Oligonucleotide compositions and methods for making same

A solid-phase synthesis method for oligonucleotides with N3'→P5' phosphoramidate and thiophosphoramidate linkages addresses inefficiencies in existing methods, resulting in higher purity and improved antisense agent efficacy for targeting telomerase.

JP7736489B2Active Publication Date: 2025-09-09GERON CORP
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2021144677
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2015-04-23
Filing Date
2021-09-06
Publication Date
2025-09-09
Estimated Expiration
2035-04-29

AI Technical Summary

Technical Problem

Existing methods for producing oligonucleotides with N3'→P5' phosphoramidate and N3'→P5' thiophosphoramidate linkages are inefficient and result in high impurity levels, limiting their effectiveness as antisense agents for targeting telomerase activity in diseases like cancer.

Method used

A solid-phase method for synthesizing oligonucleotides through successive coupling cycles, including deprotection, nucleophilic catalyst-assisted linkage formation, and oxidation to create N3'→P5' phosphoramidate and N3'→P5' thiophosphoramidate intersubunit linkages, reducing impurities and enhancing the purity of the oligonucleotides.

Benefits of technology

The method produces oligonucleotides with reduced impurities, allowing for higher purity and improved efficacy as antisense agents targeting human telomerase, thereby enhancing therapeutic potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007736489000082
    Figure 0007736489000082
  • Figure 0007736489000083
    Figure 0007736489000083
  • Figure 0007736489000084
    Figure 0007736489000084
Patent Text Reader

Abstract

To provide a solid phase method of making oligonucleotides via sequential coupling cycles including at least one coupling of a dinucleotide dimer subunit to a free 3'-terminal group of a growing chain.SOLUTION: The oligonucleotides include at least two nucleoside subunits joined by a N3'→P5' phosphoramidate linkage. The method may include the steps of (a) deprotecting the protected 3'-amino group of a terminal nucleoside attached to a solid phase support, the deprotection forming a free 3'-amino group; (b) contacting the free 3'-amino group with a 3'-protected amino-dinucleotide-5'-phosphoramidite dimer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidite linkage; and (c) oxidizing the linkage.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Interconversion of related applications Pursuant to 35 U.S.C. §119(e), this application claims priority to the filing dates of U.S. Provisional Patent Application No. 61 / 987,396, filed May 1, 2014, and U.S. Provisional Patent Application No. 62 / 151,909, filed April 23, 2015 (Attorney Reference No. 185 / 002X), the disclosures of which are incorporated herein by reference. [Background technology]

[0002] Introduction Nucleic acid polymer chemistry plays a role in many developing technologies in the fields of medicine, diagnostics, and analytics, more specifically in the subareas of antisense and antigene therapy, combinatorial chemistry, branched DNA signal amplification, and array-based DNA diagnostics and analytics. Some of this polymer chemistry is directed toward improving the binding strength, specificity, and nuclease resistance of natural nucleic acid polymers such as DNA. Peptide nucleic acid (PNA), phosphorothioate, methylphosphonate, and phosphoramidate internucleotide linkages are examples of some polymer chemistries that can be applied to oligonucleotides to provide one or more desirable properties, such as nuclease resistance, cellular uptake, and solubility.

[0003] Oligonucleotide N3'→P5' phosphoramidates can form stable duplexes with complementary DNA and RNA strands, as well as stable triplexes with DNA duplexes, and are resistant to nucleases. Oligonucleotide N3'→P5' thiophosphoramidates have found use as potent antisense agents both in vitro and in vivo. For example, because cancer cells express telomerase activity and normal human somatic cells lack biologically relevant levels of telomerase activity, oligonucleotides containing compounds that inhibit telomerase activity can be used to treat telomerase-mediated diseases such as cancer. As such, methods for preparing and isolating such oligonucleotides are of interest. Summary of the Invention [Means for solving the problem]

[0004] The present disclosure provides a solid-phase method for producing oligonucleotides through successive coupling cycles, including at least one coupling of a dinucleotide dimer subunit to a free 3'-terminal group (e.g., a 3'-hydroxyl group or a 3'-amino group) of a growing chain. The subject method includes producing an oligonucleotide in which at least two of the nucleoside subunits are linked by an N3'→P5' phosphoramidate intersubunit linkage. The method may include (a) deprotecting the protected 3' amino group of a terminal nucleoside linked to a solid support, wherein the deprotection forms a free 3' amino group; (b) contacting the free 3' amino group with a 3'-protected amino-dinucleotide-5'-phosphoramidite dimer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidite linkage; and (c) oxidizing the linkage. In some cases, oxidizing the linkage includes sulfurization to generate an internucleoside N3'→P5' thiophosphoramidate linkage.

[0005] Embodiments of the present disclosure include oligonucleotide compositions produced by the subject methods that contain a reduced amount of one or more (Nx) oligonucleotide products. In some cases, the reduced amount is less than (1.9 x N) parts by weight of one or more (Nx) products per 100 parts by weight of N products. Oligonucleotides prepared according to the subject methods include oligonucleotides having a sequence of N nucleoside subunits complementary to the RNA component of human telomerase, wherein at least two of the nucleoside subunits are linked by an N3'→P5' thiophosphoramidate intersubunit linkage. Also provided are pharmaceutical compositions containing the subject oligonucleotide compositions. The present invention provides, for example, the following items. (Item 1) A composition having an (N-1) product to less than 1 part by weight of a compound or salt thereof, wherein the compound comprises a polynucleotide having a sequence of 10 or more nucleoside subunits, at least two of the nucleoside subunits being linked by an N3'→P5' phosphoramidate intersubunit linkage. (Item 2) The N3'→P5' phosphoramidate intersubunit linkage has the structure: 3'-NH-P(S)(OR)-O-5' wherein R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group or a salt thereof. (Item 3) 3. The composition according to item 1 or 2, wherein the compound comprises a polynucleotide having a sequence of 10 or more nucleoside subunits that is complementary to the RNA component of human telomerase. (Item 4) 4. The composition of claim 3, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits that are complementary to the RNA component of human telomerase. (Item 5) 4. The composition of item 3, wherein the polynucleotide comprises between 3 and 50 contiguous nucleoside subunits that are complementary to the RNA component of human telomerase. (Item 6) 6. The composition according to any one of items 3 to 5, wherein the nucleoside subunits complementary to the RNA component of human telomerase are all linked by N3'→P5' phosphoramidate intersubunit linkages. (Item 7) 7. The composition according to any one of items 1 to 6, wherein the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4), TAGGGTTAGACAA (SEQ ID NO: 3), and CAGTTAGGGTTAG (SEQ ID NO: 5). (Item 8) 8. The composition according to any one of items 1 to 7, wherein the polynucleotide comprises a 3' amino terminal group or a 3'-hydroxyl terminal group. (Item 9) The compound has the structure: [ka] or a salt thereof, wherein "nps" represents a thiophosphoramidate linkage -NH-P(=O)(SH)-O- connecting the 3' carbon of one nucleoside to the 5' carbon of an adjacent nucleoside. (Item 10) 10. The composition according to item 9, wherein the salt is a pharmaceutically acceptable salt. (Item 11) The compound has the structure: [ka] wherein each M x+ are independently hydrogen or a salt counterion; each x is independently 1, 2, or 3; and n is an integer from 5 to 13. (Item 12) The compound has the structure: [ka] 8. The composition according to item 7, having (Item 13) 13. The composition according to any one of items 1 to 12, having an (N-1) product for said compound less than 1 part in 6 parts by weight. (Item 14) 14. The composition according to item 13, having an (N-1) product for said compound less than 1 part in 10 parts by weight. (Item 15) 15. The composition according to item 14, having an (N-1) product for said compound less than 1 part in 20 parts by weight. (Item 16) 16. The composition according to any one of items 1 to 15, having an (Nx) product for said compound of less than 1 part in 4 parts by weight. (Item 17) 17. The composition of any one of items 16, having (Nx) polynucleotide-containing products to said compound total less than 40 parts in 100 parts by weight. (Item 18) The following profiles: (N-1) product to less than 1 part of said compound in 4 parts by weight; (N-2) and (N-3) products for at least 10 parts by weight of the above compounds: 13. The composition according to any one of items 1 to 12, having (Nx) polynucleotide-containing products. (Item 19) 1. A compound active pharmaceutical ingredient having less than 11% by weight of (N-1) products, wherein the compound or a pharmaceutically acceptable salt thereof comprises a polynucleotide having a sequence of 10 or more nucleoside subunits that are complementary to an RNA component of human telomerase, and at least two of the nucleoside subunits are linked by an N3'→P5' phosphoramidate intersubunit linkage. (Item 20) 20. The compound active pharmaceutical ingredient of item 19, wherein the nucleoside subunits complementary to the RNA component of human telomerase are all linked by N3'→P5' thiophosphoramidate intersubunit linkages. (Item 21) The N3'→P5' phosphoramidate intersubunit linkage has the structure: 3'-NH-P(S)(OR)-O-5' wherein R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, a phosphate protecting group, or a pharmaceutically acceptable salt thereof. (Item 22) 22. The compound active pharmaceutical ingredient according to any one of items 19 to 21, wherein the polynucleotide comprises between 10 and 50 contiguous nucleoside subunits that are complementary to the RNA component of human telomerase. (Item 23) 23. The compound active pharmaceutical ingredient according to any one of items 19 to 22, wherein the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4), TAGGGTTAGACAA (SEQ ID NO: 3) and CAGTTAGGGTTAG (SEQ ID NO: 5). (Item 24) 24. The compound active pharmaceutical ingredient according to any one of items 19 to 23, wherein the polynucleotide comprises a 3' amino terminal group or a 3'-hydroxyl terminal group. (Item 25) The compound has the structure: [ka] or a pharmaceutically acceptable salt thereof, wherein "nps" represents a thiophosphoramidate bond -NH-P(=O)(SH)-O- connecting the 3' carbon of one nucleoside to the 5' carbon of the adjacent nucleoside. (Item 26) The compound has the structure: [ka] wherein each M x+ are independently hydrogen or a counterion of a pharmaceutically acceptable salt, each x is independently 1, 2 or 3, and n is an integer from 5 to 13. (Item 27) The compound has the structure: [ka] 27. The compound according to item 26, wherein the compound has the following structure: (Item 28) 28. The compound active pharmaceutical ingredient according to any one of items 19 to 27, having less than 9% by weight of (N-1) product. (Item 29) 29. The compound active pharmaceutical ingredient according to item 28, having less than 5% by weight of (N-1) product. (Item 30) 30. The compound active pharmaceutical ingredient according to any one of items 19 to 29, having less than 11% (Nx) products. (Item 31) 31. The compound active pharmaceutical ingredient according to any one of items 19 to 30, having less than 45% by weight of (Nx) polynucleotide-containing products in total. (Item 32) The following profiles: less than 5% by weight of (N-1) product and at least 10% by weight of (N-2) and (N-3) products: 20. The compound according to item 19, having a polynucleotide-containing product of (Nx). (Item 33) 19. A pharmaceutical composition comprising the composition according to any one of items 1 to 18, formulated in a pharmaceutically acceptable excipient. (Item 34) A method for synthesizing a polynucleotide, said method comprising: (a) deprotecting a protected 3' amino group of a terminal nucleoside linked to a solid support, said deprotection forming a free 3' amino group; (b) contacting the free 3' amino group with a 3' protected amino-dinucleotide phosphoramidate-5'-phosphoramidite dimer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidite linkage; (c) oxidizing the bond. (Item 35) moreover, (a) deprotecting a protected 3' amino group of a terminal nucleoside attached to a solid support, said deprotection forming a free 3' amino group; (b) contacting the free 3' amino group with a 3' protected aminonucleoside-5'-phosphoramidite monomer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidite linkage; (c) oxidizing the bond. (Item 36) 36. The method of any one of items 34 and 35, wherein oxidizing the bond comprises sulfurization to produce a thiophosphoramidate bond. (Item 37) 36. The method of any one of items 34 and 35, wherein oxidizing the bond results in an oxophosphoramidate bond. (Item 38) The 3'-protected amino-dinucleotide phosphoramidate-5'-phosphoramidite dimer has the formula: [ka] wherein X is O or S, and B 1 and B 2 and each independently represent a purine, a protected purine, a pyrimidine, a protected pyrimidine, or an analog thereof. (Item 39) B 1 and B 239. The method of claim 38, wherein each is independently selected from protected adenine, protected cytosine, protected guanine, thymine, and uracil. (Item 40) B 1 and B 2 are each independently selected from A(Bz), A(DMF), C(Bz), G(isobutyryl), T and U. (Item 41) 41. The method according to any one of items 38 to 40, wherein X is S. (Item 42) The polynucleotide has the formula: [ka] or a salt thereof, wherein each B is independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; each X is oxygen or sulfur; each R3 is hydrogen, fluoro, hydroxyl, alkoxy, substituted alkoxy, or protected hydroxyl; L is an optional linker; Z is independently H, a lipid, a support, a carrier, an oligonucleotide, PEG, a polypeptide, a detectable label, or a tag; R 6 is amino, hydroxyl, protected amino, protected hydroxy, -OLZ or -NH-LZ; R is hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a phosphate protecting group; n is an integer from 1 to 1000; The method comprises: (a) deprotecting a protected 3'-amino group of a terminal nucleoside attached to a solid support, said deprotection forming a free 3'-amino group; (b) In the presence of a nucleophilic catalyst, the free 3' amino group is converted to (i) a 3'-protected amino-dinucleotide phosphoramidate-5'-phosphoramidite dimer, or (ii) reacting with either a 3'-protected aminonucleotide-5'-phosphoramidite monomer to form an internucleoside N3'→P5' phosphoramidite linkage; (c) oxidizing the bond; (d) repeating steps (a) to (c) until the polynucleotide is synthesized, wherein repeating steps (a) to (c) comprises performing step (b)(i) at least once. (Item 43) 43. The method of claim 42, wherein oxidizing the bond comprises sulfurization to produce a thiophosphoramidate bond. (Item 44) 43. The method of claim 42, wherein oxidizing the bond results in an oxophosphoramidate bond. (Item 45) 45. The method of any one of items 41 to 44, wherein the polynucleotide comprises a sequence of nucleoside subunits that is complementary to the RNA component of human telomerase, and at least two of the nucleoside subunits are linked by an N3'→P5' phosphoramidate intersubunit linkage. (Item 46) The N3'→P5' phosphoramidate intersubunit linkage has the structure: 3'-NH-P(S)(OR)-O-5' and R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group or a salt thereof. (Item 47) 46. ​​The method according to any one of items 42 to 45, wherein the polynucleotide comprises the sequence TAGGGTTAGACAA. (Item 48) 48. The method of claim 47, wherein all of the internucleotide intersubunit linkages of the TAGGGTTAGACAA sequence are N3'→P5' phosphoramidate intersubunit linkages. (Item 49) The polynucleotide has the structure: [ka] or a salt thereof, wherein "nps" represents a thiophosphoramidate bond -NH-P(=O)(SH)-O- connecting the 3' carbon of one nucleoside to the 5' carbon of an adjacent nucleoside. (Item 50) The polynucleotide has the structure: [ka] wherein each M x+ are independently hydrogen or a counterion of a pharmaceutically acceptable salt; each x is independently 1, 2 or 3; and n is an integer from 5 to 13. (Item 51) The polynucleotide has the structure: [ka] 51. The method according to item 50, comprising: (Item 52) Item 53. The method of Item 47, wherein the C11 nucleotide residue of the TAGGGTTAGACAA sequence is derived from a 3'-protected aminonucleoside-5'-phosphoramidite monomer. 48. The method according to item 47, wherein the method comprises sequentially coupling the following 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimers TA, GG, GT, TA, GA and AA and a 3'-protected aminonucleoside-5'-phosphoramidite monomer C to the solid support. (Item 54) The 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimer has the formula X 1 X 2 wherein X 1 and X 2 39. The method according to any one of items 34 to 38, wherein are independently selected from protected adenine, protected cytosine, protected guanine, thymine and uracil. (Item 55) 35. The method of claim 34, wherein the 3'-protected aminonucleoside-5'-phosphoramidite dimer is selected from protected adenine, protected cytosine, protected guanine, thymine and uracil. (Item 56) Formula (II): [ka] or a salt thereof, In the formula, B 1 and B 2 are each independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; R 11 is hydrogen, a protecting group, or a phosphoramidite group; R 12 and R 13 and each independently represent hydrogen or a protecting group. (Item 57) B 1 and B 2 57. The compound according to item 56, wherein each is independently selected from protected adenine, protected cytosine, protected guanine, thymine and uracil. (Item 58) B 1 and B 2 58. The compound according to item 57, wherein each is independently selected from A(Bz), A(DMF), C(Bz), G(isobutyryl), T and U. (Item 59) R 11 is a 5'-phosphoramidite; R 12 is a protecting group; R 13 57. The compound according to item 56, wherein (Item 60) B 1 is A(Bz) or A(DMF), and B 2 59. The compound according to item 58, wherein is A(Bz) or A(DMF). (Item 61) B 1 is A(Bz) or A(DMF), and B 2 59. The compound according to item 58, wherein is C(Bz). (Item 62) B 1 is A(Bz) or A(DMF), and B 2 Item 59. The compound according to item 58, wherein G is isobutyryl. (Item 63) B 1 is A(Bz) or A(DMF), and B 2 Item 59. The compound according to item 58, wherein is T. (Item 64) B 1 is A(Bz) or A(DMF), and B 2 59. The compound according to item 58, wherein (Item 65) B 1 is C(Bz) and B 2 59. The compound according to item 58, wherein is A(Bz) or A(DMF). (Item 66) B 1 is C(Bz) and B 2 59. The compound according to item 58, wherein is C(Bz). (Item 67) B 1 is C(Bz) and B 2 The compound according to item 58, wherein G is isobutyryl. (Item 68) B 1 is C(Bz) and B 2 Item 59. The compound according to item 58, wherein is T. (Item 69) B1 is C(Bz) and B 2 59. The compound according to item 58, wherein (Item 70) B 1 is G (isobutyryl) and B 2 59. The compound according to item 58, wherein is A(Bz) or A(DMF). (Item 71) B 1 is G (isobutyryl) and B 2 The compound according to item 58, wherein is C(Bz). (Item 72) B 1 is G (isobutyryl) and B 2 Item 59. The compound according to item 58, wherein G is isobutyryl. (Item 73) B 1 is G (isobutyryl) and B 2 Item 59. The compound according to item 58, wherein is T. (Item 74) B 1 is G (isobutyryl) and B 2 59. The compound according to item 58, wherein (Item 75) B 1 is T or U, and B 2 59. The compound according to item 58, wherein is A(Bz) or A(DMF). (Item 76) B 1 is T or U, and B 2 59. The compound according to item 58, wherein is C(Bz). (Item 77) B 1 is T or U, and B 2 The compound according to item 58, wherein G is isobutyryl. (Item 78) B 1 is T or U, and B 2 Item 59. The compound according to item 58, wherein is T. (Item 79) B 1 is T or U, and B 2 59. The compound according to item 58, wherein [Brief explanation of the drawings]

