High-glucosidase-producing yeast mutants

Abstract

The present invention provides a yeast mutant strain with high glycolipid productivity, in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is suppressed or inactivated.

Description

[Technical Field]

[0001] The present invention relates to a mutant strain with high glycolipid productivity and a method for producing glycolipids using said mutant strain. [Background technology]

[0002] Sophorolipids are glycolipids produced by microorganisms, primarily yeast, consisting of long-chain hydroxy fatty acids and sophorose. Sophorolipids are amphiphilic lipids with strong surface activity and excellent biodegradability, and in recent years have attracted attention for their use as biosurfactants. Because sophorolipids are produced by microorganisms and primarily comprise nonionic components, they have good skin affinity and are therefore used as penetration enhancers for cosmetics. Furthermore, because sophorolipids are highly biodegradable and effective even with small amounts, they are increasingly being used in cleaning agents such as dishwashing detergents.

[0003] Starmerella bombicola (formerly Candida bombicola), a nonpathogenic basidiomycete yeast, is well known as a sophorolipid-producing yeast. The sophorolipid produced by Starmerella bombicola has either a lactone or acid structure, exhibits a critical micelle concentration of 40-100 mg / L, and reduces the surface tension of water from 72.8 mN / m to 30 mN / N (Non-Patent Document 1). The physicochemical properties of sophorolipids vary depending on their structure. It has been reported that properties such as antibacterial activity and surfactant activity change depending on whether the sophorolipid is in the lactone or acid form, or the fatty acid species constituting the sophorolipid (Non-Patent Documents 1 and 2).

[0004] When sophorolipids are used as detergents or cosmetic ingredients, they must compete with currently used surfactants. Conventional surfactants are bulk chemicals and therefore produced at extremely low cost. Therefore, there is a strong demand for reducing the production cost of sophorolipids.

[0005] Research and improvements have been conducted on the sophorolipid production process, mainly focusing on yield, purification methods, and foaming technology (Patent Documents 1 and 2). Furthermore, a method for improving sophorolipid productivity by modifying specific genes in Starmerella bombicola has been reported (Patent Documents 3 and 4). To further reduce costs, new methods for improving sophorolipid productivity are needed.

[0006] (Patent Document 1) Japanese Patent Application Laid-Open No. 2003-9896 (Patent Document 2) JP 2014-150774 A (Patent Document 3) Patent No. 6563721 (Patent Document 4) Patent No. 6725506 (Non-patent document 1) Appl Microbiol Biotech, 2007, 76(1): 23-34 (Non-patent document 2) J SURFACT DETERG,2006,9,QTR 1: 57-62 Summary of the Invention

[0007] The present invention relates to the following 1) to 4). 1) A yeast mutant strain in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is suppressed or inactivated. 2) A method for producing a yeast mutant, comprising suppressing or inactivating the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 in yeast. 3) A method for improving the glycolipid-producing ability of yeast, comprising inhibiting or inactivating the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 in yeast. 4) A method for producing glycolipids, which comprises culturing the yeast mutant strain described in 1).

[0008] The present invention relates to providing a yeast mutant capable of producing glycolipids with high efficiency, and a method for producing glycolipids using the same.

[0009] The present inventors have found that yeast in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 has been suppressed or inactivated has improved glycolipid-producing ability.

[0010] The present invention provides a yeast mutant strain having high glycolipid-producing ability. The yeast mutant strain of the present invention is capable of efficiently producing glycolipids.

[0011] All patents, non-patent documents, and other publications cited herein are hereby incorporated by reference in their entirety.

[0012] (1.Definition) Herein, the identity of an amino acid sequence or a nucleotide sequence is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing analysis using the homology analysis (Search homology) program of the genetic information processing software GENETYX Ver. 12, with the unit size to compare (ktup) set to 2.

[0013] As used herein, "at least 90% identity" with respect to an amino acid sequence or a nucleotide sequence means identity of 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more.

[0014] As used herein, "an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted" refers to an amino acid sequence in which 1 to 75, preferably 1 to 40, more preferably 1 to 20, even more preferably 1 to 10, even more preferably 1 to 8, even more preferably 1 to 5, and even more preferably 1 to 3 amino acids have been deleted, substituted, added, or inserted. Furthermore, "a nucleotide sequence in which one or several nucleotides have been deleted, substituted, added, or inserted" refers to a nucleotide sequence in which 1 to 220, preferably 1 to 120, more preferably 1 to 60, even more preferably 1 to 30, even more preferably 1 to 24, even more preferably 1 to 15, and even more preferably 1 to 9 nucleotides have been deleted, substituted, added, or inserted. As used herein, "addition" of an amino acid or nucleotide includes addition of an amino acid or nucleotide to one or both ends of a sequence.

[0015] As used herein, "upstream" and "downstream" in relation to a gene refer to upstream and downstream in the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter on the DNA sense strand, and "upstream" of a gene means the 5' region of the gene on the DNA sense strand.

[0016] As used herein, "yeast" refers to glycolipid-producing yeast, and "glycolipid-producing yeast" refers to yeast capable of producing glycolipids. Among these, sophorolipid-producing yeast is preferred. Examples of such yeast include ascomycetes such as Starmerella, Candida, and Wickerhamiella, with the Starmerella genus being preferred. Examples of Starmerella include Starmerella bombicola, Candida species such as Candida bogoriensis, Candida batistae, and Candida apicola, and examples of Wickerhamiella include Wickerhamiella domericqiae. A more preferred example is Starmerella bombicola.

[0017] The polypeptide whose expression is suppressed or inactivated in the yeast mutant strain of the present invention is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide corresponding thereto. The amino acid sequence set forth in SEQ ID NO: 2 is an amino acid sequence based on a specific ORF discovered by the present inventors as a result of ORF analysis of Starmerella bombicola, a species for which ORF analysis had not previously been fully performed. As shown in the Examples below, a yeast mutant strain lacking a gene encoding the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 exhibits improved glycolipid production ability. Therefore, the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 is presumed to be a polypeptide involved in the glycolipid production ability of yeast, and suppression or inactivation of this polypeptide improves the glycolipid production ability of yeast. A BLAST search at the National Center for Biotechnology Information (NCBI) revealed that the protein with the highest sequence identity to the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 was a transcriptional repressor called TUP1 from Sugiyamaella lignohabitans, but the sequence identity between the two was low at 62.9%. Therefore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 is believed to be a previously unknown novel protein, and has been named b0790 protein.

[0018] As used herein, a "polypeptide corresponding to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2" refers to a polypeptide consisting of an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2. Examples of amino acid sequences that are at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 2. A polypeptide corresponding to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 is a polypeptide that improves the glycolipid-producing ability of yeast by suppressing or inactivating its expression.

[0019] As used herein, "a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:2, i.e., the b0790 gene" preferably refers to a gene consisting of the nucleotide sequence shown in SEQ ID NO:1.

