Use of the BAZ2B gene as a target to alleviate aging

By downregulating the BAZ2B gene using specific inhibitors, the aging process and associated cognitive decline are mitigated, providing therapeutic targets and diagnostic markers for neurodegenerative diseases.

JP7734076B2Active Publication Date: 2025-09-04CENT FOR EXCELLENCE IN BRAIN SCI & INTELLIGENCE TECH CHINESE ACAD OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2021544870
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-01-31
Filing Date
2019-12-27
Publication Date
2025-09-04
Estimated Expiration
2039-12-27

AI Technical Summary

Technical Problem

The aging process leads to declines in physiological functions, including cognitive and motor skills, and is a major risk factor for neurodegenerative diseases like Alzheimer's, with unclear regulatory mechanisms underlying gene expression changes during aging.

Method used

Utilizing a downregulator of the BAZ2B gene, such as gene editing reagents, interfering molecules, or small molecule compounds, to inhibit BAZ2B protein activity, thereby ameliorating aging and related diseases by regulating mitochondrial function and improving memory and behavioral decline.

Benefits of technology

Downregulating BAZ2B gene expression attenuates aging, improves memory and behavioral decline, and provides a marker for diagnosing and prognosing aging-related diseases, offering potential therapeutic targets for neurodegenerative conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007734076000001
    Figure 0007734076000001
  • Figure 0007734076000002
    Figure 0007734076000002
  • Figure 0007734076000003
    Figure 0007734076000003
Patent Text Reader

Abstract

Use of the BAZ2B gene as a target for alleviating aging is provided. It has been found that the BAZ2B gene plays an important regulatory role in normal aging and the onset and progression of aging-related diseases, and that its downregulation can significantly alleviate aging and improve memory loss and behavioral function decline associated with the aging process. As a research target for aging and aging-related diseases, BAZ2B can be used for the development of drugs to inhibit or delay aging, and as a marker for the diagnosis and prognosis of aging and aging-related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention belongs to the field of biomedicine, and more particularly, the present invention relates to the use of the BAZ2B gene as a target for alleviating aging. [Background technology]

[0002] Today, the aging of society is progressing rapidly. According to a report by the World Health Organization, by 2050, one-third of the population in developing countries will be over 60 years old. The aging process leads to declines in various physiological functions, including cognitive and motor skills declines and sleep and rhythm disorders (Bishop et al., 2010; Satoh et al., 2017). This severely impacts the quality of life of older adults and places a tremendous burden on society. Aging is also a major risk factor for neurodegenerative diseases such as Alzheimer's disease (Lopez-Otin et al., 2013). Therefore, there is a pressing need to study the mechanisms underlying behavioral decline during normal aging and to identify methods to mitigate aging and its associated functional decline.

[0003] Genome-wide gene expression studies have revealed that the expression levels of many genes change significantly during brain aging. However, upregulated genes are primarily involved in functions such as stress, antioxidant function, and DNA repair; upregulated genes are primarily involved in regulating synaptic plasticity, vesicle transport, and mitochondrial function (Lu et al., 2004). These patterns of gene expression change during aging are highly conserved across species (Bishop et al., 2010; Yeoman et al., 2012), and may potentially contribute to the decline in behavioral and cognitive function in organisms during aging. However, the regulatory mechanisms underlying these changes in gene expression during aging have yet to be clearly investigated.

[0004] Environmental factors significantly influence both normal and pathological brain aging processes. Epigenetic regulators are molecules that connect environmental factors and cell signaling pathways. Numerous studies have shown that epigenetic molecules can regulate lifespan in model animals such as nematodes and honeybees (Dang et al., 2014; Greer et al., 2010; Imai and Guarente, 2014; Jin et al., 2011; Sen et al., 2016). During the aging process, epigenetic modifications, such as DNA methylation and histone modifications, significantly change (Akbarian et al., 2013; Delgado-Morales and Esteller, 2017). Changes in gene expression levels during brain aging may be driven by alterations in epigenetic modifications, but the specific regulatory mechanisms and the mechanisms by which changes in the expression of these genes cause behavioral decline remain unclear.

[0005] Thus, in this field, there is a strong need to identify genes closely related to the aging mechanism, with the aim of finding drugs that can be used as targets to regulate or alleviate aging. Summary of the Invention [Problem to be solved by the invention]

[0006] It is an object of the present invention to provide the use of the BAZ2B gene as a target for alleviating aging. [Means for solving the problem]

[0007] A first aspect of the present invention provides use of a down-regulator of the BAZ2B protein or its encoding gene in preparing a composition for ameliorating aging or preventing or treating aging-related diseases.

[0008] In one preferred embodiment, the downregulator is selected from the group consisting of: a gene editing reagent that specifically knocks out the BAZ2B coding gene; Interfering molecules that specifically disrupt the expression of the BAZ2B coding gene; a small molecule compound that specifically inhibits the BAZ2B protein or its encoding gene; or An antibody or ligand that specifically binds to the BAZ2B protein.

[0009] In another preferred embodiment, the downregulator is a gene editing reagent that specifically knocks out the BAZ2B-encoding gene, which is a gene editing reagent that recognizes the BAZ2B-encoding gene and knocks out the gene, or a construct that can express or form the gene editing reagent; preferably, the gene editing reagent comprises an sgRNA selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.