[0006] [Figure 1A] 1A and 1B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) of the TA dimer thiophosphoramidate (compound 7e, Scheme 1). [Figure 1B] 1A and 1B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) of the TA dimer thiophosphoramidate (compound 7e, Scheme 1). [Figure 2A] 2A and 2B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) of the AA dimer thiophosphoramidate (compound 7a, Scheme 1). [Figure 2B] 2A and 2B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) of the AA dimer thiophosphoramidate (compound 7a, Scheme 1). [Figure 3A] 3A and 3B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) for the GG dimer thiophosphoramidate (compound 7c, Scheme 1). [Figure 3B] 3A and 3B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) for the GG dimer thiophosphoramidate (compound 7c, Scheme 1). [Figure 4A] 4A and 4B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) of the GT dimeric thiophosphoramidate (compound 7d, Scheme 1). [Figure 4B] 4A and 4B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) of the GT dimeric thiophosphoramidate (compound 7d, Scheme 1). [Figure 5A] 5A and 5B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) of GA dimer thiophosphoramidate (Compound 7b, Scheme 1). [Figure 5B]5A and 5B show the HPLC chromatogram (A) and 31P-NMR spectrum (B) of GA dimer thiophosphoramidate (Compound 7b, Scheme 1). [Figure 6A] Figures 6A and 6B show LCMS traces for the dimeric amidates TA, AA, GA, GT and GG. [Figure 6B] Figures 6A and 6B show LCMS traces for the dimeric amidates TA, AA, GA, GT and GG. [Figure 7] FIG. 1 shows an HPLC chromatogram of the products of a 140 micromolar scale synthesis of imetelstat using a monomeric coupling strategy. [Figure 8] FIG. 1 shows an HPLC chromatogram of the products of a 140 micromolar scale synthesis of imetelstat using a dimer block coupling strategy. DETAILED DESCRIPTION OF THE INVENTION

[0007] definition The following terms have the following meanings unless otherwise indicated: Terms not defined have their art-recognized meanings.

[0008] As used herein, the terms polynucleotide and oligonucleotide are used interchangeably. Whenever an oligonucleotide is represented by a sequence of letters, e.g., "ATGUCCTG," it is understood that the nucleotides are in 5' to 3' order from left to right, and unless otherwise specified, "A" represents deoxyadenosine, "C" represents deoxycytidine, "G" represents deoxyguanosine, "T" represents thymidine, and "U" represents deoxyuridine.

[0009] As used herein, "nucleoside" includes naturally occurring nucleosides, including 2'-deoxy and 2'-hydroxyl forms, as described, for example, in Kornberg and Baker, DNA Replication, 2nd ed. (Freeman, San Francisco, 1992). "Analogs" with reference to nucleosides include synthetic nucleosides with modified base moieties and / or modified sugar moieties, as generally described, for example, by Scheit, Nucleotide Analogs (John Wiley, New York, 1980). Such analogs include synthetic nucleosides designed to enhance binding properties, e.g., stability, specificity, etc., as disclosed by Uhlmann and Peyman (Chemical Reviews, 90:543-584, 1990). In some embodiments, the nucleoside or nucleoside analog includes a 3'-hydroxyl group or a 3'-amino group.

[0010] The terms "base" and "nucleobase" are used interchangeably and are defined herein to include (i) conventional DNA and RNA bases (uracil, thymine, adenine, guanine, and cytosine) and (ii) modified bases or base analogs (e.g., 5-methyl-cytosine, 5-bromouracil, or inosine). Base analogs are chemicals whose molecular structure mimics that of a conventional DNA or RNA base.

[0011] As used herein, "pyrimidine" refers to pyrimidines found in naturally occurring nucleosides, including cytosine, thymine, and uracil, as well as common analogs thereof, such as those containing substituents such as oxy, methyl, propynyl, methoxy, hydroxyl, amino, thio, halo, etc. The term as used herein refers to, for example, N 4 Further included are pyrimidines with linked common protecting groups such as benzoylcytosine. Additional common protecting groups for pyrimidines are disclosed by Beaucage and Iyer, Tetrahedron, 48:2223-2311, (1992).

[0012] As used herein, "purine" refers to purines found in naturally occurring nucleosides, including adenine, guanine, and hypoxanthine, as well as common analogs thereof, such as those containing substituents such as oxy, methyl, propynyl, methoxy, hydroxyl, amino, thio, halo, etc. The term, as used herein, refers to, for example, N 2 -benzoylguanine, N 2 -isobutyrylguanine, N 6Further common protecting groups for purines include purines with linked common protecting groups such as -benzoyladenine, etc. Additional common purine protecting groups are disclosed by Beaucage and Iyer, Tetrahedron, 48:2223-2311, (1992). As used herein, the term "protected" as a component of a chemical name refers to an art-recognized protecting group for a particular portion of a compound, e.g., "5'-protected hydroxyl" with reference to a nucleoside includes triphenylmethyl (i.e., trityl), p-anisyldiphenylmethyl (i.e., monomethoxytrityl or MMT), di-anisylphenylmethyl (i.e., dimethoxytrityl or DMT), etc.; and protected nucleobase with reference to a nucleobase includes a heteroatom protected with a group such as dimethylaminoformamidine (DMF), benzoyl (Bz), isobutyryl, etc. Art-recognized protecting groups include those described in the following references: Gait, editor, Oligonucleotide Synthesis: A Practical Approach, (IRL Press, Oxford, 1984); Amarnath and Broom, Chemical Reviews, 77:183-217, 1977; Pon et al., Biotechniques, 6:768-775, 1988; Ohtsuka et al., Nickleic Acids Research, 10:6553-6570, 1982; Eckstein, editor, Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991); Greene and Wuts, Protective Groups in Organic Synthesis, 2nd Edition, (John Wiley & Sons, New York, 1991); Narang, editor, Synthesis and Applications of DNA and RNA (Academic Press, New York, 1987); Beaucage and Iyer Tetrahedron, 48:2223-2311, (1992), and similar references.

[0013] As used herein, "oligonucleotide N3'→P5' phosphoramidate" means a typically linear oligomer of nucleoside subunits linked by at least one N3'→P5' phosphoramidate bond. In general terms, nucleoside subunits include nucleosides or nucleoside analogs, see the following references: Newton et al., Nucleic Acids Research, 21:1155-1162 (1993); Griffin et al., J. Am. Chem. Soc., 114:7976-7982 (1992); Jaschke et al., Tetrahedron Letters, 34:301-304 (1992); Ma et al., International Application No. PCT / CA92 / 00423; Zon et al., International Application No. PCT / US90 / 06630; Durand et al., Nucleic Acids Research, 18:6353-6359 (1990); Salunkhe et al., J. Am. Chem. Soc., 114:8768-8772. (1992); etc., may also include more general moieties with compatible chemistries, such as abasic sugars and other carbohydrate moieties. In some instances, the term refers to an oligonucleotide in which all internucleoside linkages are replaced with N3'→P5' phosphoramidate linkages, i.e., the term encompasses partially as well as fully "amidated" oligomers. In some instances, it refers to an oligonucleotide in which all internucleoside linkages are replaced with N3'→P5' phosphoramidate linkages, and the nucleoside subunits are natural nucleosides or their analogs. The subject oligonucleotide N3'→P5' phosphoramidate in which all linkages are N3'→P5' phosphoramidate linkages ("fully amidated") may be embedded or linked to other oligonucleotides or polynucleotides to form larger "partially amidated" oligomers. The subject oligonucleotide N3'→P5' phosphoramidate may contain convenient 3' and / or 5' terminal groups. In some embodiments, the oligonucleotide N3'→P5' phosphoramidate comprises a 3'-hydroxyl or 3'-amino terminal group.

[0014] As used herein, the terms "phosphate" and "phosphate group" are intended to include thiophosphate groups and oxophosphate groups.

[0015] As used herein, the term "phosphoramidite amino group" refers to an amino group NR linked to the phosphorus atom of a phosphoramidite group. 4 R 5 and the term "phosphoramidite nitrogen" refers to the nitrogen atom of the phosphoramidite amino group.

[0016] "Alkyl" refers to monovalent saturated aliphatic hydrocarbyl groups having from 1 to 10 carbon atoms, such as from 1 to 6 carbon atoms (e.g., "alkyl of 1 to 6 carbon atoms"), or from 1 to 5 (e.g., "alkyl of 1 to 5 carbon atoms"), or from 1 to 4 (e.g., "alkyl of 1 to 4 carbon atoms"), or from 1 to 3 carbon atoms (e.g., "alkyl of 1 to 3 carbon atoms"). This term includes, by way of example, alkyl groups such as methyl (CH3-), ethyl (C Included are straight and branched chain hydrocarbyl groups such as n-propyl (CHCHCHCH-), isopropyl ((CH)CH-), n-butyl (CHCHCHCHCH-), isobutyl ((CH)CHCH-), sec-butyl ((CH)(CHCH)CH-), t-butyl ((CH)C-), n-pentyl (CHCHCHCHCHCH-), and neopentyl ((CH)CCH-).

[0017] The term "substituted alkyl" refers to an alkyl group in which one or more carbon atoms in the alkyl chain has been substituted with, for example, -O-, -N-, -S-, -S(O) nand optionally substituted by a heteroatom such as - (n is 0-2), -NR- (R is hydrogen or alkyl), and includes alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-aryl, -SO-heteroaryl, -SO2-alkyl, -SO2-aryl, -SO2-heteroaryl, and -NR a R b refers to an alkyl group as defined herein having 1 to 5 substituents selected from the group consisting of: a and R b may be the same or different and are selected from hydrogen, optionally substituted alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, aryl, heteroaryl, and heterocycle. In some examples, "substituted alkyl" includes alkoxy, cycloalkyl, cycloalkenyl, acyl, acylamino, acyloxy, amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, carboxyl, carboxylalkyl, thiol, thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, sulfonamido, and -NR a R b refers to an alkyl group as defined herein having 1 to 5 substituents selected from the group consisting of: a and R bmay be the same or different and are selected from hydrogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, aryl, heteroaryl, and heterocycle.

[0018] "Alkylene" refers to a divalent aliphatic hydrocarbyl group that is straight or branched, preferably having 1 to 6, more preferably 1 to 3 carbon atoms, including, but not limited to, -O-, -NR 10 -, -NR 10 C(O)-, -C(O)NR 10 -, etc. This term includes, by way of example, methylene (-CH-), ethylene (-CHCH-), n-propylene (-CHCHCH-), iso-propylene (-CHCH(CH)-), (-C(CH)CHCH-), (-C(CH)CHC(O)-), (-C(CH)CHC(O)NH-), (-CH(CH)CH-), and the like.

[0019] "Substituted alkylene" refers to an alkylene group having 1 to 3 hydrogens replaced with a substituent as described for carbon in the definition of "substituted" below.

