Methods for treating Huntington's disease
Inhibitory nucleic acids, particularly artificial miRNAs delivered via AAV vectors, target and reduce the expression of the huntingtin protein, offering a potential therapeutic solution for Huntington's disease by mitigating its neurodegenerative effects.
Patent Information
- Application Number
- JP2022537012
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-12-20
- Filing Date
- 2020-12-18
- Publication Date
- 2025-08-27
- Estimated Expiration
- 2040-12-18
AI Technical Summary
There is no cure for Huntington's disease, and current treatments only ameliorate symptoms, with the disease caused by an expansion of a CAG repeat region in the huntingtin gene leading to neurodegeneration and severe symptoms like depression, anxiety, and movement disorders.
The use of inhibitory nucleic acids, such as artificial miRNAs, specifically designed to hybridize with and inhibit the expression of human huntingtin (HTT) protein, delivered via adeno-associated virus (AAV) vectors, targeting specific regions of the HTT gene to reduce its expression.
The method effectively inhibits the expression of pathogenic huntingtin protein, potentially providing a therapeutic approach to treat Huntington's disease by reducing its toxic effects on neurons.
Smart Images

Figure 0007730327000028 
Figure 0007730327000029 
Figure 0007730327000030
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 USC § 119(e) of U.S. Provisional Application No. 62 / 951,582, filed December 20, 2019, the contents of which are incorporated herein by reference in their entirety.
[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy, created on December 17, 2020, is named 046192-096790WOPT_SL.txt and is 40,419 bytes in size.
[0003] Technical Field The technology described herein relates to methods for treating Huntington's disease. [Background technology]
[0004] background Huntington's disease (HD) is a devastating genetic neurodegenerative disorder caused by an expansion of a CAG repeat region in exon 1 of the huntingtin gene. While the huntingtin protein (HTT) is expressed throughout the body, the polyglutamine-expanded protein is particularly toxic to medium spiny neurons of the striatum and their cortical connections. Patients suffer from affective symptoms, including depression and anxiety, as well as characteristic movement disorders and chorea. Currently, there is no cure for Huntington's disease; treatment options are limited to ameliorating disease symptoms. Summary of the Invention
[0005] overview Aspects of the present disclosure relate to compositions and methods useful for treating Huntington's disease (HD). In some embodiments, inhibitory nucleic acids (e.g., miRNAs, such as artificial miRNAs) are provided that specifically hybridize to and inhibit the expression of human huntingtin (HTT).
[0006] Thus, in some aspects, the disclosure provides an isolated nucleic acid comprising or encoding a sequence set forth in any one of SEQ ID NOs: 1-22.
[0007] In one aspect, described herein is an isolated nucleic acid comprising: (a) a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and (b) a second region comprising a transgene encoding one or more miRNAs, wherein each miRNA comprises a seed sequence complementary to SEQ ID NO:25.
[0008] In one aspect, described herein is an isolated nucleic acid comprising: (a) a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and (b) a second region comprising a transgene encoding one or more miRNAs, wherein each miRNA is encoded by a sequence comprising a sequence set forth in any one of SEQ ID NOs: 1-22 flanked by miRNA backbone sequences.
[0009] In some aspects, the present disclosure provides isolated nucleic acids comprising: a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and a second region comprising a transgene encoding one or more miRNAs.
[0010] In some embodiments, the sequence encoding each miRNA comprises the sequence set forth in any one of SEQ ID NOs: 1-22. In some embodiments, the sequence encoding each miRNA comprises the sequence set forth in any one of SEQ ID NOs: 1-22 flanked by sequences derived from the pre-miR. In some embodiments, the isolated nucleic acid comprises a pre-miR sequence corresponding to the mature miRNA sequence set forth in any one of SEQ ID NOs: 1-22. In some embodiments, the sequence encoding each miRNA comprises the sequence set forth in any one of SEQ ID NOs: 1-22 flanked by sequences encoding a miRNA scaffold sequence. In some aspects, the present disclosure provides an isolated nucleic acid comprising a transgene encoding one or more miRNAs, wherein the sequence of the transgene encoding each miRNA comprises the sequence set forth in SEQ ID NOs: 1-22 flanked by miRNA scaffold sequences.
[0011] In some embodiments, the transgene comprises two miRNAs in tandem flanked by introns. In some embodiments, the transgene comprises two precursor miRNAs, pre-miRNAs (see, e.g., SEQ ID NO: 35), in tandem flanked by introns.
[0012] In some embodiments, the transgene comprises two miRNAs or two precursor miRNAs in tandem flanked by introns.
[0013] In some embodiments, the flanking introns are identical.
[0014] In some embodiments, the flanking introns are from the same species.
[0015] In some embodiments, the flanking intron is an hCG intron.
[0016] In some embodiments, the transgene further comprises a nucleic acid sequence encoding a promoter.
[0017] In some embodiments, the promoter is a synapsin (Syn1) promoter.
[0018] In some embodiments, the transgene further comprises a nucleic acid sequence encoding a protein.
[0019] In some embodiments, the protein is CYP46A1.
[0020] In some embodiments, the protein is a therapeutic protein (eg, non-mutant huntingtin) or a reporter protein (eg, a fluorescent protein such as GFP).
[0021] In some embodiments, the human huntingtin comprises the sequence set forth in SEQ ID NO:25.
[0022] In some embodiments, the disclosure provides nucleic acids (e.g., miRNAs) that are complementary to at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) consecutive bases of SEQ ID NO:25.
[0023] In some embodiments, the one or more miRNAs are located in the untranslated portion of the transgene.
[0024] In some embodiments, the untranslated portion is an intron.
[0025] In some embodiments, the untranslated portion is present between the last codon of the nucleic acid sequence encoding the protein and the poly A tail sequence.
[0026] In some embodiments, the untranslated portion is between the last nucleobase of the promoter sequence and the first base of the poly-A tail sequence.
[0027] In some embodiments, the polyA sequence is a small polyA sequence.
[0028] In some embodiments, the transgene is flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs), or variants thereof.
[0029] In some embodiments, the isolated nucleic acid further comprises a third region comprising a second adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof.
[0030] In some embodiments, the first or second ITR variant lacks a functional terminal separation site (TRS), and optionally, the ITR variant is an ATRS ITR.
[0031] In some embodiments, at least one of the miRNAs hybridizes to and inhibits expression of human huntingtin (eg, SEQ ID NO: 25).
[0032] In some aspects, the present disclosure provides a vector comprising an isolated nucleic acid described in this disclosure.
[0033] In some aspects, the present disclosure provides a vector comprising an isolated nucleic acid comprising a transgene encoding one or more miRNAs, wherein the sequence of the transgene encoding each miRNA comprises the sequence set forth in SEQ ID NOs: 1-22 flanked by miRNA backbone sequences.
[0034] In some embodiments, the vector is a plasmid.
[0035] In some embodiments, each miRNA scaffold sequence of the transgene is a mir-155 scaffold sequence, a mir-30 scaffold sequence, or a mir-64 scaffold sequence.
[0036] In some aspects, the present disclosure provides a host cell comprising an isolated nucleic acid or vector described in this disclosure.
[0037] In some aspects, the present disclosure provides a recombinant AAV (rAAV) comprising: (a) a capsid protein; and (b) an isolated nucleic acid described in this disclosure.
[0038] In some aspects, the present disclosure provides an isolated nucleic acid comprising a recombinant AAV (rAAV) comprising a capsid protein; and a transgene encoding one or more miRNAs, wherein the sequence of the transgene encoding each miRNA comprises the sequence set forth in SEQ ID NOs: 1-22 flanked by miRNA scaffold sequences.
[0039] In some embodiments, the capsid protein is an AAV9 capsid protein.
[0040] In some embodiments, the capsid protein is an AAVrhlO capsid protein.
[0041] In some embodiments, the capsid protein is an AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, or AAVrhlO capsid protein, or a chimera of any thereof.
[0042] In some embodiments, the recombinant AAV (rAAV) is a haploid rAAV.
[0043] In some embodiments, the haploid rAAV comprises a chimeric capsid protein.
[0044] In some embodiments, the rAAV is a self-complementary AAV (scAAV).
[0045] In some embodiments, the rAAV is formulated for delivery to the central nervous system (CNS).
[0046] Aspects of the present disclosure relate to compositions comprising any of the isolated nucleic acids described herein.
[0047] Aspects of the present disclosure relate to compositions comprising any of the vectors described herein.
[0048] Aspects of the present disclosure relate to compositions comprising any of the rAAVs described herein.
[0049] Aspects of the present disclosure relate to isolated nucleic acids that are capable of reducing (eg, inhibiting) the expression of pathogenic huntingtin, and thus may be useful in the treatment of Huntington's disease.
[0050] Accordingly, in some aspects, the present disclosure provides a method for treating Huntington's disease in a subject in need thereof, comprising administering to a subject having or at risk of developing Huntington's disease a therapeutically effective amount of an isolated nucleic acid, rAAV, or composition described in this disclosure.
[0051] In some aspects, the present disclosure provides methods for treating Huntington's disease in a subject in need thereof, the method comprising administering to the subject having or at risk of developing Huntington's disease a therapeutically effective amount of an rAAV described herein (e.g., an rAAV comprising transgenes encoding one or more miRNAs, wherein the sequence of the transgene encoding each miRNA comprises the sequence set forth in SEQ ID NOs: 1-22 flanked by miRNA scaffold sequences).
[0052] In some embodiments, the subject comprises a huntingtin gene with more than 36 CAG repeats, more than 40 repeats, or more than 100 repeats.
[0053] In some embodiments, the subject is under 20 years of age or has been diagnosed with early-onset HD.
[0054] In some embodiments, administration results in delivery of the isolated nucleic acid or rAAV to the central nervous system (CNS) of the subject.
[0055] In some embodiments, administration is by injection, optionally intravenous or intrastriatal.
[0056] In some embodiments, administration is by catheter or related device.
[0057] In some embodiments of any aspect, the method further includes, prior to administering, diagnosing the subject as having or at risk of developing Huntington's disease.
[0058] In some embodiments of any aspect, the method further comprises, prior to administering, receiving the results of an assay diagnosing the subject as having Huntington's disease or at risk of developing Huntington's disease. Exemplary assays for diagnosing a subject as having Huntington's disease or at risk of developing it, such as genetic screening for at least 36 CAG repeats, at least 40 CAG repeats, or at least 100 CAG repeats, or more, are described herein. In an embodiment of the present invention, for example, the following items are provided: (Item 1) a. a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and b. A second region comprising a transgene encoding one or more miRNAs, each miRNA comprising a seed sequence complementary to SEQ ID NO: 25. An isolated nucleic acid comprising: (Item 2) a. a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and b. A second region containing a transgene encoding one or more miRNAs, each miRNA being encoded by a sequence containing a sequence set forth in any one of SEQ ID NOS: 1 to 22 flanked by miRNA scaffold sequences. An isolated nucleic acid comprising: (Item 3) 3. The isolated nucleic acid of item 1 or 2, wherein the transgene comprises two miRNAs or two precursor miRNAs in tandem flanked by introns. (Item 4) 4. The isolated nucleic acid of item 3, wherein the flanking introns are identical. (Item 5) 4. The isolated nucleic acid of item 3, wherein the flanking introns are derived from the same species. (Item 6) 4. The isolated nucleic acid of item 3, wherein the flanking intron is an hCG intron. (Item 7) 7. The isolated nucleic acid of any one of items 1 to 6, wherein the transgene comprises a promoter. (Item 8) 8. The isolated nucleic acid of item 7, wherein the promoter is a synapsin (Syn1) promoter. (Item 9) 9. The isolated nucleic acid of any one of items 1 to 8, wherein the transgene further encodes a protein. (Item 10) 10. The isolated nucleic acid of item 9, wherein the protein is CYP46A1. (Item 11) 11. The isolated nucleic acid of any one of items 1 to 10, wherein the one or more miRNAs are located in an untranslated portion of the transgene. (Item 12) 12. The isolated nucleic acid of item 11, wherein the untranslated portion is an intron. (Item 13) 12. The isolated nucleic acid of claim 11, wherein the untranslated portion is located between the last codon of the nucleic acid sequence encoding the protein and the poly A tail sequence, or between the last nucleotide base of the promoter sequence and the poly A tail sequence. (Item 14) 14. The isolated nucleic acid of any one of paragraphs 1 to 13, further comprising a third region comprising a second adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof. (Item 15) The ITR variant lacks a functional terminal separation site (TRS), and optionally 15. The isolated nucleic acid of any one of items 1 to 14, wherein the ITR variant is an ATRS ITR. (Item 16) 16. The isolated nucleic acid of any one of paragraphs 1 to 15, wherein at least one of the miRNAs hybridizes to human huntingtin (e.g., SEQ ID NO: 25) and inhibits expression of human huntingtin. (Item 17) 17. A vector comprising the isolated nucleic acid of any one of items 1 to 16. (Item 18) Item 18. The vector according to item 17, which is a plasmid. (Item 19) 19. A host cell comprising the isolated nucleic acid of any one of items 1 to 16, or the vector of item 17 or 18. (Item 20) a. capsid proteins; and b. The isolated nucleic acid of any one of items 1 to 16. Recombinant AAV (rAAV) containing (Item 21) 21. The rAAV of item 20, wherein the capsid protein is an AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, or AAVrhlO capsid protein, or a chimera of any thereof. (Item 22) 22. The rAAV of item 20 or 21, wherein the capsid protein is an AAVrh10 capsid protein. (Item 23) 23. The rAAV of any one of items 20 to 22, which is a self-complementary AAV (scAAV). (Item 24) 23. The rAAV of any one of paragraphs 20 to 22, wherein the rAAV is formulated for delivery to the central nervous system (CNS). (Item 25) An isolated nucleic acid encoding a sequence shown in any one of SEQ ID NOs: 1 to 22. (Item 26) 17. A composition comprising the isolated nucleic acid of any of items 1 to 16. (Item 27) 19. A composition comprising the vector according to item 17 or 18. (Item 28) 25. A composition comprising the rAAV cells of any of items 20 to 24. (Item 29) 28. A method for treating Huntington's disease in a subject in need thereof, comprising administering to a subject having or at risk of developing Huntington's disease a therapeutically effective amount of the isolated nucleic acid of any one of items 1 to 16, the rAAV of any one of items 20 to 24, or the composition of any one of items 25 to 28. (Item 30) 30. The method of claim 29, wherein the subject comprises a huntingtin gene having more than 36 CAG repeats, more than 40 repeats, or more than 100 repeats. (Item 31) 31. The method of item 29 or 30, wherein the subject is under 20 years of age. (Item 32) 32. The method of any one of items 29 to 31, wherein the administration results in delivery of the isolated nucleic acid or rAAV to the central nervous system (CNS) of the subject. (Item 33) 33. The method of any one of items 29 to 32, wherein the administration is by injection, optionally intravenous or intrastriatal injection. (Item 34) 34. The method of any one of items 29 to 33, wherein the administration is by catheter or related device. (Item 35) 35. The method of claim 34, further comprising the step of diagnosing the subject as having or at risk of developing Huntington's disease prior to administering. (Item 36) 35. The method of claim 34, further comprising, prior to administering, receiving results of an assay diagnosing the subject as having or at risk of developing Huntington's disease. [Brief explanation of the drawings]
[0059] [Figure 1]Figure 1 is a schematic diagram showing the construction of artificial miRNAs. pEMBL-D(+)-Syn1-hCGintron is a control vector into which an empty human chorionic gonadotropin (hCG) intron is inserted and driven by the synapsin promoter. Two copies of a control miRNA precursor (random sequence or nonfunctional mutation) are inserted into the hCGin portion of the vector pEMBL-D(+)-Syn1-hCGin-2x control pre-miR. Two copies of an artificial pre-miR (perfect match to the 3'-UTR target sequence, including approximately 100-150 bp of adjacent upstream and downstream sequences) are cloned into the hCG intron. The vector pEMBL-D(+)-Syn1-CYP46A1-hCGin-2x artificial pre-miR is a combination construct, allowing simultaneous production of both CYP46A1 and artificial miRNAs. To confirm whether the pre-miRNA can be processed into a mature miRNA and combine with the HTT target sequence containing a CAG expansion (which is perfectly complementary to the mature miRNA), the HTT target sequence is inserted after the luciferase gene. Due to package size limitations, a small poly(A) is used in the construct.
[0060] [Figure 2] FIG. 2 is a schematic diagram showing the mechanism of Huntington's disease (HD).
[0061] [Figure 3] FIG. 3 is a schematic diagram illustrating an exemplary method of treating HD.
[0062] [Figure 4] FIG. 4 is a schematic diagram showing the process for screening artificial miRNAs for HD.
[0063] [Figure 5]Figure 5 is a schematic diagram showing the location of artificial miRNAs in the HTT gene (or mRNA): miHTT-H2 is located in region I; miHTT-H4 and miHTT-H5 are located in the 5' and 3' jumpers of the CAG repeat; miHTT-H14 is located in region IV; and miHTT-H15, H17, H19, and H21 are located in region V.
[0064] [Figure 6] Figure 6 is a schematic diagram showing the regions of the HTT gene. The CAG repeat is located in region I.
[0065] [Figure 7] FIG. 7 is a schematic diagram showing the first round of screening of artificial miRNAs by in vitro plasmid transfection (eg, in 293 cell line; Phase I).
[0066] [Figure 8-1] Figures 8A-8B are a series of schematic diagrams and graphs showing the first round (e.g., Phase I) of screening artificial miRNAs in 293 cells by in vitro plasmid transfection. Figure 8A is a schematic diagram showing selected artificial miRNAs and their target regions in the HTT gene. Figure 8B is a bar graph showing that artificial miRNAs inhibited luciferase gene expression driven by their target sequences upon cotransfection. After 48 hours of cotransfection, pEMBL-CMV-hCGin-miHTT-H2 and miHTT-H5 were able to efficiently inhibit luciferase activity by approximately 46.4% and 54.8%, respectively, compared with pEMBL-CMV-hCGin (as a control). **p<0.01 vs. pEMBL-CMV-hCGin. [Figure 8-2] Same as above.
[0067] [Figure 9] FIG. 9 is a schematic diagram showing the process (eg, Phase I) for screening artificial miRNAs for HD.
[0068] [Figure 10] FIG. 10 is a schematic diagram showing the second screening of artificial miRNAs by in vitro AAV infection.
[0069] [Figure 11-1] Figures 11A-11B are a series of bar graphs showing the testing of AAVRH10-mediated artificial miRNAs in the human neuronal cell line U87 (a human primary glioblastoma cell line). Figure 11A shows luciferase activity, and Figure 11B shows the percentage of luciferase activity compared to the control. Figures 11A-11B show that AAVRH10-mediated artificial miRNAs inhibited target sequence-driven luciferase gene expression in vitro. AAVRH10-CMV-hCGin-miHTT-H2 and H5, combined with their respective target sequences, were inserted into the luciferase gene, significantly inhibiting luciferase activity by approximately 84.9% and 76.9%, respectively, compared to AAVRH10-CMV-hCGin (as a control). *p<0.05; ***p<0.001 vs. AAVRH10-CMV-hCGin. [Figure 11-2] Same as above.
[0070] [Figure 12] FIG. 12 is a schematic diagram showing a test (eg, Phase I) of the inhibition of artificial miRNAs on HTT protein in human neuronal cells U87.
[0071] [Figure 13] Figure 13 shows a Western blot showing HTT protein levels in the human neuronal cell line U87. After treatment with AAVRH10-CMV-hCGin-miHTT-H1 to H5 in U87 cells, HTT protein expression was reduced by AAVRH10-CMV-hCGin-miHTT-H2, -miHTT-H4, and -miHTT-H5. β-Actin was used as a loading control.
[0072] [Figure 14] Figure 14 is a bar graph showing quantitative data of HTT Western blot in the human neuronal cell line U87 (see, e.g., Figure 12). HTT protein expression was inhibited by 73.2% by AAVRH10-CMV-hCGin-miHTT-H2, 58.5% by miHTT-H4, and 41.5% by miHTT-H5. (*p<0.05, **p<0.01, n=4).
[0073] [Figure 15] FIG. 15 is a schematic diagram showing the process (eg, Phase II) for screening artificial miRNAs for HD.
[0074] [Figure 16] FIG. 16 is a schematic diagram showing the first round of screening of artificial miRNAs by plasmid transfection in vitro (eg, in 293 cell line; Phase II).
[0075] [Figure 17] Figure 17 is a bar graph showing the second screening using sequences from the 3'-UTR. Artificial miRNAs inhibited luciferase gene expression driven by the target sequence upon cotransfection. In the second screening, after 48 hours of cotransfection, pEMBL-CMV-hCGin-miHTT-H14, H15, H17, H19 (miR-137) and miHTT-H21 (miR-216) efficiently inhibited luciferase activity compared with pEMBL-CMV-hCGin (as a control). MiHTT-H2, H4, and H5 were used as positive controls. MiDMPK-M5, M7, and M9, which target the myotonic dystrophy protein kinase (DMPK) gene, were also used as negative controls. ***p<0.001 vs. pEMBL-CMV-hCGin.