[0020] As used herein, a "gene encoding a polypeptide corresponding to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2" refers to a gene having the same function as the b0790 gene, and is preferably a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide corresponding thereto. Examples of nucleotide sequences having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1 include nucleotide sequences in which one or several nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence shown in SEQ ID NO: 1.

[0021] (2. Yeast Mutant Strains) The present invention provides a yeast mutant strain (hereinafter referred to as the mutant strain of the present invention). In the mutant strain of the present invention, the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto is suppressed or inactivated. Preferably, the mutant strain of the present invention is a mutant strain produced by artificially modifying yeast to suppress or inactivate the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto.

[0022] Preferably, the mutant strain of the present invention is a mutant strain in which the expression of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide equivalent thereto is suppressed compared to the strain before mutation (parent strain). In one embodiment, the mutant strain of the present invention can be a mutant strain in which the expression level of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide equivalent thereto is reduced to 50% or less, preferably 40% or less, more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, and even more preferably 5% or less compared to the parent strain. Even more preferably, the mutant strain of the present invention can be a mutant strain in which the expression level of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide equivalent thereto is reduced to an undetectable level (below the expression level of a negative control or background). The expression level of a polypeptide can be measured by commonly used protein expression quantification methods, such as, but not limited to, colorimetry, fluorometry, Western blotting, ELISA, radioimmunoassay, etc.

[0023] The mutant strain of the present invention has improved glycolipid-producing ability due to the suppression or inactivation of expression of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide corresponding thereto. Here, "improved glycolipid-producing ability" refers to an improvement in glycolipid production in the mutant strain of the present invention compared to the strain before mutation (parent strain), and "glycolipid" refers to a glycolipid containing glucose or its acetylated derivative as the sugar constituting the sugar or sugar chain. Examples of glycolipids include preferably sophorolipids, Bola-type sophorosides and / or alkylsophorosides, more preferably sophorolipids and / or Bola-type sophorosides. The glycolipid production amount by the mutant strain of the present invention with improved glycolipid-producing ability is preferably 105% or more, more preferably 110% or more, even more preferably 120% or more, and even more preferably 130% or more compared to the glycolipid production amount by the parent strain. Preferably, the glycolipid-producing ability herein is based on the glycolipid production amount after 20 to 200 hours of culture, more preferably after 50 to 200 hours of culture.

[0024] Means for suppressing or inactivating the expression of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide equivalent thereto include a method of deleting or inactivating the gene encoding it, a method of inactivating mRNA transcribed from the gene encoding it, a method of suppressing translation of mRNA of the gene encoding it by RNA interference using siRNA or the like, a method of reducing the activity of the polypeptide by mutating the gene encoding it, a method of inactivating the polypeptide with an inhibitor such as an aptamer or an antibody, etc. In a preferred embodiment, the mutant strain of the present invention is a mutant strain in which a gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a gene equivalent thereto has been deleted or inactivated.

[0025] Methods for deleting or inactivating a gene in a yeast cell include introducing a mutation (deletion, insertion, substitution, or addition) into one or more nucleotides in the nucleotide sequence of the target gene, substituting or inserting another nucleotide sequence into the nucleotide sequence, or deleting part or all of the nucleotide sequence. Alternatively, similar mutations or substitutions, insertions, or deletions of nucleotide sequences may be performed in a control region, such as the promoter region, of the target gene. For example, by introducing a mutation into the promoter that controls the expression of the target gene or by replacing it with a lower-expressing promoter, promoter activity can be reduced or eliminated, thereby reducing or eliminating transcription of mRNA from the target gene, thereby inactivating the target gene.

[0026] Specific techniques for the above-mentioned mutagenesis, or substitution, insertion, or deletion of nucleotide sequences can be any method for genetic modification of microorganisms known in the art, including, but not limited to, ultraviolet irradiation, site-specific mutagenesis, homologous recombination using SOE-PCR (splicing by overlap extension PCR: Gene, 1989, 77:61-68), and genome editing using artificial DNA cleaving enzymes (artificial DNA nucleases or programmable nucleases).

[0027] After the above-mentioned mutagenesis or substitution, insertion, or deletion of a nucleotide sequence, genetic analysis or evaluation of the expression level of mRNA or polypeptide encoded by the target gene can be performed to select cells having the desired mutation, thereby obtaining the mutant strain of the present invention.

[0028] Alternatively, when the gene is deleted or inactivated by homologous recombination using SOE-PCR, a drug resistance marker gene can be incorporated into the gene deletion DNA fragment to replace the target gene DNA, and cells containing the deletion DNA fragment can be cultured on a drug-containing medium and grown colonies isolated to obtain a mutant strain in which the target gene has been deleted. Furthermore, the mutation may be confirmed by the above-described genetic analysis or evaluation of the polypeptide expression level. By the above procedure, a yeast mutant strain of the present invention can be obtained in which a gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a gene corresponding thereto has been deleted or inactivated.

[0029] Alternatively, the mutant strain of the present invention in which the expression of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide corresponding thereto is suppressed or inactivated can be obtained by confirming the improved glycolipid production ability in the mutant strain prepared by the above procedure.

[0030] (3. Method for improving glycolipid production ability in mutant strains) The mutant strain of the present invention, produced by suppressing or inactivating the expression of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto, has improved glycolipid-producing ability compared to the strain before mutation (parent strain). Therefore, the present invention also provides a method for improving the glycolipid-producing ability of yeast, which comprises suppressing or inactivating the expression of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto in yeast.

[0031] (4. Method for producing glycolipids) The mutant strain of the present invention has improved glycolipid-producing ability. Furthermore, the mutant strain of the present invention can produce glycolipids using hydrocarbon chains, fatty acids, and the like of various chain lengths as substrates. Therefore, by culturing the mutant strain of the present invention with a substrate of an appropriate chain length, glycolipids containing constituent hydrocarbon chains, fatty acids, and the like of desired chain lengths can be efficiently produced. Therefore, the present invention also provides a method for producing glycolipids, which comprises culturing the mutant strain of the present invention.

[0032] The glycolipid is not particularly limited as long as it can be produced by the mutant strain of the present invention, but preferably includes a glycolipid containing glucose or an acetylated form thereof as the sugar constituting the sugar or sugar chain, more preferably includes a glycolipid containing glucose, sophorose, cellobiose or an acetylated form thereof as the sugar or sugar chain, even more preferably includes sophorolipid, Bola-type sophorolipid, Bola-type sophoroside, alkyl sophoroside, alkyl glucoside, Bola-type glucoside, acidic glucolipid and / or cellobioselipid, even more preferably includes sophorolipid, Bola-type sophoroside and / or alkyl sophoroside, and even more preferably includes sophorolipid and / or Bola-type sophoroside.