[0020] The term "alkane" refers to alkyl and alkylene groups, as defined herein.

[0021] The terms "alkylaminoalkyl," "alkylaminoalkenyl," and "alkylaminoalkynyl" refer to an R'NHR" group where R' is an alkyl group, as defined herein, and R" is an alkylene, alkenylene, or alkynylene group, as defined herein.

[0022] The terms "alkaryl" or "aralkyl" refer to the groups -alkylene-aryl and substituted alkylene-aryl, where alkylene, substituted alkylene, and aryl are defined herein.

[0023] "Alkoxy" refers to an -O-alkyl group, where alkyl is as defined herein. Alkoxy includes, by way of example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, t-butoxy, sec-butoxy, and n-pentoxy. The term "alkoxy" also refers to the groups alkenyl-O-, cycloalkyl-O-, cycloalkenyl-O-, and alkynyl-O-, where alkenyl, cycloalkyl, cycloalkenyl, and alkynyl are as defined herein.

[0024] The term "substituted alkoxy" refers to the groups substituted alkyl-O-, substituted alkenyl-O-, substituted cycloalkyl-O-, substituted cycloalkenyl-O-, and substituted alkynyl-O-, where substituted alkyl, substituted alkenyl, substituted cycloalkyl, substituted cycloalkenyl, and substituted alkynyl are as defined herein.

[0025] The term "alkoxyamino" refers to the group --NH-alkoxy, where alkoxy is defined herein.

[0026] The term "haloalkoxy" refers to an alkyl-O- group in which one or more hydrogen atoms on the alkyl group has been replaced by a halo group and includes, by way of example, groups such as trifluoromethoxy.

[0027] The term "haloalkyl" refers to a substituted alkyl group, as defined above, in which one or more hydrogen atoms on the alkyl group have been replaced by a halo group. Examples of such groups include, but are not limited to, fluoroalkyl groups such as trifluoromethyl, difluoromethyl, trifluoroethyl, and the like.

[0028] The term "alkylalkoxy" refers to the groups -alkylene-O-alkyl, alkylene-O-substituted alkyl, substituted alkylene-O-alkyl, and substituted alkylene-O-substituted alkyl, where alkyl, substituted alkyl, alkylene, and substituted alkylene are as defined herein.

[0029] The term "alkylthioalkoxy" refers to the groups -alkylene-S-alkyl, alkylene-S-substituted alkyl, substituted alkylene-S-alkyl and substituted alkylene-S-substituted alkyl, where alkyl, substituted alkyl, alkylene and substituted alkylene are as defined herein.

[0030] "Alkenyl" refers to straight or branched chain hydrocarbyl groups having from 2 to 6 carbon atoms, preferably from 2 to 4 carbon atoms, and having at least 1, preferably 1 to 2, sites of double bond unsaturation. The term includes, by way of example, bi-vinyl, allyl, and but-3-en-1-yl. Included within the scope of the term are cis and trans isomers or mixtures of these isomers.

[0031] The term "substituted alkenyl" refers to an alkenyl group as defined herein having from 1 to 5 substituents or from 1 to 3 substituents selected from alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO2-alkyl, -SO2-substituted alkyl, -SO2-aryl and -SO2-heteroaryl.

[0032] "Alkynyl" refers to a straight- or branched-chain monovalent hydrocarbyl group having from 2 to 6 carbon atoms, preferably 2 to 3 carbon atoms, and having at least 1, preferably 1 to 2, sites of triple bond unsaturation. Examples of such alkynyl groups include acetylenyl (-C≡CH) and propargyl (-CHC≡CH).

[0033] The term "substituted alkynyl" refers to an alkynyl group as defined herein having from 1 to 5 substituents or from 1 to 3 substituents selected from alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO2-alkyl, -SO2-substituted alkyl, -SO2-aryl and -SO2-heteroaryl.

[0034] "Alkynyloxy" refers to the group -O-alkynyl, where alkynyl is as defined herein. Alkynyloxy includes, by way of example, ethynyloxy, propynyloxy, and the like.

[0035] "Acyl" means HC(O)-, alkyl-C(O)-, substituted alkyl-C(O)-, alkenyl-C(O)-, substituted alkenyl-C(O)-, alkynyl-C(O)-, substituted alkynyl-C(O)-, cycloalkyl-C(O)-, substituted cycloalkyl-C(O)-, cycloalkenyl-C(O)-, substituted cycloalkenyl-C(O)-, aryl-C(O)-, substituted aryl-C(O)-, heteroaryl-C(O)-, substituted hetero " refers to the groups aryl-C(O)-, heterocyclyl-C(O)-, and substituted heterocyclyl-C(O)-, where alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle are as defined herein. For example, acyl includes the "acetyl" group CHC(O)-.

[0036] "Acylamino" is -NR 20 C(O) alkyl, -NR 20 C(O) substituted alkyl, NR 20 C(O)cycloalkyl, -NR 20 C(O)-substituted cycloalkyl, -NR 20 C(O)cycloalkenyl, -NR 20 C(O)-substituted cycloalkenyl, -NR 20 C(O)alkenyl, -NR 20 C(O) substituted alkenyl, -NR 20 C(O)alkynyl, -NR 20 C(O)-substituted alkynyl, -NR 20 C(O)aryl, -NR 20 C(O)-substituted aryl, -NR 20 C(O)heteroaryl, -NR 20 C(O)-substituted heteroaryl, -NR 20 C(O) heterocycle, and -NR 20 C(O) refers to a substituted heterocyclic group, where R 20is hydrogen or alkyl, and alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle are as defined herein.

[0037] "Aminocarbonyl" or the term "aminoacyl" refers to -C(O)NR 21 R 22 group, where R 21 and R 22 is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle; 21 and R 22 is optionally linked together with the nitrogen bound thereto to form a heterocyclic or substituted heterocyclic group, and wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein.

[0038] "Aminocarbonylamino" is -NR 21 C(O)NR 22 R 23 group, where R 21 , R 22 and R 23 is independently selected from hydrogen, alkyl, aryl, or cycloalkyl, or two R groups are joined to form a heterocyclyl group.

[0039] The term "alkoxycarbonylamino" refers to the group -NRC(O)OR, where each R is independently hydrogen, alkyl, substituted alkyl, aryl, heteroaryl, or heterocyclyl, where alkyl, substituted alkyl, aryl, heteroaryl, and heterocyclyl are as defined herein.

[0040] The term "acyloxy" refers to the groups alkyl-C(O)O-, substituted alkyl-C(O)O-, cycloalkyl-C(O)O-, substituted cycloalkyl-C(O)O-, aryl-C(O)O-, heteroaryl-C(O)O-, and heterocyclyl-C(O)O-, where alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, aryl, heteroaryl, and heterocyclyl are as defined herein.

[0041] "Aminosulfonyl" is -SO2NR 21 R 22 group, where R 21 and R 22 is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle; 21 and R 22 is optionally linked together with the nitrogen bound thereto to form a heterocyclic or substituted heterocyclic group, and wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein.

[0042] "Sulfonylamino" is -NR 21 SO2R 22group, where R 21 and R 22 is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle; 21 and R 22 is optionally joined together with the atom(s) attached thereto to form a heterocyclic group or a substituted heterocyclic group, and wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein.

[0043] "Aryl" or "Ar" refers to a monovalent aromatic carbocyclic group of 6 to 18 carbon atoms having a single ring (as in a phenyl group) or a ring system having multiple fused rings, which may or may not be aromatic, provided that the point of attachment is through an aromatic ring atom (examples of such aromatic ring systems include naphthyl, anthryl, and indanyl). This term includes, by way of example, phenyl and naphthyl. Unless otherwise constrained by the definition of the aryl substituent, such aryl groups may be optionally substituted with one to five substituents, or one to three substituents, selected from acyloxy, hydroxy, thiol, acyl, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, substituted alkyl, substituted alkoxy, substituted alkenyl, substituted alkynyl, substituted cycloalkyl, substituted cycloalkenyl, amino, substituted amino, aminoacyl, acylamino, alkaryl, aryl, aryloxy, azido, carboxyl, carboxylalkyl, cyano, halogen, nitro, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, aminoacyloxy, oxyacylamino, thioalkoxy, substituted thioalkoxy, thioaryloxy, thioheteroaryloxy, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO2-alkyl, -SO2-substituted alkyl, -SO2-aryl, -SO2-heteroaryl, and trihalomethyl. In such cases, the aryl group is substituted with 1 to 5 substituents (eg, as described herein) is referred to as a "substituted aryl."

[0044] "Aryloxy" refers to the group --O-aryl, where aryl is as defined herein, including optionally substituted aryl groups as defined herein, including by way of example phenoxy, naphthoxy, and the like.

[0045] "Amino" refers to the group -NH2.

[0046] The term "substituted amino" refers to the group -NRR, where each R is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, alkenyl, substituted alkenyl, cycloalkenyl, substituted cycloalkenyl, alkynyl, substituted alkynyl, aryl, heteroaryl, and heterocyclyl, provided that at least one R is not hydrogen.

[0047] The term "azido" refers to the group -N3.

[0048] "Carboxyl", "carboxy" or "carboxylate" refers to -CO2H or its salts.

[0049] "Carboxyl ester", "carboxy ester" or the term "carboxyalkyl" or "carboxylalkyl" refers to -C(O)O-alkyl, -C(O)O-substituted alkyl, -C(O)O-alkenyl, -C(O)O-substituted alkenyl, -C(O)O-alkynyl, -C(O)O-substituted alkynyl, -C(O)O-aryl, -C(O)O-substituted aryl, -C(O)O-cycloalkyl, -C(O)O-substituted cycloalkyl, -C(O)O-cycloalkenyl, -C(O)O-substituted cycloalkyl, "C(O)O-heteroaryl" refers to the groups cycloalkenyl, -C(O)O-heteroaryl, -C(O)O-substituted heteroaryl, -C(O)O-heterocycle, and -C(O)O-substituted heterocycle, where alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle are as defined herein.

[0050] "(Carboxy ester)oxy" or "carbonate" refers to -OC(O)O-alkyl, -OC(O)O-substituted alkyl, -OC(O)O-alkenyl, -OC(O)O-substituted alkenyl, -OC(O)O-alkynyl, -OC(O)O-substituted alkynyl, -OC(O)O-aryl, -OC(O)O-substituted aryl, -OC(O)O-cycloalkyl, -OC(O)O-substituted cycloalkyl, -OC(O)O-cycloalkenyl, -OC(O)O-substituted cycloalkenyl, -OC refers to the groups -C(O)O-heteroaryl, -OC(O)O-substituted heteroaryl, -OC(O)O-heterocycle, and -OC(O)O-substituted heterocycle, where alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle are as defined herein.

[0051] "Cyano" or "nitrile" refers to the group --CN.

[0052] "Cycloalkyl" refers to cyclic alkyl groups of 3 to 10 carbon atoms having mono- or polycyclic rings, including fused, bridged, and spirocyclic systems. Examples of suitable cyclic alkyl groups include, for example, adamantyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like. Such cycloalkyl groups include, for example, single-ring structures such as cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like, or multiple-ring structures such as adamantanyl, and the like.

[0053] The term "substituted cycloalkyl" refers to a cycloalkyl group having one to five substituents or one to three substituents selected from alkyl, substituted alkyl, alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO2-alkyl, -SO2-substituted alkyl, -SO2-aryl and -SO2-heteroaryl.

[0054] "Cycloalkenyl" refers to a non-aromatic cyclic alkyl group of 3 to 10 carbon atoms having a single ring or multiple rings and having at least one double bond, preferably 1 to 2 double bonds.

[0055] The term "substituted cycloalkenyl" refers to a cycloalkenyl group having one to five substituents or one to three substituents selected from alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO2-alkyl, -SO2-substituted alkyl, -SO2-aryl, and -SO2-heteroaryl.

[0056] "Cycloalkynyl" refers to a non-aromatic cycloalkyl group of from 5 to 10 carbon atoms having mono- or polycyclic rings and having at least one triple bond.

[0057] "Cycloalkoxy" refers to -O-cycloalkyl.

[0058] "Cycloalkenyloxy" refers to -O-cycloalkenyl.

[0059] "Halo" or "halogen" refers to fluoro, chloro, bromo and iodo.

[0060] "Hydroxy" or "hydroxyl" refers to the group --OH.

[0061] "Heteroaryl" refers to an aromatic group of 1 to 15 carbon atoms, e.g., 1 to 10 carbon atoms and 1 to 10 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur, within the ring. Such heteroaryl groups can have a single ring (e.g., pyridinyl, imidazolyl, or furyl) or multiple fused rings (e.g., as in groups such as indolizinyl, quinolinyl, benzofuran, benzimidazolyl, or benzothienyl) in the ring system, where at least one ring within the ring system is aromatic, and at least one ring within the ring system is aromatic, provided that the point of attachment is through an aromatic ring atom. In certain embodiments, the nitrogen and / or sulfur ring atoms of a heteroaryl group are optionally oxidized to provide N-oxide (N→O), sulfinyl, or sulfonyl moieties. This term includes, by way of example, pyridinyl, pyrrolyl, indolyl, thiophenyl, and furanyl. Unless otherwise constrained by the definition of heteroaryl substituents, such heteroaryl groups can be optionally substituted with one to five substituents or one to three substituents selected from acyloxy, hydroxy, thiol, acyl, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, substituted alkyl, substituted alkoxy, substituted alkenyl, substituted alkynyl, substituted cycloalkyl, substituted cycloalkenyl, amino, substituted amino, aminoacyl, acylamino, alkaryl, aryl, aryloxy, azido, carboxyl, carboxylalkyl, cyano, halogen, nitro, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, aminoacyloxy, oxyacylamino, thioalkoxy, substituted thioalkoxy, thioaryloxy, thioheteroaryloxy, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO2-alkyl, -SO2-substituted alkyl, -SO2-aryl and -SO2-heteroaryl, and trihalomethyl. In such cases, the heteroaryl group is substituted with 1 to 5 substituents (eg, as described herein) and is referred to as a "substituted heteroaryl group."

[0062] The term "heteroaralkyl" refers to the group -alkylene-heteroaryl, where alkylene and heteroaryl are defined herein. This term includes, by way of example, pyridylmethyl, pyridylethyl, indolylmethyl, and the like.

[0063] "Heteroaryloxy" refers to -O-heteroaryl.

[0064] "Heterocycle," "heterocyclic," "heterocycloalkyl," and "heterocyclyl" refer to saturated or unsaturated groups having a single ring or multiple fused rings, including fused, bridged, and spiro ring systems, and having 3 to 20 ring atoms, including 1 to 10 heteroatoms. These ring atoms are selected from the group consisting of nitrogen, sulfur, or oxygen, where in fused ring systems, one or more of the rings can be cycloalkyl, aryl, or heteroaryl, provided that the point of attachment is through a non-aromatic ring. In certain embodiments, the nitrogen and / or sulfur atoms of the heterocyclic group are optionally oxidized to provide an N-oxide, -S(O)-, or -SO2- moiety.