[0010] In another preferred embodiment, the interference molecule is a small interfering RNA, antisense nucleic acid, microRNA, dsRNA that targets the BAZ2B-encoding gene or its transcript for inhibition or silencing, or a construct capable of expressing or forming the small interfering RNA, antisense nucleic acid, microRNA, dsRNA; preferably, the interference molecule is an shRNA comprising the sequence of SEQ ID NO: 3.

[0011] In another preferred embodiment, the aging-related disease comprises memory decline, cognitive decline, behavioral decline, age-related weight gain, mitochondrial dysfunction, and neurodegenerative diseases (particularly aging-related neurodegenerative diseases); preferably, the neurodegenerative disease comprises Alzheimer's disease (AD).

[0012] In another preferred embodiment, the composition is further applied to increase the expression level of mitochondrial function-related genes; increase neuronal ATP levels; increase basal oxygen uptake of cells; or increase FCCP-induced maximum oxygen uptake of cells.

[0013] Another aspect of the present invention provides a method for screening for potential substances for improving aging or preventing or treating aging-related diseases, comprising: (1) treating a system in which a BAZ2B protein or its encoding gene is present with a candidate substance; and (2) detecting the expression or activity of the BAZ2B protein or its encoding gene in the system (including, but not limited to, the expression and activity of the BAZ2B protein, and the transcription and translation status of the BAZ2B encoding gene), wherein if the candidate substance can reduce the expression or activity of the BAZ2B protein or its encoding gene, the candidate substance is found to be a potential substance for improving aging or preventing or treating aging-related diseases.

[0014] In one preferred example, step (1) includes adding a candidate substance to a system in which a BAZ2B protein or its encoding gene is present in a test group; step (2) includes detecting the expression or activity of a BAZ2B protein or its encoding gene in the system of the test group and comparing it with a control group, which is an expression system of a BAZ2B protein or its encoding gene to which the candidate substance is not added; if the expression or activity of a BAZ2B protein or its encoding gene in the test group is statistically lower than that in the control group, the candidate substance is found to be a potential substance for improving aging.

[0015] In another preferred embodiment, the system is selected from the group consisting of a cellular system (eg, a cell or cell culture expressing BAZ2B), a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

[0016] In another preferred example, the term "statistically low" preferably refers to "significantly low," for example, 20% or more lower, preferably 50% or more lower, more preferably 80% or more lower.

[0017] In another preferred example, the candidate substance includes, but is not limited to, small molecule compounds designed against the BAZ2B protein or its encoding gene, interference molecules designed against signal transduction pathways involving the BAZ2B protein or its encoding gene or proteins upstream or downstream thereof, nucleic acid inhibitors, binding molecules (e.g., antibodies or ligands), etc.

[0018] In another preferred embodiment, the method further comprises conducting cell and / or animal tests on the obtained potential substances to further select and identify substances useful for improving aging or preventing and treating aging-related diseases from the candidate substances.

[0019] Another aspect of the present invention provides a pharmaceutical composition for ameliorating aging or preventing or treating aging-related diseases, comprising a downregulator of the BAZ2B protein or its encoding gene and a pharmaceutically acceptable carrier.

[0020] In another preferred example, the downregulator is a gene editing reagent that specifically knocks out the BAZ2B-encoding gene, which is a gene editing reagent that recognizes the BAZ2B-encoding gene and knocks out the gene, or a construct that can express or form the gene editing reagent; more preferably, the gene editing reagent includes an sgRNA selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2; or the downregulator is an interference molecule shRNA including the sequence of SEQ ID NO: 3.

[0021] Another aspect of the present invention provides a kit for improving aging or preventing or treating aging-related diseases, comprising the pharmaceutical composition.

[0022] Another aspect of the present invention provides use of a reagent that specifically recognizes the BAZ2B protein or its encoding gene in the preparation of a reagent or kit for diagnosing or prognostic evaluation of aging or aging-related diseases.

[0023] In one preferred embodiment, the reagent that specifically recognizes the BAZ2B protein or its encoding gene is selected from the group consisting of primers that specifically amplify the encoding gene of the BAZ2B protein; probes that specifically recognize the encoding gene of the BAZ2B protein; and antibodies or ligands that specifically bind to the BAZ2B protein. Other aspects of the present invention will be apparent to those skilled in the art from the disclosure herein. [Brief explanation of the drawings]