[0076] [Figure 18]Figure 18 is a bar graph showing the second screening using sequences from the 3'-UTR. Artificial miRNAs inhibited luciferase gene expression driven by the target sequence upon cotransfection. After 48 hours of cotransfection, pEMBL-CMV-hCGin-miHTT-H14, H15, H17, H19 (miR-137), and miHTT-H21 (miR-216) efficiently inhibited luciferase activity compared with pEMBL-CMV-hCGin (as a control). Compared to the control (100%), the luciferase activity was 2.45% (H14), 8.75% (H15), 9.2% (H17), 12.89% (miR-137), and 4.17% (miR-216), respectively. MiHTT-H2, H4, and H5 were used as positive controls. MiDMPK-M5, M7 and M9, which target the DMPK gene, were also used as negative controls. ***p<0.001 vs. pEMBL-CMV-hCGin.
[0077] [Figure 19] Figure 19 is a schematic diagram showing the second screening by the sequence from 3'-UTR. Specifically, the diagram shows the location of artificial miRNA in HTT gene. miHTT-H2 is located in region I; miHTT-H4 and miHTT-H5 are located in the 5' jumper and 3' jumper of CAG repeat, respectively; miHTT-H14 is located in region IV; and miHTT-H15, H17, H19 and H21 are located in region V.
[0078] [Figure 20] FIG. 20 is a schematic diagram showing the test (eg, Phase II) of the inhibition of artificial miRNA on HTT protein in human neuronal cells U87.
[0079] [Figure 21]Figure 21 is a schematic diagram showing the testing of artificial miRNAs in human fibroblasts derived from HD patients. As a non-limiting example, transfected / infected samples from the second to third highest performing miHTTs can be sent for off-target analysis.
[0080] [Figure 22] Figure 22 is a schematic diagram showing the artificial miRNA construct. EMBL-D(+)-Syn1-hCGintron is used as a control and is a double-stranded vector containing an empty human chorionic gonadotropin (hCG) intron (i.e., no miRNA) driven by the synapsin promoter. Two copies of the artificial miHTT (a perfect match to the target sequence, including approximately 100-150 bp of adjacent upstream and downstream sequences) are cloned into the hCG intron. To confirm whether miHTT can be processed into mature miRNA, an HTT target sequence containing a CAG expansion (which is perfectly complementary to the mature miRNA) is inserted after the luciferase gene. Due to package size limitations, a small poly(A) is used in the construct. Note that Syn1 stands for synapsin 1.
[0081] [Figure 23-1] FIG. 23 is a schematic diagram showing a map of pEMBL-D(+)-Syn1-hCGin-2x miHTT. [Figure 23-2] FIG. 23 is a schematic diagram showing a map of pEMBL-D(+)-Syn1-hCGin-2x miHTT.
[0082] [Figure 24]Figure 24 is a schematic diagram showing the optimized CYP46A1 expression vector. pAAV2.1-Syn1-GFP-sPA is a single-stranded vector used as a control. pAAV2.1-Syn1-CYP46A1-sPA is used to overexpress CYP46A1 driven by the muscle-specific promoter Syn1. The vector pAAV2.1-Syn1-CYP46A1-hCGin-2x miHTT is a combination construct, which can simultaneously produce both CYP46A1 and two copies of artificial miHTT.
[0083] [Figure 25-1] Figure 25 is a schematic diagram showing the map of pAAV2.1-Syn1-CYP46A1-hCGin-2x miHTT. [Figure 25-2] Figure 25 is a schematic diagram showing the map of pAAV2.1-Syn1-CYP46A1-hCGin-2x miHTT.
[0084] [Figure 26] Figure 26 is a schematic diagram showing the process of screening artificial miRNA and identifying its target sequence in vitro. Two copies of the artificial miRNA precursor are cleaved and processed into mature miRNA. The miRNA further precisely matches the HTT target sequence containing a CAG expansion and inhibits luciferase expression. At the same time, the control miRNA can also be processed, but because it cannot bind to the HTT target sequence, it does not affect the expression of luciferase. This method is usually used to identify the target sequence of miRNA in vitro.
[0085] [Figure 27] FIG. 27 is a series of schematics and images and associated blots showing the construction of artificial miRNAs based on the scaffold of the miR-30 precursor. DETAILED DESCRIPTION OF THE INVENTION
[0086] Detailed Description Aspects of the present invention relate to certain interfering RNAs (e.g., miRNAs, such as artificial miRNAs) that, when delivered to a subject, are effective in reducing the expression of pathogenic Huntington's protein (HTT) in the subject. Thus, the methods and compositions described by the present disclosure are, in some embodiments, useful for the treatment of Huntington's disease. inhibitory RNA
[0087] In one aspect, described herein is an inhibitory RNA that can be used for the treatment of Huntington's disease. In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOS: 1-24 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOS: 1-24, which maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOS: 1-24.
[0088] [Table 1-1] [Table 1-2] [Table 1-3]
[0089] Combinations of any of the described inhibitory RNAs (e.g., SEQ ID NOS: 1-24) can be used, for example, in the vectors, rAAV compositions, or treatment methods described herein. As non-limiting examples, the following combinations are specifically contemplated: at least one of SEQ ID NOS: 1-22; at least one of SEQ ID NOS: 1-10; at least one of SEQ ID NOS: 1-5; at least one of SEQ ID NOS: 6-7; at least one of SEQ ID NOS: 8-10; at least one of SEQ ID NOS: 11-24; at least one of SEQ ID NOS: 11-14; at least one of SEQ ID NOS: 15-24; at least one of SEQ ID NOS: 15-22; at least one of SEQ ID NOS: 15-18; at least one of SEQ ID NOS: 19-22. at least one of SEQ ID NOs: 23-24; at least one of SEQ ID NOs: 1 or 4-9; at least one of SEQ ID NOs: 2, 4, 5, 14, 15, 17, 19, or 21; at least one of SEQ ID NOs: 2, 4, 5, 14, 15, or 17; at least one of SEQ ID NOs: 2, 4, or 5; at least one of SEQ ID NOs: 2 or 5; or at least one of SEQ ID NOs: 14, 15, 17, 19, or 21; at least one of SEQ ID NOs: 14, 15, or 17.
[0090] In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 1-22 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 1-10 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 1-22.
[0091] In some embodiments of any of the aspects, the inhibitory RNA targets at least one of regions I-III of the HTT gene (e.g., the CAG repeat, the CAG5' jumper, the CAG3' jumper; the 5'-UTR; or exon 1). Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOS: 1-10 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOS: 1-10 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOS: 1-10.
[0092] In some embodiments of any of the aspects, the inhibitory RNA targets region I of the HTT gene (e.g., the CAG repeat, the CAG5' jumper, or the CAG3' jumper). Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOS: 1-5 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOS: 1-5 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOS: 1-5.
[0093] In some embodiments of any of the aspects, the inhibitory RNA targets region II (e.g., the 5'-UTR) of the HTT gene. Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOS: 6-7 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOS: 6-7 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOS: 6-7.
[0094] In some embodiments of any of the aspects, the inhibitory RNA targets region III (exon 1) of the HTT gene. Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOS: 8-10 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOS: 8-10 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOS: 8-10.
[0095] In some embodiments of any of the aspects, the inhibitory RNA targets at least one of regions VI-V of the HTT gene (e.g., exons 2-67 or the 3'UTR). Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOS: 11-24 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOS: 11-24, or that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOS: 11-24.
[0096] In some embodiments of any of the aspects, the inhibitory RNA targets region VI of the HTT gene (e.g., exons 2-67). Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOS: 11-14 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOS: 11-14 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOS: 11-14.
[0097] In some embodiments of any of the aspects, the inhibitory RNA targets regions III and VI of the HTT gene (e.g., the 5'-UTR and exons 2-67). Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 8 or 13 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 8 or 13 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 8 or 13.
[0098] In some embodiments of any of the aspects, the inhibitory RNA targets region V (e.g., the 3'UTR) of the HTT gene. Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 15-24 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 15-24 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 15-24.
[0099] In some embodiments of any of the aspects, the inhibitory RNA targets region V (e.g., the 3'UTR) of the HTT gene. Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 15-22 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 15-22 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 15-22.
[0100] In some embodiments of any of the aspects, the inhibitory RNA targets region V (e.g., the 3'UTR) of the HTT gene and is an artificial miRNA. Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOS: 15-18 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOS: 15-18 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOS: 15-18.
[0101] In some embodiments of any of the aspects, the inhibitory RNA targets region V (e.g., the 3'UTR) of the HTT gene and is a human-expressed miRNA. Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOS: 19-22 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOS: 19-22 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOS: 19-22.
[0102] In some embodiments of any of the aspects, the inhibitory RNA targets region V (e.g., the 3'UTR) of the HTT gene. Thus, in some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to one of SEQ ID NOs:23-24 or at least one of SEQ ID NOs:23-24 that maintains the same function (e.g., HTT inhibition) as one of SEQ ID NOs:23-24. In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA does not comprise a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to one of SEQ ID NOs:23-24 or at least one of SEQ ID NOs:23-24 that maintains the same function (e.g., HTT inhibition) as one of SEQ ID NOs:23-24 or at least one of SEQ ID NOs:23-24.
[0103] In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 1 or 4-9 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 1 or 4-9 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 1 or 4-9.
[0104] In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 2, 4, 5, 14, 15, 17, 19, 21 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 2, 4, 5, 14, 15, 17, 19, 21 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 2, 4, 5, 14, 15, 17, 19, 21.
[0105] In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 2, 4, 5, 14, 15, 17 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 2, 4, 5, 14, 15, 17 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 2, 4, 5, 14, 15, 17.
[0106] In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 2, 4, 5 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 2, 4, 5 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 2, 4, 5.
[0107] In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 2, 5 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 2 or 5 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 2 or 5.
[0108] In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 14, 15, 17, 19, 21 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 14, 15, 17, 19, 21 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 14, 15, 17, 19, 21.
[0109] In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NOs: 14, 15, 17 or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to at least one of SEQ ID NOs: 14, 15, 17 that maintains the same function (e.g., HTT inhibition) as at least one of SEQ ID NOs: 14, 15, 17.
[0110] In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises miHTT-H2 (SEQ ID NO:2). In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises miHTT-H4 (SEQ ID NO:4). In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises miHTT-H5 (SEQ ID NO:5). In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises miHTT-H14 (SEQ ID NO:14). In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises miHTT-H15 (SEQ ID NO:15). In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises miHTT-H17 (SEQ ID NO:17). In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises miHTT-H19 (SEQ ID NO:19; miR-137). In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises miHTT-H21 (SEQ ID NO:21; miR-216).
[0111] In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets at least a portion of an HTT nucleic acid (see, e.g., SEQ ID NO: 25). In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets a 5' untranslated region of an HTT nucleic acid (e.g., mRNA).
[0112] In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets exon 1 (i.e., the first nucleic acid segment that encodes a polypeptide) of a target (e.g., HTT).
[0113] In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets the CAG repeat of an HTT nucleic acid (e.g., mRNA). The term "CAG repeat" refers to a region of exon 1 of the HTT gene that contains a CAG trinucleotide (i.e., cytosine, adenine, and guanine) repeat. Typically, the CAG trinucleotide can be repeated 10 to 35 times within the HTT gene. In individuals with Huntington's disease, the CAG segment can be repeated 36 to 120 times or more.
[0114] In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets the CAG5'-jumper of an HTT nucleic acid (e.g., mRNA). The term "CAG5'-jumper" refers to the region of the HTT gene that includes the 3' end of exon 1 and the 5' end of the CAG repeat.
[0115] In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets the CAG 3' jumper of an HTT nucleic acid (e.g., mRNA). The term "CAG 3'-jumper" refers to the region of the HTT gene that includes the 3' end of the CAG repeat and the 5' end of exons 2-67.
[0116] In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets exons 2-67 of an HTT nucleic acid (e.g., mRNA). The term "exons 2-67" of the HTT gene refers to the region consisting of exons 2 through 67 of the HTT gene. In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) is selected from: exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, exon 22, exon 23, exon 24, exon 25, exon 26, exon 27, exon 28, exon 29, exon 30, exon 31, exon 32, exon 33 of an HTT nucleic acid (e.g., mRNA). Binds to and / or targets at least one of exon 34, exon 35, exon 36, exon 37, exon 38, exon 39, exon 40, exon 41, exon 42, exon 43, exon 44, exon 45, exon 46, exon 47, exon 48, exon 49, exon 50, exon 51, exon 52, exon 53, exon 54, exon 55, exon 56, exon 57, exon 58, exon 59, exon 60, exon 61, exon 62, exon 63, exon 64, exon 65, exon 66, or exon 67.
[0117] In some embodiments of any of the aspects, the inhibitory RNA (eg, miRNA) binds to and / or targets the 3' untranslated region (UTR) of an HTT nucleic acid (eg, mRNA).
[0118] In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets the 5' UTR, exon 1, CAG repeat, CAG5'-jumper, or CAG3' jumper of a target (e.g., HTT). In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets exons 2-67 or the 3' UTR of a target (e.g., HTT). In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets the 5' UTR, exon 1, CAG repeat, CAG5'-jumper, or CAG3' jumper of a target (e.g., HTT).
[0119] In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to at least one binding site in an HTT nucleic acid (e.g., mRNA). In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 binding sites in an HTT nucleic acid (e.g., mRNA).
[0120] In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets human, non-human primate, or mouse HTT nucleic acid (e.g., mRNA). In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets human, non-human primate, and mouse HTT nucleic acid (e.g., mRNA). In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets human HTT nucleic acid (e.g., mRNA). In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets non-human primate HTT nucleic acid (e.g., mRNA). In some embodiments of any of the aspects, the inhibitory RNA (e.g., miRNA) binds to and / or targets mouse HTT nucleic acid (e.g., mRNA). In some embodiments of any of the aspects, the inhibitory RNA (eg, miRNA) binds to and / or targets HTT nucleic acids (eg, mRNA) in humans and non-human primates.
[0121] In some embodiments of any of the aspects, the agent for treating Huntington's disease is an inhibitory nucleic acid. In some embodiments of any of the aspects, the inhibitor of the expression of a given gene can be an inhibitory nucleic acid. As used herein, "inhibitory nucleic acid" refers to a nucleic acid molecule that can inhibit the expression of a target, such as double-stranded RNA (dsRNA), inhibitory RNA (iRNA), etc.
[0122] Double-stranded RNA molecules (dsRNA) have been shown to block gene expression through a highly conserved regulatory mechanism known as RNA interference (RNAi). The inhibitory nucleic acids described herein can comprise an RNA strand (antisense strand) that is 30 nucleotides or shorter in length, i.e., 15-30 nucleotides in length, generally 19-24 nucleotides in length, that is substantially complementary, at least in part, to a target mRNA transcript. The use of these iRNAs allows for the targeted degradation of mRNA transcripts, resulting in decreased target expression and / or activity.
[0123] As used herein, the term "iRNA" refers to an agent that contains RNA (or a modified nucleic acid as described herein below) and mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. In some embodiments of any of the aspects, the iRNA described herein results in inhibition of target expression and / or activity. In some embodiments of any of the aspects, contacting a cell with an inhibitor (e.g., an iRNA) results in a reduction in target mRNA levels in the cell of at least about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, and up to 100% (including 100%) of the target mRNA levels found in cells without the iRNA. In some embodiments of any of the aspects, administering an inhibitor (e.g., an iRNA) to a subject results in a reduction in target mRNA levels in the subject of at least about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, up to and including 100% of the target mRNA levels found in the subject in the absence of the iRNA.
[0124] In some embodiments of any of the aspects, the iRNA may be a dsRNA. The dsRNA comprises two RNA strands that are sufficiently complementary to hybridize and form a double-stranded structure under the conditions in which the dsRNA is used. One strand of the dsRNA (the antisense strand) comprises a complementary region that is substantially complementary to the target sequence, and generally is completely complementary. The target sequence may be derived from the sequence of the mRNA formed during the expression of the target; for example, the target sequence may span one or more intron boundaries. The other strand (the sense strand) comprises a region that is complementary to the antisense strand, so that the two strands hybridize and form a double-stranded structure when combined under suitable conditions. Generally, the double-stranded structure is between 15 and 30 base pairs in length (inclusive), more commonly between 18 and 25 base pairs in length (inclusive), even more commonly between 19 and 24 base pairs in length (inclusive), and most commonly between 19 and 21 base pairs in length (inclusive). Similarly, the region that is complementary to the target sequence is between 15 and 30 base pairs in length (inclusive), more commonly between 18 and 25 base pairs in length (inclusive), even more commonly between 19 and 24 base pairs in length (inclusive), and most commonly between 19 and 21 base pairs in length (inclusive). In some embodiments of any of the aspects, the dsRNA is between 15 and 20 nucleotides in length (inclusive), and in other embodiments, the dsRNA is between 25 and 30 nucleotides in length (inclusive). As those skilled in the art will recognize, the target region of an RNA targeted for cleavage is almost always a portion of a larger RNA molecule (often an mRNA molecule). In relevant cases, a "portion" of an mRNA target is a continuous sequence of the mRNA target long enough to be a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway). Under some circumstances, dsRNAs with double strands as short as 9 base pairs can mediate RNAi-specific RNA cleavage. In most cases, the target is at least 15 nucleotides long, preferably 15-30 nucleotides long.
[0125] Exemplary embodiments of types of inhibitory nucleic acids may include, for example, siRNA, shRNA, miRNA, and / or amiRNA, which are well known in the art.
[0126] In some embodiments of any of the aspects, the inhibitory RNA for treating Huntington's disease is an miRNA. MicroRNAs (miRNAs) are small RNAs of 17 to 25 nucleotides that function as regulators of gene expression in eukaryotes. MiRNAs are initially expressed in the nucleus as part of a long primary transcription product called the primary miRNA (pri-miRNA). Inside the nucleus, the pri-miRNA is partially digested by the enzyme Drosha to form a 65 to 120 nucleotide-long hairpin precursor miRNA (pre-miRNA), which is transported to the cytoplasm and further processed by Dicer to form a shorter, active mature miRNA. In animals, these short RNAs contain a 5'-proximal "seed" region (2 to 8 nucleotides) that is thought to be the primary determinant of the miRNA's binding specificity to the 3'-untranslated region (3'-UTR) of the target mRNA. A more detailed explanation is provided in the section providing general definitions.
[0127] In the context of the present invention, miRNA molecules or their equivalents, mimics, or isomiRs may be synthetic miRNAs, natural miRNAs, recombinant miRNAs, mature miRNAs, or parts of mature miRNAs or human miRNAs, or may be derived from human miRNAs as further defined in the section providing the general definition. Human miRNA molecules are miRNA molecules found in human cells, tissues, organs, or body fluids (i.e., endogenous human miRNA molecules). Human miRNA molecules may also be derived from endogenous human miRNA molecules by nucleotide substitution, deletion, and / or addition. miRNA molecules or their equivalents or mimics may be single-stranded or double-stranded RNA molecules. Preferably, the miRNA molecule or equivalent or mimic thereof is 6 to 30 nucleotides in length, preferably 12 to 30 nucleotides in length, preferably 15 to 28 nucleotides in length, more preferably the molecule is at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides in length.
[0128] In a preferred embodiment, the miRNA molecule, or its equivalent, mimic, or isomiR, comprises at least 6 of the 7 nucleotides present in the seed sequence of said miRNA molecule, or its equivalent, mimic, or isomiR. Preferably, in this embodiment, the miRNA molecule, or its equivalent, mimic, or isomiR, is 6 to 30 nucleotides in length, more preferably comprises at least 6 of the 7 nucleotides present in the seed sequence of said miRNA molecule, or its equivalent. Even more preferably, the miRNA molecule, or its equivalent, mimic, or isomiR, is 15 to 28 nucleotides in length, more preferably comprises at least 6 of the 7 nucleotides present in the seed sequence, and even more preferably, the miRNA molecule is at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides in length.
[0129] Thus, preferred miRNA molecules or equivalents or mimetics or isomiRs thereof comprise at least 6 of the 7 nucleotides present in a seed sequence identified as at least one of SEQ ID NOs: 1-24, and more preferably have a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides in length.