[0065] Examples of heterocycles and heteroaryls include azetidine, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, dihydroindole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthylpyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, phenon, These include, but are not limited to, oxazine, phenothiazine, imidazolidine, imidazoline, piperidine, piperazine, indoline, phthalimide, 1,2,3,4-tetrahydroisoquinoline, 4,5,6,7-tetrahydrobenzo[b]thiophene, thiazole, thiazolidine, thiophene, benzo[b]thiophene, morpholinyl, thiomorpholinyl (also called thiamorpholinyl), 1,1-dioxothiomorpholinyl, piperidinyl, pyrrolidine, tetrahydrofuranyl, and the like.

[0066] Unless otherwise constrained by the definition of heterocycle substituents, such heterocycle groups can be optionally substituted with 1 to 5 substituents or 1 to 3 substituents selected from alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO2-alkyl, -SO2-substituted alkyl, -SO2-aryl, -SO2-heteroaryl and fused heterocycle.

[0067] "Heterocyclyloxy" refers to the group --O-heterocyclyl.

[0068] The term "heterocyclylthio" refers to the group heterocycle-S-.

[0069] The term "heterocyclene" refers to a diradical group formed from a heterocycle, as defined herein.

[0070] The term "hydroxyamino" refers to the group --NHOH.

[0071] "Nitro" refers to the -NO2 group.

[0072] "Oxo" refers to the atom (=O).

[0073] "Sulfonyl" refers to the group SO-alkyl, SO-substituted alkyl, SO-alkenyl, SO-substituted alkenyl, SO-cycloalkyl, SO-substituted cycloalkyl, SO-cycloalkenyl, SO-substituted cycloalkenyl, SO-aryl, SO-substituted aryl, SO-heteroaryl, SO-substituted heteroaryl, SO-heterocycle, and SO-substituted heterocycle, where alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle are as defined herein. Sulfonyl includes, by way of example, methyl-SO-, phenyl-SO-, and 4-methylphenyl-SO-.

[0074] "Sulfonyloxy" refers to the groups OSO2-alkyl, OSO2-substituted alkyl, OSO2-alkenyl, OSO2-substituted alkenyl, OSO2-cycloalkyl, OSO2-substituted cycloalkyl, OSO2-cycloalkenyl, OSO2-substituted cycloalkenyl, OSO2-aryl, OSO2-substituted aryl, OSO2-heteroaryl, OSO2-substituted heteroaryl, OSO2-heterocycle, and OSO2-substituted heterocycle, where alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle are as defined herein.

[0075] The term "aminocarbonyloxy" refers to the group -OC(O)NRR where each R is independently hydrogen, alkyl, substituted alkyl, aryl, heteroaryl, or heterocycle, where alkyl, substituted alkyl, aryl, heteroaryl, and heterocycle are as defined herein.

[0076] "Thiol" refers to the group --SH.

[0077] The term "thioxo" or "thioketo" refers to the atom (=S).

[0078] The term "alkylthio" or "thioalkoxy" refers to an -S-alkyl group, where alkyl is as defined herein. In certain embodiments, the sulfur may be oxidized to -S(O)-. The sulfoxide may exist as one or more stereoisomers.

[0079] The term "substituted thioalkoxy" refers to an -S-substituted alkyl group.

[0080] The term "thioaryloxy" refers to an aryl-S- group, where the aryl group is optionally substituted as defined herein, including aryl groups also as defined herein.

[0081] The term "thioheteroaryloxy" refers to the group heteroaryl-S-, where the heteroaryl group is as defined herein and includes an optionally substituted aryl group, also as defined herein.

[0082] The term "thioheterocyclooxy" refers to the group heterocyclyl-S-, where the heterocyclyl group is as defined herein and includes optionally substituted heterocyclyl groups also defined herein.

[0083] Further to the disclosure herein, the term "substituted," when used to modify a particular group or radical, can also mean that one or more hydrogen atoms of the particular group or radical are replaced, independently of one another, with the same or different substituents as defined below.

[0084] In addition to the groups disclosed for each individual term herein, one or more hydrogens on a saturated carbon atom in a particular group or radical (two hydrogens on a single carbon are ═O, ═NR 70 , =N-OR 70 , ═N2 or ═S), unless specified, is a substituent for substitution on 60 , halo, =O, -OR 70 , -SR 70 , -NR 80 R 80 , trihalomethyl, -CN, -OCN, -SCN, -NO, -NO2, =N2, -N3, -SO2R 70 , -SO2O - M + , -SO2OR 70 , -OSO2R 70 , -OSO2O - M + , -OSO2OR 70 , -P(O)(O - )2(M + )2, -P(O)(OR 70 )O - M + , -P(O)(OR 70 )2, -C(O)R 70 , -C(S)R 70 , -C(NR 70 )R 70 , -C(O)O - M + , -C(O)OR 70 , -C(S)OR 70 , -C(O)NR 80 R 80 , -C(NR 70 )NR 80 R 80 , -OC(O)R 70 , -OC(S)R 70 , -OC(O)O - M + , -OC(O)OR 70 , -OC(S)OR 70 , -NR 70 C(O)R 70 , -NR 70 C(S)R 70 , -NR70 CO2 - M + , -NR 70 CO2R 70 , -NR 70 C(S)OR 70 , -NR 70 C(O)NR 80 R 80 , -NR 70 C(NR 70 )R 70 and -NR 70 C(NR 70 )NR 80 R 80 In this case, R 60 is selected from the group consisting of optionally substituted alkyl, cycloalkyl, heteroalkyl, heterocycloalkylalkyl, cycloalkylalkyl, aryl, arylalkyl, heteroaryl, and heteroarylalkyl; and each R 70 are independently hydrogen or R 60 and each R 80 is independently R 70 or alternatively two R 80 together with the nitrogen atom to which it is attached form a 5-, 6-, or 7-membered heterocycloalkyl ring, which may optionally contain 1 to 4 identical or different additional heteroatoms selected from the group consisting of O, N, and S, where N may have —H or C1-C3 alkyl substitution; each M + is a counterion with a net single positive charge. + are independent, e.g., K + , Na + , Li + Alkaline ions such as; + N(R 60 ) 4; or [Ca 2+ ] 0.5 , [Mg 2+ ] 0.5 or [Ba 2+ ] 0.5(The subscript 0.5 means that one of the counterions for such divalent alkaline earth ions can be an ionized form of a compound of the invention and the other can be a counterion such as chloride, or two ionized compounds disclosed herein can serve as counterions for such divalent alkaline earth ions, or doubly ionized compounds of the invention can serve as counterions for such divalent alkaline earth ions.) Specific Example - NR 80 R 80 is meant to include -NH2, -NH-alkyl, N-pyrrolidinyl, N-piperazinyl, N-methyl-piperazin-1-yl and N-morpholinyl.

[0085] Further to the disclosure herein, the substituents for hydrogens on unsaturated carbon atoms in "substituted" alkene, alkyne, aryl, and heteroaryl groups are, unless specified, in the case of a substituted alkene or alkyne, the substituent is -O. - M + , -OR 70 , -SR 70 , or -S - M + -R, provided that 60 , halo, -O - M + , -OR 70 , -SR 70 , -S - M + , -NR 80 R 80 , trihalomethyl, -CF3, -CN, -OCN, -SCN, -NO, -NO2, -N3, -SO2R 70 , -SO3 - M + , -SO3R 70 , -OSO2R 70 , -OSO3 - M + , -OSO3R 70 , -PO3 -2 (M + )2, -P(O)(OR 70 )O - M +, -P(O)(OR 70 )2, -C(O)R 70 , -C(S)R 70 , -C(NR 70 )R 70 , -CO2 - M + , -CO2R 70 , -C(S)OR 70 , -C(O)NR 80 R 80 , -C(NR 70 )NR 80 R 80 , -OC(O)R 70 , -OC(S)R 70 , -OCO2 - M + , -OCO2R 70 , -OC(S)OR 70 , -NR 70 C(O)R 70 , -NR 70 C(S)R 70 , -NR 70 CO2 - M + , -NR 70 CO2R 70 , -NR 70 C(S)OR 70 , -NR 70 C(O)NR 80 R 80 , -NR 70 C(NR 70 )R 70 and -NR 70 C(NR 70 )NR 80 R 80 In this case, R 60 , R 70 , R 80 and M + is as defined herein.

[0086] In addition to the groups disclosed for each individual term herein, the substituents for the hydrogen on the nitrogen atom in "substituted" heteroalkyl and cycloheteroalkyl groups are, unless specified, -R 60 , -O - M + , -OR 70 , -S- R 70 、 -S - M + 、 -NR 80 R 80 、 trihalomethyl, -CF3, -CN, -NO, -NO2, -S(O)2R 70 、 -S(O)2O - M + 、 -S(O)2OR 70 、 -OS(O)2R 70 、 -OS(O)2O - M + 、 -OS(O)2OR 70 、 -P(O)(O - )2(M + 、 -P(O)(OR 70 )O - M + 、 -P(O)(OR 70 )(OR 70 、 -C(O)R 70 、 -C(S)R 70 、 -C(NR 70 )R 70 、 -C(O)OR 70 、 -C(S)OR 70 、 -C(O)NR 80 R 80 、 -C(NR 70 )NR 80 R 80 \、 -OC(O)R 70 、 -OC(S)R 70 、 -OC(O)OR 70 、 -OC(S)OR 70 、 -NR 70 C(O)R 70 、 -NR 70 C(S)R 70 、 -NR 70 C(O)OR 70 、 -NR 70 C(S)OR 70 、 -NR 70 C(O)NR 80 R 80 、 -NR 70 C(NR 70 )R 70 及び -NR 70 C(NR 70 )NR 80 R 80In this case, R 60 , R 70 , R 80 and M + is as previously defined.

[0087] Further to the disclosure herein, in certain embodiments, a substituted group has 1, 2, 3, or 4 substituents, 1, 2, or 3 substituents, 1 or 2 substituents, or 1 substituent.

[0088] For all of the substituted groups defined above, it is understood that polymers arrived at by defining the substituent in terms of further substituents thereon (e.g., substituted aryl having a substituted aryl group as a substituent which is itself substituted by a substituted aryl group, which is further substituted by a substituted aryl group, etc.) are not intended to be encompassed herein. In such cases, the maximum number of such substitutions is three. For example, sequential substitutions of substituted aryl groups specifically contemplated herein are limited to substituted aryl-(substituted aryl)-substituted aryl.

[0089] Unless otherwise indicated, naming of substituents not expressly defined herein is accomplished by naming the terminal position of the functional group followed by the adjacent functional group toward the point of attachment. For example, the substituent "arylalkyloxycarbonyl" refers to the group (aryl)-(alkyl)-OC(O).

[0090] With respect to any of the groups disclosed herein that contain one or more substituents, it is of course understood that such groups do not contain substitutions or substitution patterns that are sterically impractical and / or synthetically impractical. In addition, the subject compounds include all stereochemical isomers arising from the substitution of these compounds.

[0091] The term "pharmaceutically acceptable salt" refers to a salt that is acceptable for administration to a patient, such as a mammal (a salt having a counterion that has acceptable mammalian safety for a given dosing regimen). Such salts can be derived from pharmaceutically acceptable inorganic and organic bases and from pharmaceutically acceptable inorganic and organic acids. "Pharmaceutically acceptable salt" refers to a pharmaceutically acceptable salt of a compound, where the salt is derived from a variety of organic and inorganic counterions well known in the art, including, by way of example only, sodium; and where the molecule contains a basic functional group, a salt of an organic or inorganic acid, e.g., hydrochloride, etc. Pharmaceutically acceptable salts of interest include, but are not limited to, aluminum salts, ammonium salts, arginine salts, barium salts, benzathine salts, calcium salts, cholinate salts, ethylenediamine salts, lysine salts, lithium salts, magnesium salts, meglumine salts, procaine salts, potassium salts, sodium salts, tromethamine salts, N-methylglucamine salts, N,N'-dibenzylethylene-diamine salts, chloroprocaine salts, diethanolamine salts, ethanolamine salts, piperazine salts, zinc salts, diisopropylamine salts, diisopropylethylamine salts, triethylamine salts, and triethanolamine salts.

[0092] The term "salt thereof" refers to a compound formed when a proton of an acid is replaced with a cation, such as, for example, a metal cation or an organic cation. This does not require salts of intermediate compounds not intended for administration to a patient, although, where applicable, the salts are pharmaceutically acceptable salts. By way of example, salts of the present compounds include those formed by protonating the compound with an inorganic or organic acid to form a cation, with the conjugate base of the inorganic or organic acid as the anionic component of the salt. Salts of interest include, but are not limited to, aluminum salts, ammonium salts, arginine salts, barium salts, benzathine salts, calcium salts, cesium salts, cholinate salts, ethylenediamine salts, lithium salts, magnesium salts, meglumine salts, procaine salts, N-methylglucamine salts, piperazine salts, potassium salts, sodium salts, tromethamine salts, zinc salts, N,N'-dibenzylethylenediamine salts, chloroprocaine salts, diethanolamine salts, ethanolamine salts, piperazine salts, diisopropylamine salts, diisopropylethylamine salts, triethylamine salts, and triethanolamine salts. For any of the oligonucleotide structures shown herein that include an internucleoside linkage backbone, it is understood that such oligonucleotides may also include any convenient salt form. In some embodiments, the acid form of the internucleoside linkage is depicted for simplicity. In some examples, the salt of the compound of interest is a monovalent cation salt. In certain examples, the salt of the compound of interest is a divalent cation salt. In some instances, the salt of the subject compound is a trivalent cation salt. "Solvate" refers to a complex formed by the combination of solvent molecules with solute molecules or ions. The solvent can be an organic compound, an inorganic compound, or a mixture of both. Some examples of solvents include, but are not limited to, methanol, N,N-dimethylformamide, tetrahydrofuran, dimethyl sulfoxide, and water. When the solvent is water, the solvate formed is a hydrate.

[0093] "Stereoisomer" and "stereoisomers" refer to compounds that have identical atomic connectivity but different atomic arrangements in space. Stereoisomers include cis / trans isomers, E and Z isomers, enantiomers and diastereomers.

[0094] "Tautomer" refers to alternative forms of molecules that differ only in the location of the electron bonds and / or protons of the atoms, such as, for example, enol / keto and imine / enamine tautomers, -NH-P(=S)(OH)-O- and -NH-P(=O)(SH)-O-, tautomeric forms of heteroaryl groups containing ring atom configurations of -N=C(H)-NH-, e.g., pyrazole, imidazole, benzimidazole, triazole, and tetrazole. One skilled in the art will recognize that other tautomeric configurations of the groups described herein are possible. For example, the following structures: [ka] The oligonucleotides described by the formula: [ka] where "nps" represents a thiophosphoramidate bond (-NH-P(=O)(SH)-O- or -NH-P(=S)(OH)-O-) connecting the 3' carbon of one nucleoside to the 5' carbon of the adjacent nucleoside. All tautomeric forms of the subject compounds are understood to be encompassed by a structure that depicts one possible tautomeric configuration of the groups of the compound, even if not specifically shown. Any convenient tautomeric configuration of the groups of the subject compound may be utilized to describe the compound.