[0024] [Figure 1] Changes in BAZ2B expression levels during aging and its relationship to AD disease progression. A, BAZ2B expression increases during aging. Data in the left panel are from the human brain gene expression database GSE1572, and data in the right panel are from database GSE44772. B, BAZ2B expression in the prefrontal cortex of AD patients is significantly increased compared with age-matched healthy elderly subjects; data are from database GSE5281. C&D, BAZ2B expression is significantly positively correlated with late-onset AD disease progression, including Braak stage and degree of anterior cortical atrophy. Significance is indicated by ***P<0.001 (unpaired Student's t-test). [Figure 2] Baz2b knockout can delay age-dependent weight gain in mice. A, Representative photographs of Baz2b knockout heterozygous, homozygous, and wild-type mice at young and old ages. B, Statistical analysis of body weights of Baz2b knockout heterozygous, homozygous, and wild-type mice at young (approximately 2.5 months) and old (approximately 19 months) ages. Significance is indicated by *P<0.05 (one-way ANOVA Dunnett's test). [Figure 3]Baz2b knockout improves spatial learning and memory in aged mice. A: Schematic diagram of the measurement of spatial learning and memory in aged mice (18-24 months) using the Barnes maze. The target hole is indicated in red. B: Statistical analysis of the time required for each genotype mouse to find the target hole over four consecutive days of training. C: Statistical analysis of the time required for each genotype mouse to first find the target hole in the exploration experiment on day 5. D: Statistical analysis of the number of times each genotype mouse explored the target hole in the exploration experiment on day 5. Significance is indicated by *P<0.05 (one-way ANOVA Dunnett's test). [Figure 4] Baz2b regulates mitochondrial function in mouse neurons. A. Chromatin immunoprecipitation-quantitative PCR assay demonstrated that Baz2b binds to the promoter regions of mitochondrial function-related genes. Experiments were performed using HEK293T cells overexpressing Baz2b-Flag. B. Reducing Baz2b expression in ex vivo cultured mouse cerebellar neurons increased the expression levels of mitochondrial function-related genes. C. Reducing Baz2b expression increased ATP levels in mouse cerebellar neurons. D. Reducing Baz2b expression increased the basal oxygen uptake and FCCP-induced maximal oxygen uptake in mouse cerebellar neurons. E. Overexpressing Baz2b in ex vivo cultured mouse cortical neurons decreased ATP levels in the neurons. F. Overexpressing Baz2b in ex vivo cultured mouse cortical neurons decreased the basal oxygen uptake and FCCP-induced maximal oxygen uptake in the neurons. Significance is indicated by *P<0.05, **P<0.01, ***P<0.001 (Student's t-test). DETAILED DESCRIPTION OF THE INVENTION

[0025] Specific Embodiments Through extensive and in-depth research, the inventors have found that the bromodomain adjacent to zinc finger domain protein 2B (BAZ2B) gene plays an important regulatory role in normal aging and the onset and progression of aging-related diseases, and that downregulation of the BAZ2B gene significantly attenuates aging and improves memory and behavioral decline during the aging process. Therefore, BAZ2B can be used as a research target for aging and aging-related diseases, for the development of drugs to inhibit or delay aging, and as a marker for the diagnosis and prognosis of aging and aging-related diseases.

[0026] BAZ2B protein and its coding gene The specific function of the BAZ2B protein is currently unclear in this field. BAZ2B contains a DNA-binding domain, a PHD zinc finger domain, and a BROMO domain that can bind to acetylated histones. The functions of these domains suggest that BAZ2B may play an epigenetic regulatory role. Research reports that its homologous protein, BAZ2A, is a component of a chromatin remodeling complex that binds to DNA and plays a role in transcriptional repression.

[0027] In the present invention, the term "BAZ2B protein" refers to a protein having the sequence shown in SEQ ID NO: 4 (human) or SEQ ID NO: 5 (mouse) (these gene sequences are GenBank NM_013450 (human) and GenBank NM_001001182 (mouse), respectively). The term also includes mutant forms of the sequence that have similar functions to the BAZ2B protein. These mutant forms include, but are not limited to, deletion, insertion, and / or substitution of a small number of amino acids (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10, even more preferably 1 to 8, or 1 to 5), as well as addition or deletion of one or more amino acids (usually 20 or less, preferably 10 or less, more preferably 5 or less) at the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids with close or similar properties usually does not alter the function of the protein. Also, for example, the addition or deletion of one or more amino acids at the C-terminus and / or N-terminus does not normally alter the function of the protein. The term also includes active fragments and active derivatives of the BAZ2B protein.

[0028] Polynucleotide sequences (coding sequences) encoding the BAZ2B protein or its conservative variants are also applicable to the present invention. The term "coding gene" may refer to a polynucleotide that encodes the protein, but may also include additional coding and / or non-coding sequences. The BAZ2B protein is highly conserved among mammals, and its mouse-derived protein and human-derived protein share high sequence homology.

[0029] By analyzing a human brain gene expression database, we found that BAZ2B gene expression levels in the prefrontal cortex increased with aging. Furthermore, by analyzing a gene expression database of the prefrontal cortex of age-matched AD (Alzheimer's disease) patients and healthy elderly individuals, we found that BAZ2B gene expression levels were significantly elevated in AD patients and that BAZ2B expression levels were significantly positively correlated with late-onset AD disease progression, such as Braak stage and the degree of anterior cortical atrophy. During aging, the body weight of wild-type mice increased with age, and the body weight of Baz2b knockout mice was significantly lower than that of wild-type mice at older ages. However, there was little difference in body weight between Baz2b knockout and wild-type mice at younger ages. Furthermore, knockout of Baz2b significantly improved spatial learning and memory functions in aged mice. Through mechanistic studies, we found that Baz2b binds to the promoter regions of mitochondrial function-related genes, regulating the expression of these genes and thereby regulating mitochondrial function in neurons. These results reveal that Baz2b plays an important role in normal and pathological brain aging processes, and Baz2b can be applied as a target for developing useful drugs and tools to promote healthy aging in organisms.

[0030] BAZ2B Downregulators and Uses Thereof Based on the above-mentioned novel discovery by the present inventors, the present invention provides use of a downregulator of BAZ2B protein or its encoding gene in the preparation of a pharmaceutical composition for ameliorating aging or preventing or treating aging-related diseases, including, but not limited to, memory decline, cognitive decline, behavioral decline, age-related weight gain, mitochondrial dysfunction, neurodegenerative diseases (particularly aging-related neurodegenerative diseases), diabetes, and cancer.