[0033] The mutant strain of the present invention used in the method for producing glycolipids of the present invention is a yeast mutant strain in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is suppressed or inactivated, and may be further modified to improve glycolipid-producing ability. Examples of further modifications include suppressing or inactivating the expression of a polypeptide involved in suppressing the ability to produce the target glycolipid, enhancing the expression of a polypeptide involved in improving the ability to produce the target glycolipid, and enhancing the expression of various enzymes for producing the target glycolipid.

[0034] A preferred example of further modification is the suppression or inactivation of FAO1 (fatty alcohol oxidase 1) or a protein equivalent thereto. Here, "FAO1" refers to a polypeptide having fatty alcohol oxidase activity, preferably Starmerella bombicola FAO1, and more preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 34. Furthermore, a "protein equivalent to FAO1" refers to a protein having the same function as FAO1, including FAO1 homologs, orthologs, and variants thereof. A protein equivalent to FAO1 is preferably a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 34. Examples of amino acid sequences at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 34 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 34. The modification is preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 34, more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 33 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 33, and even more preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 33 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 33 and consisting of the amino acid sequence shown in SEQ ID NO: 34 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 34.It has been reported that a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34 is encoded in Starmerella bombicola by the nucleotide sequence shown in SEQ ID NO: 33, and that a Starmerella bombicola mutant in which the expression of this polypeptide is suppressed or inactivated is capable of producing Bola-type sophorosides, alkylsophorosides, alkylglucosides, and Bola-type glucosides (Appl Microbiol Biotechnol. 2016 Nov;100(22):9519-9528). A specific example of a mutant strain of the present invention in which the expression of FAO1 or a protein corresponding thereto is suppressed or inactivated is the Starmerella bombicola Δfao1Δb0790::hyg strain shown in the Examples below.

[0035] Another preferred example of further modification is the suppression or inactivation of expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 36 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 36. A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 36 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 36 is a putative transcription factor protein, more preferably a putative transcription factor protein having two zinc finger C2H2-type DNA-binding domains. The presence or absence of zinc finger C2H2-type DNA-binding domains in a certain polypeptide can be confirmed by analyzing the amino acid sequence using, for example, NCBI CD search, although the method for analyzing the presence or absence of such domains is not limited to this. The modification is preferably deletion or inactivation of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 36 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 36, more preferably deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 35 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 35, and even more preferably deletion or inactivation of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 35 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 35 and consisting of the amino acid sequence shown in SEQ ID NO: 36 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 36. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 36 is encoded by the nucleotide sequence shown in SEQ ID NO: 35 in Starmerella bombicola, and it has been reported that a Starmerella bombicola mutant in which the expression of the polypeptide is suppressed or inactivated has improved sophorolipid production ability compared to the parent strain (Japanese Patent No. 6725506).

[0036] Another preferred example of further modification is the suppression or inactivation of the expression of CYP52M1 (CYP52M1 cytochrome P450 monooxygenase) or a protein equivalent thereto. Here, "CYP52M1" refers to a polypeptide having hydroxylation activity at the ω- or ω-1-position of fatty acids or aliphatic alcohols, preferably CYP52M1 from Starmerella bombicola, and more preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 38. Furthermore, "a protein equivalent to CYP52M1" refers to a protein having the same function as CYP52M1, including CYP52M1 homologs, orthologs, and variants thereof. A protein equivalent to CYP52M1 is preferably a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 38. Examples of amino acid sequences at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 38 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 38. The modification is preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 38 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 38, more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 37 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 37, and even more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 37 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 37, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 38 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 38. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 38 is encoded by the nucleotide sequence shown in SEQ ID NO: 37 in Starmerella bombicola.It has been reported that a Starmerella bombicola mutant strain in which the cyp52M1 gene and fao1 gene were disrupted exhibited good productivity of Bola-type sophoroside and suppressed the by-production of sophorolipids (WO 2020 / 104582).

[0037] Another preferred example of further modification is the suppression or inactivation of expression of CYP52N1 (CYP52N1 cytochrome P450 monooxygenase) or a protein equivalent thereto. Here, "CYP52N1" refers to a polypeptide that, like the above-mentioned CYP52M1, has the activity of hydroxylating fatty acids or fatty alcohols at the ω- or ω-1-position (Inge N.A. Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), preferably CYP52N1 from Starmerella bombicola, more preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 40. Furthermore, "a protein equivalent to CYP52N1" refers to a protein having the same function as CYP52N1, including CYP52N1 homologs, orthologs, and variants thereof. A protein equivalent to CYP52N1 is preferably a polypeptide consisting of an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 40. An example of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 40 is an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 40. The modification is preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 40 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 40, more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 39 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 39, and even more preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 39 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 39 and consisting of the amino acid sequence shown in SEQ ID NO: 40 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 40.The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 40 is encoded by the nucleotide sequence shown in SEQ ID NO: 39 in Starmerella bombicola.

[0038] Another preferred example of further modification is the suppression or inactivation of expression of CYP52E3 (CYP52E3 cytochrome P450 monooxygenase) or a protein equivalent thereto. Here, "CYP52E3" refers to a polypeptide that, like the above-mentioned CYP52M1, has the activity of hydroxylating fatty acids or fatty alcohols at the ω- or ω-1-position (Inge N.A. Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), preferably CYP52E3 from Starmerella bombicola, more preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 42. Furthermore, "a protein equivalent to CYP52E3" refers to a protein having the same function as CYP52E3, including CYP52E3 homologs, orthologs, and variants thereof. A protein equivalent to CYP52E3 is preferably a polypeptide consisting of an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 42. An example of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 42 is an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 42. The modification is preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 42 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 42, more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 41 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 41, and even more preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 41 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 41 and consisting of the amino acid sequence shown in SEQ ID NO: 42 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 42.The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 42 is encoded by the nucleotide sequence shown in SEQ ID NO: 41 in Starmerella bombicola.

[0039] Another preferred example of further modification is the suppression or inactivation of the expression of UGTB1 (UDP-glucosyltransferase B1) or a protein equivalent thereto. Here, "UGTB1" refers to a polypeptide having the activity of transglycosylating hydroxylated fatty acids using UDP-glucose as a donor, preferably UGTB1 from Starmerella bombicola, and more preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 44. Furthermore, a "protein equivalent to UGTB1" refers to a protein having the same function as UGTB1, including UGTB1 homologs, orthologs, and variants thereof. A protein equivalent to UGTB1 is preferably a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 44. Examples of amino acid sequences at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 44 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 44. The modification is preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 44 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 44, more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 43 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 43, and even more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 43 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 43, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 44 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 44. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 44 is encoded by the nucleotide sequence shown in SEQ ID NO: 43 in Starmerella bombicola.It has been reported that a Starmerella bombicola mutant strain in which the ugtB1 gene has been disrupted is capable of producing glucolipids (Sofie Lodens et al., Biotechnol Bioeng., 2020, 117(2): 453-465). It has also been reported that a Starmerella bombicola mutant strain in which the ugtB1 gene, fao1 gene, and cyp52M1 gene have been disrupted is capable of producing alkylglucosides and alkylsophorosides (WO 2021 / 229017).