[0095] It will be appreciated that the term "or a salt or solvate or stereoisomer thereof" is intended to include all salt, solvate, and stereoisomeric permutations, such as, for example, solvates of pharmaceutically acceptable salts of stereoisomers of the subject compound. The term "or a salt thereof" is understood to be intended to include all salt permutations. The term "or a pharmaceutically acceptable salt thereof" is understood to be intended to include all salt permutations. The term "or a solvate thereof" is understood to be intended to include all solvate permutations. The term "or a stereoisomer thereof" is understood to be intended to include all stereoisomeric permutations. The term "or a tautomer thereof" is understood to be intended to include all tautomeric permutations. Thus, for example, in short, it will be intended to include solvates of pharmaceutically acceptable salts of tautomers of stereoisomers of the subject compound.

[0096] "Pharmaceutically effective amount" and "therapeutically effective amount" refer to an amount of a compound sufficient to treat a specified disorder or disease or one or more of its symptoms and / or prevent the onset of said disease or disorder. With reference to tumorigenic proliferative disorders, a pharmaceutically or therapeutically effective amount includes, inter alia, an amount sufficient to cause tumor regression or reduce the rate of tumor growth.

[0097] "Patient" refers to human and non-human subjects, particularly mammalian subjects.

[0098] The term "treating" or "treatment," as used herein, means the treatment or cure of a disease or medical condition in a patient, such as a mammal (particularly a human), including (a) preventing a disease or medical condition from occurring, such as prophylactic treatment of a subject; (b) ameliorating a disease or medical condition, such as eliminating or causing regression of the disease or medical condition in a patient; (c) inhibiting a disease or medical condition, for example, by slowing or arresting the onset of the disease or medical condition in a patient; or (d) alleviating the symptoms of a disease or medical condition.

[0099] As used herein, the term "isolated" is intended to describe a compound of interest that is in an environment different from that which the compound naturally occurs in. "Isolated" is intended to include a compound that is substantially enriched for the compound of interest and / or is within a sample from which the compound of interest is partially or substantially purified.

[0100] As used herein, the term "substantially purified" refers to a compound that has been removed from its natural environment and is at least 60% free, at least 75% free, at least 80% free, at least 85% free, at least 90% free, at least 95% free, at least 98% free, or more than 98% free from other components with which it is naturally associated.

[0101] The term "physiological conditions" is intended to encompass conditions compatible with living cells, eg, primarily aqueous conditions of temperature, pH, salinity, etc., compatible with living cells.

[0102] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0103] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limits of that range, and any other stated or intervening value in the stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the scope of the invention, subject to any specifically excluded limit in the stated value. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0104] It is understood that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of embodiments pertaining to the present invention are specifically embraced by the present invention and, to the extent such combinations include subject matter that is, for example, a stable compound (i.e., a compound that can be made, isolated, characterized, and tested for biological activity), are disclosed herein as if each and every combination were individually and expressly disclosed. In addition, all subcombinations of the various embodiments and elements thereof (e.g., elements of chemical groups listed in the embodiments describing such variables) are also specifically embraced by the present invention and are disclosed herein as if each and every such subcombination were individually and expressly disclosed herein.

[0105] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those disclosed herein can also be used in the practice or testing of the present invention, the methods and materials of interest are now described. All publications mentioned herein are incorporated by reference as if to disclose and describe the methods and / or materials for which the publications are cited.

[0106] As used in this specification and the appended claims, the singular forms "a," "an," and "the" should be referred to as including the plural unless the context clearly indicates otherwise. It is further noted that the claims may be drafted to exclude any element. As such, this statement is intended to serve as a foreword for the use of exclusionary terminology such as "solely," "only," and the like in conjunction with reciting claim elements or the use of "negative" limitations.

[0107] It is to be appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.

[0108] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the publication dates provided may be different from the actual publication dates which may need to be independently confirmed.

[0109] Detailed Description As summarized above, the present disclosure provides a solid-phase method for preparing oligonucleotides through successive coupling cycles involving the coupling of dinucleotide dimers to the free 3'-terminal group (e.g., 3'-hydroxyl or 3'-amino group) of a growing chain. Broadly speaking, synthesis proceeds from the 5' to the 3' end of the target oligonucleotide sequence and involves at least one coupling of a dinucleotide dimer. The dimer may be coupled to the free 3'-terminal group of the growing chain via any convenient chemistry. In some cases, the dimer may be a 3'-protected-dinucleotide-5'-phosphoramidite dimer, and the dinucleotide may contain any convenient internucleoside linkage. The oligonucleotide may contain one or more phosphoramidate intersubunit linkages (e.g., oxo-phosphoramidate or thiophosphoramidate linkages).

[0110] In some embodiments, the oligonucleotide has the formula: [ka] wherein B is a purine, a protected purine, a pyrimidine, or a protected pyrimidine or an analog thereof; X is O or S; R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group; and R 3 is hydrogen, OR 2 and halogen, wherein R 2 is H, alkyl, substituted alkyl (e.g., -(CH2) n W(CH2) m H, where n is between 1 and 10, m is between 0 and 10, and W is O, S, or NH) or a hydroxyl protecting group. It is understood that some of the oligonucleotides comprising subunits described by the above formula may exist in the form of a salt. Such forms, to the extent that they may exist, are intended to be included within the scope of the present disclosure.

[0111] The subject methods provide a reduced number of coupling cycles and result in reduced amounts of synthesis of non-target oligonucleotide products compared to methods involving only the coupling of nucleoside monomers. The retrosynthetic strategy utilized to prepare a target oligonucleotide sequence may be selected depending on various factors, such as the length and sequence of the target oligonucleotide, to minimize the amount of specific non-target oligonucleotide products of synthesis.

[0112] In some embodiments, the subject methods provide for the preparation of compositions having a reduced amount of one or more (Nx) products relative to the target oligonucleotide of interest.

[0113] In certain embodiments, any of the compositions described herein having a low amount of one or more (Nx) products relative to the target oligonucleotide of interest is unpurified.

[0114] As used herein, the term "(Nx) product" (where x is an integer between 1 and N-1, and N is the number of nucleoside residues in the target oligonucleotide) refers to a non-target oligonucleotide produced during the subject method of preparation that lacks x nucleoside residues when compared to the sequence of a target oligonucleotide of length N residues. A target oligonucleotide is a product that the subject method of preparation is designed to produce. As such, an (N-1) product is a non-target oligonucleotide that lacks one nucleoside residue from the sequence of the target oligonucleotide. Thus, in some cases, the term "(N-1) product" refers to various non-target oligonucleotide products, each of which lacks one nucleoside residue when compared to the sequence of the target oligonucleotide. Similarly, the term "(Nx) product" refers to various non-target oligonucleotide products, each of which lacks x nucleoside residues when compared to the sequence of the target oligonucleotide. For example, an (N-2) product is a non-target oligonucleotide that lacks two nucleoside residues from the sequence of the target oligonucleotide. In some cases, the x residues are adjacent to each other relative to the target oligonucleotide sequence. In other cases, the x residues are not adjacent to each other relative to the target oligonucleotide sequence. The x nucleoside residues may be missing from the target sequence or may arise from unreacted 3'-terminal groups during coupling cycles. The (Nx) product of the subject method may contain one or more additional modifications resulting from the subject method of synthesis, such as partial deprotection modification, loss of a nucleobase (e.g., depurination), end-group capping, derivatization via a synthesis reagent (e.g., phenylacetylation by sulfurization), etc. A variety of modified oligonucleotides are possible depending on the oligonucleotide synthesis chemistry and reagents used. Unless otherwise indicated, all such modifications are intended to be encompassed by the term (Nx) product.

[0115] In some embodiments, the subject methods result in the reduction of one or more non-target products of oligonucleotide synthesis selected from partially protected products or partially protected (Nx) products, e.g., oligonucleotide products that include one or more nucleobase protecting groups. In the subject oligonucleotide compositions, the target oligonucleotide sequence may be more easily isolated or purified from other oligonucleotide-containing products of the method, e.g., (Nx) products and products lacking nucleobases.

[0116] Embodiments of the subject methods and compositions are described in further detail in the following sections.

[0117] How to make oligonucleotides The present disclosure provides methods for preparing oligonucleotides. The subject methods may include at least one coupling of a dinucleotide dimer to the free 3'-terminal group of a growing oligonucleotide chain. Convenient oligonucleotide synthesis methods and chemistries may be utilized in the subject methods of preparation. Chemistry and methods of oligonucleotide synthesis that may be adapted for use in the subject methods include, but are not limited to, phosphoramidites, H-phosphonates, phosphodiesters, phosphotriesters, phosphitotriesters, and those described in US Pat. No. 5,824,793 to Fearon et al., the disclosure of which is incorporated herein by reference in its entirety. The oligonucleotide components of the compounds of the present invention may be synthesized by adapting conventional protocols to the type of chemistry selected. Methods of interest for the synthesis of oligonucleotides having N3'→P5' phosphoramidate chemistry include, but are not limited to, those described in McCurdy et al. (1997), Tetrahedron Letters, 38:207-210 and Pongracz and Gryaznov (1999), Tetrahedron Letters, 49:7661-7664.

[0118] Oligonucleotides of interest may be prepared using the subject method via sequential coupling starting from the 5'-end of the target oligonucleotide sequence and proceeding to the 3'-end. The 5'-terminal nucleoside subunit may be linked to a convenient solid support via any linking group or 5'-terminal group. Coupling of the subunit to the growing oligonucleotide chain may then be achieved using either a dimeric phosphoramidite or a monomeric phosphoramidite. Alternatively, the 5'-terminal nucleotide subunit may be linked to a convenient solid support via any linking group or 5'-terminal group. Once the first subunit (e.g., a monomeric or dimeric subunit) is linked to the solid support, the subunit may be deprotected to yield a free, immobilized 3'-terminal group. Optionally, the method includes coupling the support-bound 3'-terminal group to a 3'-protected dinucleotide-5'-phosphoramidite dimer. In certain embodiments, the 3'-terminal group is a 3'-hydroxyl group. In certain embodiments, the 3'-terminal group is a 3'-amino group.

[0119] In some examples, the method includes (a) deprotecting a protected 3'-amino group of a terminal nucleoside linked to a solid support, said deprotection forming a free 3'-amino group; (b) contacting the free 3'-amino group with a 3'-protected amino-dinucleotide thiophosphoramidate or phosphoramidite-5'-phosphoramidite dimer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidite linkage; and (c) oxidizing the linkage.

[0120] The target oligonucleotide sequence may be synthesized using a retrosynthetic strategy involving sequential coupling of dimeric and monomeric subunits to the 3'-terminal group of a growing oligonucleotide chain. As such, in some embodiments, the method further comprises (a) deprotecting the protected 3'-amino group of the terminal nucleoside linked to the solid support, said deprotection forming a free 3'-amino group, (b) contacting the free 3'-amino group with a 3'-protected aminonucleoside-5'-phosphoramidite monomer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidate linkage, and (c) oxidizing the linkage to yield an N3'→P5' phosphoramidate linkage.

[0121] As used herein, "N3'→P5' phosphoramidate linkage" refers to the phosphorus(III) intermediate of an N3'→P5' phosphoramidate linkage. Broadly speaking, an N3'→P5' phosphoramidate linkage is formed by oxidizing an N3'→P5' phosphoramidate linkage to a phosphorus(V) product (e.g., an N3'→P5' phosphoramidate linkage that may include an oxo (P=O) group or a thio (P=S) group). In some cases, the oxidizing step may be described as sulfurizing the N3'→P5' phosphoramidate linkage to produce an N3'→P5' phosphoramidate linkage.

[0122] As used herein, "N3'→P5' phosphoramidate," "P5'→N3' phosphoramidate," and "phosphoramidate" refer to a group having the formula: 3'-NH-P(=X)(OR)-O-5' or its tautomers, where 3' and 5' refer to the carbon atoms of the sugar moieties of consecutive nucleosides connected by the bond; R is hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a phosphate protecting group; and X is oxygen or a chalcogen, such as sulfur. It is understood that some internucleoside subunit linkages described by the above formula, where R is hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a phosphate protecting group, may exist in the form of a salt. Such forms, to the extent they may exist, are intended to be included within the scope of the present disclosure. In some cases, when X is sulfur, a phosphoramidate may be referred to as a thiophosphoramidate. In some cases, when X is oxygen, a "phosphoramidate" may be referred to as an "oxophosphoramidate." In some cases, when R is a phosphate protecting group, it may be alkyl, alkenyl, aryl, aralkyl, cycloalkyl, or a substituted version thereof. In some cases, R is a phosphate protecting group containing 10 or fewer carbon atoms. In certain examples, when R is a phosphate protecting group, it is an alkyl having 1 to 6 carbon atoms; an electron-withdrawing β-substituted ethyl (e.g., β-thiohalomethyl-, β-cyano-, β-sulfo-, or β-nitro-substituted ethyl); an electron-withdrawing substituted phenyl (e.g., halo-, sulfo-, cyano-, or nitro-substituted phenyl); or an electron-withdrawing substituted phenylethyl. In some embodiments, when R is a phosphate protecting group, it is methyl, β-cyanoethyl, or 4-nitrophenylethyl. In certain embodiments, R is hydrogen, methyl, or β-cyanoethyl. Electron-withdrawing substituents of interest include, but are not limited to, halo, cyano, nitro, sulfo, or mono-, di-, or tri-halomethyl. Halogen atom substituents are typically fluoro, chloro, bromo, or iodo; in some examples, they are fluoro or chloro."Electron-withdrawing" refers to the tendency of a substituent to attract the valence electrons of the molecule of which it is a part, i.e., it is electronegative; see, for example, March, Advanced Organic Chemistry, pgs. 16-18 (John Wiley, New York, 1985). Guidelines for selecting phosphate protecting groups are provided in Beaucage and Iyer, Tetrahedron, 48:2223-2311 (1992). For convenience, nucleotide phosphoramidates are sometimes referred to herein by the subscripts "np" or "pn" for N3'→P5' phosphoramidate or P3'→N5' phosphoramidate, respectively. Thus, "U. np "U" is a dinucleotide in which a 3'-aminouridine and a uridine are linked by an N3'→P5' phosphoramidate linkage. When the linkage is an oxo-phosphoramidate, the nucleotide oxo-phosphoramidate may be designated by the subscript "npo" or "opn" for N3'→P5' phosphoramidate or P3'→N5' phosphoramidate, respectively. Similarly, a nucleotide thiophosphoramidate may be designated herein by the subscript "nps" or "spn" for N3'→P5' thiophosphoramidate or P3'→N5' thiophosphoramidate, respectively. Similarly, a 2'-fluoro substituent is designated by the subscript "f." Thus, "U" is a dinucleotide in which a 3'-aminouridine and a uridine are linked by an N3'→P5' phosphoramidate linkage. When the linkage is an oxo-phosphoramidate, the nucleotide oxo-phosphoramidate may be designated by the subscript "npo" or "opn" for N3'→P5' phosphoramidate or P3'→N5' phosphoramidate, respectively. Similarly, a 2'-fluoro substituent may be ... f.np "U" is a dinucleotide in which 5'-most-3'-amino-2'-fluorouridine is linked to uridine by an N3'→P5' phosphoramidate bond. The single leading subscript "p" indicates the 5' monophosphate, and the single trailing subscript "n" indicates the 3'-amino group.