[0031] As used herein, down-regulators of the BAZ2B protein or its encoding gene include suppressors, antagonists, inhibitors, blockers, etc., and these terms are used interchangeably.

[0032] The downregulator of the BAZ2B protein or its encoding gene refers to any substance that can reduce the activity of the BAZ2B protein, reduce the stability of the BAZ2B protein or its encoding gene, downregulate the expression of the BAZ2B protein, shorten the effective time of the BAZ2B protein, or inhibit the transcription and translation of the BAZ2B gene. Any of these substances can be used in the present invention to downregulate BAZ2B and improve aging or prevent or treat aging-related diseases. For example, the downregulator can be an interfering RNA molecule or antisense nucleotide that specifically interferes with the expression of the BAZ2B gene, or an antibody or ligand that specifically binds to the protein encoded by the BAZ2B gene.

[0033] In one embodiment of the present invention, the down-regulator may be a small molecule compound that targets BAZ2B. Those skilled in the art can screen for such small molecule compounds using screening methods commonly used in the art.

[0034] In one embodiment of the present invention, the downregulator may be a BAZ2B-specific interfering RNA molecule (shRNA). As will be understood by those skilled in the art, such interfering RNA molecules can be prepared or obtained based on the BAZ2B gene sequence provided in the present invention. The method for preparing interfering RNA molecules is not particularly limited and includes, but is not limited to, chemical synthesis and in vitro transcription. The interfering RNA can be delivered to cells using an appropriate transfection reagent or various techniques known in the art.

[0035] In one preferred embodiment of the present invention, targeted gene editing using the CRISPR / Cas (e.g., Cas9) system can be used to knock out the BAZ2B gene in a target disease region. A common method for knocking out the BAZ2B gene is to co-transfect an sgRNA or a nucleic acid capable of forming the sgRNA with Cas9 mRNA or a nucleic acid capable of forming the Cas9 mRNA into a target region or target cell. After determining the target site, the sgRNA and Cas9 can be introduced into cells using known methods. The nucleic acid capable of forming the sgRNA is a nucleic acid construct or expression vector, or the nucleic acid capable of forming the Cas9 mRNA is a nucleic acid construct or expression vector. Introducing these expression vectors into cells results in the formation of active sgRNA and Cas9 mRNA in the cells. Particularly preferably, the gene editing reagent is an sgRNA selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2, which has excellent targeting ability and, as demonstrated in the examples, has a significant anti-aging effect.

[0036] Use in the diagnosis and prognosis assessment of age-related diseases The present invention has revealed that BAZ2B plays an important regulatory role in normal aging and the onset and progression of AD disease. For example, as demonstrated in the Examples, BAZ2B expression levels are significantly positively correlated with late-onset AD disease progression, such as Braak stage and the degree of anterior cortical atrophy.

[0037] Based on the above-mentioned novel findings by the present inventors, BAZ2B can be used as a marker for the diagnosis and prognosis evaluation of aging-related diseases, and can be applied to (i) classification, differential diagnosis, and / or sensitivity analysis of aging-related diseases, and (ii) evaluation of therapeutic drugs, drug therapeutic effects, prognosis, and selection of appropriate treatment methods for aging-related diseases in relevant human populations. For example, isolation of human populations with abnormalities in BAZ2B gene expression can enable more targeted treatment.

[0038] By determining the expression or activity of BAZ2B in the sample to be evaluated, the prognosis of the aging-related disease of the subject who provided the sample to be evaluated can be predicted, and appropriate drugs can be selected for treatment. Usually, a threshold value of BAZ2B can be specified, and if the expression status of BAZ2B is higher than the specified threshold, a BAZ2B inhibition regimen can be used for treatment. The threshold value can be easily determined by those skilled in the art. For example, the threshold value of abnormal BAZ2B expression can be obtained by comparing the expression status of BAZ2B in cells or tissues of healthy individuals with the expression status of BAZ2B in cells or tissues of patients.

[0039] Thus, the present invention provides use of the BAZ2B protein or its encoding gene in the preparation of a reagent or kit for diagnosing or prognostic evaluation of aging or aging-related diseases.

[0040] The presence or absence and expression status of the BAZ2B gene can be detected using various techniques known in the art, all of which are encompassed by the present invention. For example, existing techniques such as Southern blotting, Western blotting, DNA sequence analysis, and PCR can be used, and these methods can be used in combination.

[0041] The present invention further provides a reagent for detecting the presence or absence and expression status of BAZ2B protein or its encoding gene in an analyte. Preferably, when detecting at the gene level, the presence or absence of the BAZ2B gene can be determined using primers that specifically amplify BAZ2B or a probe that specifically recognizes BAZ2B; when detecting at the protein level, the expression status of BAZ2B protein can be determined using an antibody or ligand that specifically binds to the protein encoded by BAZ2B.

[0042] Designing a probe specific to the BAZ2B gene is a technique well known to those skilled in the art, and examples include preparing a probe that can specifically bind to a specific site in the BAZ2B gene but does not specifically bind to genes other than the BAZ2B gene, and that has a detectable signal.

[0043] A method for detecting the expression status of BAZ2B protein in an analyte using an antibody that specifically binds to BAZ2B protein is also a technique well known to those skilled in the art.