[0130] Delivery vehicles for miRNA include, but are not limited to, liposomes, polymeric nanoparticles, viral systems, conjugation of lipids or receptor-binding molecules, exosomes, and bacteriophages; see, e.g., Baumann and Winkler, miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents, Future Med Chem. 2014, 6(17): 1967-1984; U.S. Patent No. 8,900,627; U.S. Patent No. 9,421,173; U.S. Patent No. 9,555,060; WO2019 / 177550, the contents of each of which are incorporated herein by reference in their entireties. nucleic acid
[0131] In some aspects, the present disclosure provides isolated nucleic acids useful for reducing (e.g., inhibiting) the expression of human huntingtin (HTT). A "nucleic acid" sequence refers to a DNA or RNA sequence. In some embodiments, the proteins and nucleic acids of the present disclosure are isolated. As used herein, the term "isolated" means artificially produced. As used herein with respect to nucleic acids, the term "isolated" means: (i) amplified in vitro, e.g., by polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, e.g., by cleavage and gel separation; or (iv) synthesized, e.g., by chemical synthesis. An isolated nucleic acid is one that is readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector for which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences are disclosed is considered isolated, whereas a nucleic acid sequence native to its natural host is not. An isolated nucleic acid may, but need not, be substantially purified. For example, a nucleic acid isolated within a cloning or expression vector is not pure in that it may only comprise a small percentage of the substance in the cell in which it resides.However, this term is used because such nucleic acids can be easily manipulated by standard techniques known to those skilled in the art, and therefore such nucleic acids are isolated.When used herein in reference to a protein or peptide, the term "isolated" refers to a protein or peptide that has been isolated from its natural environment or artificially produced (e.g., by chemical synthesis, by recombinant DNA technology, etc.).
[0132] Those skilled in the art will also recognize that conservative amino acid substitutions can be made to provide functionally equivalent variants or homologs of capsid proteins. In some aspects, the present disclosure encompasses sequence changes that result in conservative amino acid substitutions. As used herein, a conservative amino acid substitution refers to an amino acid substitution that does not alter the relative change or size characteristics of the protein in which the amino acid substitution is made. Variants can be prepared according to methods for modifying polypeptide sequences known to those skilled in the art, such as those found in references compiling such methods, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F. M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Conservative amino acid substitutions include those made between amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. Thus, conservative amino acid substitutions may be made to the amino acid sequences of the proteins and polypeptides disclosed herein.
[0133] The isolated nucleic acid of the present invention may be a recombinant adeno-associated virus (AAV) vector (rAAV vector). In some embodiments, the isolated nucleic acid described by the present disclosure comprises a region (e.g., a first region) comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR) or a variant thereof. The isolated nucleic acid (e.g., a recombinant AAV vector) may be packaged in a capsid protein and administered to a subject and / or delivered to a selected target cell. A "recombinant AAV (rAAV) vector" typically minimally comprises a transgene and its regulatory sequences, as well as 5' and 3' AAV inverted terminal repeats (ITRs). The transgene may include one or more regions encoding one or more inhibitory RNAs (e.g., miRNAs), including nucleic acids targeting endogenous mRNAs of the subject, as disclosed elsewhere herein. The transgene may include, for example, a protein-coding region and / or expression control sequences (e.g., a polyA tail), as described elsewhere in this disclosure.
[0134] Generally, the ITR sequence is approximately 145 bp in length. Preferably, substantially the entire ITR-encoding sequence is used in the molecule, although some minor modifications of these sequences are acceptable. The ability to modify these ITR sequences is within the skill of the art. (See, for example, Sambrook et al., "Molecular Cloning. A Laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J. Virol., 70:520-532 (1996)). An example of such a molecule used in the present invention is a "cis-acting" plasmid containing a transgene, in which the selected transgene sequence and associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. The AAV ITR sequences may be obtained from any known AAV, including the mammalian AAV types identified by the present invention. In some embodiments, the isolated nucleic acid (e.g., rAAV vector) comprises at least one ITR having a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, AAVrhlO, and variants thereof. In some embodiments, the isolated nucleic acid comprises a region (e.g., a first region) encoding an AAV2 ITR.
[0135] In some embodiments, the isolated nucleic acid further comprises a region (e.g., a second region, a third region, a fourth region, etc.) comprising a second AAV ITR. In some embodiments, the second AAV ITR has a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, AAVrhlO, and variants thereof. In some embodiments, the second ITR is a mutant ITR lacking a functional terminal separation site (TRS). The term "lacking a terminal separation site" may refer to an AAV ITR containing a mutation (e.g., a sense mutation, such as a nonsynonymous mutation, or a missense mutation) that prevents the function of the terminal separation site (TRS) of the ITR, or a truncated AAV ITR (e.g., an ATRS ITR) that lacks a nucleic acid sequence encoding a functional TRS. Without wishing to be bound by any particular theory, rAAV vectors containing ITRs that lack a functional TRS result in self-complementary rAAV vectors, as described, for example, in McCarthy (2008) Molecular Therapy 16(10): 1648-1656.
[0136] In addition to the key elements identified above for recombinant AAV vectors, the vector also contains conventional control elements operably linked to the transgene elements to allow its transcription, translation, and / or expression in cells transfected with the vector or infected with the virus produced by the present invention. As used herein, "operably linked" sequences include both expression control sequences contiguous with the gene of interest and expression control sequences acting in trans or distally to control the gene of interest. Expression control sequences include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and, if desired, sequences that enhance secretion of the encoded product. Several expression control sequences, including native, constitutive, inducible, and / or tissue-specific promoters, are known in the art and may be utilized.
[0137] As used herein, a nucleic acid sequence (e.g., a coding sequence) and a regulatory sequence are said to be operably linked when they are covalently linked so as to place the expression or transcription of the nucleic acid sequence under the influence or control of the regulatory sequence. When it is desired that the nucleic acid sequence be translated into a functional protein, two DNA sequences are said to be operably linked if induction of a promoter in the 5' regulatory sequence results in transcription of the coding sequence, and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frameshift mutation, (2) interfere with the ability of the promoter region to direct transcription of the coding sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region will be operably linked to a nucleic acid sequence if it is capable of causing transcription of that DNA sequence so that the resulting transcript can be translated into a desired protein or polypeptide. Similarly, two or more coding regions are operably linked if they are linked such that their transcription from a common promoter results in the expression of two or more in-frame translated proteins. In some embodiments, the operably linked coding sequences result in a fusion protein. In some embodiments, the operably linked coding sequences result in a functional RNA (e.g., miRNA).
[0138] In some aspects, the present disclosure provides an isolated nucleic acid comprising a transgene, wherein the transgene comprises a nucleic acid sequence encoding one or more microRNAs (e.g., miRNAs). A "microRNA" or "miRNA" is a small, non-coding RNA molecule capable of mediating post-transcriptional or post-translational gene silencing. Typically, miRNAs are transcribed as hairpin or stem-loop (e.g., self-complementary, single-stranded backbone) double-stranded structures, termed primary miRNAs (pri-miRNAs), that are enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into pre-miRNAs. The length of the pri-miRNA can vary. In some embodiments, the pri-miRNA ranges in length from about 100 to about 5000 base pairs (e.g., about 100, about 200, about 500, about 1000, about 1200, about 1500, about 1800, or about 2000 base pairs). In some embodiments, the pri-miRNA is greater than 200 base pairs in length (eg, 2500, 5000, 7000, 9000, or more base pairs in length).
[0139] The length of the pre-miRNA, which is also characterized by a hairpin or stem-loop double-stranded structure, can also vary. In some embodiments, the pre-miRNA ranges in size from about 40 base pairs to about 500 base pairs. In some embodiments, the pre-miRNA ranges in size from about 50 to 100 base pairs. In some embodiments, the pre-miRNA ranges in size from about 50 to about 90 base pairs in length (e.g., about 50, about 52, about 54, about 56, about 58, about 60, about 62, about 64, about 66, about 68, about 70, about 72, about 74, about 76, about 78, about 80, about 82, about 84, about 86, about 88, or about 90 base pairs in length).
[0140] Generally, pre-miRNAs are transported into the cytoplasm and enzymatically processed by Dicer to first produce incomplete miRNAs / miRNAs. *This produces a double-stranded, then single-stranded, mature miRNA molecule, which is then loaded into the RNA-induced silencing complex (RISC). Typically, mature miRNA molecules range in size from about 19 to about 30 base pairs in length. In some embodiments, mature miRNA molecules are about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or 30 base pairs in length. In some embodiments, the isolated nucleic acid of the present disclosure comprises a sequence encoding a pri-miRNA, pre-miRNA, or mature miRNA comprising a sequence set forth in any one of SEQ ID NOs: 1-24.
[0141] It should be appreciated that an isolated nucleic acid or vector (e.g., an rAAV vector) may, in some embodiments, comprise a nucleic acid sequence encoding two or more (e.g., a plurality, e.g., 2, 3, 4, 5, 10, or more) miRNAs. In some embodiments, each of the two or more miRNAs targets (e.g., hybridizes or specifically binds to) the same target gene (e.g., an isolated nucleic acid encoding three unique miRNAs, each targeting the HTT gene). In some embodiments, each of the two or more miRNAs targets (e.g., hybridizes or specifically binds to) a different region of the same target gene (e.g., HTT). In some embodiments, each of the two or more miRNAs targets (e.g., hybridizes or specifically binds to) a different target gene.
[0142] In some aspects, the present disclosure provides isolated nucleic acids and vectors (e.g., rAAV vectors) encoding one or more artificial miRNAs. As used herein, "artificial miRNA" or "amiRNA" refers to miRNAs and *The sequence of the corresponding amiRNA / amiRNA (e.g., the passenger strand of the miRNA duplex) directs highly efficient RNA silencing of target genes, as described, for example, in Eamens et al. (2014), Methods Mol. Biol. 1062:211-224. * The term "miRNA backbone" refers to an endogenous pri-miRNA or pre-miRNA (e.g., a miRNA backbone, which is a precursor miRNA capable of generating a functional mature miRNA) in which a sequence has been replaced with a sequence encoding a mature HTT-specific miRNA (e.g., any one of SEQ ID NOS: 1-24). For example, in some embodiments, an artificial miRNA comprises a miR-155 pri-miRNA backbone in which a sequence encoding a mature HTT-specific miRNA (e.g., any one of SEQ ID NOS: 1-24) has been inserted in place of the endogenous miR-155 mature miRNA coding sequence. In some embodiments, a miRNA described in the present disclosure (e.g., an artificial miRNA; e.g., one of SEQ ID NOS: 1-24) comprises a miR-155 backbone sequence, a miR-30 backbone sequence, a miR-64 backbone sequence, or a miR-122 backbone sequence. In some embodiments, a miRNA described in the present disclosure (e.g., an artificial miRNA; e.g., one of SEQ ID NOS: 1-24) comprises the backbone disclosed in SEQ ID NOS: 35.
[0143] The region containing the transgene (e.g., the second region, third region, fourth region, etc.) may be located in any suitable location in the isolated nucleic acid. The region may be located in any untranslated portion of the nucleic acid, including, for example, an intron, a 5' or 3' untranslated region, etc.
[0144] In some cases, it may be desirable to place a region (e.g., a second region, a third region, a fourth region, etc.) upstream of the first codon of a nucleic acid sequence encoding a protein (e.g., a protein-coding sequence). For example, the region may be located between the first codon of the protein-coding sequence and 2000 nucleotides upstream of the first codon. The region may be located between the first codon of the protein-coding sequence and 1000 nucleotides upstream of the first codon. The region may be located between the first codon of the protein-coding sequence and 500 nucleotides upstream of the first codon. The region may be located between the first codon of the protein-coding sequence and 250 nucleotides upstream of the first codon. The region may be located between the first codon of the protein-coding sequence and 150 nucleotides upstream of the first codon. In some cases (e.g., when the transgene lacks a protein-coding sequence), it may be desirable to place a region (e.g., a second region, a third region, a fourth region, etc.) upstream of the poly-A tail of the transgene. For example, the region may be located between the first base of the poly-A tail and 2000 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 1000 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 500 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 250 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 150 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 100 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 50 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 20 nucleotides upstream of the first base. In some embodiments, the region is located between the last nucleotide base of the promoter sequence and the first nucleotide base of the poly-A tail sequence.
[0145] In some cases, the region may be located downstream of the last base of the poly-A tail of the transgene. The region may be located between the last base of the poly-A tail and a position 2000 nucleotides downstream of the last base. The region may be located between the last base of the poly-A tail and a position 1000 nucleotides downstream of the last base. The region may be located between the last base of the poly-A tail and a position 500 nucleotides downstream of the last base. The region may be located between the last base of the poly-A tail and a position 250 nucleotides downstream of the last base. The region may be located between the last base of the poly-A tail and a position 150 nucleotides downstream of the last base.
[0146] It should be appreciated that when a transgene encodes two or more miRNAs, each miRNA may be placed in any suitable location within the transgene. For example, a nucleic acid encoding a first miRNA may be placed in an intron of the transgene, and a nucleic acid sequence encoding a second miRNA may be placed in a separate untranslated region (e.g., between the last codon of the protein-coding sequence and the first base of the poly-A tail of the transgene).
[0147] In some embodiments, the transgene further comprises a nucleic acid sequence encoding one or more expression control sequences (e.g., promoters, etc.). Expression control sequences include appropriate transcription start sequences, stop sequences, promoter sequences, and enhancer sequences; efficient RNA processing signals such as splicing signals and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and, if desired, sequences that enhance secretion of the encoded product. Numerous expression control sequences, including native, constitutive, inducible, and / or tissue-specific promoters, are known in the art and can be utilized.
[0148] A "promoter" refers to a DNA sequence recognized by or introduced into the synthetic machinery of a cell, required to initiate the specific transcription of a gene. The phrases "operably positioned," "under control," or "under transcriptional control" mean that the promoter is in the correct location and orientation with respect to the nucleic acid to control the initiation of RNA polymerase and expression of the gene.
[0149] In nucleic acids encoding proteins, a polyadenylation sequence is generally inserted after the transgene sequence and before the 3' AAV ITR sequence. rAAV constructs useful in the present disclosure may also contain an intron, which is preferably located between the promoter / enhancer sequence and the transgene. One possible intron sequence is derived from SV-40 and is referred to as the SV-40 T intron sequence. Another vector element that can be used is an internal ribosome entry site (IRES). IRES sequences are used to generate two or more polypeptides from a single gene transcript. IRES sequences will be used to generate proteins containing two or more polypeptide chains. The selection of these and other common vector elements is conventional, and many such sequences are available (see, e.g., Sambrook et al., and the references cited therein, e.g., pages 3.18-3.26 and 16.17-16.27, as well as Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989). In some embodiments, the foot-and-mouth disease virus 2A sequence is contained in the polyprotein; it is a small peptide (approximately 18 amino acids in length) that has been shown to mediate polyprotein cleavage (Ryan, MD et al., EMBO, 1994; 4: 928-933; Mattion, NM et al., J Virology, November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001; 8: 864-873; and Halpin, C et al., The Plant Journal, 1999; 4: 453-459).The cleavage activity of 2A sequences has previously been demonstrated in artificial systems, including plasmids and gene therapy vectors (AAV and retrovirus) (Ryan, MD et al., EMBO, 1994; 4: 928-933; Mattion, NM et al., J Virology, November 1996; pp. 8124-8127; Furler, S et al., Gene Therapy, 2001; pp. 864-873; and Halpin, C et al., The Plant Journal, 1999; pp. 453-459; de Felipe, P et al., Gene Therapy, 1999; pp. 6: 198-208; de Felipe, P et al., Human Gene Therapy, 2000; pp. 11: 1921-1931; and Klump, H et al., Gene Therapy, 2001;8:811-817).
[0150] Examples of constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer) (see, e.g., Boshart et al., Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1 promoter (Invitrogen). In some embodiments, the promoter is an enhanced chicken β-actin promoter. In some embodiments, the promoter is a U6 promoter.
[0151] Inducible promoters allow for the regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or specific physiological conditions, such as the presence of an acute phase, a specific differentiation state of cells, or only in replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including, but not limited to, Invitrogen, Clontech, and Ariad. Many other systems have been described and can be easily selected by those skilled in the art. Examples of inducible promoters regulated by an exogenously supplied promoter include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), and the tetracycline-inducible system (Gossen et al., Science, 268: 1766-1769 (1995); Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1996)). (1998)), the RU486 inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)), and the rapamycin inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Other types of inducible promoters that may be useful in this context are those that are regulated by specific physiological conditions, such as temperature, acute phase, a specific differentiation state of cells, or only in replicating cells.
[0152] In another embodiment, the native promoter of the transgene is used. A native promoter may be preferred when it is desired that the expression of the transgene mimic native expression. A native promoter can be used when the expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimulus. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, can also be used to mimic native expression.
[0153] In some embodiments, the regulatory sequence confers tissue-specific gene expression. In some cases, the tissue-specific regulatory sequence binds to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synapsin-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, α-myosin heavy chain (α-MHC) promoter, or cardiac troponin T (cTnT) promoter.Other exemplary promoters include the beta-actin promoter, the hepatitis B virus core promoter, Sandig et al., Gene Ther., 3: 1002-9 (1996); the alpha-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7: 1503-14 (1996); the bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24: 185-96 (1997)); the bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), the CD2 promoter (Hansal et al., J. Immunol., 161: 1063-8 (1996)), among others that will be apparent to those of skill in the art. (1998); immunoglobulin heavy chain promoter; T cell receptor α-chain promoter, neuronal promoters such as neuron-specific enolase (NSE) (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)).
[0154] Aspects of the present disclosure relate to isolated nucleic acids comprising two or more promoters (e.g., two, three, four, five, or more promoters). For example, in the context of a construct having a transgene comprising a first region encoding a protein and a second region encoding an inhibitory RNA (e.g., miRNA), it may be desirable to drive expression of the protein coding region using a first promoter sequence (e.g., the first promoter sequence is operably linked to the protein coding region) and to drive expression of the inhibitory RNA coding region with a second promoter sequence (e.g., the second promoter sequence is operably linked to the inhibitory RNA coding region). Generally, the first promoter sequence and the second promoter sequence may be the same or different promoter sequences. In some embodiments, the first promoter sequence (e.g., the promoter driving expression of the protein coding region) is an RNA polymerase III (pol III) promoter sequence. Non-limiting examples of pol III promoter sequences include U6 and HI promoter sequences. In some embodiments, the second promoter sequence (e.g., the promoter sequence driving the expression of an inhibitory RNA) is an RNA polymerase II (pol II) promoter sequence. Non-limiting examples of pol II promoter sequences include T7, T3, SP6, RSV, and cytomegalovirus promoter sequences. In some embodiments, the pol III promoter sequence drives the expression of an inhibitory RNA (e.g., miRNA) coding region. In some embodiments, the pol II promoter sequence drives the expression of a protein coding region.
[0155] In some embodiments, the nucleic acid comprises a transgene encoding a protein. The protein may be a therapeutic protein (e.g., a peptide, protein, or polypeptide useful for treating or preventing a disease state in a mammalian subject) or a reporter protein. In some embodiments, the therapeutic protein is useful for treating or preventing Huntington's disease, such as CYP46A1, polyglutamine-binding peptide 1 (QBP1), PTD-QBP1, ED11, C4 intrabody, VL12.3 intrabody, MW7 intrabody, Happ1 antibody, Happ3 antibody, mEM48 intrabody, certain monoclonal antibodies (e.g., 1C2), and peptide P42 and variants thereof, as described in Marelli et al. (2016) Orphanet Journal of Rare Disease 11:24. In some embodiments, the therapeutic protein is a wild-type huntingtin protein (e.g., a huntingtin protein having a PolyQ repeat region containing fewer than 36 repeats).
[0156] Without wishing to be bound by any particular theory, allele-specific silencing of mutant huntingtin (HTT) may result in an improved safety profile in subjects compared with non-allele-specific silencing (for example, silencing both wild-type and mutant HTT alleles) because wild-type HTT expression and function are preserved in cells.The present invention relates to the inventors' recognition and understanding that isolated nucleic acids and vectors incorporating one or more inhibitory RNA (e.g., miRNA) sequences that target the HTT gene in a non-allele-specific manner while driving the expression of a hardened wild-type HTT gene (a wild-type HTT gene that is not targeted by miRNA) can achieve concomitant mutant HTT knockdown, for example, in CNS tissues with increased expression of wild-type HTT.Generally, the sequences of the nucleic acids encoding endogenous wild-type and mutant HTT mRNAs and the nucleic acid of the transgene encoding the "hardened" wild-type HTT mRNA are sufficiently different, so that the mRNA of the "hardened" wild-type HTT transgene is not targeted by one or more inhibitory RNAs (e.g., miRNA). This can be achieved, for example, by introducing one or more silent mutations into the HTT transgene sequence so that the HTT transgene sequence encodes the same protein as the endogenous wild-type HTT gene but has a different nucleic acid sequence. In this case, the exogenous mRNA can be referred to as "hardened." Alternatively, inhibitory RNA (e.g., miRNA) can target the 5' and / or 3' untranslated region of endogenous wild-type HTT mRNA. These 5' and / or 3' regions can then be removed or replaced in the transgene mRNA so that the transgene mRNA is not targeted by one or more inhibitory RNAs.