[0123] In some instances, the internucleoside subunit linkages have the formula: The internucleoside linkages are described by 3'-NH-P(=X)(OR)-O-5' or tautomers thereof, where 3' and 5' refer to carbon atoms of the sugar moieties of consecutive nucleosides connected by the bond, R is hydrogen, and X is oxygen or sulfur. For any of the oligonucleotides described herein that contain such internucleoside linkages, it is understood that such oligonucleotides may also contain convenient salt forms of the linkages. As such, the internucleoside linkages may be in the form of salts with convenient counterions.

[0124] The subject methods may utilize any convenient protecting group strategy to protect the base, phosphoramidite group, phosphoramidate group, 5' group, 2' group, and / or 3' group. Suitable protecting groups include, but are not limited to, those described by Ohkubo et al., Org. Lett., 2010, 12(11), pp. 2496-2499; and Beaucage and Iyer, Tetrahedron, 48:2223-2311 (1992).

[0125] As used herein, the term "phosphate protecting group" refers to a protecting group that may be attached to a phosphorus-containing intersubunit bond of an oligonucleotide. When present, the phosphate protecting group may interfere with (i.e., prevent) reaction of the phosphorus-containing bond at the position to which the phosphate protecting group is attached. Convenient phosphorus-containing intersubunit bonds (e.g., P(III) and P(V) bonds) may be protected by a phosphate protecting group of interest, including, but not limited to, phosphoramidite, oxophosphoramidate, thiophosphoramidate, phosphate ester, thiophosphate ester, phosphodiester bond, and the like. The phosphate protecting group may be attached to an available oxygen atom of the phosphorus-containing intersubunit bond. Any convenient protecting group may be utilized as the phosphate protecting group. Phosphate protecting groups of interest include, but are not limited to, alkyl, alkenyl, aryl, aralkyl, cycloalkyl, or substituted versions thereof, e.g., alkyl having 1 to 6 carbon atoms, e.g., electron-withdrawing β-substituted ethyl (e.g., β-trihalomethyl-, β-cyano-, β-sulfo-, or β-nitro-substituted ethyl); electron-withdrawing substituted phenyl (e.g., halo-, sulfo-, cyano-, or nitro-substituted phenyl); or electron-withdrawing substituted phenylethyl, methyl, β-cyanoethyl, or 4-nitrophenylethyl. In certain embodiments, the phosphate protecting group is methyl or β-cyanoethyl. Electron-withdrawing substituents of interest include, but are not limited to, halo (e.g., chloro, fluoro), cyano, nitro, sulfo, or mono-, di-, or tri-halomethyl, and the like.

[0126] The 3'-terminal group of a growing oligonucleotide chain may include a 3'-hydroxyl group, a 3'-amino group, or protected versions thereof. A convenient hydroxyl-protecting group and / or an amino-protecting group may be utilized at the 3'-terminal group during the synthesis of the oligonucleotide. In some embodiments, the 3'-terminal group is a protected 3'-amino group, and the method includes deprotecting or removing the protecting group to generate a free 3'-amino group.

[0127] As used herein, the term "free amino group" with reference to monomers and dimers means an amino group available to react with a phosphoramidite group of an incoming monomer or dimer. In some embodiments, the free amino group is a primary amine. After the deprotection (detritylation) step, the amino group may be in the form of a salt (e.g., a salt of the conjugate base of the acid used for detritylation). After the detritylation step, the salt may optionally be neutralized with a basic solution, such as, for example, 2% triethylamine or pyridine in acetonitrile.

[0128] In some embodiments, the 3'-terminal group is a protected 3'-hydroxyl group, and the method includes deprotecting or removing the protecting group to generate a free 3'-hydroxyl group. In some embodiments, the 3'-terminal group is a protected 3'-amino group, and the method includes deprotecting or removing the protecting group to generate a free 3'-amino group. The protected 3'-amino or 3'-hydroxyl group may be protected with a trityl protecting group. In certain embodiments, the trityl protecting group is triphenylmethyl (Tr, PhC-). In certain embodiments, the trityl protecting group is 4,4'-dimethoxytrityl (DMT).

[0129] Deprotection of the 3'-terminal amino or hydroxyl group may be accomplished using any convenient method. Methods of interest include, but are not limited to, those described by Beaucage and Iyer, Tetrahedron, 48:2223-2311, (1992). In some cases, deprotection of the protected 3'-amino group of the terminal nucleoside includes detritylation, e.g., acid-catalyzed detritylation, to generate a free 3'-terminal group.

[0130] Generally, the phosphoramidite of a dimeric or monomeric subunit contains a protected 3'-hydroxyl or 3'-amino group that is the same as the 3'-amino group of the terminal nucleoside attached to the solid support. The 3' protection of the incoming subunit phosphoramidite prevents undesired polymerization of the chain.

[0131] Any convenient solid support may be used in the subject methods, including, but not limited to, microparticles composed of controlled pore glass (CPG), cross-linked polystyrene (e.g., NittoPhase HL400 or GE Primer 350), acrylic copolymers, cellulose, nylon, dextran, latex, polyacrolein, and the like, as disclosed in the following exemplary references: Meth. Enzymol., Section A, pages 11-147, Vol. 44 (Academic Press, New York, 1976); U.S. Patent Nos. 4,678,814; 4,413,070; and 4,046,720; and Pon, Chapter 19, in Agrawal, editor, Methods in Molecular Biology, Vol. 20, (Humana Press, Totowa, NJ, 1993). Further supports of interest include polystyrene beads; polyethylene glycol-grafted polystyrene (TentaGel™, Rapp Polymere, Tübingen, Germany), etc. The selection of the characteristics of the support, e.g., material, porosity, size, shape, etc., and the type of linking moiety employed, will depend on various factors, such as the protecting groups employed, the length of the final product, the amount of the final product, etc. Exemplary linking moieties are disclosed in Pon et al., Biotechniques, 6:768-775 (1988); Webb, U.S. Patent No. 4,659,774; Barany et al., International Patent Application PCT / US91 / 06103; Brown et al., J. Chem. Soc. Commun., 1989:891-893; Damha et al., Nucleic Acids Research, 18:3813-3821 (1990); Beattie et al., Clinical Chemistry, 39:719-722 (1993); Maskos and Southern, Nucleic Acids Research, 20:1679-1684 (1992); and others.

[0132] In some embodiments, the solid support used in the subject methods includes polystyrene grafted with CPG and polyethylene glycol and having terminal amino groups (e.g., TentaGel-NH2™, Rapp Polymere, Tubingen Germ An aminopropyl group may be used as a spacer between the CPG and the nucleoside bond. In some cases, the bond to the 5'-hydroxyl of the first nucleoside is a succinyl group, providing a base-labile ester bond that may be cleaved with aqueous ammonia after synthesis.

[0133] Following deprotection, the support-bound nucleoside can react with a phosphoramidite of a dimeric or monomeric subunit to form an internucleoside linkage. It is understood that a support-bound nucleoside can refer to a single residue attached to a solid support or to the terminal residue of an oligonucleotide chain that is attached to a support.

[0134] Any convenient coupling chemistry, coupling reagents and methods may be utilized in the subject methods. Important guidance in making selections regarding coupling conditions, protecting groups, solid supports, linking groups, deprotecting reagents, reagents for cleaving the product from the solid support, product purification, etc. in the context of the subject methods can be found in the literature, e.g., Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Amarnath and Broom, Chemical Reviews, Vol. 77, pgs. 183-217 (1977); Pon et al., Biotechniques, Vol. 6, pgs 768-775 (1988); Ohtsuka et al., Nucleic Acids Research, Vol. 10, pgs. 6553-6570 (1982); Eckstein, editor, Oligonucleotides. and Analogues: A Practical Approach (IRL Press, Oxford, 1991), Greene and Wuts, “Protective Groups in Organic Synthesis”, 3rd edition, Wiley, New York, 1999, Narang, editor, Synthesis and Applications of DNA and RNA,(Academic Press,New York, 1987), Beaucage and Iyer, Tetrahedron, 48:2223-2311 (1992), and similar references.

[0135] The coupling step of the subject method may be carried out at a temperature ranging from -20 to 200°C. In some instances, the reaction is carried out at ambient temperature (approximately 15 to 30°C). The reaction may be carried out by adding a solution of phosphoramidite dimers or monomers and an activator (or a solution containing phosphoramidite dimers or monomers and an activator) to a reaction vessel containing the free amino group of an (oligo)nucleotide covalently bound to a solid support. Generally, the activators of interest include nucleophilic catalysts that displace the amino group of the more stable phosphoramidite to form a highly reactive (and less stable) intermediate, which then reacts with the free 3' amino group of the solid-supported oligonucleotide N3'→P5' phosphoramidate. The mixture is then mixed by methods such as mechanical vortexing, sparging with an inert gas, etc. Alternatively, the dimer or monomer and activator solution can be flowed through a reaction vessel (or column) containing a solid-supported (oligo)nucleotide with a free 3' terminal group. The monomers and activator can be premixed, can be mixed at the shutoff valve of a suitable synthesizer, can be mixed and pre-equilibrated in a preactivation vessel if desired, or they can be added separately to the reaction vessel.

[0136] Activators of interest that may be utilized in the subject method include, but are not limited to, tetrazole, 5-(ethylthio)tetrazole, 5-(4-nitrophenyl)tetrazole, 5-(2-thiophene)tetrazole, triazole, pyridinium chloride, and the like, such as those described by Beaucage and Iyer, Tetrahedron, 48:2223-2311 (1992); Berner et al., Nucleic Acids Research, 17:853-864 (1989); Benson, Chem. Rev. 41:1-61 (1947). As used herein, the term "tetrazole activator" refers to an activator that is tetrazole or a derivative of tetrazole. In some embodiments, the activator is tetrazole. Convenient solvents include, but are not limited to, acetonitrile, tetrahydrofuran, methylene chloride, and the like. Care may be exercised to use anhydrous (water-free) dimers or monomers, activators and solvents for the coupling step, and for the solvents used to wash the solid support immediately prior to the coupling step.

[0137] After coupling, any unreacted 3'-amino groups on the growing strand of support-bound oligonucleotide may be optionally capped with a convenient capping agent prior to the next deprotection step to render them inert to subsequent coupling steps. This capping step may improve the HPLC profile of the preparation, further facilitating purification, and may also improve the overall yield of the product. Capping reagents useful in the subject method include electrophilic reagents such as acetic anhydride and isobutyric anhydride, acid chlorides such as adamantylcarbonyl chloride, pivaoyl chloride, etc., isothiocyanates, chloroformates, etc. Also useful are phosphoramidites in conjunction with an activating agent followed by oxidation, and H-phosphonates such as triethylammonium isopropyl-H-phosphonate used in conjunction with acid chlorides such as pivaoyl chloride or adamantylcarbonyl chloride.

[0138] In some embodiments, the method includes oxidizing the internucleoside N3'→P5' phosphoramidite linkage. As used herein, the terms "oxidize," "oxidize," "oxidizing," and the like, with reference to a phosphorus-containing internucleoside linkage, refer to a process or treatment that converts the phosphorus atom of the linkage from its phosphorus(III) form to its phosphorus(V) form. Oxidation of the internucleotide linkage may be performed at any convenient point in the synthesis using a convenient method. In some embodiments, oxidation is performed in a stepwise manner, for example, between each coupling cycle. In other embodiments, oxidation of multiple internucleotide linkages is performed at the end of the synthesis. In some examples, oxidizing the N3'→P5' phosphoramidite linkage (e.g., using an iodine / water-based oxidizing agent) generates an oxo-phosphoramidite linkage. In other examples, oxidizing the N3'→P5' phosphoramidite linkage includes sulfurization to generate a thiophosphoramidite linkage. Sulfurization may be performed using a convenient method. Sulfurization methods of interest include those described by Gryazonov et al., WO2001018015, the entire disclosure of which is incorporated herein by reference. Sulfurization agents for use in the present invention include elemental sulfur, thiuram disulfides such as tetraethylthiuram disulfide, acyl disulfides such as phenylacyl disulfides, and phosphinothioyl disulfides such as S-Tetra™ and 1,1-dioxo-3H-1,2-benzodithiol-3-one. In some embodiments, sulfurization is carried out using elemental sulfur (S). In certain embodiments, sulfurization may be carried out using Beaucage reagent, using methods such as those described by Iyer et al., J. Organic Chemistry, 55:4693-4699, 1990.

[0139] Oxidizing agents useful in the method include iodine, chlorine, bromine, peracids such as m-chlorobenzoic acid, hydroperoxides such as t-butyl hydroperoxide, ethyl hydroperoxide, methyl hydroperoxide, and the like, ozone, mixed acyl-sulfinic anhydrides such as 3H-2,1-benzoxathiolan-3-one-1-oxide, salts of persulfuric acid such as sodium, ammonium, and tetrabutylammonium persulfate, monoperoxysulfates such as Oxone™, sodium and / or other hypochlorites, diethyl peroxide or bis(trimethylsilyl) peroxide, or peroxides such as hydrogen peroxide or non-aqueous hydrogen peroxide equivalents, e.g., urea / hydrogen peroxide complex, and the like. Other useful oxidizing agents that may be used to convert phosphorus(III) to phosphorus(V) are described in Beaucage and Iyer, Tetrahedron, 48:2223-2311 (1992).

[0140] In some cases, the oxidizing or sulfurizing agent may be prone to undergoing the undesirable Arbuzov side reaction in parallel with the desired oxidation (Beaucage and Iyer, cited above). The Arbuzov side reaction can result in a deprotected phosphoramidate that is unstable to the acidic conditions of the subsequent detritylation step, resulting in fragmentation of the oligonucleotide. In certain embodiments, hydrogen peroxide is used as the oxidizing agent to minimize the Arbuzov side reaction. In certain embodiments, oxidation involves contacting the oligonucleotide with a solution of 1.5% hydrogen peroxide, 3.5% water, 20% pyridine, and 75% THF.