[0040] Another preferred example of further modification is the suppression or inactivation of expression of UGTA1 (UDP-glucosyltransferase A1) or a protein equivalent thereto. Here, "UGTA1" refers to a polypeptide that, like the above-mentioned UGTB1, has the activity of transglycosylating hydroxylated fatty acids using UDP-glucose as a donor (Karen MJ Saerens et al., FEMS Yeast Res., 2015, 15(7): fov075), preferably UGTA1 from Starmerella bombicola, and more preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 46. Furthermore, "proteins equivalent to UGTA1" refer to proteins that have the same function as UGTA1, including UGTA1 homologs, orthologs, and variants thereof. Proteins equivalent to UGTA1 are preferably polypeptides consisting of an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 46. An example of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 46 is an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 46. The modification is preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 46 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 46, more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 45 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 45, and even more preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 45 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 45 and consisting of the amino acid sequence shown in SEQ ID NO: 46 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 46.The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 46 is encoded by the nucleotide sequence shown in SEQ ID NO: 45 in Starmerella bombicola.

[0041] Another preferred example of further modification is the suppression or inactivation of the expression of AT (acetyl transferase) or a protein equivalent thereto. Here, "AT" refers to a polypeptide having the activity of acetylating the OH moiety of sugars, preferably the AT of Starmerella bombicola, and more preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 48. Furthermore, "a protein equivalent to AT" refers to a protein having the same function as AT, including AT homologs, orthologs, or variants thereof. A protein equivalent to AT is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 48. Examples of amino acid sequences having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 48 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 48. The modification is preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 48 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 48, more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 47 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 47, and even more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 47 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 47, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 48 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 48. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 48 is encoded by the nucleotide sequence shown in SEQ ID NO: 47 in Starmerella bombicola.It has been reported that a mutant of Starmerella bombicola in which the at gene is disrupted produces non-acetylated sophorolipids (Karen MJ Saerens et al., Biotechnol Bioeng., 2011, 108(12): 2923-2931).

[0042] Another preferred example of further modification is the suppression or inactivation of expression of SBLE (Starmerella Bombicola Lactone Esterase) or a protein equivalent thereto. Here, "SBLE" refers to a polypeptide having sophorolipid lactonization activity, preferably SBLE from Starmerella bombicola, and more preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 50. Furthermore, "a protein equivalent to SBLE" refers to a protein having the same function as SBLE, including SBLE homologs, orthologs, and variants thereof. A protein equivalent to SBLE is preferably a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 50. Examples of amino acid sequences at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 50 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 50. The modification is preferably the deletion or inactivation of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 50 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 50, more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 49 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 49, and even more preferably the deletion or inactivation of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 49 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 49, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 50 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 50. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 50 is encoded by the nucleotide sequence shown in SEQ ID NO: 49 in Starmerella bombicola.It has been reported that the ratio of acid-type sophorolipids is increased in a Starmerella bombicola mutant in which the sble gene is disrupted (Katarzyna Ciesielska et al., Appl Microbiol Biotechnol., 2016, 100(22): 9529-9541). It has also been reported that a Starmerella bombicola mutant in which the sble gene and the at gene are disrupted is capable of producing non-acetylated Bola-type sophorolipids (WO 2015 / 028278).

[0043] A preferred example of further modification is enhanced expression of MDR1 (multidrug resistance protein 1) or a protein equivalent thereto. Here, "MDR1" refers to a transporter polypeptide responsible for intracellular and extracellular transport of sophorolipids, preferably MDR1 of Starmerella bombicola, and more preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 52. Furthermore, "a protein equivalent to MDR1" refers to a protein having the same function as MDR1, including MDR1 homologs, orthologs, and variants thereof. A protein equivalent to MDR1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 52. Examples of amino acid sequences having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 52 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 52. The modification is preferably enhanced expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 52 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 52, more preferably enhanced expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 51 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 51, and even more preferably enhanced expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 51 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 51, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 52 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 52. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 52 is encoded by the nucleotide sequence shown in SEQ ID NO: 51 in Starmerella bombicola.It has been reported that the productivity of sophorolipids and Bola-type sophorolipids is significantly reduced in Starmerella bombicola mutants in which the mdr1 gene is disrupted (Silke Claus et al., BMC Genomics, 2022, 23(1): 22).

[0044] Another preferred example of further modification is the suppression or inactivation of MFE-2 (multifunctional enzyme type 2) or a protein equivalent thereto. Here, "MFE-2" refers to a polypeptide involved in the beta-oxidation degradation of fatty acids, preferably MFE-2 from Starmerella bombicola. Furthermore, "proteins equivalent to MFE-2" refer to proteins with the same function as MFE2, including MFE2 homologs, orthologs, and mutants thereof. It has been reported that a Starmerella bombicola mutant strain in which the mfe-2 gene is disrupted produces sophorolipids with a medium-chain fatty acid backbone (Inge N.A. Van Bogaert et al., FEMS Yeast Res., 2009, 9(4): 610-617).

[0045] In the method for producing glycolipids of the present invention, the mutant strain of the present invention is cultured in a medium containing substrates such as fatty acids, fatty acid alkyl esters, triacylglycerols, diacylglycerols, monoacylglycerols, fats and oils, alkanes, alkenes, alkynes, alcohols, etc. After the culture, glycolipids are recovered from the medium and, if necessary, appropriately purified to produce glycolipids.

[0046] The medium used for the above-mentioned culture can be a conventional medium containing a carbon source, a nitrogen source, inorganic salts, and, if necessary, organic trace nutrients such as amino acids and vitamins. The medium may be either a synthetic medium or a natural medium.

[0047] The carbon and nitrogen sources contained in the medium may be of any type that can be utilized by the mutant strain to be cultured. Examples of carbon sources include sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolysates, and molasses; organic acids such as acetic acid and citric acid; and alcohols such as ethanol. These carbon sources can be used alone or in combination of two or more. Examples of nitrogen sources include ammonia; ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; nitrates; and urea.

[0048] Examples of the inorganic salts include phosphates, magnesium salts, calcium salts, iron salts, manganese salts, etc. Examples of the organic trace nutrients include amino acids, vitamins, fatty acids, nucleic acids, and peptones containing these, casamino acids, yeast extract, soy protein hydrolysates, etc. When using an auxotrophic mutant strain that requires amino acids or the like for growth, the required nutrients may be supplemented.

[0049] Preferred examples of substrates that can be contained in the medium include C12-22 fatty acids and their alkyl esters, triacylglycerols containing C12-22 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-22 fatty acids or their alkyl esters, C12-22 alkanes, C12-22 alkenes, C12-22 alkynes, and C12-22 alcohols. More preferred examples include C12-18 fatty acids and their alkyl esters, triacylglycerols containing C12-18 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-18 fatty acids or their alkyl esters, C12-18 alkanes, C12-18 alkenes, C12-18 alkynes, and C12-18 alcohols. More preferred examples include C12 to C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C18 fatty acids or alkyl esters thereof, and C12 to C18 alcohols.