[0157] Reporter sequences (e.g., nucleic acid sequences encoding reporter proteins) that can be provided in a transgene include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and the like, which are well known in the art. When associated with regulatory elements that drive their expression, reporter sequences produce signals that are detectable by conventional means, including enzymatic assays, radiographic assays, colorimetric assays, fluorometric or other spectrophotometric assays, fluorescence-activated cell sorting assays, and immunological assays, including enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), and immunohistochemistry. For example, if the marker sequence is the LacZ gene, the presence of a signal-carrying vector is detected by an assay for β-galactosidase activity. If the transgene is green fluorescent protein or luciferase, the presence of a signal-carrying vector can be measured visually by color or light production in a luminometer. Such reporters can be useful, for example, in verifying the tissue-specific targeting ability of nucleic acids and tissue-specific promoter regulatory activity. Recombinant adeno-associated virus (rAAV). In some aspects, the present disclosure provides an isolated AAV. When used herein with respect to AAV, the term "isolated" refers to an AAV that is artificially produced or obtained. Isolated AAV can be produced using recombinant methods. Such AAV is referred to herein as "recombinant AAV." Recombinant AAV (rAAV) preferably has tissue-specific targeting ability, so that the nuclease and / or transgene of the rAAV can be specifically delivered to one or more predetermined tissue(s). The AAV capsid is an important factor in determining these tissue-specific targeting abilities. Therefore, rAAVs with capsids appropriate for the tissues to be targeted can be selected.
[0158] Methods for obtaining recombinant AAVs with desired capsid proteins are well known in the art. (See, for example, US2003 / 0138772, the contents of which are incorporated herein by reference in their entirety.) Typically, the methods involve culturing host cells containing a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; a recombinant AAV vector composed of AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to enable packaging of the recombinant AAV vector into the AAV capsid protein. In some embodiments, the capsid protein is a structural protein encoded by the AAV cap gene. AAV contains three capsid proteins, namely, virion proteins 1 to 3 (designated VP1, VP2, and VP3), all of which are transcribed from a single cap gene by alternative splicing. In some embodiments, the molecular weights of VP1, VP2, and VP3 are approximately 87 kDa, approximately 72 kDa, and approximately 62 kDa, respectively. In some embodiments, during translation, capsid protein forms a spherical 60-mer protein shell around the viral genome. In some embodiments, the function of capsid protein is to protect the viral genome, deliver the genome, and interact with the host. In some aspects, capsid protein delivers the viral genome to the host in a tissue-specific manner.
[0159] In some embodiments, the AAV capsid protein is of an AAV serotype selected from the group consisting of AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAVrh8, AAV9, AAV10, and AAVrh10. In some embodiments, the AAV capsid protein is of a serotype derived from a non-human primate, such as the AAVrh8 or AAVrh10 serotype. In some embodiments, the AAV capsid protein is of the AAV9 serotype. In some embodiments, the AAV capsid protein is of the AAVrh10 serotype. In some embodiments, the capsid protein is an AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or AAVrh10 capsid protein, or a chimera of any of them. In some embodiments, the recombinant AAV (rAAV) is a haploid rAAV. In some embodiments, the haploid rAAV comprises a chimeric capsid protein.
[0160] In one embodiment, the viral capsid is modified. In one embodiment, the modified viral capsid is a chimeric capsid. As used herein, a "chimeric" capsid protein refers to an AAV capsid protein (e.g., any one or more of VP1, VP2, or VP3) that has been modified by the substitution of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residues in the amino acid sequence of the capsid protein compared to the wild type, and the insertion and / or deletion of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residues in the amino acid sequence compared to the wild type. In some embodiments, complete or partial domains, functional regions, epitopes, etc. from one AAV serotype are substituted for corresponding wild-type domains, functional regions, epitopes, etc. from a different AAV serotype in any combination to generate the chimeric capsid protein of the present invention. The production of chimeric capsid proteins can be carried out according to protocols well known in the art, and a number of chimeric capsid proteins that can be included in the capsids of the invention have been described in the literature and herein.
[0161] In one embodiment, the modified viral capsid is a haploid capsid. As used herein, the term "haploid AAV" refers to AAV as described in International Application No. WO2018 / 170310 or U.S. Application No. US2018 / 037149, the entire contents of which are incorporated herein by reference. In some embodiments, the population of virions is a haploid AAV population capable of assembling virion particles, wherein at least one viral protein from the group consisting of AAV capsid proteins VP1, VP2, and VP3 is different from at least one of the other viral proteins required to form virion particles capable of encapsulating the AAV genome. For each viral protein present (VP1, VP2, and / or VP3), the protein is of the same type (e.g., all AAV2 VP1). In one case, at least one viral protein is a chimeric viral protein, and at least one of the other two viral proteins is not chimeric. In one embodiment, VP1 and VP2 are chimeric, and only VP3 is not chimeric. For example, only viral particles composed of VP1 / VP2 from chimeric AAV2 / 8 (N-terminus of AAV2 and C-terminus of AAV8) are paired with VP3 from AAV2; or only chimeric VP1 / VP2 28m-2P3 (N-terminus from AAV8 without VP3 start codon mutation and C-terminus from AAV2) are paired with VP3 from AAV2. In another embodiment, only VP3 is chimeric, and VP1 and VP2 are not chimeric. In another embodiment, at least one viral protein is derived from a completely different serotype. For example, only chimeric VP1 / VP2 28m-2P3 is paired with VP3 from AAV3. In another example, no chimera exists. For example, see U.S. Patent Application No. 2019 / 0002841 or U.S. Patent No. 8,906,675, the contents of each of which are incorporated herein by reference in their entirety.
[0162] The components cultured in the host cell to package the rAAV vector into an AAV capsid can be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., recombinant AAV vector, rep sequence, cap sequence, and / or helper functions) can be provided by a stable host cell engineered to contain one or more of the required components using methods known to those skilled in the art. Most preferably, such a stable host cell contains the required component(s) under the control of an inducible promoter. However, the required component(s) can also be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the discussion of suitable regulatory elements for use with the transgene. In yet another alternative, the selected stable host cell can contain the selected component(s) under the control of a constitutive promoter and the selected other component(s) under the control of one or more inducible promoters. For example, stable host cells can be generated that are derived from 293 cells (containing E1 helper functions under the control of a constitutive promoter), but contain the rep and / or cap proteins under the control of an inducible promoter. Other stable host cells can also be generated by those skilled in the art. In some embodiments, the present disclosure relates to host cells that contain a nucleic acid that includes a coding sequence encoding a protein (e.g., a wild-type huntingtin protein, optionally a "hardened" wild-type huntingtin protein). In some embodiments, the present disclosure relates to compositions comprising the host cells described above. In some embodiments, the composition comprising the host cells further comprises a cryopreservation agent.
[0163] The recombinant AAV vector, rep sequence, cap sequence, and helper functions required to generate the rAAV of the present disclosure may be delivered to the packaging host cell using any suitable genetic element (vector). The selected genetic element can be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of the present disclosure are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for producing rAAV virions are well known, and the selection of a suitable method is not a limitation of the present disclosure. See, for example, K. Fisher et al., J. Virol., 70:520-532 (1993) and U.S. Patent No. 5,478,745.
[0164] In some embodiments, recombinant AAV can be produced using a triple transfection method (described in detail in U.S. Pat. No. 6,001,650). Typically, recombinant AAV is produced by transfecting host cells with a recombinant AAV vector (including a transgene) to be packaged into AAV particles, an AAV helper function vector, and an accessory function vector. The AAV helper function vector encodes "AAV helper function" sequences (i.e., rep and cap), which function in trans for productive AAV replication and encapsidation. Preferably, the AAV helper function vector supports efficient AAV vector production without producing any detectable wild-type AAV virions (i.e., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use in connection with the present disclosure include the pHLP19 vector described in U.S. Pat. No. 6,001,650 and the pRep6cap6 vector described in U.S. Pat. No. 6,156,303, both of which are incorporated herein by reference in their entireties. Accessory function vectors encode nucleotide sequences for non-AAV-derived viral and / or cellular functions (i.e., "accessory functions") on which AAV replication depends. Accessory functions include those functions required for AAV replication, including, but not limited to, those moieties involved in AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, cap expression product synthesis, and activation of AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses, such as adenovirus, herpesvirus (other than herpes simplex virus type 1), and vaccinia virus.
[0165] In some aspects, the present disclosure provides transfected host cells. The term "transfection" is used to refer to the uptake of foreign DNA by a cell, and a cell is "transfected" when exogenous DNA is introduced inside the cell membrane. Several transfection techniques are generally known in the art. See, for example, Graham et al. (1973) Virology, 52:456; Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York; Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier; and Chu et al. (1981) Gene 13:197. Using such techniques, one or more exogenous nucleic acids, such as nucleotide integration vectors and other nucleic acid molecules, can be introduced into a suitable host cell.
[0166] "Host cell" refers to any cell that harbors or is capable of harboring a substance of interest. Host cells are often mammalian cells. Host cells can be used as recipients of AAV helper constructs, AAV minigene plasmids, accessory function vectors, or other transfer DNA involved in the generation of recombinant AAV. The term also includes the progeny of the original transfected cell. Thus, as used herein, "host cell" can refer to a cell transfected with an exogenous DNA sequence. It is understood that the progeny of a single parent cell may not necessarily be completely identical in morphology or in overall genetic or DNA complement to the original parent due to natural, accidental, or deliberate mutation.
[0167] As used herein, the term "cell line" refers to a cell population that can grow and divide continuously or for a long period in vitro.In many cases, cell line is a clonal population derived from a single progenitor cell.Natural or induced changes may occur in karyotype during the storage or transfer of such clonal population.Therefore, the cells derived from the cell line referred to may not be exactly the same as the ancestral cell or culture, and the cell line referred to includes such variants.
[0168] As used herein, the term "recombinant cell" refers to a cell into which an exogenous DNA segment has been introduced, such as a DNA segment that results in the transcription of a biologically active polypeptide or the production of a nucleic acid, such as a biologically active RNA.
[0169] As used herein, the term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, or virion, which, when associated with the appropriate control elements, is capable of replication and can transfer gene sequences between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. In some embodiments, useful vectors are contemplated as those vectors in which the nucleic acid segment to be transcribed is placed under the transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by or introduced into the synthetic machinery of a cell, necessary for initiating the specific transcription of a gene. The phrases "operably positioned," "under control," or "under transcriptional control" mean that the promoter is in the correct position and orientation relative to the nucleic acid to control the initiation of RNA polymerase and expression of the gene. The term "expression vector or construct" refers to any type of genetic construct containing a nucleic acid from which part or all of a nucleic acid coding sequence can be transcribed. In some embodiments, expression includes transcription of the nucleic acid, for example, to produce a biologically active polypeptide product or functional RNA (e.g., guide RNA) from the transcribed gene.
[0170] The above methods for packaging a recombinant vector into a desired AAV capsid to generate the rAAV of the present disclosure are not meant to be limiting, and other suitable methods will be apparent to those of skill in the art.
[0171] In some embodiments, any one or more thymidine (T) or uridine (U) nucleotides in the sequences provided herein, including those provided in the sequence listing, may be replaced with any other nucleotide suitable for pairing with an adenosine nucleotide (e.g., by Watson-Crick base pairing). For example, in some embodiments, any one or more thymidine (T) nucleotides in the sequences provided herein, including those provided in the sequence listing, may be suitable for replacement with a uridine (U) nucleotide, or vice versa.
[0172] In some embodiments of any of the aspects, nucleic acids (e.g., miRNAs) are chemically modified to enhance stability or other beneficial characteristics. The nucleic acids described herein may be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated by reference. Modifications include, for example, (a) terminal modifications, e.g., 5'-terminal modifications (phosphorylation, conjugation, reverse ligation, etc.), 3'-terminal modifications (conjugation, DNA nucleotides, reverse ligation, etc.), (b) base modifications, e.g., replacement with a stabilizing base, a destabilizing base, or a base that base-pairs with a wide range of partners, base removal (abasic nucleotide), or conjugated base, (c) sugar modifications (e.g., at the 2' or 4' position) or sugar replacement, and (d) backbone modifications, including modification or replacement of a phosphodiester linkage. Specific examples of nucleic acid compounds useful in the embodiments described herein include, but are not limited to, nucleic acids containing modified backbones or lacking natural internucleoside linkages. Nucleic acids with modified backbones include, among others, those lacking a phosphorus atom in the backbone. For purposes of this specification, and as sometimes referenced in the art, modified nucleic acids lacking a phosphorus atom in the internucleoside backbone can also be considered oligonucleosides. In some embodiments of any of the aspects, the modified nucleic acid has a phosphorus atom in the internucleoside backbone.
[0173] Modified nucleic acid backbones can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl phosphonates and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and phosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and those with reverse polarity, in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.Various salts, mixed salts, and free acid forms are also included. Modified nucleic acid backbones that do not contain phosphorus atoms therein have backbones formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. These include morpholino linkages (formed in part from the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamic acid backbones; methyleneimino and methylenehydrazino backbones; sulfonic acid and sulfonamide backbones; amide backbones; and others containing a mixture of N, O, S, and CH2 moieties. and in particular, those having --CH2--NH--CH2--, [known as the methylene(methylimino) or MMI backbone] --CH2--N(CH3)--O--CH2--, --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2--, and --N(CH3)--CH2--CH2--, where the native phosphodiester backbone is represented as --O--P--O--CH2--.
[0174] In other nucleic acid mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to the aza nitrogen atoms of the amide portion of the backbone.
[0175] Nucleic acid may be modified to include one or more locked nucleic acids (LNA).Locked nucleic acids are nucleotides with modified ribose moieties, which contain an extra bridge connecting the 2' and 4' carbons of the ribose moiety. This structure "locks" the ribose in a 3'-endo conformation.The addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol. Canc. Ther. 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
[0176] Modified nucleic acids may contain one or more substituted sugar moieties. The nucleic acids described herein may include one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where the alkyl, alkenyl, and alkynyl may be substituted or unsubstituted C1-C10 alkyl or C2-C10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. In some embodiments of any of the aspects, the nucleic acid comprises one of the following at the 2' position: C1-C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a nucleic acid, or a group for improving the pharmacodynamic properties of a nucleic acid, and other substituents with similar properties. In some embodiments of any of the aspects, the modification includes 2' methoxyethoxy (2'-O--CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group.Another exemplary modification is the 2'-dimethylaminooxyethoxy, i.e., O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, described herein below in the Examples, and the 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2--O--CH2--N(CH2)2, also described herein below in the Examples.
[0177] Other modifications include 2'-methoxy (2'-OCH), 2'-aminopropoxy (2'-OCHCHCHNH), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions in nucleic acids, particularly the 3' position of the sugar in the 3'-terminal nucleotide or in 2'-5'-linked dsRNA and the 5' position of the 5'-terminal nucleotide. Nucleic acids can also have sugar mimetics, such as cyclobutyl moieties, in place of the pentofuranosyl sugar.
[0178] Nucleic acids may contain modifications or substitutions of nucleobases (often simply referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include, but are not limited to, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil (pseudouracil)), and 5-methylcytosine (5-me-C). Other synthetic and natural nucleobases may be included, including 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and adenine, 8-azaguanine and adenine, 7-deazaguanine and adenine, and 3-deazaguanine and adenine. Certain of these nucleobases are particularly useful for increasing the binding affinity of the inhibitory nucleic acids featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, YS, Crooke, ST and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and are an exemplary base substitution, even more particularly when combined with a 2'-O-methoxyethyl sugar modification. In some embodiments of any of the aspects, the modified nucleobase may include d5SICS and dNAM, which are non-limiting examples of unnatural nucleobases that can be used separately or together as base pairs (see, e.g., Leconte et al. J. Am. Chem. Soc. 2008, 130, 7, 2336-2343; Malyshev et al. PNAS. 2012. 109 (30) 12005-12010). In some embodiments of any of the aspects, the oligonucleotide tag (e.g., Oligopaint) comprises any modified nucleobase known in the art, i.e., any nucleobase that is modified from an unmodified and / or natural nucleobase.
[0179] The preparation of the above-described modified nucleic acids, backbones, and nucleobases is well known in the art.
[0180] Another modification of nucleic acids that is a feature of the invention involves chemically linking the nucleic acid to one or more ligands, moieties, or conjugates that enhance the activity, intracellular distribution, pharmacokinetic properties, or cellular uptake of the nucleic acid. Such moieties include, but are not limited to, cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers such as beryl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterols (Oberhauser et al., Nucl. Acids Res., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), and the like. 20:533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or lipid moiety such as octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937). Treatment method
[0181] The present disclosure provides a method for delivering a transgene (e.g., an inhibitory RNA such as miRNA) to a subject. The method typically involves administering to the subject a therapeutically effective amount of an rAAV containing an isolated nucleic acid encoding an interfering RNA capable of reducing the expression of huntingtin (htt) protein, or a nucleic acid for expressing an inhibitory RNA capable of reducing the expression of huntingtin protein.
[0182] In some aspects, the present disclosure provides inhibitory miRNAs that specifically bind to (e.g., hybridize with) at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) consecutive bases of human huntingtin (e.g., SEQ ID NO: 25). As used herein, "consecutive bases" refers to two or more nucleotide bases that are covalently linked to each other (e.g., as part of a nucleic acid molecule) (e.g., by one or more phosphodiester bonds). In some embodiments, at least one miRNA is about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, or about 100% identical to two or more (about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) consecutive nucleotide bases of SEQ ID NO: 25. In some embodiments, the inhibitory RNA is an miRNA that comprises or is encoded by a sequence set forth in any one of SEQ ID NOs: 1-24.
[0183] As used herein, "Huntington's disease" or "HD" refers to a neurodegenerative disease characterized by progressively worsening motor, cognitive, and behavioral changes caused by a trinucleotide repeat expansion (e.g., CAG, which translates to a polyglutamine, or polyQ, tract) in the HTT gene, which results in the production of a pathogenic mutant huntingtin protein (HTT, or mHTT). In some embodiments, the mutant huntingtin protein accelerates the rate of neuronal cell death in certain regions of the brain. Generally, the severity of HD correlates with the size of the trinucleotide repeat expansion in a subject. For example, subjects with a CAG repeat region containing between 36 and 39 repeats are characterized as having "incomplete penetrance" HD, while subjects with more than 40 repeats are characterized as having "full penetrance" HD. Thus, in some embodiments, a subject with HD or at risk of having HD has an HTT gene that contains between about 36 and about 39 CAG repeats (e.g., 36, 37, 38, or 39 repeats). In some embodiments, a subject with HD or at risk of having HD has an HTT gene that contains 40 or more (e.g., 40, 45, 50, 60, 70, 80, 90, 100, 200, or more) CAG repeats. In some embodiments, subjects with an HTT gene that contains more than 100 CAG repeats develop HD earlier than subjects with fewer than 100 CAG repeats. In some embodiments, subjects with an HTT gene that contains more than 100 CAG repeats may develop HD symptoms before about age 20 and are referred to as having juvenile HD (also referred to as akinetic-rigid HD or Westphal variant HD). The number of CAG repeats in the alleles of the HTT gene of a subject can be determined by any suitable modality known in the art.For example, nucleic acid (e.g., DNA) can be isolated from a subject's biological sample (e.g., blood), and the number of CAG repeats of the HTT allele can be determined by hybridization-based methods such as PCR or nucleic acid sequencing (e.g., Illumina sequencing, Sanger sequencing, SMRT sequencing, etc.).
[0184] In some embodiments of any aspect, the method further includes, prior to administering, diagnosing the subject as having or at risk of developing Huntington's disease.
[0185] In some embodiments of any aspect, the method further comprises, prior to administering, receiving the results of an assay diagnosing the subject as having Huntington's disease or at risk of developing Huntington's disease. Exemplary assays for diagnosing a subject as having or at risk of developing Huntington's disease, such as genetic screening for at least 36 CAG repeats, at least 40 CAG repeats, or at least 100 CAG repeats, or more, are described herein.
[0186] An "effective amount" of a substance is an amount sufficient to produce a desired effect. In some embodiments, an effective amount of an isolated nucleic acid is an amount sufficient to transfect (or infect, in the context of rAAV-mediated delivery) a sufficient number of target cells in a target tissue of a subject. In some embodiments, the target tissue is a central nervous system (CNS) tissue (e.g., brain tissue, spinal cord tissue, cerebrospinal fluid (CSF), etc.). In some embodiments, an effective amount of an isolated nucleic acid (e.g., which may be delivered by rAAV) may be an amount sufficient to have a therapeutic benefit in a subject, e.g., to reduce the expression of a pathogenic gene or protein (e.g., HTT), extend the lifespan of a subject, ameliorate one or more symptoms of a disease in a subject (e.g., symptoms of Huntington's disease), etc. The effective amount depends on various factors, such as the species, age, weight, health, and tissue targeted by the subject, and thus may vary between subjects and tissues, as described elsewhere in this disclosure. Administration
[0187] The rAAV of the present disclosure can be delivered to the subject in the composition according to any suitable method known in the art.For example, rAAV can be preferably suspended in a pharmacologically compatible carrier (i.e., in the composition) and administered to the subject, that is, the host animal such as human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey or non-human primate (e.g., macaque).In some embodiments, the host animal does not include human.