[0044] The present invention further provides a kit for detecting the presence or absence and expression status of BAZ2B protein in an analyte, the kit comprising primers that specifically amplify the BAZ2B gene, a probe that specifically recognizes the BAZ2B gene, or an antibody or ligand that specifically binds to the protein encoded by the BAZ2B gene.

[0045] The kit may further include various reagents necessary for DNA extraction, PCR, hybridization, color development, etc., including, but not limited to, extraction solutions, amplification solutions, hybridization solutions, enzymes, control solutions, color development solutions, washing solutions, etc. The kit may further include an instruction manual and / or nucleic acid sequence analysis software.

[0046] Drug screening Given the close relationship between BAZ2B overexpression and aging and aging-related diseases, we can screen for substances that inhibit the expression or activity of BAZ2B protein or its encoding gene based on this characteristic, and from these substances, we can find truly useful drugs for improving aging or preventing and treating aging-related diseases.

[0047] Therefore, the present invention provides a method for screening for potential substances for ameliorating aging or preventing or treating aging-related diseases, comprising treating a BAZ2B expression system with a candidate substance and detecting BAZ2B expression or activity in the system, wherein the candidate substance is found to be a potential substance for ameliorating aging or preventing or treating aging-related diseases if it can inhibit BAZ2B expression or activity. The BAZ2B expression system is preferably a cell (or cell culture) system, and the cells may be cells that endogenously express BAZ2B or cells that recombinantly express BAZ2B.

[0048] In a preferred embodiment of the present invention, a control group, which is a BAZ2B expression system to which the candidate substance is not added, can be set up during screening to more easily observe changes in BAZ2B expression or activity.

[0049] In a preferred embodiment of the present invention, the method further comprises conducting further cell and / or animal testing on the obtained potential substances to further select and identify substances that are truly useful for improving aging or preventing or treating aging-related diseases.

[0050] Meanwhile, the present invention further provides potential substances for ameliorating aging or preventing and treating aging-related diseases, obtained using the screening method. These initially screened substances can constitute a screening library, which can ultimately contribute to the screening of substances that inhibit the expression and activity of BAZ2B, thereby being useful for ameliorating aging or preventing and treating aging-related diseases.

[0051] Pharmaceutical Composition The present invention further provides a pharmaceutical composition comprising an effective amount (e.g., 0.000001 to 50 wt%; preferably 0.00001 to 20 wt%; more preferably 0.0001 to 10 wt%) of the BAZ2B protein or a downregulator of the gene encoding it, and a pharmaceutically acceptable carrier.

[0052] In one preferred embodiment, the present invention provides a composition for ameliorating aging or preventing or treating aging-related diseases, comprising an effective amount of a downregulator of the BAZ2B protein or its encoding gene and a pharmaceutically acceptable carrier. Preferably, the downregulator is a gene-editing reagent that specifically knocks out the BAZ2B-encoding gene, such as a gene-editing reagent that recognizes and knocks out the BAZ2B-encoding gene, or a construct that can express or form the gene-editing reagent.

[0053] As used herein, the term "effective amount" refers to an amount that is functional or active in humans and / or animals and acceptable to humans and / or animals. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent, including various excipients and diluents. This term refers to a pharmaceutical carrier that is not a necessary active ingredient itself and is not excessively toxic after use. Suitable carriers are well known to those skilled in the art. In compositions, pharmaceutically acceptable carriers may include liquids such as water, saline, and buffer solutions. Furthermore, these carriers may contain auxiliary substances such as fillers, lubricants, flow agents, wetting agents, emulsifiers, and pH buffering substances. The carrier may also include a cell transfection reagent.

[0054] Once the use of the downregulator of the BAZ2B protein or its encoding gene is known, the downregulator, its encoding gene, or a pharmaceutical composition thereof can be administered to a mammal or human using several methods well known in the art.

[0055] Preferably, gene therapy methods may be employed. For example, a BAZ2B downregulator can be directly administered to a subject by injection or other methods; alternatively, an expression unit (such as an expression vector, virus, or siRNA) carrying a BAZ2B downregulator can be delivered to a target via a specific route and allowed to express the downregulator of activity; the specific circumstances depend on the type of the downregulator, and all of these are well known to those skilled in the art.

[0056] The effective dose of the downregulator of the BAZ2B protein or its encoding gene according to the present invention varies depending on the administration pattern, the severity of the disease to be treated, etc. Selection of a preferred effective dose can be determined by those skilled in the art (e.g., through clinical trials) based on various factors, including, but not limited to, the bioavailability, metabolism, and pharmacokinetic parameters (e.g., half-life) of the downregulator of the BAZ2B protein or its encoding gene, the severity of the disease to be treated in the patient, the patient's body weight, the patient's immune status, and the administration route.

[0057] The present invention further provides a kit comprising the pharmaceutical composition or the down-regulator of the BAZ2B protein or its encoding gene, and may further comprise an instruction manual for use of the drug in the kit. [Example]

[0058] The present invention will be further described below with reference to specific examples. These examples are used to explain the present invention and should not be construed as limiting the scope of the present invention. Experimental methods for which specific conditions are not specifically described in the following examples may be carried out under the conditions described in, for example, J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, Scientific Press, 2002, or under the conditions recommended by the manufacturer.