[0050] More specific examples of the substrate include, but are not limited to, the C12-22 fatty acids, which may be saturated or unsaturated, and may be straight-chain or branched, such as lauric acid, tridecylic acid, myristic acid, pentadecylic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, behenic acid, palmitoleic acid, oleic acid, linoleic acid, α-linolenic acid, γ-linolenic acid, arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid; the alkyl esters of the C12-22 fatty acids include alkyl esters of the above-listed fatty acids having 1 to 4 carbon atoms, preferably methyl esters and ethyl esters; and the fats and oils containing the C12-22 fatty acids or alkyl esters thereof include coconut oil, palm oil, palm kernel oil, olive oil, rapeseed oil, rice bran oil, soybean oil, castor oil, and mahua oil.

[0051] The C12-22 alkanes may be straight-chain or branched, and examples thereof include dodecane, tridecane, tetradecane, pentadecane, hexadecane, heptadecane, octadecane, nonadecane, icosane, henicosane, and docosane; the C12-22 alkenes may be straight-chain or branched, and examples thereof include 1-dodecene, 1-tridecene, 1-tetradecene, 1-pentadecene, and 1-hexadecene. , 1-heptadecene, 1-octadecene, 1-nonadecene, 1-icosene, 1-heneicosene, 1-docosene, etc.; the C12-22 alkynes may be linear or branched, and examples thereof include 1-dodecyne, 1-tridecyne, 1-tetradecyne, 1-pentadecyne, 1-hexadecyne, 1-heptadecyne, 1-octadecyne, 1-nonadecyne, 1-icosine, 1-heneicosine, 1-docosine, etc.

[0052] The C12-22 alcohol may be a saturated or unsaturated alcohol, and may be a straight-chain or branched-chain alcohol, and examples thereof include lauryl alcohol, tridecyl alcohol, myristyl alcohol, pentadecyl alcohol, cetyl alcohol, heptadecyl alcohol, stearyl alcohol, isostearyl alcohol, nonadecyl alcohol, arachidyl alcohol, behenyl alcohol, palmitoleyl alcohol, oleyl alcohol, linoleyl alcohol, and linolenyl alcohol.

[0053] The substrates listed above can be used alone or in combination of two or more. Preferably, fatty acids with a chain length of C12 to C18 or their alkyl esters, triacylglycerols, diacylglycerols, monoacylglycerols, or fats and oils containing them, or alkanes, alkenes, alkynes, or alcohols with a chain length of C12 to C18 are used. More preferably, fatty acids with a chain length of C12 to C18 or their alkyl esters, or alcohols with a chain length of C12 to C18 are used. Even more preferably, fatty acids with a chain length of C16 to C18 or their alkyl esters, or alcohols with a chain length of C16 to C18 are used. Even more preferably, C18 fatty acids or their alkyl esters, or C18 alcohols are used. Even more preferably, oleic acid or its alkyl esters, or oleyl alcohol are used. Rapeseed oil, whose main component is triacylglycerols containing a large amount of oleic acid as a constituent fatty acid, is also preferably used.

[0054] The content of the above-mentioned substrate that can be contained in the medium (at the time of adding the substrate) is preferably 0.1 mass / volume% or more, more preferably 0.5 mass / volume% or more, even more preferably 1 mass / volume% or more, even more preferably 2 mass / volume% or more, even more preferably 3 mass / volume% or more, and even more preferably 5 mass / volume% or more in terms of the amount of glycolipid produced, and is preferably 40 mass / volume% or less, more preferably 30 mass / volume% or less, even more preferably 25 mass / volume% or less, even more preferably 20 mass / volume% or less, even more preferably 15 mass / volume% or less, and even more preferably 10 mass / volume% or less in terms of glycolipid production efficiency. Alternatively, preferably, the amount is 0.1 to 40 mass / volume%, 0.1 to 30 mass / volume%, 0.1 to 25 mass / volume%, 0.1 to 20 mass / volume%, 0.1 to 15 mass / volume%, 0.1 to 10 mass / volume%, 0.5 to 40 mass / volume%, 0.5 to 30 mass / volume%, 0.5 to 25 mass / volume%, 0.5 to 20 mass / volume%, 0.5 to 15 mass / volume%, 0.5 to 10 mass / volume%, 1 to 40 mass / volume%, 1 to 30 mass / volume%, 1 to 25 mass / volume%, 1 to 20 mass / volume%, 1 to 15 mass / volume%. %, 1 to 10 mass / volume%, 2 to 40 mass / volume%, 2 to 30 mass / volume%, 2 to 25 mass / volume%, 2 to 20 mass / volume%, 2 to 15 mass / volume%, 2 to 10 mass / volume%, 3 to 40 mass / volume%, 3 to 30 mass / volume%, 3 to 25 mass / volume%, 3 to 20 mass / volume%, 3 to 15 mass / volume%, 3 to 10 mass / volume%, 5 to 40 mass / volume%, 5 to 30 mass / volume%, 5 to 25 mass / volume%, 5 to 20 mass / volume%, 5 to 15 mass / volume%, or 5 to 10 mass / volume%. In this specification, volume refers to the volume at 25°C and 1 atmosphere.

[0055] The culture conditions may be any conditions that allow the mutant strain of the present invention to produce glycolipids by fermentation. Cultivation is preferably carried out under aerobic conditions, and common methods such as aeration and agitation culture or shaking culture can be used. The culture temperature is preferably 20 to 33°C, more preferably 25 to 30°C, and even more preferably 28 to 30°C. The initial pH of the medium (at 30°C) is preferably 2 to 7, more preferably 3 to 6. The culture time is preferably about 24 to 200 hours, and more preferably 50 to 200 hours.

[0056] In the above-mentioned culture, the mutant strain of the present invention may be cultured under conditions in which the cells grow, thereby producing glycolipids by fermentation, or the mutant strain of the present invention may be cultured in a resting cell state, i.e., in a state in which growth and proliferation have stopped, thereby producing glycolipids by fermentation.

[0057] The method for recovering glycolipids from the culture medium after cultivation is not particularly limited, and may be performed according to a known recovery method. For example, glycolipids in the culture medium can be recovered or purified by solvent extraction using ethyl acetate, butanol, etc., fractional precipitation, liquid-liquid partitioning, column chromatography, high-performance liquid chromatography, etc., either alone or in combination as appropriate.

[0058] The following compositions, manufacturing methods, uses, and methods are further disclosed herein as exemplary embodiments of the present invention, but the present invention is not limited to these embodiments.