[0188] Delivery of rAAV to a mammalian subject may be, for example, by intramuscular injection or by administration into the mammalian subject's bloodstream. Administration into the bloodstream may be by injection into a vein, artery, or any other vascular conduit. In some embodiments, rAAV is administered into the bloodstream by hyperthermic limb perfusion, a technique well known in the surgical arts; this method essentially allows one skilled in the art to isolate a limb from the systemic circulation before administering rAAV virions. A variant of the hyperthermic limb perfusion technique described in U.S. Patent No. 6,177,403 can also be used by those skilled in the art to administer virions into the vasculature of an isolated limb, potentially enhancing transduction into muscle cells or tissues. Furthermore, in certain cases, it may be desirable to deliver virions to the subject's CNS. By "CNS" is meant all cells and tissues of the vertebrate brain and spinal cord. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage, and the like. Recombinant AAV can be delivered directly to the CNS or brain, for example, by injection into the ventricular region, and to the striatum (e.g., the caudate nucleus or putamen of the striatum), the spinal cord and neuromuscular junction, or the cerebellar lobule using a needle, catheter, or related device, using neurosurgical techniques known in the art, such as by stereotactic injection (see, for example, Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000). In some embodiments, the rAAV described in this disclosure is administered by intravenous injection. In some embodiments, rAAV is administered by intracerebral injection. In some embodiments, rAAV is administered by intrathecal injection. In some embodiments, rAAV is administered by intrastriatal injection. In some embodiments, rAAV is delivered by intracranial injection.In some embodiments, the rAAV is delivered by cisternal magna injection. In some embodiments, the rAAV is delivered by lateral ventricle injection.
[0189] Aspects of the present disclosure relate to compositions comprising a recombinant AAV comprising a capsid protein and a nucleic acid encoding a transgene, wherein the transgene comprises a nucleic acid sequence encoding one or more miRNAs. In some embodiments, each miRNA comprises a sequence set forth in any one of SEQ ID NOS: 1-24. In some embodiments, the nucleic acid further comprises AAV ITRs. In some embodiments, the ITRs are those of AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or AAVrhlO. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. Compositions of the present disclosure may comprise rAAV alone or in combination with one or more other viruses (e.g., a second rAAV encoding one or more different transgenes). In some embodiments, the composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAVs, each carrying one or more different transgenes.
[0190] Suitable carriers can be easily selected by those skilled in the art, taking into consideration the indications that rAAV is intended for.For example, one suitable carrier includes saline, and can be formulated with various buffer solutions (for example, phosphate-buffered saline).Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water.The selection of carriers is not a limitation of the present disclosure.
[0191] Optionally, the compositions of the present disclosure may contain other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers, in addition to the rAAV and carrier(s). Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.
[0192] rAAV is administered in an amount sufficient to transfect the cells of desired tissue, and to bring about sufficient level of gene transfer and expression without excessive adverse effects.Traditional and pharmaceutically acceptable administration routes include but are not limited to direct delivery to selected organ (for example, intraportal delivery to the liver), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral and other parenteral administration routes.If desired, administration routes can be combined.
[0193] The dose of rAAV virions required to achieve a particular "therapeutic effect," e.g., dosage units in genome copies per kilogram of body weight (GC / kg), will vary based on several factors, including, but not limited to, the route of administration of the rAAV virions, the gene or RNA expression level required to achieve the therapeutic effect, the specific disease or injury being treated, and the stability of the gene or RNA product. One of skill in the art can readily determine the dose range of rAAV virions for treating a patient with a particular disease or disorder based on these and other factors well known in the art.
[0194] The effective amount of rAAV is sufficient to target animals, infect animals, and target desired tissue.In some embodiments, the effective amount of rAAV is sufficient to generate stable somatic transgenic animal models.Effective amount mainly depends on factors such as the species, age, weight, health, and tissue of the target subject, and therefore may vary between animals and tissues.For example, the effective amount of rAAV is generally about 10 9 ~10 16 In some cases, the volume of the solution ranges from about 1 ml to about 100 ml, containing about 10 genome copies. 11 ~10 13 A dosage of between 10 and 10 rAAV genome copies is appropriate. In certain embodiments, 12 or 10 13 rAAV genome copies are effective in targeting CNS tissues. In some cases, stable transgenic animals are generated with multiple doses of rAAV.
[0195] In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar day (e.g., a 24-hour period). In some embodiments, a dose of rAAV is administered to a subject no more than once per 2, 3, 4, 5, 6, or 7 calendar days. In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar week (e.g., 7 calendar days). In some embodiments, a dose of rAAV is administered to a subject no more than once every two weeks (e.g., once in a two-calendar-week period). In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar month (e.g., once every 30 calendar days). In some embodiments, a dose of rAAV is administered to a subject no more than once per six calendar months. In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar year (e.g., 365 days or 366 days in a leap year).
[0196] In some embodiments, the rAAV composition may be present in a particularly high concentration of rAAV (e.g., -10 per ml). 13The composition is formulated to reduce aggregation of AAV particles in the composition when the rAAV is present in a medium containing 1 or more GCs. Methods for reducing aggregation of rAAV are well known in the art and include, for example, adding surfactants, adjusting pH, adjusting salt concentrations, etc. (See, for example, Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the contents of which are incorporated herein by reference).
[0197] The formulation of pharmaceutically acceptable excipients and carrier solutions is well known to those skilled in the art, as is the development of suitable administration and treatment regimens for use with the particular compositions described herein in various treatment regimens.
[0198] Typically, these preparations may contain at least about 0.1% or more of the active compound, but the percentage of the active ingredient may, of course, vary, and may conveniently be between about 1% or 2% and about 70% or 80% or more by weight or volume of the total formulation. Naturally, the amount of active compound in each therapeutically useful composition can be adjusted so that a suitable dosage is obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations are taken into account by those skilled in the art of preparing such pharmaceutical preparations, and thus, various dosage and treatment regimens may be desirable.
[0199] In certain circumstances, it is desirable to deliver the rAAV-based therapeutic construct in a suitably formulated pharmaceutical composition disclosed herein subcutaneously, intrapancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, or by inhalation. In some embodiments, rAAV can be delivered using the administration modalities described in U.S. Patent Nos. 5,543,158; 5,641,515 and 5,399,363 (each of which is specifically incorporated herein by reference in its entirety). In some embodiments, the preferred mode of administration is via portal vein injection.
[0200] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions may be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations contain preservatives to prevent the growth of microorganisms. In many cases, the form is sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and / or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Protection against the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it is preferable to include an isotonic agent, for example, sugar or sodium chloride. Prolonged absorption of injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0201] For administration of injectable aqueous solutions, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, sterile aqueous media that can be used are known to those skilled in the art. For example, a single dose can be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermic infusion fluid or injected at the proposed site of injection (see, e.g., "Remington's Pharmaceutical Sciences," 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.
[0202] Sterile injectable solution is prepared by mixing active rAAV with various other ingredients listed herein in the required amount in a suitable solvent, and then, if necessary, sterilize by filtration.Generally, dispersion is prepared by mixing various sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and other ingredients required from those listed above.For the preparation of sterile powder for sterile injectable solution, the preferred preparation method is vacuum drying and freeze-drying technology, which obtains powder of active ingredient and any additional desired ingredients from its previously sterile-filtered solution.
[0203] The rAAV compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the protein), which are formed with inorganic acids such as, for example, hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, and the like. Salts formed with free carboxyl groups may also be derived from inorganic bases such as, for example, sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, and the like. Once formulated, solutions are administered in a manner compatible with the dosage formulation and in such an amount that is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as injectable solutions, drug-release capsules, and the like.
[0204] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspending agents, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients may also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host.
[0205] Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. may be used for the introduction of the compositions of the present disclosure into suitable host cells. In particular, transgenes delivered by rAAV vectors may be formulated for delivery either encapsulated in lipid particles, liposomes, vesicles, nanospheres, nanoparticles, etc.
[0206] Such formulations may be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids or rAAV constructs disclosed herein. The formation and use of liposomes are generally known to those skilled in the art. Recently, liposomes with improved serum stability and circulation half-life have been developed (U.S. Patent No. 5,741,516). Furthermore, various methods for preparing liposomes and liposome-like preparations as potential drug carriers have been described (U.S. Patent Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).
[0207] Liposomes have been successfully used with several cell types that are normally resistant to transfection by other procedures. Furthermore, liposomes do not have the DNA length constraints typical of viral delivery systems. Liposomes have been effectively used to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors, and allosteric effectors into various cultured cell lines and animals. Furthermore, several successful clinical trials investigating the efficacy of liposome-mediated drug delivery have been completed.
[0208] Liposomes are formed from phospholipids dispersed in an aqueous medium, spontaneously forming multilamellar concentric bilayer vesicles (also called multilamellar vesicles (MLVs)). MLVs generally have diameters between 25 nm and 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 Å, which contain an aqueous liquid drug within their core.
[0209] Alternatively, nanocapsule formulations of rAAV may be used. Nanocapsules can generally entrap substances in a stable and reproducible manner. To avoid side effects due to intracellular polymer overload, such ultrafine particles (approximately 0.1 μm in size) should be designed using polymers that can be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.
[0210] In addition to the above delivery methods, the following techniques are also contemplated as alternative methods for delivering rAAV compositions to a host: Sonophoresis (i.e., ultrasound) has been used as a device to enhance the rate and efficiency of drug penetration into and through the circulatory system and is described in U.S. Patent No. 5,656,016. Other contemplated drug delivery options are intraosseous injection (U.S. Patent No. 5,779,708), microchip devices (U.S. Patent No. 5,797,898), ophthalmic formulations (Bourlais et al., 1998), transdermal matrices (U.S. Patent Nos. 5,770,219 and 5,783,208), and feedback-controlled delivery (U.S. Patent No. 5,697,899).
[0211] In some embodiments, the methods described herein relate to treating a subject who has or has been diagnosed with Huntington's disease with the nucleic acid described herein. A subject who has Huntington's disease can be identified by a physician using current methods for diagnosing Huntington's disease. Symptoms and / or complications of Huntington's disease that characterize these conditions and aid in diagnosis are well known in the art and include, but are not limited to, depression and anxiety, and are accompanied by characteristic movement disorders and chorea. Tests that can aid in the diagnosis of Huntington's disease include, for example, but are not limited to, genetic testing. A family history of Huntington's disease can also be helpful in determining whether a subject is prone to have Huntington's disease or in making a diagnosis of Huntington's disease.
[0212] The compositions and methods described herein can be administered to a subject who has or has been diagnosed with Huntington's disease. In some embodiments, the methods described herein include administering an effective amount of a composition described herein, e.g., a nucleic acid described herein, to a subject to alleviate symptoms of Huntington's disease. As used herein, "alleviating symptoms of Huntington's disease" refers to improving any condition or symptom associated with Huntington's disease. When compared to an equivalent untreated control, such reduction can be at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more, as measured by any standard technique.
[0213] The effective amount, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the minimum effective dose and / or maximum tolerated dose. The dosage can vary depending on the dosage form used and the route of administration utilized. The therapeutically effective dose can be initially estimated from cell culture assays. The dose can also be formulated in animal models to achieve a dosage range between the minimum effective dose and the maximum tolerated dose. The effect of any particular dosage can be monitored by suitable bioassays, for example, assays for tumor growth and / or size, among others. The dosage can be determined by a physician and, if necessary, adjusted according to the observed effects of treatment.
[0214] Provided herein are in vitro and animal model assays that allow for the evaluation of a given dose of an isolated nucleic acid described herein (e.g., at least one of SEQ ID NOs: 1-24), or a recombinant AAV (rAAV) comprising a given dose of an isolated nucleic acid described herein (see, e.g., Figures 4, 9, 15).As a non-limiting example, the efficacy of a dose of the isolated nucleic acid or rAAV described herein can be determined in vivo by any one of the following methods: The present invention can be evaluated in vitro by: (1) co-transfecting an isolated nucleic acid (e.g., a plasmid comprising at least one of SEQ ID NOs: 1-24) and a target sequence (e.g., an HTT target sequence associated with luciferase expression) into cells (e.g., 293 cells) and measuring the concentration and / or activity of the target (see, e.g., Figures 7, 8B, and 16-18); (2) infecting cells (e.g., human neuronal U87 cells) with an rAAV (e.g., AAVRH10) expressing an isolated nucleic acid (e.g., at least one of SEQ ID NOs: 1-24 operably linked to a constitutive promoter such as a CMV promoter) and an rAAV expressing a target sequence (e.g., an HTT target sequence associated with luciferase expression) and measuring the concentration and / or activity of the target (see, e.g., Figures 10, 11A-11B); (3) infecting cells expressing HTT (e.g., human neuronal U87 cells or human lung fibroblasts derived from HD patients). (4) infecting cells expressing HTT (e.g., human neuronal cells U87 or human lung fibroblasts derived from HD patients) with rAAV (e.g., AAVRH10) expressing an isolated nucleic acid (e.g., at least one of SEQ ID NOs: 1-24 operably linked to a constitutive promoter such as a CMV promoter) and measuring the concentration and / or activity of HTT protein and / or mRNA (see, e.g., Figures 12-14, 20-21); or (5) infecting cells expressing HTT (e.g., human neuronal cells U87 or human lung fibroblasts derived from HD patients) with rAAV (e.g., AAVRH10) expressing an isolated nucleic acid (e.g., at least one of SEQ ID NOs: 1-24 operably linked to a neuron-specific promoter such as hSyn1, where the rAAV optionally further expresses a transgene encoding a protein such as CYP46A1) and measuring the concentration and / or activity of HTT protein and / or mRNA (see, e.g., Figures 4, 9, 15).
[0215] The effectiveness of the isolated nucleic acid or rAAV described herein can also be evaluated in animal models, such as mouse models that express HTT protein.For example, the following HTT mouse models can be used according to the desired HTT target (see, for example, Table 3): Hu128; B6CBA-R6 / 2 (CAG 120 + / - 5); B6CBA-Tg (HD exon 1) 62 Gpb / 3J; B6CBA-R6 / 2 (CAG 160 + / - 5); or B6CBA-Tg (HD exon 1) 62 Gpb / 1J. As a non-limiting example, a mouse model described herein is infected with an rAAV (e.g., AAVRH10) expressing an isolated nucleic acid (e.g., at least one of SEQ ID NOs: 1-24 operably linked to a neuron-specific promoter such as hSyn1, where the rAAV optionally further expresses a transgene encoding a protein such as CYP46A1), and HTT protein and / or mRNA levels and / or activity and / or disease pathogenesis are measured in the mice. See, e.g., Figures 4, 9, 15. vector
[0216] In some embodiments, one or more of the miRNAs described herein are expressed in a recombinant expression vector or plasmid. As used herein, the term "vector" refers to a polynucleotide sequence suitable for transferring a transgene into a host cell. The term "vector" includes plasmids, minichromosomes, phages, naked DNA, etc. For example, see U.S. Patent Nos. 4,980,285; 5,631,150; 5,707,828; 5,759,828; 5,888,783; and 5,919,670, and Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Press (1989). One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments are ligated. Another type of vector is a viral vector, in which additional DNA segments are ligated into a viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors." In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. As used herein, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
[0217] A cloning vector is a vector that can replicate autonomously or integrate into the genome of a host cell, and is further characterized by one or more endonuclease restriction sites, at which the vector can be cut in a determinable manner, and the desired DNA sequence can be ligated so that the new recombinant vector retains its ability to replicate in the host cell. In the case of a plasmid, the replication of the desired sequence can occur multiple times, so that the plasmid increases its copy number in a host cell, such as a host bacterium, or can occur only once per host before the host reproduces by mitosis. In the case of a phage, replication can occur actively during the lytic phase, or passively during the lysogenic phase.
[0218] An expression vector is a vector into which a desired DNA sequence can be inserted by restriction and ligation, so that it is operably linked to regulatory sequences and can be expressed as an RNA transcript. A vector can further contain one or more marker sequences suitable for use in identifying cells transformed, transformed, or transfected with the vector, or cells that have not been transformed, transformed, or transfected. Markers include, for example, genes encoding proteins that increase or decrease resistance or sensitivity to antibiotics or other compounds, genes encoding enzymes whose activity can be detected by standard assays known in the art (e.g., β-galactosidase, luciferase, or alkaline phosphatase), and genes that visually affect the phenotype of transformed or transfected cells, hosts, colonies, or plaques (e.g., green fluorescent protein). In certain embodiments, the vectors used herein are capable of autonomous replication and expression of structural gene products present in the DNA segments to which they are operably linked.
[0219] As used herein, a coding sequence and a regulatory sequence are said to be "operably" linked when they are covalently linked in such a way that the expression or transcription of the coding sequence is under the influence or control of the regulatory sequence. If it is desired that the coding sequence be translated into a functional protein, two DNA sequences are said to be operably linked if induction of a promoter in the 5' regulatory sequence results in transcription of the coding sequence, and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frameshift mutation, (2) interfere with the ability of the promoter region to direct transcription of the coding sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region is operably linked to a coding sequence if the promoter region is capable of effecting transcription of that DNA sequence so that the resulting transcript can be translated into the desired protein or polypeptide.
[0220] When a nucleic acid molecule encoding any of the polypeptides described herein is expressed in a cell, various transcription control sequences (e.g., promoter / enhancer sequences) can be used to direct its expression. The promoter can be a native promoter, i.e., the promoter of a gene in its endogenous context, which normally regulates the expression of the gene. In some embodiments, the promoter can be constitutive, i.e., the promoter is not regulated and allows continuous transcription of its associated gene. Various conditional promoters can also be used, e.g., promoters controlled by the presence or absence of a molecule.
[0221] The exact nature of the regulatory sequences required for gene expression may vary between species or cell types, but generally, they may include, if necessary, 5' non-transcribed and 5' non-translated sequences involved in initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, etc. In particular, such 5' non-transcribed regulatory sequences include promoter regions containing promoter sequences for transcriptional control of operably linked genes. Regulatory sequences may also include enhancer sequences or upstream activator sequences, if desired. Vectors of the present invention may also include 5' leader or signal sequences, as needed. The selection and design of appropriate vectors is within the ability and discretion of one skilled in the art.
[0222] Expression vectors containing all the elements necessary for expression are commercially available and known to those skilled in the art.See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989.Cells are genetically engineered by introducing heterologous DNA (RNA) into the cell.This heterologous DNA (RNA) is placed under the operable control of transcription elements that allow the expression of the heterologous DNA in the host cell.
[0223] In some embodiments, the vector is an adeno-associated virus (AAV) or a recombinant AAV.
[0224] In some embodiments of any of the aspects, the vector is pEMBL. In some embodiments of any of the aspects, the vector is pEMBL-D(+)Syn1. In some embodiments of any of the aspects, the vector is pEMBL-D(+)Syn1-hCG intron only. In some embodiments of any of the aspects, the vector is pEMBL-D(+)Syn1-hCGin-2x control pre-miR. In some embodiments of any of the aspects, the vector is pEMBL-D(+)Syn1-hCGin-2x artificial pre-miR. In some embodiments of any of the aspects, the vector is pEMBL-D(+)Syn1-CYP46A1-hCGin-2x artificial pre-miR. In some embodiments of any of the aspects, the vector is pEMBL-D(+)Syn1-luc-HTT-3'UTR / mutant.
[0225] In some embodiments of any of the aspects, the vector or isolated nucleic acid described herein comprises at least one of the following: at least one (e.g., two) ITRs; a Syn1 promoter (see, e.g., SEQ ID NOs: 31-32); at least one (e.g., two) hCG intron (see, e.g., SEQ ID NO: 34); at least one (e.g., two) copies of a premiR (see, e.g., SEQ ID NO: 35; e.g., a control premiR; an artificial premiR; at least one of SEQ ID NOs: 1-24); a small polyA (see, e.g., SEQ ID NO: 36); a CYP46A1 (see, e.g., SEQ ID NOs: 26-27); a luciferase (see, e.g., SEQ ID NOs: 28-29); and / or an HTT target sequence (see, e.g., SEQ ID NO: 30, e.g., an HTT-3'UTR / mutant). See, e.g., FIG. 1.
[0226] In some embodiments of any of the aspects, the isolated nucleic acid or vector described herein comprises CYP46A1. CYP46A1 is a member of the cytochrome P450 superfamily of enzymes. Cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and the synthesis of cholesterol, steroids, and other lipids. This endoplasmic reticulum protein is expressed in the brain, where it converts cholesterol to 24S-hydroxycholesterol. Although cholesterol cannot cross the blood-brain barrier, 24S-hydroxycholesterol can be secreted into circulation in the brain and returned to the liver for catabolism. In some embodiments of any of the aspects, CYP46A1 can include human CYP46A1 (see, e.g., NCBI Reference Nos. NG_007963.1 RefSeqGene Range 4881-47884; NM_006668.2; NP_006659.1; see, e.g., SEQ ID NOs: 26-27). CYP46A1, the rate-limiting enzyme for cholesterol degradation, is neuroprotective in Huntington's disease (see, e.g., Boussicault et al., CYP46A1, the rate-limiting enzyme for cholesterol degradation, is neuroprotective in Huntington's disease, Brain. 2016 Mar, 139(Pt 3):953-70; Kacher et al., CYP46A1 gene therapy deciphers the role of brain cholesterol metabolism in Huntington's disease, Brain. 2019 Aug 1;142(8):2432-2450, the contents of each of which are incorporated herein by reference in their entireties).