[0059] I. Materials and Methods 1. Construction of Baz2b knockout mice using CRISPR / Cas9 The mouse Baz2b gene has 14 transcripts, four of which encode proteins: two long transcripts and two very short transcripts. The proteins encoded by the two long transcripts are identical, and sgRNAs were designed in the exon region where the ATG initiation codon is located: sgRNA1:ATCATCTTCTGCTCCTTCCGTGG (SEQ ID NO: 1); sgRNA2: AGATGATGTTGGTGTAGTGGAGG (SEQ ID NO: 2); The sgRNA was constructed into the HP180 Cass9 plasmid (two constructs were constructed separately in the plasmid), and the sgRNA and cas9 mRNA were transcribed in vitro (two transcribed separately and mixed 1:1), then injected into mouse fertilized eggs to obtain F0 generation mice. The genotypes of the F0 generation mice were determined using PCR, and genotype knockout homozygous mice were obtained by crossbreeding.

[0060] 2. Chromatin Immunoprecipitation HEK293T cells stably expressing Baz2b::3FLAG were used for chromatin immunoprecipitation experiments. Overgrown HEK293T cells in 100 mm Petri dishes were harvested and fixed with 1% formaldehyde. The cells were lysed on ice using a lysis solution containing 10 mM Tris-HCl, pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% sodium deoxycholate, 0.5% N-lauroylsarcosine, 0.2% SDS, and a protease inhibitor cocktail (Roche). Genomic DNA was then disrupted using a Bioruptor ultrasonic disruptor. The supernatant samples, which were centrifuged after sonication, were immunoprecipitated with anti-Flag (Sigma F3165) antibody and the corresponding species IgG and protein A / G Sepharose beads. After digestion with proteinase K and decrosslinking, the DNA was extracted and purified by ethanol precipitation and used for qPCR detection.

[0061] 3. Culture of mouse primary neurons Cortical neurons were isolated from E13.5 C57 mice. Mouse cortical tissue was dissected in 1x HBSS (Thermo 14175095) buffer and digested with 2 mg / ml papain (Worthington LS003119) at 37°C for 10 minutes. The digestion solution was removed, and DMEM medium containing 10% fetal bovine serum and 1% P / S was added to stop the digestion. The tissue was gently flicked with a pipette to dissociate single cells. The cell suspension was then filtered through a 40 μm mesh sieve and centrifuged at 1000 rpm for 5 minutes. After resuspending the cells in PM medium (Neurobasal, 2% B27 supplement, 1% Glutamax, 1% penicillin-streptomycin, 5% FBS), the cells were counted, and the required amount of cells was transfected with the appropriate expression plasmid by cell electroporation. After nuclear transfection, cells were seeded at an appropriate density onto PDL and laminin-coated culture plates and cultured. After 24 hours, half of the medium was replaced with serum-free medium (Neurobasal, 2% B27 supplement, 1% Glutamax, 1% penicillin-streptomycin).

[0062] 4. ATP level detection ATP level detection requires approximately 6 × 10 5 Primary cultured mouse neurons were required. First, adherent cultured cells were washed once with 1x PBS and lysed in 300 μl of lysis solution (10 mM Tris, 1 mM EDTA, 0.5% Triton-X100) on ice for 5 minutes. The cells were transferred to a 1.5 ml EP tube by flicking evenly and allowed to lyse for 10 minutes at 4°C. Then, the cells were centrifuged at 2000 x g for 10 minutes at 4°C. A 75 μl aliquot of the supernatant was used to detect protein concentration using the BCA method. A 40 μl aliquot was diluted 10-fold and used to detect ATP levels using the CellTiter-Glo (Promega G7570) kit. The ratio of ATP content to protein content was used to analyze ATP levels in cells from different treatment groups.

[0063] 5. Mouse behavioral experiments The Barnes maze experiment was used to examine the spatial learning and memory functions of aged mice. Experimental mice were approximately 24 months old, and mice of different genotypes were obtained from littermates. Mice were first trained to find the target hole, four times a day, with 15-minute intervals between each training session, for four consecutive days. On the fifth day, the mice's ability to find the target hole was measured, reflecting their spatial learning and memory functions. The time required for the mice to first find the target hole and the number of times they explored the target hole were statistically analyzed. The behavioral experiments were double-blind and in accordance with animal ethics.

[0064] II. Working Examples Example 1: Expression of the BAZ2B gene The BAZ2B gene is expressed widely in tissues such as bone marrow, lung, and brain. By analyzing the human brain gene expression databases GSE1572 and GSE44772, we found that the expression level of the BAZ2B gene in the anterior cortex increases with age (Fig. 1A). Furthermore, by analyzing the gene expression database in the prefrontal cortex of AD patients and healthy elderly people, we found that the expression level of the BAZ2B gene was significantly increased in AD patients compared to healthy elderly people of the same age (Figure 1B). By analyzing changes in BAZ2B gene expression during the progression of AD, we found that BAZ2B expression levels were significantly positively correlated with late-onset AD progression, such as Braak stage and the degree of anterior cortical atrophy (Fig. 1C, D). These results suggest that BAZ2B plays an important regulatory role in normal aging and the onset and progression of AD disease, and also demonstrate that BAZ2B can be targeted for the diagnosis and prognosis of aging or aging-related diseases.