[0059] [1] A yeast mutant strain in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is suppressed or inactivated. [2] A mutant strain described in [1], in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is deleted or inactivated. [3] A mutant strain described in [2], in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, or a gene encoding a polypeptide consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2, is deleted or inactivated. [4] A mutant strain described in any one of [1] to [3], further comprising a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 34, whose expression is suppressed or inactivated. [5] The mutant strain according to any one of [1] to [4], wherein the yeast is a glycolipid-producing yeast. [6] The mutant strain according to any one of [1] to [5], wherein the yeast is a Starmerella yeast, preferably Starmerella bombicola. [7] The mutant strain according to any one of [1] to [6], which has improved glycolipid-producing ability compared to the strain before mutation. [8] The mutant strain according to any one of [5] to [7], wherein the glycolipid is selected from Bola-type sophorolipids, Bola-type sophorosides, alkylsophorosides, alkylglucosides, Bola-type glucosides, acidic glucolipids, and cellobioselipids, preferably selected from sophorolipids, Bola-type sophorosides, and alkylsophorosides, and more preferably selected from sophorolipids and Bola-type sophorosides.

[0060] [9] A method for producing a yeast mutant, comprising suppressing or inactivating the expression of a polypeptide in a yeast, the polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[10] The method described in [9], which comprises deleting or inactivating a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[11] The method described in

[10] , comprising deleting or inactivating a gene encoding a polypeptide consisting of a nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1, and consisting of the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[12] The method described in any one of [9] to

[11] , further comprising suppressing or inactivating the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 34.

[13] The method according to any one of [9] to

[12] , wherein the yeast is a glycolipid-producing yeast.

[14] The method according to any one of [9] to

[13] , wherein the yeast is a Starmerella yeast, preferably Starmerella bombicola.

[15] The method according to any one of [9] to

[14] , wherein the glycolipid-producing ability of the mutant strain is improved compared to the strain before mutation.

[16] The method according to any one of [9] to

[15] , wherein the glycolipid is selected from a Bola-type sophorolipid, a Bola-type sophoroside, an alkylsophoroside, an alkylglucoside, a Bola-type glucoside, an acidic glucolipid, and a cellobioselipid, preferably a sophorolipid, a Bola-type sophoroside, and an alkylsophoroside, more preferably a sophorolipid and a Bola-type sophoroside.

[0061]

[17] A method for improving glycolipid productivity in yeast, comprising suppressing or inactivating the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 in yeast.

[18] The method described in

[17] , which comprises deleting or inactivating a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[19] The method described in

[18] , comprising deleting or inactivating a gene encoding a polypeptide consisting of a nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1, and consisting of the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[20] The method described in any one of

[17] to

[19] , further comprising suppressing or inactivating the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 34.

[21] The method according to any one of

[17] to

[20] , wherein the yeast is a Starmerella yeast, preferably Starmerella bombicola.

[22] The method according to any one of

[17] to

[21] , wherein the glycolipid is selected from a Bola-type sophorolipid, a Bola-type sophoroside, an alkylsophoroside, an alkylglucoside, a Bola-type glucoside, an acidic glucolipid, and a cellobioselipid, preferably a sophorolipid, a Bola-type sophoroside, and an alkylsophoroside, more preferably a sophorolipid and a Bola-type sophoroside.

[0062]

[23] A method for producing a glycolipid, comprising culturing the yeast mutant strain according to any one of [1] to [8].

[24] The method described in

[23] , wherein the glycolipid is selected from Bola-type sophorolipid, Bola-type sophoroside, alkylsophoroside, alkylglucoside, Bola-type glucoside, acidic glucolipid, and cellobioselipid, preferably selected from sophorolipid, Bola-type sophoroside, and alkylsophoroside, more preferably selected from sophorolipid and Bola-type sophoroside.

[25] The method according to

[23] or

[24] , wherein the culture medium contains the following substrates: at least one substrate selected from the group consisting of C12 to C22 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C22 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, oils and fats containing C12 to C22 fatty acids or alkyl esters thereof, C12 to C22 alkanes, C12 to C22 alkenes, C12 to C22 alkynes, and C12 to C22 alcohols; At least one substrate selected from the group consisting of C12 to C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C18 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, oils and fats containing C12 to C18 fatty acids or alkyl esters thereof, C12 to C18 alkanes, C12 to C18 alkenes, C12 to C18 alkynes, and C12 to C18 alcohols; or At least one substrate selected from the group consisting of C12-C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12-C18 fatty acids or alkyl esters thereof, and C12-C18 alcohols.

[26] The content of the substrate in the medium is preferably 0.1% by mass / volume or more, more preferably 0.5% by mass / volume or more, even more preferably 1% by mass / volume or more, still more preferably 2% by mass / volume or more, still more preferably 3% by mass / volume or more, still more preferably 5% by mass / volume or more, and preferably 40% by mass / volume or less, more preferably 30% by mass / volume or less, even more preferably 25% by mass / volume or less, still more preferably 20% by mass / volume or less, still more preferably 15% by mass / volume or less, still more preferably 10% by mass / volume or less, or preferably 0.1 to 40% by mass / volume, 0.1 to 30% by mass / volume, 0.1 to 25% by mass / volume, 0.1 to 20% by mass / volume, 0.1 to 15% by mass / volume, 0.1 to 10% by mass / volume, 0.5 to 40% by mass / volume, Volume%, 0.5-30 mass / volume%, 0.5-25 mass / volume%, 0.5-20 mass / volume%, 0.5-15 mass / volume%, 0.5-10 mass / volume%, 1-40 mass / volume%, 1-30 mass / volume%, 1-25 mass / volume%, 1-20 mass / volume%, 1-15 mass / volume%, 1-10 mass / volume%, 2-40 mass / volume%, 2-30 mass / volume%, 2-25 mass / volume%, 2-20 mass / vol%, 2 to 15 mass / vol%, 2 to 10 mass / vol%, 3 to 40 mass / vol%, 3 to 30 mass / vol%, 3 to 25 mass / vol%, 3 to 20 mass / vol%, 3 to 15 mass / vol%, 3 to 10 mass / vol%, 5 to 40 mass / vol%, 5 to 30 mass / vol%, 5 to 25 mass / vol%, 5 to 20 mass / vol%, 5 to 15 mass / vol%, or 5 to 10 mass / vol%.

[27] The method according to any one of

[23] to

[26] , further comprising recovering glycolipids from the culture medium after the culture. [Example]

[0063] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to the following examples.

[0064] Example 1 (1) Genomic DNA extraction from the NBRC10243 strain Genomic DNA was extracted and purified from Starmerella bombicola NBRC10243 strain (ATCC22214 strain) using GenTorukun (for yeast) High Recovery (Takara Bio) according to the attached protocol.

[0065] (2) Amplification of a DNA fragment containing the hygromycin resistance gene Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio) was used for all PCR reactions performed hereinafter. Using DNA (SEQ ID NO: 3) containing a hygromycin resistance gene prepared by artificial gene synthesis as a template, the hygromycin resistance gene expression cassette was amplified using primers (SEQ ID NO: 4: GTTGTTGCTGGAGTCTCATCTGCAAG and SEQ ID NO: 5: CCGGGTATACTAGTGATTTGAACAAAC).