[0227] In some embodiments of any of the aspects, the transgene (e.g., CYP46A1) described herein comprises SEQ ID NO:27, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO:27, which maintains the same function as SEQ ID NO:27 (e.g., a therapeutic protein for HD).
[0228] In some embodiments of any of the aspects, the transgene described herein (e.g., CYP46A1) is encoded by a nucleic acid sequence comprising SEQ ID NO:26, or a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:26 and maintains the same function, or a codon-optimized version of SEQ ID NO:26.
[0229] SEQ ID NO:26, CYP46A1, 1503 nucleotides (nt) (see, e.g., Homo sapiens cytochrome P450 family 46 subfamily A member 1 (CYP46A1), mRNA, NCBI Reference Sequence: NM_006668.2) [ka]
[0230] SEQ ID NO: 27, CYP46A1, 500 amino acids (aa) (see, e.g., cholesterol 24-hydroxylase precursor (Homo sapiens), NCBI Reference Sequence: NP_006659.1)
[0231] [ka] [ka]
[0232] In some embodiments, one or more of the recombinantly expressed genes may be integrated into the genome of the cell.
[0233] In some embodiments of any of the aspects, the isolated nucleic acids or vectors described herein comprise at least one promoter. In some embodiments of any of the aspects, the promoter is a human Syn1 promoter. In some embodiments of any of the aspects, the promoters described herein (e.g., Syn1) comprise one of SEQ ID NOs: 31-32, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 31-32, or that maintains the same function as one of SEQ ID NOs: 31-32 (e.g., a tissue-specific promoter).
[0234] SEQ ID NO: 31, Syn1 promoter, 477 nt [ka]
[0235] SEQ ID NO: 32, Syn1 promoter, 448 nt [ka]
[0236] In some embodiments of any of the aspects, the promoter is a constitutive CMV promoter. In some embodiments of any of the aspects, a promoter (e.g., CMV) described herein comprises SEQ ID NO: 33, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO: 33 that maintains the same function as SEQ ID NO: 33 (e.g., a constitutive promoter).
[0237] SEQ ID NO: 33, CMV promoter [ka] [ka]
[0238] In some embodiments of any of the aspects, the isolated nucleic acids or vectors described herein comprise at least one intron. In some embodiments of any of the aspects, the intron is an hCG intron. In some embodiments of any of the aspects, the intron (e.g., an hCG intron) described herein comprises SEQ ID NO:34, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO:34, while maintaining the same function as SEQ ID NO:34. In some embodiments of any of the aspects, the isolated nucleic acids or vectors described herein comprise at least one (e.g., two) portions of SEQ ID NO:34, e.g., approximately nucleotides 1-100, 16-100, 114-635, and / or 122-635 of SEQ ID NO:34.
[0239] SEQ ID NO: 34, hCG intron, 635 nt (see, e.g., human chorionic gonadotropin (HCG) gene 6 beta subunit, GenBank: X00266.1) [ka]
[0240] In some embodiments of any of the aspects, the isolated nucleic acids or vectors described herein comprise a premiR that includes two copies of an artificial miRNA described herein (e.g., one of SEQ ID NOS: 1-24). In some embodiments of any of the aspects, the premiR described herein comprises SEQ ID NO: 35, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO: 35, while maintaining the same function as SEQ ID NO: 35 (e.g., expression of at least one miRNA). In some embodiments of any of the aspects, the isolated nucleic acids or vectors described herein comprise a portion of SEQ ID NO: 35, e.g., approximately nt 1-191, 1-199, 191-386, or 199-386 of SEQ ID NO: 35, such that one miRNA copy is expressed.
[0241] SEQ ID NO:35, 2x miHTT-H1; bold text indicates 5' flanking sequence (e.g., nt 1-65 or 199-260 of SEQ ID NO:35); italic text indicates miHTT passenger (e.g., nt 69-87 or 264-282 of SEQ ID NO:35; see, e.g., the reverse complement of SEQ ID NO:1, used as a non-limiting example; the reverse complement of any one of SEQ ID NOs:2-24 can be used in place of the reverse complement of SEQ ID NO:1 in SEQ ID NO:35); bold italic text indicates miR30a loop (e.g., italicized, double-underlined text indicates the miHTT guide strand (e.g., nt 107-126 or 302-321 of SEQ ID NO: 35; see, e.g., SEQ ID NO: 1, used as a non-limiting example; any one of SEQ ID NOs: 2-24 can be used in place of SEQ ID NO: 1 in SEQ ID NO: 35); and bold, double-underlined text indicates the 3' flanking sequence (e.g., nt 130-191 or 325-386 of SEQ ID NO: 35). [ka]
[0242] In some embodiments of any of the aspects, an isolated nucleic acid or vector described herein comprises a polyadenylation region (e.g., a small poly A). In some embodiments of any of the aspects, the poly A described herein comprises SEQ ID NO: 36, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO: 36, which maintains the same function (e.g., polyadenylation) as SEQ ID NO: 36.
[0243] SEQ ID NO: 36, small poly A, 54 nt; [ka]
[0244] In some embodiments of any of the aspects, an isolated nucleic acid or vector described herein (e.g., used to test a miRNA described herein) comprises luciferase as a reporter. In some embodiments of any of the aspects, the reporter (e.g., luciferase) described herein comprises SEQ ID NO:29, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO:29, and that maintains the same function as SEQ ID NO:29 (e.g., luciferase activity and luminescence).
[0245] In some embodiments of any of the aspects, the reporter (e.g., luciferase) described herein is encoded by a nucleic acid sequence comprising SEQ ID NO:28, or a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:28 and maintains the same function, or a codon-optimized version of SEQ ID NO:28.
[0246] SEQ ID NO: 28, luciferase nucleic acid, 1653 nt [ka]
[0247] SEQ ID NO: 29, luciferase protein, 550 aa [ka] [ka]
[0248] In some embodiments of any of the aspects, an isolated nucleic acid or vector described herein (e.g., used to test the miRNAs described herein) comprises an HTT target sequence (i.e., a short nucleic acid sequence derived from the HTT gene). In some embodiments of any of the aspects, the HTT target sequence described herein comprises SEQ ID NO: 30, or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO: 30, while maintaining the same function as SEQ ID NO: 30 (e.g., targeting or testing the miRNAs described herein).
[0249] SEQ ID NO: 30, HTT target sequence (e.g., HTT-3'UTR / mutant), 417 nt [ka]
[0250] Nucleic acid molecules encoding the enzymes of the claimed invention can be introduced into a cell(s) using methods and techniques that are standard in the art. For example, the nucleic acid molecules can be introduced by standard protocols such as transformation, including chemical transformation and electroporation, transduction, particle bombardment, etc. Expression of nucleic acid molecules encoding the enzymes of the claimed invention can also be achieved by integrating the nucleic acid molecules into the genome. kit
[0251] In some embodiments, the agents described herein may be assembled into pharmaceutical, diagnostic, or research kits to facilitate their use in therapeutic, diagnostic, or research applications. The kits may include one or more containers housing the components of the present disclosure and instructions for use. Specifically, such kits may include one or more agents described herein, along with instructions describing the intended application and the appropriate use of these agents. In certain embodiments, the agents in the kits may be in pharmaceutical formulations and may be in dosages suitable for the particular application and method of administration of the agents. Kits for research purposes may contain components in concentrations or amounts appropriate for conducting various experiments.
[0252] In some embodiments, the disclosure relates to a kit for producing rAAV, the kit comprising a container housing an isolated nucleic acid comprising or encoded by a miRNA comprising a sequence set forth in any one of SEQ ID NOs: 1-24. In some embodiments, the kit further comprises a container housing an isolated nucleic acid encoding an AAV capsid protein, e.g., an AAV9 or AAVrh10 capsid protein.
[0253] The kit may be designed to facilitate use of the methods described herein by researchers and may take many forms. Each of the components of the kit may be provided in liquid form (e.g., in solution) or solid form (e.g., dry powder), as appropriate. In certain cases, portions of the composition may be configurable or otherwise processable (e.g., into an active form), for example, by adding a suitable solvent or other species (e.g., water or cell culture medium) (which may or may not be provided with the kit). As used herein, "instructions" can define instructional and / or promotional components, and typically refers to written instructions on or associated with the packaging of the present disclosure. Instructions can also include any oral or electronic instructions provided in any manner that clearly identifies the user to the kit, for example, via audiovisual communication (e.g., videotape, DVD, etc.), internet communication, and / or web-based communication, etc. The written instructions may be in a form prescribed by a government agency regulating the manufacture, use, or sale of pharmaceutical or biological products, and the instructions may also reflect approval by the agency for manufacture, use, or sale for administration to animals.
[0254] The kit may contain any one or more of the components described herein in one or more containers. By way of example, in one embodiment, the kit may include instructions for mixing one or more components of the kit and / or isolating and mixing a sample and applying to a subject. The kit may include a container housing an agent described herein. The agent may be in liquid, gel, or solid (powder) form. The agent may be prepared sterilely, packaged in a syringe, and shipped refrigerated. Alternatively, the agent may be housed in a vial or other container for storage. A second container may have another agent prepared sterilely. Alternatively, the kit may include an active agent premixed and shipped in a syringe, vial, tube, or other container.
[0255] Exemplary embodiments of the present invention are described in more detail by the following examples. These embodiments are illustrative of the present invention, and those skilled in the art will recognize that the present invention is not limited to the exemplary embodiments. immune modulators
[0256] In some embodiments, the methods and compositions described herein further comprise administering an immune modulator. In some embodiments, the immune modulator may be administered at the time of, before, or after administration. If the subject is re-administered with at least a second dose of the composition, the immune modulator may be administered before, with, or after at least the second dose.
[0257] In some embodiments, the immune modulator is an immunoglobulin-degrading enzyme such as IdeS, IdeZ, IdeS / Z, Endo S, or a functional variant thereof. Non-limiting examples of references to such immunoglobulin-degrading enzymes and their uses are described in US 7,666,582, US 8,133,483, US20180037962, US20180023070, US20170209550, US 8,889,128, WO2010 / 057626, US 9,707,279, US 8,323,908, US20190345533, US20190262434, and WO2020 / 016318, each of which is incorporated by reference in its entirety.
[0258] In some embodiments, the immunomodulator is a proteasome inhibitor.In certain aspects, the proteasome inhibitor is bortezomib.In some aspects of the embodiment, the immunomodulator comprises bortezomib and anti-CD20 antibody rituximab.In other aspects of the embodiment, the immunomodulator comprises bortezomib, rituximab, methotrexate, and intravenous gamma globulin.Non-limiting examples of such references that disclose proteasome inhibitors and their combination with rituximab, methotrexate, and intravenous gamma globulin are described in US10,028,993, US9,592,247, and US8,809,282, each of which is incorporated by reference in its entirety.
[0259] In alternative embodiments, the immunomodulator is an inhibitor of the NF-kB pathway. In certain aspects of the embodiment, the immunomodulator is rapamycin or a functional variant. Non-limiting examples of references disclosing rapamycin and its uses are set forth in US 10,071,114, US 20160067228, US 20160074531, US 20160074532, US 20190076458, and US 10,046,064, which are incorporated in their entirety. In other aspects of the embodiment, the immunomodulator is a synthetic nanocarrier comprising an immunosuppressant. US20150320728, US20180193482, US20190142974, US20150328333, US20160243253, US10,039,822, US20190076522, US20160022650, US10,441,651, US10,420,835, US20150320870, US2014035636, US10,434,088, US10,335,395, U Non-limiting examples of references for immunosuppressants, immunosuppressants linked to synthetic nanocarriers, synthetic nanocarriers comprising rapamycin, and / or tolerogenic synthetic nanocarriers, their dosages, administration, and uses are described in: S20200069659, US10,357,483, US20140335186, US10,668,053, US10,357,482, US20160128986, US20160128987, US20200038462, US20200038463.
[0260] In some embodiments, the immune modulator is a synthetic nanocarrier comprising rapamycin (ImmTOR™ nanoparticles) disclosed in US20200038463, US Patent No. 9,006,254 (Kishimoto, et al., 2016, Nat Nanotechnol, 11(10): 890-899; Maldonado, et al., 2015, PNAS, 112(2): E156-165), each of which is incorporated herein by reference in its entirety. In some embodiments, the immune modulator is an engineered cell, for example, an immune cell modified using SQZ technology as disclosed in WO2017192786, which is incorporated herein by reference in its entirety.
[0261] In some embodiments, the immune modulator is poly-ICLC, 1018 ISS, aluminum salts, Amplivax, AS15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, JuvImmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide In another further embodiment, the immune modulator or adjuvant is selected from the group consisting of ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PEPTEL, vector systems, PLGA microparticles, resiquimod, SRL172, virosomes and other virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, and Aquila's QS21 stimulon.
[0262] In some embodiments, the immune modulator is a small molecule that inhibits the innate immune response in cells, such as chloroquine (a TLR signaling inhibitor) and 2-aminopurine (a PKR inhibitor), and can also be administered in combination with a composition comprising at least one rAAV as disclosed herein. Some non-limiting examples of commercially available TLR signaling inhibitors include BX795, chloroquine, CLI-095, OxPAPC, polymyxin B, and rapamycin (all available from INVIVOGEN™). Additionally, inhibitors of pattern recognition receptors (PRRs) (involved in innate immune signaling), such as 2-aminopurine, BX795, chloroquine, and H-89, can also be used in the compositions and methods comprising at least one rAAV vector as disclosed herein for in vivo protein expression.
[0263] In some embodiments, rAAV vectors having modified viral capsids may also encode negative regulators of innate immunity, such as NLRX1. Thus, in some embodiments, rAAV vectors may also optionally encode one or more of NLRX1, NS1, NS3 / 4A, or A46R, or any combination thereof. Furthermore, in some embodiments, compositions comprising at least one rAAV vector disclosed herein may also include synthetic, modified RNA encoding an inhibitor of the innate immune system to avoid an innate immune response generated by a tissue or subject.
[0264] In some embodiments, the immune modulator for use in the administration methods disclosed herein is an immunosuppressant. As used herein, the term "immunosuppressant drug or immunosuppressant" is intended to include pharmaceutical agents that inhibit or interfere with normal immune function. Examples of immunosuppressants suitable for the methods disclosed herein include agents that inhibit the T cell / B cell costimulatory pathway, such as agents that interfere with T cell and B cell coupling via the CTLA4 and B7 pathways, as disclosed in U.S. Patent Publication No. 2002 / 0182211. In one embodiment, the immunosuppressant is cyclosporine A. Other examples include myophenylate mofetil, rapamycin, and antithymocyte globulin. In one embodiment, the immunosuppressant is administered in a composition comprising at least one rAAV vector disclosed herein or in a separate composition, but may be administered simultaneously with, before, or after administration of a composition comprising at least one rAAV vector according to the administration methods disclosed herein. The immunosuppressant is administered to a subject in a formulation compatible with the route of administration and at a dosage sufficient to achieve the desired therapeutic effect, hi some embodiments, the immunosuppressant is administered transiently for a time sufficient to induce tolerance to the rAAV vectors disclosed herein.
[0265] In any of the embodiments of the methods and compositions disclosed herein, the subject receiving the composition disclosed herein is also administered an immunosuppressant. Various methods are known for immunosuppressing the immune response of a patient receiving AAV. Methods known in the art include administering an immunosuppressant, such as a proteasome inhibitor, to the patient. For example, one such proteasome inhibitor known in the art is bortezomib, disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15 / 796,137, both of which are incorporated herein by reference. In some embodiments, the immunosuppressant can be an antibody, including a polyclonal antibody, a monoclonal antibody, an SCFV or other antibody-derived molecule, which can suppress the immune response, for example, by eliminating or suppressing antibody-producing cells. In further embodiments, the immunosuppressant element can be a short hairpin RNA (shRNA). In such embodiments, the coding region for the shRNA is included in the rAAV cassette and is generally located 3' downstream of the polyA tail. shRNAs can be targeted to reduce or eliminate expression of immune stimulators such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF, and others known).
[0266] The use of such immune modulating agents facilitates the ability of one to use multiple dosing (e.g., multiple administrations) over a period of months and / or years, thereby allowing for the use of multiple agents, e.g., multiple genes encoding rAAV vectors, as discussed below, or multiple administrations to a subject.
[0267] Exemplary embodiments of the present invention are described in more detail by the following examples. These embodiments are illustrative of the present invention, and those skilled in the art will recognize that the present invention is not limited to the exemplary embodiments. definition
[0268] For convenience, the meanings of some terms and phrases used in the specification, examples, and appended claims are provided below. Unless otherwise stated or implied from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments and are not intended to limit the claimed invention, as the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided herein shall control.
[0269] For convenience, certain terms used herein in the specification, examples, and appended claims are collected here.
[0270] The terms "reduce," "reduce," "reduction," or "inhibit" are all used herein to mean a statistically significant reduction. In some embodiments, "reduce," "reduction," "reduce," or "inhibit" typically refers to a reduction of at least 10% compared to a reference level (e.g., the absence of a given treatment or agent), and may include, for example, a reduction of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or greater. As used herein, "reduction" or "inhibition" does not encompass complete inhibition or reduction compared to a reference level. "Complete inhibition" is 100% inhibition compared to a reference level. Reduction may be preferred to a level that is accepted as within the normal range for an individual without the given disorder.
[0271] The terms "increased," "increase," "enhance," or "activate" are all used herein to mean an increase by a statistically significant amount. In some embodiments, the terms "increased," "increase," "enhance," or "activate" can mean an increase of at least 10% compared to a reference level, e.g., an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% compared to a reference level, or an increase of up to 100% (including 100%), or any increase between 10 and 100%, or an increase of at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold, or any increase between 2-fold and 10-fold or more compared to a reference level. In the context of a marker or symptom, an "increase" is a statistically significant increase in such level.
[0272] As used herein, "subject" refers to a human or an animal. Typically, an animal is a vertebrate such as a primate, a rodent, a domestic animal, or a game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, such as rhesus monkeys. Rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. Domestic and game animals include cattle, horses, pigs, deer, bison, buffalo, feline species, such as domestic cats, canine species, such as dogs, foxes, wolves, avian species, such as chickens, emus, ostriches, and fish, such as trout, catfish, and salmon. In some embodiments, the subject is a mammal, such as a primate, for example, a human. The terms "individual," "patient," and "subject" are used interchangeably herein.
[0273] Preferably, the subject is a mammal. The mammal may be, but is not limited to, a human, a non-human primate, a mouse, a rat, a dog, a cat, a horse, or a cow. Non-human mammals can be advantageously used as subjects representing animal models of Huntington's disease. The subject may be male or female.
[0274] The subject may be a subject who has previously been diagnosed with, confirmed to have, or has a condition requiring treatment (e.g., Huntington's disease) or one or more complications associated with such a condition, and may, if necessary, have already received treatment for Huntington's disease or one or more complications associated with Huntington's disease. Alternatively, the subject may not have previously been diagnosed with Huntington's disease or one or more complications associated with Huntington's disease. For example, the subject may be a subject who exhibits one or more risk factors for Huntington's disease or one or more complications associated with Huntington's disease, or a subject who does not exhibit risk factors.
[0275] A "subject in need" of treatment for a particular condition may be a subject who has the condition, has been diagnosed with the condition, or is at risk of developing the condition.
[0276] As used herein, the terms "protein" and "polypeptide" are used interchangeably to refer to a series of amino acid residues connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. The terms "protein" and "polypeptide" refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of their size or function. "Protein" and "polypeptide" are often used in reference to relatively large polypeptides, while the term "peptide" is often used in reference to small polypeptides, but the use of these terms overlaps in the art. The terms "protein" and "polypeptide" are used interchangeably herein when referring to gene products and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.
[0277] A variant amino acid or DNA sequence may be at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to a native or reference sequence. The degree of homology (percent identity) between a native and a variant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly used for this purpose on the World Wide Web (e.g., BLASTp or BLASTn with default settings).
[0278] Alterations to native amino acid sequences can be achieved by any of several techniques known to those skilled in the art. Mutations can be introduced at specific loci, for example, by synthesizing oligonucleotides containing mutant sequences flanked by restriction sites that allow ligation to fragments of the native sequence. After ligation, the resulting reconstructed sequence encodes an analog with the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be used to create altered nucleotide sequences with specific codons altered by the required substitution, deletion, or insertion. Techniques for making such modifications are well established and include, for example, those disclosed in Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and U.S. Patent Nos. 4,518,584 and 4,737,462, which are incorporated herein by reference in their entirety. Any cysteine residue not involved in maintaining the proper conformation of the polypeptide can also be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant cross-linking. Conversely, cysteine bond(s) can be added to a polypeptide to improve its stability or facilitate oligomerization.