[0065] Example 2: Baz2b knockout can improve learning function in aging animals To investigate the regulatory role of the Baz2b gene in animal aging, we constructed Baz2b knockout mice using the CRISPR / Cas9 method. For behavioral analysis, Baz2b knockout heterozygous mice were bred to obtain littermates of Baz2b knockout heterozygous, homozygous, and wild-type mice. We analyzed the behavior of Baz2b knockout heterozygous, homozygous, and wild-type mice during the aging process. We found that wild-type mice showed age-dependent weight gain, and that the body weights of young Baz2b knockout heterozygous, homozygous, and wild-type mice were not significantly different (Fig. 2A, B). However, the body weights of old Baz2b knockout mice were significantly lower than those of wild-type mice. In a Barnes maze experiment, we examined the spatial learning and memory functions of aged mice. Over 4 consecutive days of training, Baz2b knockout mice found the target hole faster than wild-type mice (Fig. 3A, B). In a search experiment on day 5, Baz2b knockout mice found the target hole faster (Fig. 3C) and also explored the target more frequently (Fig. 3D). These results demonstrate that Baz2b gene knockout can improve spatial learning and memory functions in aged mice.

[0066] Example 3: Study of the mechanism by which Baz2b improves behavioral decline during aging Next, we will investigate the potential mechanisms by which Baz2b exerts its function in ameliorating behavioral decline during the aging process. Because Baz2b contains a DNA-binding domain, we used chromatin immunoprecipitation quantitative PCR to detect which genes it binds to. As shown in the results, Baz2b can bind to the promoter regions of mitochondrial function-related genes (Figure 4A). We found that treatment of mouse cerebellar primary neurons with shRNA (5'-GGCTCTTTCTCCAAGTTAA-3' (SEQ ID NO: 3)) reduced Baz2b expression, thereby increasing the expression levels of mitochondrial function-related genes (Fig. 4B), thereby improving neuronal ATP levels (Fig. 4C), as well as basal and FCCP-induced maximal oxygen uptake (Fig. 4D). Since Baz2b expression increases during brain aging, we investigated the effects of overexpressing Baz2b in primary mouse cortical neurons by electroporation to mimic the aging process. As shown, overexpression of Baz2b significantly reduced ATP levels and cellular oxygen uptake in mouse cortical neurons (Figure 4E, F). These results suggest that Baz2b protein regulates mitochondrial function in cells by binding to and regulating the expression of mitochondrial function-related genes, thereby regulating behavioral decline during the aging process.

[0067] Example 4, Drug Screening Installation: Test group: cerebellar primary neuronal cells (in which Baz2b was endogenously expressed) and administered with candidate substances; Control group: cerebellar primary neuronal cells (in which Baz2b was endogenously expressed) and no candidate substance was administered; The expression of Baz2b in the test group and the control group was detected and compared. If the expression of Baz2b in the test group was statistically lower (e.g., 30% or more) than that in the control group, it suggested that the candidate substance was a useful reagent for alleviating aging or preventing or treating aging-related diseases.

[0068] All documents related to the present invention are incorporated herein by reference as if each document were individually incorporated by reference. After reading the above disclosure of the present invention, those skilled in the art will be able to make various variations and modifications to the present invention, and it should be understood that equivalents thereof are also within the scope of the claims of the present application.

[0069] References: Akbarian, S., Beeri, MS, and Haroutunian, V. (2013). Epigenetic determinants of healthy and diseased brain aging and cognition. JAMA Neurol 70, 711-718. Bishop, NA, Lu, T., and Yankner, BA (2010). Neural mechanisms of aging and cognitive decline. Nature 464, 529-535. Dang, W., Sutphin, GL, Dorsey, JA, Otte, GL, Cao, K., Perry, RM, Wanat, JJ, Saviolaki, D., Murakami, CJ, Tsuchiyama, S., et al. (2014). Inactivation of yeast Isw2 chromatin remodeling enzyme mimics longevity effect of calorie restriction via induction of genotoxic stress response. Cell Metab 19, 952-966. Delgado-Morales, R., and Esteller, M. (2017). Opening up the DNA methylome of dementia. Mol Psychiatr 22, 485-496. Greer, E.L., Maures, T.J., Hauswirth, A.G., Green, E.M., Leeman, D.S., Maro, G.S., Han, S., Banko, M.R., Gozani, O., and Brunet, A. (2010). Members of the H3K4 trimethylation complex regulate lifespan in a germline-dependent manner in C. elegans. Nature 466, 383-387. Imai, S., and Guarente, L. (2014). NAD+ and sirtuins in aging and disease. Trends Cell Biol 24, 464-471. Jin, C., Li, J., Green, C.D., Yu, X., Tang, X., Han, D., Xian, B., Wang, D., Huang, X., Cao, X., et al. (2011). Histone demethylase UTX-1 regulates C. elegans life span by targeting the insulin / IGF-1 signaling pathway. Cell Metab 14, 161-172. Lopez-Otin, C., Blasco, M.A., Partridge, L., Serrano, M., and Kroemer, G. (2013). The hallmarks of aging. Cell 153, 1194-1217. Lu, T., Pan, Y., Kao, S.Y., Li, C., Kohane, I., Chan, J., and Yankner, B.A. (2004). Gene regulation and DNA damage in the ageing human brain. Nature 429, 883-891. Satoh, A., Imai, S., and Guarente, L. (2017). The brain, sirtuins, and ageing. Nat Rev Neurosci 18, 362-374. Sen, P., Shah, P.P., Nativio, R., and Berger, S.L. (2016). Epigenetic Mechanisms of Longevity and Aging. Cell 166, 822-839. Yeoman, M., Scutt, G., and Faragher, R. (2012). Insights into CNS ageing from animal models of senescence. Nat Rev Neurosci 13, 435-445.