[0066] (3) Amplification of genomic DNA fragments 1 kbp upstream and 1 kbp downstream of the b0790 gene Using the genomic DNA of the NBRC10243 strain obtained in Example 1(1) as a template, a 1-kbp DNA fragment downstream of the b0790 gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 was amplified using primers (SEQ ID NO: 6: GCCAAGCTTGCATGCTTGGGCACCTTCTGCGCACCCAGCACGGAG and SEQ ID NO: 7: GACTCCAGCAACAACCATTAATATCGAGCTTGGCTCCTAATACTATAC), and a 1-kbp DNA fragment upstream of the b0790 gene was amplified using primers (SEQ ID NO: 8: CACTAGTATACCCGGACTTCGTATATGGCCAGGCTGCCTTGAG and SEQ ID NO: 9: AGAGTCGACCTGCAGCAATGACGATAGCGAAGATCCCAC).

[0067] (4) Amplification of vector fragments A vector DNA fragment was amplified using pHSG298 (Takara Bio) as a template and primers (SEQ ID NO: 10: GCATGCAAGCTTGGCACTGGCCGTC and SEQ ID NO: 11: CTGCAGGTCGACTCTAGAGGATCCCCG).

[0068] (5) Preparation of the template plasmid pbJK9 for the introduced DNA fragment The four PCR products described in Examples 1(2), (3), and (4) were purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.) to obtain DNA fragments, which were then ligated using an In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α (Nippon Gene Co., Ltd.), and the cell suspension was plated on LB agar medium containing kanamycin and incubated overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio Inc.) as the enzyme. Introduction of the target DNA fragment was confirmed using primers (SEQ ID NO: 12: CTCTTCGCTATTACGCCAGC and SEQ ID NO: 13: CACTTTATGCTTCCGGCTCG). Transformants carrying the plasmids for which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37°C. The plasmid was purified from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.) to obtain plasmid pbJK9, which contains a DNA fragment in which 1 kbp upstream of the b0790 gene, an expression cassette for the hygromycin resistance gene, and 1 kbp downstream of the b0790 gene were linked.

[0069] (6) Preparation of DNA fragment for introduction Using the pbJK9 plasmid as a template and primers (SEQ ID NO: 14: TTGGGCACCTTCTGCGCACCCAG and SEQ ID NO: 15: CAATGACGATAGCGAAGATCC), a DNA fragment containing 1 kbp upstream of the b0790 gene, a hygromycin resistance gene expression cassette, and 1 kbp downstream of the b0790 gene was amplified. The resulting PCR product was treated with DpnI (Takara Bio), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio).

[0070] (7) Insertion of the DNA fragment into the NBRC10243 strain and generation of the Δb0790::hyg strain The NBRC10243 strain was transformed by electroporation (Nepa Gene) using the DNA fragment obtained in Example 1(6), which contained a 1-kbp upstream region of the b0790 gene, an expression cassette for a hygromycin resistance gene, and a 1-kbp downstream region of the b0790 gene. The transformed cell sap was spread onto YPD+hyg agar medium (1% yeast extract, 2% tryptone, 2% glucose, 1.5% agar, 0.05% hygromycin) and allowed to stand at 30°C for 2 days. PCR was performed using the resulting colonies as templates and primers (SEQ ID NO: 16: CTTGACTGAGCGCTCAAGAAG and SEQ ID NO: 17: GGTGCAGCCAACCACTAATTC), and the amplified fragment was sequenced. After confirming that the introduced DNA fragment had been integrated into the genome, this strain was designated the Δb0790::hyg strain. In this mutant strain, an expression cassette for the hygromycin resistance gene has been inserted in place of the b0790 gene on the genome.

[0071] (8) Confirmation of glycolipid productivity of the Δb0790::hyg strain The Δb0790::hyg strain and NBRC10243 strain obtained in Example 1(7) were inoculated into a glycolipid production medium (0.1% by mass / volume urea, 2% by mass / volume yeast extract, 5% by mass / volume oleic acid, and 12.5% ​​by mass / volume glucose) and cultured with shaking at 30°C. After 72 hours of culture, 5 mL of the culture medium was collected, and 4 mL of hexane was added and mixed by stirring for 5 seconds. After 5 minutes of centrifugation at 3000 rpm and 25°C, the hexane fraction in the supernatant was removed. Next, 6 mL of ethyl acetate was added to the remaining solution and mixed by stirring for 5 seconds. After 5 minutes of centrifugation at 3000 rpm and 25°C, the entire ethyl acetate fraction was collected. The collected ethyl acetate fraction was volatilized by blowing nitrogen gas, and the dissolved glycolipids (sophorolipids) were precipitated. The weight of the precipitated sophorolipids was measured, and the sophorolipid concentration in the culture medium was calculated. The results are shown in Table 1. Compared with the NBRC10243 strain, the Δb0790::hyg strain had a 32% increase in sophorolipid concentration, confirming the effect of improving sophorolipid productivity.

[0072] [Table 1]

[0073] Example 2 (1) Amplification of a self-excising DNA fragment containing the hygromycin resistance gene Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio) was used for all PCR reactions. The self-excising hygromycin resistance gene expression cassette six-PgalK-βrec-Ttkt-Pgpd-HygR-Ttkt-six (SEQ ID NO: 18), which has been confirmed to function in Starmerella bombicola, was used as a template to amplify the hygromycin resistance gene expression cassette using primers (SEQ ID NO: 19: TCCGGAATTGACACATATAGGTCAATAGAGTATACTTATTTG and SEQ ID NO: 20: TAAATCTAGATGATATATTATGCTCAACTTAAATGACCTACT).

[0074] (2) Amplification of vector fragments A vector DNA fragment was amplified using pHSG298 (Takara Bio Inc.) as a template and primers (SEQ ID NO: 21: GCATGCAAGCTTGGCACTGGCCGTCG and SEQ ID NO: 22: CTGCAGGTCGACTCTAGAGGATCCCC).

[0075] (3) Amplification of genomic DNA fragments 1 kbp upstream and 1 kbp downstream of the fao1 gene Using the genomic DNA of the NBRC10243 strain obtained in Example 1(1) as a template, a 1-kbp DNA fragment upstream of the fao1 gene (SEQ ID NO: 33) was amplified using primers (SEQ ID NO: 23: GCCAAGCTTGCATGCGAAGGGGCTCTCCGAAGTACATCACTG and SEQ ID NO: 24: TGTGTCAATTCCGGAAAAACGACAGAAAAGTGCTGAGGCCGC), and a 1-kbp DNA fragment downstream of the fao1 gene was amplified using primers (SEQ ID NO: 25: TATCATCTAGATTTATATCACAAGTCACTATTTACTTGTTTA and SEQ ID NO: 26: AGAGTCGACCTGCAGCTCAATGAACTGAGACAGCAGCTTGTC).