[0279] As used herein, the term "nucleic acid" or "nucleic acid sequence" refers to any molecule, preferably a polymeric molecule, that incorporates units of ribonucleic acid, deoxyribonucleic acid, or analogs thereof. Nucleic acid may be single-stranded or double-stranded. A single-stranded nucleic acid may be one nucleic acid strand of denatured double-stranded DNA. Alternatively, it may be a single-stranded nucleic acid that is not derived from any double-stranded DNA. In one embodiment, the nucleic acid may be DNA. In another embodiment, the nucleic acid may be RNA. Suitable DNA may include, for example, genomic DNA or cDNA. Suitable RNA may include, for example, mRNA, miRNA.
[0280] In some embodiments of any of the aspects, the polypeptides, nucleic acids, or cells described herein may be engineered. As used herein, "engineered" refers to aspects that have been manipulated by human hands. For example, a polypeptide is considered to be "engineered" if at least one aspect of the polypeptide, such as its sequence, has been manipulated by human hands so that it differs from its naturally occurring form. As is common practice and understood by those skilled in the art, the progeny of an engineered cell is typically still referred to as "engineered," even if actual manipulation was performed in the previous instance.
[0281] In some embodiments of any of the aspects, the miRNAs described herein are exogenous. In some embodiments of any of the aspects, the miRNAs described herein are ectopic. In some embodiments of any of the aspects, the miRNAs described herein are not endogenous.
[0282] The term "exogenous" refers to a substance present in a cell other than its native source. As used herein, the term "exogenous" can refer to a nucleic acid (e.g., a nucleic acid encoding a polypeptide) or polypeptide that is not normally found and that has been introduced by a process involving the hand of man into a biological system, such as a cell or organism, where one wishes to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, "exogenous" can refer to a nucleic acid or polypeptide that is only found in relatively low amounts and that has been introduced by a process involving the hand of man into a biological system, such as a cell or organism, where one wishes to increase the amount of the nucleic acid or polypeptide in the cell or organism, e.g., create ectopic expression or levels. In contrast, the term "endogenous" refers to a substance that is native to a biological system or cell. As used herein, "ectopic" refers to a substance that is found in an unusual location and / or amount. An ectopic substance can be a substance that is normally found in a given cell, but only in very low amounts and / or at a different time. Ectopic also includes a substance, such as a polypeptide or nucleic acid, that is not found in nature or expressed within a given cell in its natural environment.
[0283] In some embodiments, the nucleic acid encoding the inhibitory RNA described herein (e.g., SEQ ID NOS: 1-24) is contained by a vector. In some aspects described herein, a nucleic acid sequence encoding a given polypeptide described herein, or any module thereof, is operably linked to a vector. The term "vector," as used herein, refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector may be a viral or non-viral vector. The term "vector" encompasses any genetic element that, when associated with the appropriate control elements, is capable of replication and transfer of gene sequences into a cell. Vectors may include, but are not limited to, cloning vectors, expression vectors, plasmids, phages, transposons, cosmids, chromosomes, viruses, virions, etc.
[0284] In some embodiments of any of the aspects, the vector is a recombinant vector, e.g., it comprises sequences originating from at least two different sources. In some embodiments of any of the aspects, the vector comprises sequences originating from at least two different species. In some embodiments of any of the aspects, the vector comprises sequences originating from at least two different genes, e.g., it comprises a nucleic acid encoding a fusion protein or expression product operably linked to at least one non-native (e.g., heterologous) genetic control element (e.g., promoter, suppressor, activator, enhancer, response element, etc.).
[0285] In some embodiments of any of the aspects, the vectors or nucleic acids described herein are codon-optimized, e.g., the native or wild-type sequence of a nucleic acid sequence has been altered or engineered to include alternative codons such that the altered or engineered nucleic acid encodes the same polypeptide expression product as the native / wild-type sequence but is transcribed and / or translated with improved efficiency in a desired expression system. In some embodiments of any of the aspects, the expression system is an organism (or cells obtained from such an organism) other than the source of the native / wild-type sequence. In some embodiments of any of the aspects, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in a mammal or mammalian cell, e.g., a mouse, a mouse cell, or a human cell. In some embodiments of any of the aspects, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in a human cell. In some embodiments of any of the aspects, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in a yeast or yeast cell. In some embodiments of any of the aspects, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in a bacterial cell. In some embodiments of any of the aspects, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in E. coli cells.
[0286] As used herein, the term " expression vector " refers to the vector that directs the expression of RNA or polypeptide from the sequence linked to the transcriptional regulatory sequence on the vector.The sequence that is expressed is often, but not necessarily, heterologous to cell.Expression vector may contain additional elements, for example, expression vector may have two replication systems, so that it can be maintained in two organisms, for example, in human cells for expression, and in prokaryotic hosts for cloning and amplification.
[0287] As used herein, the term "viral vector" refers to a nucleic acid vector construct that contains at least one element of viral origin and has the ability to be packaged into a viral vector particle. A viral vector may contain a nucleic acid encoding a polypeptide described herein in place of a non-essential viral gene. The vector and / or particle can be used to transfer any nucleic acid into cells either in vitro or in vivo. Many forms of viral vectors are known in the art. Non-limiting examples of viral vectors of the present invention include AAV vectors, adenovirus vectors, lentivirus vectors, retrovirus vectors, herpesvirus vectors, alphavirus vectors, poxvirus vectors, baculovirus vectors, and chimeric virus vectors.
[0288] It should be understood that in some embodiments, the vector described herein can be combined with other suitable compositions and treatments.In some embodiments, the vector is an episomal vector.The use of suitable episomal vector provides a method for maintaining the target nucleotide in the subject in high copy number extrachromosomal DNA, thereby eliminating the potential effect of chromosomal integration.
[0289] As used herein, the terms "treat," "treatment," "treating," or "amelioration" refer to therapeutic treatment, wherein the purpose is to reverse, alleviate, improve, inhibit, slow, or halt the progression or severity of a condition associated with a disease or disorder, such as Huntington's disease. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease, or disorder associated with Huntington's disease. Treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is "effective" if the progression of the disease is reduced or halted. That is, "treatment" includes not just an improvement in symptoms or markers, but also an interruption or at least a slowing of the progression or worsening of symptoms compared to that expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, whether detectable or undetectable, attenuation of the extent of the disease, stabilized (i.e., not worsening) disease, delay or slowing of disease progression, improvement or palliation of the disease state, remission (whether partial or total), and / or reduced mortality. The term "treatment" of a disease also includes providing relief (including palliative treatment) from the symptoms of the disease or its side effects.
[0290] As used herein, the term "pharmaceutical composition" refers to an active agent in combination with a pharmaceutically acceptable carrier, e.g., a carrier commonly used in the pharmaceutical industry. The phrase "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio. In some embodiments of any of the aspects, the pharmaceutically acceptable carrier may be a carrier other than water. In some embodiments of any of the aspects, the pharmaceutically acceptable carrier may be a cream, emulsion, gel, liposome, nanoparticle, and / or ointment. In some embodiments of any of the aspects, the pharmaceutically acceptable carrier may be an artificial or engineered carrier, e.g., a carrier not found in which the active ingredient is naturally occurring.
[0291] As used herein, the term "administering" refers to placing a compound disclosed herein in a subject by a method or route that results in at least partial delivery of the agent to a desired site. Pharmaceutical compositions containing a compound disclosed herein can be administered by any appropriate route that results in effective treatment in a subject. In some embodiments, administration involves physical human activity, such as injection, ingestion, application, and / or operation of a delivery device or machine. Such activity can be performed, for example, by a medical professional and / or the subject being treated.
[0292] As used herein, "contacting" refers to any suitable means for delivering or exposing an agent to at least one cell.Exemplary delivery methods include, but are not limited to, direct delivery into cell culture medium, perfusion, injection, or other delivery methods known to those skilled in the art.In some embodiments, contacting includes physical human activity, such as injection; dispersing, mixing, and / or decanting; and / or operating a delivery device or machine.
[0293] The terms "statistically significant" or "significantly" refer to statistical significance, generally meaning a difference of 2 standard deviations (2 SD) or greater.
[0294] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood to be modified in all instances by the term "about." When used in conjunction with percentages, the term "about" can mean ±1%.
[0295] As used herein, the term "comprising" means that other elements may be present in addition to the specified elements represented. The use of "comprising" indicates inclusion rather than limitation.
[0296] The term "consisting of" refers to the compositions, methods, and their respective components described herein, excluding all elements not recited in that description of the embodiment.
[0297] As used herein, the term "consisting essentially of" refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of the embodiment of the invention.
[0298] As used herein, the term "corresponding to" refers to an amino acid or nucleotide at a recited position in a first polypeptide or nucleic acid, or an amino acid or nucleotide that is equivalent to the recited amino acid or nucleotide in a second polypeptide or nucleic acid. The equivalent recited amino acid or nucleotide can be determined by alignment of candidate sequences using a range of homology programs known in the art, e.g., BLAST.
[0299] As used herein, the term "specific binding" refers to a chemical interaction between two molecules, compounds, cells, and / or particles in which a first entity binds to a second entity that targets the entity with greater specificity and affinity than it binds to a third, non-target entity. In some embodiments, specific binding can refer to an affinity of a first entity for a second target entity that is at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000-fold, or more, greater than its affinity for a third, non-target entity. A reagent specific for a given target is one that exhibits specific binding to that target under the conditions of the assay being utilized.
[0300] The singular terms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure; suitable methods and materials are described below. The abbreviation "eg" is derived from the Latin "exempli gratia" and is used herein to indicate a non-limiting example. Thus, the abbreviation "eg" is synonymous with the term "for example."
[0301] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limiting. Members of each group may be referred to or claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group may be included in or deleted from a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is deemed to contain that group as modified herein, and thus satisfies the written description of all Markush groups used in the appended claims.
[0302] Unless otherwise defined herein, scientific and technical terms used in connection with this application have the meanings commonly understood by those skilled in the art to which this disclosure belongs. It should be understood that the present invention is not limited to the particular methodology, protocols, and reagents described herein, as such may vary. The terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology are found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), WWNorton & Company, 2016 (ISBN 0815345054, 978-0815345053);Lewin’s Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055);Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414);Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X);Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542);Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005;およびCurrent Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), WO2018 / 057855A, US 10,457,940.
[0303] In some embodiments of any of the aspects, the disclosure described herein does not relate to processes for cloning humans, processes for altering the genetic identity of human germ lines, the use of human embryos for industrial or commercial purposes, or processes for altering the genetic identity of animals that may cause disease in the animals without any substantial medical benefit to humans or animals, nor to animals resulting from such processes.
[0304] Other terms are defined herein within the description of various aspects of the invention.
[0305] All patents and other publications, including references, issued patents, published patent applications, and co-pending patent applications, cited throughout this application are expressly incorporated herein by reference to describe and disclose, for example, the methodologies described in such publications that might be used in conjunction with the technology described herein. These publications merely provide their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the accuracy of the dates or contents of these documents.
[0306] The descriptions of the embodiments of the present disclosure are not intended to be exhaustive or to limit the disclosure to the precise form disclosed. Specific embodiments of the present disclosure, and examples thereof, are described herein for illustrative purposes; however, as those skilled in the relevant art will recognize, various equivalent modifications are possible within the scope of the present disclosure. For example, while method steps or functions are presented in a given order, alternative embodiments may perform the functions in a different order, or the functions may be performed substantially simultaneously. The teachings of the present disclosure provided herein may be applied to other procedures or methods, as appropriate. The various embodiments described herein may be combined to provide further embodiments. Aspects of the present disclosure may be modified, if necessary, to employ compositions, functions, and concepts from the above references and applications to provide still further embodiments of the present disclosure. These and other changes can be made to the present disclosure in light of the detailed description. All such modifications are intended to be within the scope of the appended claims.
[0307] Particular elements of any of the foregoing embodiments may be combined with or substituted for elements of other embodiments. Additionally, although advantages associated with certain embodiments of the present disclosure are described with respect to those embodiments, other embodiments may exhibit such advantages, and not necessarily all embodiments within the scope of the present disclosure.
[0308] The technology described herein is further illustrated by the following examples, which should not be construed as further limiting in any way.
[0309] Some embodiments of the technology described herein may be defined by any of the following numbered paragraphs: 1. a. a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and b. A second region comprising a transgene encoding one or more miRNAs, each miRNA comprising a seed sequence complementary to SEQ ID NO: 25. An isolated nucleic acid comprising: 2. a. a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and b. A second region containing a transgene encoding one or more miRNAs, each miRNA being encoded by a sequence containing a sequence set forth in any one of SEQ ID NOS: 1 to 22 flanked by miRNA scaffold sequences. An isolated nucleic acid comprising: 3. The isolated nucleic acid of paragraph 1 or 2, wherein the transgene comprises two miRNAs or two precursor miRNAs in tandem flanked by introns. 4. The isolated nucleic acid of paragraph 3, wherein the flanking introns are identical. 5. The isolated nucleic acid of paragraph 3, wherein the flanking introns are derived from the same species. 6. The isolated nucleic acid of paragraph 3, wherein the flanking intron is an hCG intron. 7. The isolated nucleic acid of any one of paragraphs 1 to 6, wherein the transgene comprises a promoter. 8. The isolated nucleic acid of paragraph 7, wherein the promoter is a synapsin (Syn1) promoter. 9. The isolated nucleic acid of any one of paragraphs 1 to 8, wherein the transgene further encodes a protein. 10. The isolated nucleic acid of paragraph 9, wherein the protein is CYP46A1. 11. The isolated nucleic acid of any one of paragraphs 1 to 10, wherein the one or more miRNAs are located in an untranslated portion of the transgene. 12. The isolated nucleic acid of paragraph 11, wherein the untranslated portion is an intron. 13. The isolated nucleic acid of paragraph 11, wherein the untranslated portion is located between the last codon of the nucleic acid sequence encoding the protein and the poly-A tail sequence, or between the last nucleotide base of the promoter sequence and the poly-A tail sequence. 14. The isolated nucleic acid of any one of paragraphs 1 to 13, further comprising a third region comprising a second adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof. 15. The isolated nucleic acid of any one of paragraphs 1 to 14, wherein the ITR variant lacks a functional terminal separation site (TRS), and optionally the ITR variant is an ATRS ITR. 16. The isolated nucleic acid of any one of paragraphs 1 to 15, wherein at least one of the miRNAs hybridizes to human huntingtin (e.g., SEQ ID NO: 25) and inhibits expression of human huntingtin. 17. A vector comprising the isolated nucleic acid of any one of paragraphs 1 to 16. 18. The vector of paragraph 17, which is a plasmid. 19. A host cell comprising the isolated nucleic acid of any one of paragraphs 1 to 16, or the vector of paragraph 17 or 18. 20. a. Capsid proteins; and b. The isolated nucleic acid of any one of paragraphs 1 to 16. Recombinant AAV (rAAV) containing 21. The rAAV of paragraph 20, wherein the capsid protein is an AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, or AAVrhlO capsid protein, or a chimera of any thereof. 22. The rAAV of paragraph 20 or 21, wherein the capsid protein is an AAVrh10 capsid protein. 23. The rAAV of any one of paragraphs 20 to 22, which is a self-complementary AAV (scAAV). 24. The rAAV of any one of paragraphs 20 to 22, formulated for delivery to the central nervous system (CNS). 25. An isolated nucleic acid encoding a sequence set forth in any one of SEQ ID NOs: 1 to 22. 26. A composition comprising the isolated nucleic acid of any of paragraphs 1 to 16. 27. A composition comprising the vector described in paragraph 17 or 18. 28. A composition comprising rAAV cells described in any of paragraphs 20 to 24. 29. A method for treating Huntington's disease in a subject in need thereof, comprising administering to a subject having Huntington's disease or at risk of developing Huntington's disease a therapeutically effective amount of an isolated nucleic acid described in any one of paragraphs 1 to 16, an rAAV described in any one of paragraphs 20 to 24, or a composition described in any one of paragraphs 25 to 28. 30. The method of paragraph 29, wherein the subject comprises a huntingtin gene having more than 36 CAG repeats, more than 40 repeats, or more than 100 repeats. 31. The method of paragraph 29 or 30, wherein the subject is under 20 years of age. 32. The method of any one of paragraphs 29 to 31, wherein the administration results in delivery of the isolated nucleic acid or rAAV to the central nervous system (CNS) of the subject. 33. The method of any one of paragraphs 29 to 32, wherein the administration is by injection, optionally intravenous or intrastriatal injection. 34. The method of any one of paragraphs 29 to 33, wherein the administration is by means of a catheter or related device. 35. The method of paragraph 34, further comprising the step of diagnosing the subject as having or at risk of developing Huntington's disease prior to administering. 36. The method of paragraph 34, further comprising, prior to administering, receiving results of an assay diagnosing the subject as having or at risk of developing Huntington's disease. [Example]
[0310] Example 1 In one aspect, described herein is an inhibitory RNA that can be used for the treatment of Huntington's disease. In some embodiments of any of the aspects, the nucleic acid sequence of the inhibitory RNA comprises one of SEQ ID NO:1 or SEQ ID NOs:4-9, or a sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the sequence of SEQ ID NO:1 or at least one of SEQ ID NOs:4-9 that maintains the same function (e.g., HTT inhibition) as SEQ ID NO:1 or SEQ ID NOs:4-9.
[0311] Constructs containing artificial miRNAs are described herein (see, e.g., Figure 1). pEMBL-D(+)-Syn1-hCGintron is a control vector, which contains an empty human chorionic gonadotropin (hCG) intron (hCGin; see, e.g., SEQ ID NO: 34) and is driven by the synapsin promoter (see, e.g., SEQ ID NOs: 31-32). Two copies of a control miRNA precursor (random sequence or non-functional mutation) are inserted into the hCGin of the vector pEMBL-D(+)-Syn1-hCGin-2xcontrol pre-miR. Two copies of the artificial pre-miR (see, e.g., SEQ ID NO: 35; a perfect match to the 3'-UTR target sequence, including approximately 100-150 bp of adjacent upstream and downstream sequence) are cloned between the hCG introns. Two copies of the artificial miRNA sequence are inserted into the human chorionic gonadotropin (hCG) intron, which can cleave the inserter to form a precursor miRNA. The pre-miRNA is a precursor, which has a hairpin loop structure. The pre-miRNA is translated in the cytoplasm with the help of exportin 5 (Exp5) and Ran-GTP. These miRNA precursors are further processed into mature miRNAs with the help of the RNase III enzyme Drosha in the nucleus and Dicer in the cytoplasm (e.g., Dicer cleaves the precursor into mature miRNA, which can be approximately 20-22 bp). The vector pEMBL-D(+)-Syn1-CYP46A1-hCGin-2x artificial pre-miR is a combination construct that can simultaneously generate both CYP46A1 and the artificial miRNA. To confirm whether the pre-miRNA can be processed into a mature miRNA and combined with the HTT target sequence containing a CAG expansion (which is perfectly complementary to the mature miRNA), the HTT target sequence is inserted after the luciferase gene. Due to package size limitations, a small poly(A) is used in the construct.
[0312] The following sequences are known in the art: pEMBL; synapsin promoter (Syn1); ITRs (e.g., from AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or AAVrhlO); hCG intron; small polyA; CYP46A1; luciferase; and / or HTT target sequence (e.g., HTT-3'UTR / mutant).
[0313] Synapsin-1 (Syn1) is a member of the synapsin gene family. Synapsin encodes a neuronal phosphoprotein that associates with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains that are involved in synaptogenesis and modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric disorders. Syn1 plays a role in regulating axon formation and synaptogenesis. The Syn1 protein serves as a substrate for several different protein kinases, and phosphorylation can function in regulating this protein at nerve terminals. Mutations in this gene may be associated with X-linked disorders with major neurodegeneration, such as Rett syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. In some embodiments of any of the aspects, the Syn1 promoter may include human promoter Syn1 (see, e.g., Syn1 promoters associated with NCBI Reference Nos. NG_008437.1 RefSeqGene Range 5001-52957, NM_006950.3, NP_008881.2; NM_133499.2, NP_598006.1; see, e.g., SEQ ID NOs: 31-32).