[0141] In some embodiments, the method comprises: (a) deprotecting a protected 3'-amino group of a terminal nucleoside attached to a solid support, said deprotection forming a free 3'-amino group; (b) In the presence of a nucleophilic catalyst, the free 3' amino group is converted to (i) a 3'-protected amino-dinucleotide phosphoramidate-5'-phosphoramidite dimer, or (ii) reacting with any of the 3'-protected aminonucleoside-5'-phosphoramidite monomers to form an internucleoside N3'→P5' phosphoramidite linkage; (c) oxidizing the bond; (d) repeating steps (a) to (c) until a polynucleotide is synthesized, wherein repeating steps (a) to (c) comprises performing step (b)(i) at least once.

[0142] In some embodiments, repeating steps (a)-(c) comprises performing step (b)(i) two or more times. In certain embodiments, repeating steps (a)-(c) comprises performing step (b)(i) three or more times, e.g., four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, fifteen or more, twenty or more, or even thirty or more times. In certain embodiments, repeating steps (a)-(c) comprises performing step (b)(i) after every coupling step. In certain embodiments, repeating steps (a)-(c) comprises performing step (b)(i) after every coupling step except one. In certain embodiments, repeating steps (a)-(c) comprises performing step (b)(ii) only once. In certain embodiments, repeating steps (a)-(c) comprises performing step (b)(ii) only two times.

[0143] As used herein, the term phosphoramidite linkage is intended to encompass both oxo-phosphoramidite linkages and thio-phosphoramidite linkages (e.g., as depicted in Formula I). ​​In certain embodiments of the method, oxidizing the internucleoside N3'→P5' phosphoramidite linkage generates an oxo-phosphoramidite linkage. In some embodiments of the method, oxidizing the internucleoside N3'→P5' phosphoramidite linkage comprises sulfurization to generate a thio-phosphoramidite linkage.

[0144] In some embodiments of the method, the oligonucleotide has Formula (I): [ka] wherein: each B is independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; each X is independently oxygen or sulfur; Each R 3 is hydrogen, fluoro, hydroxyl, alkoxy, substituted alkoxy or protected hydroxyl; R 6 is amino, hydroxyl, protected amino, protected hydroxy, -OLZ or -NH-LZ; each L is independently an optional linker; each Z is independently H, a lipid, a support, a carrier, an oligonucleotide, a polymer, a polypeptide, a detectable label, or a tag; R is hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a phosphate protecting group; n is an integer from 1 to 1000. When R is hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a phosphate protecting group, it is understood that some of the oligonucleotides of formula (I) may exist in salt form. Such forms, to the extent they may exist, are intended to be included within the scope of the present disclosure.

[0145] In some embodiments of Formula (I), each R 3 is hydrogen. In some embodiments of Formula (I), each R 3 In some embodiments of Formula (I), each R 3 is hydroxyl.

[0146] In some embodiments of Formula (I), R 6 is amino. In some embodiments of Formula (I), R 6 is hydroxyl.

[0147] In some embodiments of formula (I), each R is hydrogen. When R is hydrogen, the phosphate linkage may be charged under aqueous conditions, for example, physiological conditions. As such, the oligonucleotide of formula (I) may include any convenient salt form of the linkage. As such, the internucleoside linkage of formula (I) may be in the form of a salt with a convenient counterion. In some embodiments of formula (I), each R is alkyl or substituted alkyl. In some embodiments of formula (I), each R is aryl or substituted aryl. In some embodiments of formula (I), each R is a phosphate protecting group.

[0148] In some embodiments of Formula (I), Z is H. In some embodiments of Formula (I), Z is a lipid (e.g., as described herein). In certain cases, the lipid is a fatty acid (e.g., as described herein). In some embodiments of Formula (I), Z is a support. In some embodiments of Formula (I), Z is a carrier. In some embodiments of Formula (I), Z is an oligonucleotide. In some embodiments of Formula (I), Z is a polymer. In certain cases, the polymer is PEG. In some embodiments of Formula (I), Z is a polypeptide. In some embodiments of Formula (I), Z is a detectable label. In some embodiments of Formula (I), Z is a tag.

[0149] In some embodiments of Formula (I), L is absent.

[0150] In some embodiments, each B is independently selected from A, C, G, T, and U or protected forms thereof.

[0151] In some embodiments of Formula (I), n is an integer between 1 and 500, e.g., between 1 and 100, between 1 and 75, between 1 and 50, between 1 and 40, between 1 and 30, between 1 and 20, between 1 and 15, between 1 and 10, or between 4 and 10. In certain embodiments, n is an integer between 1 and 100, e.g., between 5 and 50, between 10 and 50, between 10 and 40, between 10 and 30, between 10 and 25, between 10 and 20, between 12 and 18, or between 12 and 16. In certain embodiments, n is 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0152] In certain embodiments of the method, the oligonucleotide comprises a sequence of nucleoside subunits that is complementary to the RNA component of human telomerase, and at least two of the nucleoside subunits are linked by an N3'→P5' phosphoramidate intersubunit linkage.

[0153] In some embodiments of the method, the oligonucleotide comprises a sequence of between 3 and 50 contiguous nucleoside subunits that are complementary to the RNA component of human telomerase, e.g., between 5 and 40, between 10 and 40, between 10 and 30, between 10 and 25, between 10 and 20, between 12 and 18, or between 12 and 16 nucleoside subunits. In certain embodiments, the oligonucleotide comprises a sequence of 10 or more contiguous nucleoside subunits that are complementary to the RNA component of human telomerase. In certain embodiments, the oligonucleotide comprises a sequence of 7 or more contiguous nucleoside subunits, e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 contiguous nucleoside subunits. In certain embodiments, the oligonucleotide comprises a sequence of between 11 and 18, e.g., 11 and 16 contiguous nucleoside subunits that are complementary to the RNA component of human telomerase.

[0154] In some examples of the methods, the N3'→P5' phosphoramidate intersubunit linkage has the following structure: 3'-NH-P(S)(OR)-O-5', where R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group. It is understood that when R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group, some of the internucleoside subunit linkages described by the above formula may exist in salt form. Such forms, to the extent they may exist, are intended to be included within the scope of the present disclosure.

[0155] In some examples of the methods, the N3'→P5' phosphoramidate intersubunit linkage has the following structure: 3'-NH-P(S)(OR)-O-5' where R is hydrogen. For any of the oligonucleotides described herein that contain such intersubunit linkages, it is understood that such oligonucleotides may also contain convenient salt forms of the linkages. As such, the intersubunit linkages may be in the form of salts containing convenient counterions.

[0156] In some embodiments of the method, the oligonucleotide comprises the sequence TAGGGTTAGACAA (SEQ ID NO: 3). In certain embodiments, all of the internucleoside intersubunit linkages of the TAGGGTTAGACAA (SEQ ID NO: 3) sequence are N3'→P5' phosphoramidate intersubunit linkages. In certain examples, all of the N3'→P5' phosphoramidate intersubunit linkages of the sequence are N3'→P5' thiophosphoamidate intersubunit linkages (e.g., nps linkages). In certain examples, all of the N3'→P5' phosphoramidate intersubunit linkages of the sequence are N3'→P5' oxo-phosphoamidate intersubunit linkages (e.g., np linkages).

[0157] In some embodiments of the method, the polynucleotide comprises a 3'-amino or 3'-hydroxyl end group. In certain embodiments of the method, the polynucleotide comprises a 3'-amino end group. In certain embodiments of the method, the polynucleotide comprises a 3'-hydroxyl end group.

[0158] In some embodiments of the method, the oligonucleotide has the structure: [ka] where "nps" represents a thiophosphoramidate linkage (e.g., -NH-P(=O)(SH)-O- or a tautomer thereof) connecting the 3'-carbon of one nucleoside to the 5'-carbon of an adjacent nucleoside.

[0159] It is understood that all embodiments referring to oligonucleotides also apply to salt forms of said oligonucleotides.

[0160] In some embodiments of the method, the oligonucleotide has the structure: [ka] or a salt thereof, where "nps" represents a thiophosphoramidate linkage (e.g., -NH-P(=O)(SH)-O-, or a tautomer thereof, or a salt thereof) connecting the 3'-carbon of one nucleoside to the 5'-carbon of an adjacent nucleoside. In certain embodiments, the composition comprises a pharmaceutically acceptable salt of the compound. In certain examples, the composition comprises a sodium salt of the compound. In certain embodiments, the composition comprises a divalent cation salt of the compound, such as, for example, a magnesium salt of the compound. In certain embodiments, the composition comprises a trivalent cation salt of the compound, such as an aluminum salt of the compound.

[0161] In certain embodiments of the method, the oligonucleotide has the following structure: [ka] where each M x+ is independently hydrogen or a convenient counterion of a salt, each x is independently 1, 2, or 3, and n is an integer from 5 to 13, e.g., 5, 6, 7, 8, 9, 10, 11, 12, or 13, e.g., n is 13. In particular examples, each x is 1. In particular examples, each x is independently 1 or 2. In particular examples, each x is independently 1 or 3. In particular examples, M x+ is hydrogen.

[0162] In certain embodiments of the method, the oligonucleotide is described by the following structure, which may include a convenient cationic counterion of a salt:

[0163] In certain embodiments of the method, the oligonucleotide has the structure: [ka] It is described by:

[0164] In certain embodiments of the method, the C11 nucleotide residue of the TAGGGTTAGACAA (SEQ ID NO: 3) sequence is derived from a 3'-protected aminonucleoside-5'-phosphoramidite monomer. By "derived" is meant that the residue of interest is introduced during synthesis via a specific subunit. In a particular example, residues T1 through A10, A12, and A13 of the TAGGGTTAGACAA (SEQ ID NO: 3) sequence are derived from a 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimer.

[0165] In some cases, the method involves sequential coupling of the following 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimers and 3'-protected aminonucleoside-5'-phosphoramidite monomers to the end groups of a solid support: TA, GG, GT, TA, GA, C, and AA. For simplicity, the protected phosphoramidite subunits used in the coupling of the subject method are designated by the symbol X. 1 or X 1 X 2 In this case, X 1 and X 2 are independently any convenient nucleoside linked via any convenient internucleoside linkage (e.g., as described herein). Any convenient synthetic strategy may be utilized in the subject methods. Some strategies of interest are presented below to demonstrate how to assign preparations of oligonucleotide target sequences to specific dimeric and / or monomeric subunits.

[0166] An exemplary retrosynthetic strategy, illustrated by the following list of a series of dimeric and / or monomeric subunits, is provided for the exemplary target oligonucleotide sequence TAGGGTTAGACAA (SEQ ID NO: 3). It is understood that this list of strategies is not exhaustive and may be applied to the synthesis of any convenient target oligonucleotide. In some embodiments, the method comprises sequential coupling of one of the following series of 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimers and / or 3'-protected aminonucleoside-5'-phosphoramidite monomers to the end groups of a solid support:

[0167] TA,G,G,G,T,T,A,G,A,C,A,A

[0168] T,AG,G,G,T,T,A,G,A,C,A,A

[0169] T,A,GG,G,T,T,A,G,A,C,A,A

[0170] T,A,G,GG,T,T,A,G,A,C,A,A

[0171] T,A,G,G,GT,T,A,G,A,C,A,A

[0172] T,A,G,G,G,TT,A,G,A,C,A,A

[0173] T,A,G,G,G,T,TA,G,A,C,A,A

[0174] T,A,G,G,G,T,T,AG,A,C,A,A

[0175] T,A,G,G,G,T,T,A,GA,C,A,A

[0176] T,A,G,G,G,T,T,A,G,AC,A,A

[0177] T,A,G,G,G,T,T,A,G,A,CA,A

[0178] T,A,G,G,G,T,T,A,G,A,C,AA

[0179] TA,GG,G,T,T,A,G,A,C,A,A

[0180] TA,G,GG,T,T,A,G,A,C,A,A

[0181] TA,G,G,GT,T,A,G,A,C,A,A

[0182] TA,G,G,G,TT,A,G,A,C,A,A

[0183] TA,G,G,G,T,TA,G,A,C,A,A

[0184] TA,G,G,G,T,T,AG,A,C,A,A

[0185] TA,G,G,G,T,T,A,GA,C,A,A

[0186] TA,G,G,G,T,T,A,G,AC,A,A

[0187] TA,G,G,G,T,T,A,G,A,CA,A

[0188] TA,G,G,G,T,T,A,G,A,C,AA

[0189] T,AG,GG,T,T,A,G,A,C,A,A

[0190] T,AG,G,GT,T,A,G,A,C,A,A

[0191] T,AG,G,G,TT,A,G,A,C,A,A

[0192] T,AG,G,G,T,TA,G,A,C,A,A

[0193] T,AG,G,G,T,T,AG,A,C,A,A

[0194] T,AG,G,G,T,T,A,GA,C,A,A

[0195] T,AG,G,G,T,T,A,G,AC,A,A

[0196] T,AG,G,G,T,T,A,G,A,CA,A

[0197] T,AG,G,G,T,T,A,G,A,C,AA

[0198] T,A,GG,GT,T,A,G,A,C,A,A

[0199] T,A,GG,G,TT,A,G,A,C,A,A

[0200] T,A,GG,G,T,TA,G,A,C,A,A

[0201] T,A,GG,G,T,T,AG,A,C,A,A

[0202] T,A,GG,G,T,T,A,GA,C,A,A

[0203] T,A,GG,G,T,T,A,G,AC,A,A

[0204] T,A,GG,G,T,T,A,G,A,CA,A

[0205] T,A,GG,G,T,T,A,G,A,C,AA

[0206] T,A,G,GG,TT,A,G,A,C,A,A

[0207] T,A,G,GG,T,TA,G,A,C,A,A

[0208] T,A,G,GG,T,T,AG,A,C,A,A

[0209] T,A,G,GG,T,T,A,GA,C,A,A

[0210] T,A,G,GG,T,T,A,G,AC,A,A

[0211] T,A,G,GG,T,T,A,G,A,CA,A

[0212] T,A,G,GG,T,T,A,G,A,C,AA

[0213] T,A,G,G,GT,TA,G,A,C,A,A

[0214] T,A,G,G,GT,T,AG,A,C,A,A

[0215] T,A,G,G,GT,T,A,GA,C,A,A

[0216] T,A,G,G,GT,T,A,G,AC,A,A

[0217] T,A,G,G,GT,T,A,G,A,CA,A

[0218] T,A,G,G,GT,T,A,G,A,C,AA.

[0219] T,A,G,G,G,TT,AG,A,C,A,A

[0220] T,A,G,G,G,TT,A,GA,C,A,A

[0221] T,A,G,G,G,TT,A,G,AC,A,A

[0222] T,A,G,G,G,TT,A,G,A,CA,A

[0223] T,A,G,G,G,TT,A,G,A,C,AA

[0224] T,A,G,G,G,T,TA,GA,C,A,A

[0225] T,A,G,G,G,T,TA,G,AC,A,A

[0226] T,A,G,G,G,T,TA,G,A,CA,A

[0227] T,A,G,G,G,T,TA,G,A,C,AA

[0228] T,A,G,G,G,T,T,AG,AC,A,A

[0229] T,A,G,G,G,T,T,AG,A,CA,A

[0230] T,A,G,G,G,T,T,AG,A,C,AA.