Claims

1. Use of a down-regulator of BAZ2B protein or its encoding gene in the preparation of a composition for ameliorating, preventing or treating an age-related disease; the down-regulator is selected from the group consisting of: a gene editing reagent that specifically knocks out the BAZ2B-encoding gene; or an interference molecule that specifically inhibits the expression of the BAZ2B-encoding gene; the gene-editing reagent recognizes the BAZ2B-encoding gene and knocks out the gene; or is a construct capable of expressing or forming the gene-editing reagent; The interfering molecule is a small interfering RNA, an antisense nucleic acid, or a dsRNA that targets the BAZ2B-encoding gene or its transcript for inhibition or silencing, or a construct capable of expressing or forming the small interfering RNA, the antisense nucleic acid, or the dsRNA; the aging-related disease is selected from the group consisting of memory decline, cognitive decline, behavioral decline, neuronal mitochondrial dysfunction, and Alzheimer's disease; The use, characterized in that the BAZ2B protein is overexpressed in neurons of the aging-related disease.

2. The use of claim 1, wherein the gene editing reagent comprises an sgRNA selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:

2.

3. The use according to claim 1, characterized in that the interfering molecule is an shRNA comprising the sequence of SEQ ID NO:

3.

4. The use described in claim 1, characterized in that the aging-related disease includes Alzheimer's disease, memory decline, cognitive decline, or behavioral decline.

5. The composition further comprises: Enhanced expression levels of mitochondrial function-related genes in neurons; Increased neuronal ATP levels; Improving basal oxygen uptake in neurons; The use according to claim 1, characterized in that it is applied to improve the maximal oxygen uptake induced by FCCP in neurons.

6. (1) treating a system in which a BAZ2B protein or its encoding gene is present with a candidate substance; (2) detecting the expression or activity of BAZ2B protein or its encoding gene in the system; wherein the system is a cell system expressing a BAZ2B protein, the cells endogenously expressing BAZ2B or expressing recombinant BAZ2B, and the cells are neuronal cells; and when the candidate substance can reduce the expression or activity of the BAZ2B protein or its encoding gene, the candidate substance is indicated as a potential substance for ameliorating, preventing, or treating an aging-related disease; the aging-related disease is selected from the group consisting of memory decline, cognitive decline, behavioral decline, neuronal mitochondrial dysfunction, and Alzheimer's disease; A method for screening a potential substance for improving, preventing or treating an aging-related disease, wherein the BAZ2B protein is overexpressed in neurons of the aging-related disease.

7. Step (1) comprises adding a candidate substance to a system in which a BAZ2B protein or its encoding gene is present in a test group; Step (2) comprises detecting the expression or activity of the BAZ2B protein or its encoding gene in the system of the test group, and comparing it with a control group, which is an expression system of the BAZ2B protein or its encoding gene to which the candidate substance is not added; 7. The method of claim 6, wherein if the expression or activity of BAZ2B protein or its encoding gene in the test group is statistically lower than that in the control group, the candidate substance is indicated to be a potential substance for ameliorating, preventing or treating aging-related diseases, The method further comprises conducting animal testing of the potential substance to further select and determine a substance useful for improving, preventing or treating aging-related diseases, wherein the animal testing detects spatial learning and memory function in aged mice using the Barnes maze test.

8. A pharmaceutical composition for ameliorating, preventing, or treating an aging-related disease, comprising a down-regulator of a BAZ2B protein or its encoding gene and a pharmaceutically acceptable carrier, The down-regulator is a gene editing reagent that specifically knocks out the BAZ2B-encoding gene, and the gene editing reagent is a gene editing reagent that recognizes the BAZ2B-encoding gene and knocks out the gene; or a construct that can express or form the gene editing reagent; or the down-regulator is an interference molecule that specifically inhibits the expression of the BAZ2B-encoding gene, and the interference molecule is a small interfering RNA, an antisense nucleic acid, or a dsRNA that targets the BAZ2B-encoding gene for inhibition or silencing, or a construct that can express or form the small interfering RNA, the antisense nucleic acid, or the dsRNA; The aging-related disease is selected from the group consisting of memory decline, cognitive decline, behavioral decline, neuronal mitochondrial dysfunction, and Alzheimer's disease; and the BAZ2B protein is overexpressed in neurons of the aging-related disease.

9. The pharmaceutical composition of claim 8, wherein the gene editing reagent comprises an sgRNA selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2; or the downregulator is an interference molecule shRNA comprising the sequence of SEQ ID NO:

3.

10. A kit for improving, preventing, or treating an aging-related disease, comprising the pharmaceutical composition according to claim 8, The aging-related disease is selected from the group consisting of memory decline, cognitive decline, behavioral decline, neuronal mitochondrial dysfunction, and Alzheimer's disease; and the BAZ2B protein is overexpressed in neurons of the aging-related disease.

Citation Information

Patent Citations

  • Small Molecule Transcription Modulators of Bromodomains

    US20170107218A1