[0314] CYP46A1 is a member of the cytochrome P450 superfamily of enzymes. Cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and the synthesis of cholesterol, steroids, and other lipids. This endoplasmic reticulum protein is expressed in the brain, where it converts cholesterol to 24S-hydroxycholesterol. Cholesterol cannot cross the blood-brain barrier, but 24S-hydroxycholesterol can be secreted into circulation in the brain and returned to the liver for catabolism. In some embodiments of any of the aspects, CYP46A1 may include human CYP46A1 (see, e.g., NCBI Reference Nos. NG_007963.1 RefSeqGene Range 4881-47884; NM_006668.2; NP_006659.1; see, e.g., SEQ ID NOs: 26-27). CYP46A1, the rate-limiting enzyme for cholesterol degradation, is neuroprotective in Huntington's disease (see, e.g., Boussicault et al., CYP46A1, the rate-limiting enzyme for cholesterol degradation, is neuroprotective in Huntington's disease, Brain. 2016 Mar, 139(Pt 3):953-70; Kacher et al., CYP46A1 gene therapy deciphers the role of brain cholesterol metabolism in Huntington's disease, Brain. 2019 Aug 1;142(8):2432-2450, the contents of each of which are incorporated herein by reference in their entireties).
[0315] Non-limiting examples of miRNAs of the present disclosure include SEQ ID NO: 1 or SEQ ID NOs: 4-9.
[0316] SEQ ID NO: 6 CGAGGCCGGGGCGGGGCACA
[0317] SEQ ID NO: 7 CGGGGCGGGGCCGTGGAGGG
[0318] SEQ ID NO: 8 ACTGTGCCACTATGTTTTCA
[0319] SEQ ID NO: 9 GCCTTCATCAGCTTTTCCAG
[0320] SEQ ID NO: 1 GCTGCTGCTGCTGCTGCTGC
[0321] SEQ ID NO: 4 TGCTGGAAGGACTTGAGGGA
[0322] SEQ ID NO: 5 TGTTGCTGCTGCTGCTGCTG
[0323] In some embodiments of any of the aspects, the miRNA comprises a sequence complementary to at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) consecutive bases of the sequence set forth in SEQ ID NO: 25 flanked by an miRNA backbone sequence. In some embodiments of any of the aspects, the miRNA comprises a sequence complementary to at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) consecutive bases of an untranslated region (e.g., 5'UTR, 3'UTR), exon, CAG repeat, or CAG jumper (e.g., CAG 5' jumper, CAG 3' jumper) sequence associated with HTT (see, e.g., NCBI Gene ID: 3064; e.g., SEQ ID NO: 25; see, e.g., Tables 1 or 2) flanked by a miRNA backbone sequence.
[0324] [Table 2]
[0325] Huntingtin mRNA (Homo sapiens) of SEQ ID NO: 25; NCBI reference sequence NM 002111.8 (e.g., NG_009378.1 RefSeqGene, range 5001-174286 for the exemplary HTT gene) [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] Example 2
[0326] AAV-mediated artificial miRNAs and their application to Huntington's disease (HD)
[0327] Artificial miRNAs that can be used to treat HD are described herein (see, e.g., Figures 2-3). Several screens were performed to identify and test artificial miRNAs. Overall, the process of screening artificial miRNAs for HD includes: (1) designing and synthesizing artificial miRs (e.g., 24 artificial miRNA constructs; see, e.g., Table 1, SEQ ID NOS: 1-24, Figure 1, Figures 5-6, Figure 8A, Figure 19). The first round of in vitro screening includes: (2) co-transfecting the plasmids in vitro (e.g., screening 24 miRs by plasmid co-transfection in 293 cells; see, e.g., Figures 7, 8B, and 16-18); (3) performing AAVRH10-mediated infection in vitro for approximately the top five candidates from step (2) (e.g., using a CMV promoter; see, e.g., Figures 10-14, and 20-21); and / or (4) performing AAVRH10-mediated infection driven by a neuron-specific promoter (e.g., the hSyn1 promoter, optionally co-expressing CYP46A1) for approximately the top two to three candidates from step (3) to test the efficacy of the miRs in vitro. (5) The second in vivo screening involves in vivo AAVRH10-mediated treatment, including testing AAVrh10-mediated artificial miRNAs in transgenic (Tg) mice (e.g., Hu-128 or B6CBA-R6 / 2). (6) The efficacy and safety of the artificial miRs and their combination with CYP46A1 are then evaluated. See, for example, Figures 4, 9, and 15. Phase I: Screening of artificial miRNAs located in regions I-III
[0328] Artificial miRNAs located in regions I to III include miHTT-H1 (SEQ ID NO: 1); miHTT-H2 (SEQ ID NO: 2); miHTT-H3 (SEQ ID NO: 3); miHTT-H4 (SEQ ID NO: 4); miHTT-H5 (SEQ ID NO: 5); miHTT-H6 (SEQ ID NO: 6); miHTT-H7 (SEQ ID NO: 7); miHTT-H8 (SEQ ID NO: 8); miHTT-H9 (SEQ ID NO: 9); or miHTT-H10 (SEQ ID NO: 10); see, for example, Table 1.
[0329] The process of screening artificial miRNAs located in regions I-III for HD includes: (1) designing and synthesizing artificial miRs (e.g., 9-10 artificial miRNA constructs; see, e.g., Table 1, SEQ ID NOs: 1-10, Figure 8A). The first round of in vitro screening involves: (2) cotransfecting the plasmids in vitro (e.g., screening 9-10 miRs by plasmid cotransfection in 293 cells; see, e.g., Figure 8B); (3) performing AAVRH10-mediated infection in vitro for approximately the top five candidates from step (2) (e.g., using a CMV promoter; see, e.g., Figures 10-14); and / or (4) performing AAVRH10-mediated infection driven by a neuron-specific promoter (e.g., the hSyn1 promoter, optionally coexpressed with CYP46A1) for the top two candidates from step (3) (e.g., miR-H2 and miR-H5) to test the efficacy of the miRs in vitro. (5) A second in vivo screening involves in vivo AAVRH10-mediated treatment, including testing AAVrh10-mediated artificial miRNAs in Tg mice (e.g., Hu-128 or B6CBA-R6 / 2). (6) The efficacy and safety of the artificial miRs, with or without CYP46A1 in combination, are then evaluated. See, for example, Figure 9. The experiments described herein have confirmed that the following artificial miRNAs are particularly effective: miHTT-H2 (SEQ ID NO: 2); miHTT-H4 (SEQ ID NO: 4); or miHTT-H5 (SEQ ID NO: 5); see, for example, Figures 8A-8B, 11A-11B, and 13-14. In particular, as shown in Figures 13 and 14, miHTT-H2, H4, and H5 effectively down-regulate HTT expression in the neuronal cell line U87 compared to HTT expression induced by an empty vector (no miRNA) or other miRNAs tested, such as miHTT-H1 or miHTT-H3. Phase II: Screening of artificial miRNAs located in regions IV-V
[0330] miRNAs located in regions IV-V include miHTT-H11 (SEQ ID NO: 11); miHTT-H12 (SEQ ID NO: 12); miHTT-H13 (SEQ ID NO: 13); miHTT-H14 (SEQ ID NO: 14); miHTT-H15 (SEQ ID NO: 15); miHTT-H16 (SEQ ID NO: 16); miHTT-H17 (SEQ ID NO: 17); miHTT-H18 (SEQ ID NO: 18); miHTT-H19 (SEQ ID NO: 19; miR-137); miHTT-H20 (SEQ ID NO: 20; miR-455); miHTT-H21 (SEQ ID NO: 21; miR-216); or miHTT-H22 (SEQ ID NO: 22; miR-27a); see, for example, Table 1. The following miRs from stage I can be used as positive controls: miHTT-H2 (SEQ ID NO: 2); miHTT-H4 (SEQ ID NO: 4); or miHTT-H5 (SEQ ID NO: 5).
[0331] The process of screening miRNAs located in regions IV-V for HD includes: (1) designing and synthesizing artificial miRs (e.g., 12 artificial miRNA constructs; see, e.g., Table 1, SEQ ID NOs: 11-22, and Figure 19). The first round of in vitro screening includes: (2) co-transfecting the plasmids in vitro (e.g., screening 12 miRs by plasmid co-transfection in 293 cells; see, e.g., Figures 16-18); (3) performing AAVRH10-mediated infection in vitro (e.g., using a CMV promoter; see, e.g., Figures 20-21) for approximately the top five candidates from step (2) (e.g., miHTT-H14; miHTT-H15; miHTT-H17; miHTT-H19; and miHTT-H21); and / or (4) performing AAVRH10-mediated infection driven by a neuron-specific promoter (e.g., the hSyn1 promoter, optionally co-expressing CYP46A1) for approximately the top two to three candidates from step (3) to test the efficacy of the miRs in vitro. (5) A second in vivo screening involves in vivo AAVRH10-mediated treatment, including testing AAVrh10-mediated artificial miRNAs in Tg mice (e.g., Hu-128). (6) The efficacy and safety of the artificial miRs, with or without CYP46A1 in combination, are then evaluated. See, for example, Figure 15. Experiments described herein have confirmed that the following artificial miRNAs are particularly effective, along with the human-expressed miRNAs miHTT-H19 (SEQ ID NO: 19; miR-137) and miHTT-H21 (SEQ ID NO: 21; miR-216): miHTT-H14 (SEQ ID NO: 14); miHTT-H15 (SEQ ID NO: 15); and miHTT-H17 (SEQ ID NO: 17); see, for example, Figures 17-19.
[0332] miR-137, miR-455, miR-216, and miR-27a (e.g., miHTT-H19-H22, SEQ ID NOs: 19-22) are examples of miRNAs expressed in humans that have been tested for their effectiveness in down-regulating HTT. The inhibitory activity of these sequences against HTT was previously unknown. As shown herein, miR-137 (miHTT-H19, SEQ ID NO: 19) and miR-216 (miHTT-H21, SEQ ID NO: 21) were two particularly effective candidates targeting the HTT 3'-UTR.
[0333] miR-137 (e.g., miHTT-H19, see SEQ ID NO: 19) is located on human chromosome 1p22 and has been implicated in acting as a tumor suppressor in several cancer types, including colorectal cancer, squamous cell carcinoma, and melanoma, through cell cycle regulation. miR-137 has been shown to regulate neural stem cell proliferation and differentiation in mouse embryonic stem cells, and neuronal maturation, including regulating dendrite length, branching points, terminal points, and spine density in neurons derived from mouse adult hippocampal neural progenitor cells and mouse fetal hippocampal neurons. Diseases associated with miR455 include endometrial serous adenocarcinoma and Pettigrew syndrome.
[0334] miR-455 (e.g., miHTT-H20, see SEQ ID NO: 20) is located on human chromosome 9q32. Diseases associated with miR-455 include endometrial serous adenocarcinoma and Pettigrew syndrome. miR-216 (e.g., miHTT-H21, see SEQ ID NO: 21) is located on human chromosome 2p16.1. Diseases associated with miR-216 include microvascular complications of diabetes and pancreatic ductal adenocarcinoma. miR-27a (e.g., miHTT-H22, see SEQ ID NO: 22) is located on human chromosome 19p13.12. Diseases associated with miR27A include leukemia and gastric cancer. miR-27a is used herein as a positive control and has been reported to reduce the aggregation of mutant HTT in vitro; see, for example, Ban et al., Biochemical and Biophysical Research Communications 488(2), 2017, 316-321. Phase III: Testing of additional artificial miRNAs located in region V against miRNAs identified in Phase II and II
[0335] Additional artificial miRNAs located in region V include miR-451a (SEQ ID NO: 23) or miR-155 (SEQ ID NO: 24); see, e.g., Table 1. miR-451a (SEQ ID NO: 23) is located on human chromosome 17q11.2. miR-451 potentially regulates the drug transporter protein P-glycoprotein, promoting resistance to the chemotherapy drug paclitaxel. Diseases associated with miR451A include glioma susceptibility and gastric cancer. miR-155 (see, e.g., SEQ ID NO: 24) is located on human chromosome 21q21.3. Exogenous molecular control of miR-155 expression in vivo can inhibit malignant disease growth, viral infections, and enhance the progression of cardiovascular disease. Diseases associated with miR155 include diffuse large B-cell lymphoma and pancreatic ductal adenocarcinoma. See, for example, U.S. Patent No. 10,767,180 for a discussion of these additional artificial miRNAs, miR-451a and miR-155, the contents of which are incorporated herein by reference in their entirety. Without wishing to be bound by theory, it is expected that at least one or more miRNAs disclosed herein, e.g., in Table 1, will be better at inhibiting a target gene, e.g., HTT, when compared to the inhibitory efficiency of miR-451a or miR-155 targeting the same target gene.
[0336] The following artificial miRs from stages I and II can be tested against the additional miRNAs listed above: miHTT-H2 (SEQ ID NO: 2); miHTT-H4 (SEQ ID NO: 4); and miHTT-H5 (SEQ ID NO: 5); miHTT-H14 (SEQ ID NO: 14); miHTT-H15 (SEQ ID NO: 15); miHTT-H17 (SEQ ID NO: 17); miHTT-H19 (SEQ ID NO: 19; miR-137); or miHTT-H21 (SEQ ID NO: 21; miR-216).
[0337] For the artificial mRNAs identified in Phases I and II, the process of testing additional artificial miRNAs for HD involves: (1) designing and synthesizing an artificial miR (e.g., two artificial miRNA constructs; see, e.g., Table 1, SEQ ID NOS:23-24, and Figure 6). The first round of in vitro testing involves: (2) cotransfecting plasmids in vitro (e.g., screening two miRs by plasmid cotransfection in 293 cells); (3) performing AAVRH10-mediated infection in vitro (e.g., using a CMV promoter); and / or (4) performing AAVRH10-mediated infection driven by a neuron-specific promoter (e.g., the hSyn1 promoter, optionally coexpressing CYP46A1) to test the efficacy of the miR in vitro. (5) A second in vivo study involves in vivo AAVRH10-mediated treatment, including testing AAVrh10-mediated artificial miRNAs in Tg mice (e.g., Hu-128 or B6CBA-R6 / 2). (6) The efficacy and safety of the artificial miRs, with or without combination with CYP46A1, are then evaluated.
[0338] Furthermore, the efficacy of the additional miRNAs is compared to that of the artificial miRNAs identified in Phases I and II (e.g., miHTT-H2 (SEQ ID NO: 2); miHTT-H4 (SEQ ID NO: 4); and miHTT-H5 (SEQ ID NO: 5); miHTT-H14 (SEQ ID NO: 14); miHTT-H15 (SEQ ID NO: 15); miHTT-H17 (SEQ ID NO: 17); miHTT-H19 (SEQ ID NO: 19; miR-137); or miHTT-H21 (SEQ ID NO: 21; miR-216)). See, e.g., FIG. 4. Without wishing to be bound by theory, it is expected that at least one of SEQ ID NOs: 2, 4, 5, 14, 15, 17, or 21 may exhibit increased efficiency and / or efficacy (e.g., in reducing HTT mRNA or protein levels or activity) in vitro or in vivo compared to SEQ ID NOs: 23 or 24. Selection of artificial miRNAs for various HTT mouse models
[0339] [Table 3]
[0340] The transgenic mouse model Hu128 has a knock-in of the full-length human HTT gene, including the 5'-untranslated region (5'-UTR) and 3'-UTR (see, e.g., Figure 6 and Table 3). Other transgenic mouse models (e.g., B6CBA-R6 / 2(CAG 120+ / -5); B6CBA-Tg(HD exon 1)62Gpb / 3J; B6CBA-R6 / 2(CAG 160+ / -5); or B6CBA-Tg(HD exon 1)62Gpb / 1J) contain a 1 kb 5'-UTR, exon I, and 260 bp intron of human HTT, which are inserted into one other gene (e.g., Gm12695, chromosome 4, chr4:96,409,585-96,414,930).
[0341] Therefore, to test a particular miR, the mouse model selected should contain the target region of HTT (see, e.g., Figures 5-6 and Tables 1 and 3). As a non-limiting example, the transgenic mouse model Hu128, which has a full-length human HTT gene knock-in, can be used to test miRs targeting any one of regions I-V (e.g., SEQ ID NOS: 1-24). As another non-limiting example, other transgenic mouse models (e.g., B6CBA-R6 / 2 or B6CBA-Tg (HD exon 1) strains) with a 1-kb 5'-UTR, exon I, and a 260-bp intron of human HTT can be used to test miRs targeting any one of regions I-III (e.g., SEQ ID NOS: 1-10).
Claims
1. a. a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and b. A second region comprising a transgene encoding one or more miRNAs, each miRNA being encoded by a sequence comprising a sequence set forth in any one of SEQ ID NOs: 2, 4, 5, 14, 15, 17, 19, or 21 flanked by miRNA scaffold sequences. An isolated nucleic acid comprising:
2. 2. The isolated nucleic acid of claim 1, wherein the transgene comprises two miRNAs or two precursor miRNAs in tandem flanked by introns.
3. The isolated nucleic acid of claim 2 , wherein the flanking introns are identical.
4. The isolated nucleic acid of claim 2 , wherein the flanking introns are derived from the same species.
5. 3. The isolated nucleic acid of claim 2, wherein the flanking intron is an hCG intron.
6. The isolated nucleic acid of claim 1 , wherein the transgene comprises a promoter.
7. The isolated nucleic acid of claim 6, wherein the promoter is a synapsin (Syn1) promoter.
8. The isolated nucleic acid of claim 1 , wherein the transgene further encodes a protein.
9. The isolated nucleic acid of claim 8, wherein the protein is CYP46A1.
10. 10. The isolated nucleic acid of claim 1, wherein the one or more miRNAs are located in an untranslated portion of the transgene.
11. The isolated nucleic acid of claim 10, wherein the untranslated portion is an intron.
12. 11. The isolated nucleic acid of claim 10, wherein the untranslated portion is located between the last codon of the nucleic acid sequence encoding the protein and the poly-A tail sequence, or between the last nucleotide base of the promoter sequence and the poly-A tail sequence.
13. 13. The isolated nucleic acid of any one of claims 1 to 12, further comprising a third region comprising a second adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof.
14. 14. The isolated nucleic acid of claim 1, wherein the ITR variant lacks a functional terminal separation site (TRS), and optionally the ITR variant is an ATRS ITR.
15. 15. The isolated nucleic acid of any one of claims 1 to 14, wherein at least one of the miRNAs hybridizes to human huntingtin (e.g., SEQ ID NO: 25) and inhibits expression of human huntingtin.
16. A vector comprising the isolated nucleic acid of any one of claims 1 to 15.
17. The vector of claim 16 which is a plasmid.
18. 18. A host cell comprising an isolated nucleic acid according to any one of claims 1 to 15, or a vector according to claim 16 or 17.
19. a. capsid proteins; and b. The isolated nucleic acid of any one of claims 1 to 15. A recombinant AAV (rAAV) comprising:
20. 20. The rAAV of claim 19, wherein the capsid protein is an AAV1, AAV2, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, or AAVrhlO capsid protein, or a chimera of any thereof.
21. 21. The rAAV of claim 19 or 20, wherein the capsid protein is an AAVrhlO capsid protein.
22. 22. The rAAV of any one of claims 19 to 21, which is a self-complementary AAV (scAAV).
23. 22. The rAAV of any one of claims 19 to 21, formulated for delivery to the central nervous system (CNS).
24. An isolated nucleic acid encoding a sequence set forth in any one of SEQ ID NOs: 2, 4, 5, 14, 15, 17, 19 or 21.
25. A composition comprising the isolated nucleic acid of any one of claims 1 to 15.
26. A composition comprising the vector of claim 16 or 17.
27. A composition comprising an rAAV cell according to any one of claims 19 to 23.
28. A composition comprising an isolated nucleic acid described in any one of claims 1 to 15, a composition comprising an rAAV described in any one of claims 19 to 23, or a composition described in any one of claims 24 to 27, for use in a method for treating Huntington's disease in a subject in need thereof, the method comprising administering the composition to a subject having or at risk of developing Huntington's disease.
29. 29. The composition of claim 28, wherein the subject comprises a huntingtin gene having more than 36 CAG repeats, more than 40 repeats, or more than 100 repeats.
30. 30. The composition of claim 28 or 29, wherein the subject is under 20 years of age.
31. 31. The composition of any one of claims 28 to 30, wherein the administration results in delivery of the isolated nucleic acid or rAAV to the central nervous system (CNS) of the subject.
32. 32. The composition of any one of claims 28 to 31, wherein the administration is by injection, optionally intravenous or intrastriatal injection.
33. 33. The composition of any one of claims 28 to 32, wherein the administration is by catheter or related device.
34. 34. The composition of claim 33, wherein the method further comprises the step of diagnosing the subject as having or at risk of developing Huntington's disease prior to administering.
35. 34. The composition of claim 33, wherein the method further comprises, prior to administering, receiving results of an assay diagnosing the subject as having or at risk of developing Huntington's disease.
Citation Information
Patent Citations
Compositions and uses thereof against huntingtin
JP2009524431A
Compositions and methods for treating disorders associated with repetitive DNA
JP2022545921A
Gene expression control system and its use in recombinant virus packaging cell lines
US20030190746A1
Ribonucleic acid interference molecules of oryza sativa
US20080311659A1
Compositions and their uses directed to huntingtin
US20160053256A1