[0076] (4) Preparation of template plasmid pbJK27 for the introduced DNA fragment The four PCR products described in Examples 2(1), (2), and (3) were purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.) to obtain DNA fragments, which were then ligated using an In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α (Nippon Gene Co., Ltd.), and the cell suspension was plated on LB agar medium containing kanamycin and incubated overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio Inc.) as the enzyme. Introduction of the target DNA fragment was confirmed using primers (SEQ ID NO: 27: CTCTTCGCTATTACGCCAGC and SEQ ID NO: 28: CACTTTATGCTTCCGGCTCG). Transformants carrying the plasmids for which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37°C. The plasmid was purified from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.) to obtain plasmid pbJK27, which contains a DNA fragment containing 1 kbp upstream of the fao1 gene, the self-excising hygromycin resistance gene expression cassette six-PgalK-βrec-Ttkt-Pgpd-HygR-Ttkt-six, and 1 kbp downstream of the fao1 gene.

[0077] (5) Preparation of DNA fragment for introduction A DNA fragment for disrupting the fao1 gene was amplified using primers (SEQ ID NO: 29: GAAGGGCTCTCCGAAGTACA and SEQ ID NO: 30: CTCAATGAACTGAGACAGCAG) with plasmid pbJK27 as a template. Each PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.).

[0078] (6) Insertion of DNA fragment into NBRC10243 strain and generation of Δfao1 strain The NBRC10243 strain was transformed by electroporation (Nepa Gene) using the DNA fragment for disrupting the fao1 gene obtained in Example 2(5). The transformed cell sap was spread on YPD+hyg agar medium (1% by mass / volume yeast extract, 2% by mass / volume tryptone, 2% by mass / volume glucose, 1.5% by mass / volume agar, 0.05% by mass / volume hygromycin) and allowed to stand at 30°C for 2 days. The resulting colonies were inoculated into 5 mL of YNB+GAL liquid medium (0.67% by mass / volume yeast nitrogen base with amino acids, 2% by mass / volume galactose) and cultured with shaking at 30°C for 2 days. The culture sap was spread on YPD agar medium (1% by mass / volume yeast extract, 2% by mass / volume tryptone, 2% by mass / volume glucose, 1.5% by mass / volume agar) and allowed to stand at 30°C for 2 days. The resulting colonies were inoculated onto YPD agar medium and YPD + hyg agar medium. Colonies that grew only on YPD agar medium were used as templates for PCR using primers (SEQ ID NO: 31: CTAAGGCCAGTACAAGAGATC and SEQ ID NO: 32: CTAAAGCTCGAATTAATAGAGACACG), and the amplified fragments were sequenced. Disruption of the fao1 gene was confirmed, and this strain was designated the Δfao1 strain.

[0079] (7) Insertion of the DNA fragment into the Δfao1 strain and generation of the Δfao1Δb0790::hyg strain The Δfao1 strain was transformed by electroporation (Nepa Gene) using the DNA fragment obtained in Example 1(6), which contained a 1-kbp upstream region of the b0790 gene, an expression cassette for a hygromycin resistance gene, and a 1-kbp downstream region of the b0790 gene. The transformed cell lysate was plated onto YPD+hyg agar medium (1% yeast extract, 2% tryptone, 2% glucose, 1.5% agar, 0.05% hygromycin) and incubated at 30°C for 2 days. PCR was performed using the resulting colonies as templates and primers (SEQ ID NOS: 16 and 17), and the amplified fragments were sequenced. After confirming that the introduced DNA fragment had been integrated into the genome, this strain was designated the Δfao1Δb0790::hyg strain. In this mutant, the expression cassette for the hygromycin resistance gene was inserted in place of the b0790 gene in the genome.

[0080] (8) Confirmation of glycolipid productivity in the Δfao1 and Δfao1Δb0790::hyg strains The Δfao1 and Δfao1Δb0790::hyg strains were inoculated into glycolipid production medium 3 (0.5% w / v trisodium citrate dihydrate, 0.4% w / v yeast extract, 0.15% w / v ammonium chloride, 0.07% w / v magnesium sulfate heptahydrate, 0.05% w / v sodium chloride, 0.027% w / v calcium chloride dihydrate, 0.1% w / v potassium dihydrogen phosphate, 0.016% w / v dipotassium dihydrogen phosphate, 15% w / v glucose, and 2.6% w / v oleyl alcohol) and cultured with shaking at 30°C. After 4 days of culture, 3 mL of the culture medium was collected, 3 mL of hexane was added, and the mixture was stirred and mixed for 5 seconds. The mixture was centrifuged at 3,000 rpm and 25°C for 5 minutes, and the hexane fraction from the supernatant was removed. Next, 3 mL of butanol was added to the remaining solution, and the mixture was stirred and mixed for 5 seconds. After 5 minutes of centrifugation at 3000 rpm and 25°C, the entire butanol fraction was recovered. An additional 3 mL of butanol was added to the remaining solution, and the same procedure was repeated to recover the entire butanol fraction. The recovered butanol fraction was volatilized by blowing nitrogen gas over it, and the weight of the dissolved precipitate was measured and defined as the Bola-type sophoroside concentration in the culture medium. The results are shown in Table 2. Compared to the Δfao1 strain, the Δfao1Δb0790::hyg strain had a 1.96-fold increase in Bola-type sophoroside concentration, confirming the improved productivity of Bola-type sophoroside.

[0081] [Table 2]

Claims

1. A mutant yeast strain of the genus Starmerella in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is suppressed or inactivated.

2. A mutant strain as described in claim 1, in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 has been deleted or inactivated.

3. A mutant strain as described in claim 2, in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1, and consisting of the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2, has been deleted or inactivated.

4. The mutant strain described in claim 1, further comprising a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 34, whose expression is suppressed or inactivated.

5. A method for producing a mutant strain of Starmerella yeast, comprising inhibiting or inactivating the expression of a polypeptide in a Starmerella yeast, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:

2.

6. The method of claim 5, comprising deleting or inactivating a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:

2.

7. The method according to claim 6, comprising deleting or inactivating a gene encoding a polypeptide consisting of a nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1, and consisting of the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:

2.

8. A method for improving the glycolipid production ability of Starmerella yeast, comprising inhibiting or inactivating the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 in Starmerella yeast.

9. The method of claim 8, comprising deleting or inactivating a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:

2.

10. The method according to claim 9, comprising deleting or inactivating a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1, and consisting of the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:

2.

11. The method according to any one of claims 8 to 10, wherein the glycolipid is selected from sophorolipids and Bola-type sophorosides.

12. A method for producing glycolipids, comprising culturing the Starmerella yeast mutant strain according to any one of claims 1 to 4.

13. The method according to claim 12, wherein the glycolipid is selected from sophorolipids and Bola-type sophorosides.

Images