observed at 100x magnification. More than 100 photographs were taken for each group, and the expressed regions were analyzed by color image analysis. Quantification was performed using a color image analyzer (TDI Scope Eye version 3.6 for windows; Olympus, Japan) (Figure 14). Representative photographs of the stained tissue from each group are shown in Figure 15. The results of the experiment showed that the expression of klotho protein in mice administered with the KS1 compound was statistically significantly increased (p<0.05). It was confirmed that this is the case.

[0181] urine analysis Microalbumin levels were measured via urine analysis and expressed proportionally to creatinine levels to correct for differences in muscle mass between individual experimental mice. The results showed a statistically significant (p < 0.05) decrease in microalbumin levels in mice treated with the KS1 compound (Figure 16).

[0182] blood analysis The blood urea nitrogen (BUN) level, a characteristic blood marker of chronic kidney disease, was measured and a statistically significant (p<0.05) decrease in blood urea nitrogen (BUN) was observed in experimental mice treated with the KS1 compound. A decrease in urea nitrogen was confirmed (Figure 17).

[0183] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention can be embodied in various modified forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is particularly indicated in the appended claims, rather than the foregoing description, and all variations within the scope of equivalents thereto should be construed as being within the scope of the present invention.

Claims

1. A pharmaceutical composition for preventing or treating chronic kidney disease, comprising a compound represented by the following Chemical Formula 1 or a pharmaceutically acceptable salt thereof: 【Chemical 1】 (In the above Chemical Formula 1, R １ and R ２ are each —H or C １－１０ is a straight or branched chain alkyl.

2. 2. The pharmaceutical composition according to claim 1, wherein the compound represented by Formula 1 is any one selected from the following compound group: 9) N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine; and 10) N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.

3. The pharmaceutical composition according to claim 1, wherein the composition enhances the expression level of the Klotho gene.

4. The pharmaceutical composition according to claim 1, wherein the chronic kidney disease is defined as a disease state in which renal damage persists for more than three months or renal function is impaired.

5. 2. The pharmaceutical composition of claim 1, wherein the chronic kidney disease includes one or more diseases selected from the group consisting of chronic nephritis, chronic pyelonephritis, renal syndrome, chronic pyelonephritis, urinary tract infection, diabetic nephropathy, chronic glomerulonephritis, nephrotic syndrome, microglomerulosclerosis, membranous nephropathy, and membranoproliferative glomerulonephritis.

6. A functional health food composition for preventing or improving chronic kidney disease, comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof: 【Chemistry 2】 (In the above Chemical Formula 1, R １ and R ２ are each —H or C １－１０ is a straight or branched chain alkyl.

7. 1. A food composition for preventing or improving chronic kidney disease, comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof: 【Chemistry 3】 (In the above Chemical Formula 1, R １ and R ２ are each —H or C １－１０ is a straight or branched chain alkyl.

Images