[0231] T,A,G,G,G,T,T,A,GA,CA,A

[0232] T,A,G,G,G,T,T,A,GA,C,AA.

[0233] TA,GG,GT,T,A,G,A,C,A,A

[0234] TA,GG,G,TT,A,G,A,C,A,A

[0235] TA,GG,G,T,TA,G,A,C,A,A

[0236] TA,GG,G,T,T,AG,A,C,A,A

[0237] TA,GG,G,T,T,A,GA,C,A,A

[0238] TA,GG,G,T,T,A,G,AC,A,A

[0239] TA,GG,G,T,T,A,G,A,CA,A

[0240] TA,GG,G,T,T,A,G,A,C,AA

[0241] TA,G,GG,TT,A,G,A,C,A,A

[0242] TA,G,GG,T,TA,G,A,C,A,A

[0243] TA,G,GG,T,T,AG,A,C,A,A

[0244] TA,G,GG,T,T,A,GA,C,A,A

[0245] TA,G,GG,T,T,A,G,AC,A,A

[0246] TA,G,GG,T,T,A,G,A,CA,A

[0247] TA,G,GG,T,T,A,G,A,C,AA, etc.

[0248] TA,GG,GT,TA,G,A,C,A,A

[0249] TA,GG,GT,T,AG,A,C,A,A

[0250] TA,GG,GT,T,A,GA,C,A,A

[0251] TA, GG, GT, T, A, G, AC, A, A

[0252] TA, GG, GT, T, A, G, A, CA, A

[0253] TA, GG, GT, T, A, G, A, C, AA, etc.

[0254] TA, GG, GT, TA, GA, C, A, A

[0255] TA, GG, GT, TA, G, AC, A, A

[0256] TA, GG, GT, TA, G, A, CA, A

[0257] TA, GG, GT, TA, G, A, C, AA, etc.

[0258] TA, G, GG, TT, AG, AC, A, A

[0259] TA, G, GG, TT, AG, A, CA, A

[0260] TA, G, GG, TT, AG, A, C, AA

[0261] TA, G, G, GT, TA, GA, CA, A

[0262] TA, G, G, GT, TA, GA, C, AA

[0263] TA, G, G, GT, TA, GA, CA, A

[0264] TA, G, G, G, TT, AG, AC, AA

[0265] TA, G, GG, T, TA, GA, CA, A

[0266] TA, G, GG, T, TA, GA, C, AA

[0267] TA, G, GG, T, TA, G, AC, AA, etc.

[0268] T, A, G, GG, TT, AG, AC, AA

[0269] T, A, GG, G, TT, AG, AC, AA

[0270] T, AG, G, G, TT, AG, AC, AA

[0271] TA, G, G, G, TT, AG, AC, AA

[0272] T, AG, G, GT, T, AG, AC, AA, etc.

[0273] T, AG, GG, T, T, AG, AC, AA, etc.

[0274] T, AG, GG, TT, A, G, AC, AA, etc.

[0275] T, AG, GG, TT, AG, A, C, AA, etc.

[0276] T, AG, GG, TT, AG, AC, A, A

[0277] T, AG, GG, TT, AG, AC, AA

[0278] TA, G, GG, TT, AG, AC, AA <000|794>

[0279] TA, GG, G, TT, AG, AC, AA

[0280] TA, GG, GT, T, AG, AC, AA

[0281] TA, GG, GT, TA, G, AC, AA

[0282] TA, GG, GT, TA, GA, C, AA or

[0283] TA, GG, GT, TA, GA, CA, A

[0284] It should be noted that there seems to be a small formatting issue in the original text where "000|794" might be a typo. It's presented as "0001794" in the translation as best as possible. In some embodiments, the method comprises sequentially coupling a series of 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimers and / or 3'-protected aminonucleoside-5'-phosphoramidite monomers to the end groups of a solid support, with at least the last coupling of the synthesis being a dimer coupling. In certain embodiments, the penultimate and last couplings are dimer couplings. In certain cases, when N is an even number, the method comprises N / 2 dimer couplings. In certain examples, when N is an even number, the method comprises N / 2-1 dimer couplings. In certain examples, when N is an even number, the method comprises N / 2-2 dimer couplings. In certain examples, when N is an even number, the method comprises N / 2-3 dimer couplings. In certain examples, when N is an even number, the method comprises N / 2-4 dimer couplings. In certain examples, when N is an even number, the method comprises N / 2-5 dimer couplings. In certain cases, when N is odd, the method involves coupling dimers N / 2-1 times. In certain cases, when N is odd, the method involves coupling dimers N / 2-2 times. In certain cases, when N is odd, the method involves coupling dimers N / 2-3 times. In certain cases, when N is odd, the method involves coupling dimers N / 2-4 times. In certain cases, when N is odd, the method involves coupling dimers N / 2-5 times. In certain cases, when N is odd, the method involves coupling dimers N / 2-6 times. For example, sequential coupling of the following series of 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimers and / or 3'-protected aminonucleoside-5'-phosphoramidite monomers to the end group of a solid support:

[0285] T,A,G,G,G,T,T,A,G,A,C,AA

[0286] T,A,G,G,G,T,T,A,G,AC,AA

[0287] T,A,G,G,G,T,T,A,GA,C,AA

[0288] T,A,G,G,G,T,T,AG,A,C,AA

[0289] T,A,G,G,G,T,TA,G,A,C,AA

[0290] T,A,G,G,G,TT,A,G,A,C,AA

[0291] T,A,G,G,GT,T,A,G,A,C,AA

[0292] T,A,G,GG,T,T,A,G,A,C,AA

[0293] T,A,GG,G,T,T,A,G,A,C,AA

[0294] T,AG,G,G,T,T,A,G,A,C,AA

[0295] TA,G,G,G,T,T,A,G,A,C,AA, etc.

[0296] T,A,G,G,G,T,T,AG,AC,AA

[0297] T,A,G,G,G,TT,AG,AC,AA

[0298] [[ID=4​​​​​​​​​​​​​​​​​​​​​

[0304] TA,GG,GT,TA,GA,C,AA

[0305] In some embodiments of the method, the 3′-protected amino-dinucleotide thiophosphoramidate-5′-phosphoramidite dimer has the formula X 1 X 2 In this case, X 1 and X 2 are independently selected from protected adenine, protected cytosine, protected guanine, thymine, and uracil.

[0306] Lipid-modified oligonucleotides Depending on the nature of the linkage selected, various synthetic approaches can be used to attach the lipid moiety L' to the oligonucleotide, including those described in Mishra et al. (1995) Biochemica et Biophysica Acta, 1264:229-237, Shea et al. (1990) Nucleic Acids Res. 18:3777-3783, and Rump et al. (1998) Bioconj. Chem. 9:341-349. Synthesis of compounds in which the lipid moiety is attached to the 5' or 3' end of the oligonucleotide can be achieved through the use of a suitable functional group at the appropriate terminus, in some cases through the use of an amino group capable of reacting with carboxylic acids, acid chlorides, anhydrides, and active esters. Thiol groups may also be used as functional groups (see Kupihar et al. (2001) Bioorganic and Medicinal Chemistry, 9:1241-1247). Amino- and thiol-modifiers of different chain lengths are commercially available for oligonucleotide synthesis. Because oligonucleotides with N3'→P5' phosphoramidate (e.g., N3'→P5' thiophosphoramidate) linkages contain a 3' amino group (rather than the 3'-hydroxyl found in most conventional oligonucleotide chemistries), these oligonucleotides offer a unique opportunity to attach a lipid group to the 3'-terminus of the oligonucleotide.

[0307] Various approaches can be used to attach lipid groups to the termini of oligonucleotides using N3'→P5' phosphoramidate (e.g., N3'→P5' thiophosphoramidate) chemistry (see, for example, the 3-palmitoylamino-1-O-(4,4'-dimethoxytrityl)-2-O-succinylpropanediol linker in Table 2). For attachment to the 3' end, conjugate compounds can be synthesized by reacting the free 3'-amino group of a fully protected, solid-support-bound oligonucleotide with the corresponding acid anhydride, followed by deprotection with ammonia and purification. Alternatively, lipid groups can be attached using coupling of the carboxylic acid of a lipid to the free 3'-amino group of a support-bound oligonucleotide using a coupling agent such as carbodiimide, HBTU, or 2-chloro-1-methylpyridinium iodide. These two methods form an amide bond between the lipid and the oligonucleotide. Lipids can also be attached to oligonucleotide chains using phosphoramidite derivatives of lipids that are coupled to the oligonucleotide during chain elongation. This approach results in a phosphoramidate (e.g., thiophosphoramidate) bond connecting the lipid and the oligonucleotide (exemplified by the compounds propyl-palmitoyl and 2-hydroxypropyl-palmitoyl). Yet another approach involves reaction of the free 3'-amino group of a fully protected, support-bound oligonucleotide with a suitable lipid aldehyde, followed by reduction with sodium cyanoborohydride, which results in an amine bond.

[0308] For linkage to the 5' end, oligonucleotides can be synthesized using modified, lipid-containing solid supports followed by synthesis of the oligonucleotide in the 5' to 3' direction as described in Pongracz and Gryaznov (1999). Examples of modified supports are provided below. In the example where n = 14, the fatty acid is palmitic acid; reaction of 3-amino-1,2-propanediol with palmitoyl chloride followed by dimethoxytritylation and succinylation provided the intermediate used for coupling to the solid support. R can also be a long-chain alkylamine controlled pore glass. [ka]

[0309] Dimers useful for making oligonucleotides In some embodiments of the method for making an oligonucleotide, the method comprises contacting a support-bound free 3'-terminal group (e.g., a 3'-hydroxyl group or a 3'-amino group) with a dinucleotide dimer subunit to form an intersubunit linkage. Generally, the dinucleotide dimer is 3'-protected and comprises a 5' group capable of coupling with the 3'-terminal group. In some embodiments, the dinucleotide dimer comprises a 5'-phosphoramidite. The dinucleotide dimer may comprise a 3'-protected amino group or a 3'-protected hydroxyl group. In some embodiments, the dinucleotide has the formula X 1 X 2 Described by X 1 and X 2are independently any convenient nucleoside (e.g., A, C, G, T, or U, or protected forms thereof) linked via a convenient internucleoside linkage (e.g., as described herein). A dinucleotide may contain any convenient internucleoside linkage between the two nucleosides. Internucleoside linkages of interest for use in dinucleotide dimers include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate (e.g., thiophosphoramidate), and phosphorothioate linkages.

[0310] In some cases, the dinucleotide dimer is a 3'-protected-dinucleotide-5'-phosphoramidite dimer or a synthetic precursor thereof, and the dinucleotide has the formula X 1 X 2 Described by X 1 and X 2 is independently selected from A, C, G, T, or U or protected forms thereof, and X 1 and X 2 are linked via a phosphodiester, phosphotriester, methylphosphonate, phosphoramidate (eg, thiophosphoamidate) or phosphorothioate bond, or a protected form thereof.

[0311] In some embodiments of the method for producing an oligonucleotide, the method includes contacting a free 3'-amino group attached to a support with a 3'-protected amino-dinucleotide phosphoramidate-5'-phosphoramidite dimer to form an internucleoside N3'→P5' phosphoramidite linkage. A convenient 3'-protected amino-dinucleotide phosphoramidate-5'-phosphoramidite dimer or its synthetic precursor may be used in the subject method. In some cases, the dimer may be represented by one of the following sequences: AA, AC, AG, AT, AU, CA, CC, CG, CT or CU, GA, GC, GG, GT or GU, TA or UA, TC or UC, TG or UG, and TT or UU. In some cases, the dimer contains a protected 2'-hydroxyl group.

[0312] In certain embodiments, the dinucleotide dimer has formula (II): [ka] wherein B is a dinucleotide thiophosphoramidate compound described by the formula: 1 and B 2 are each independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; R 11 is hydrogen, a protecting group, or a phosphoramidite group; R 12 is hydrogen or a protecting group; R 13 is hydrogen, alkyl, substituted alkyl, aryl, substituted aryl or a protecting group. 1 and / or B. 2 R contains a nucleobase protecting group. 13 It is understood that when is hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a protecting group, some of the dinucleotides described by formula (II) may also exist in salt form, and such forms, to the extent they may exist, are intended to be included within the scope of this disclosure.

[0313] In some embodiments of Formula (II), R 11 is hydrogen. In some embodiments of Formula (II), R 11 is a protecting group. Any convenient protecting group may be used in the subject dimer of formula (II). In some embodiments of formula (II), R 11 is a levulinic acid-based protecting group. In some embodiments of Formula (II), R 11 is a levulinic acid protecting group (i.e., -COCH2CH2COCH3). In some embodiments of Formula (II), R 11 is a 5'-phosphoramidite group.

[0314] In some embodiments of Formula (II), R 12 is hydrogen. In some embodiments of Formula (II), R 12 is a protecting group. In certain embodiments, R 12 is a trityl group (e.g., triphenylmethyl (Trt), monomethoxytrityl (MMT), or dimethoxytrityl (DMT)). In some embodiments of Formula (II), R 12 is a Trt protecting group.

[0315] In some embodiments of Formula (II), R 12 is a photocleavable protecting group. Any convenient photocleavable protecting group may be used in the preparation of the subject dinucleotide dimers and their synthetic precursors. In some embodiments of formula (II), R 12 is a substituted pixyl protecting group, for example, a nitro, fluoro, methyl, trifluoromethyl, and / or methoxy substituted pixyl protecting group. In some embodiments of Formula (II), R 12 is a pixyl protecting group (i.e., 9-(9-phenyl)xanthenyl).

[0316] In some embodiments of Formula (II), R 11 is a levunyl protecting group, and R 12 is a trityl protecting group.

[0317] In some embodiments of Formula (II), R 13is hydrogen. In some embodiments of Formula (II), R 13 is a protecting group. In certain embodiments, R 13 is a 2-cyano-ethyl group.

[0318] In certain embodiments, the 3'-protected-dinucleotide phosphoramidate-5'-phosphoramidite dimer has formula (III): [ka] wherein B 1 and B 2 are each independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof. 1 and / or B. 2 contains nucleobase protecting groups.

[0319] In certain embodiments, the 3'-protected-dinucleotide phosphoramidate-5'-phosphoramidite dimer has formula (III): [ka] wherein B 1 and B 2 are each independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; R 18 is a trityl protecting group (e.g., Trt, DMT, or MMT) or a pixyl protecting group.

[0320] In some embodiments of formula (II) or (III), B 1 and B 2 are each independently selected from a protected adenine, a protected cytosine, a protected guanine, a thymine, and a uracil. In some embodiments of Formula (II) or (III), B 1 and B 2are each independently selected from A(Bz), A(DMF), C(Bz), G(isobutyryl), T, and U. In some embodiments of formula (II) or (III), B 1 is A(Bz). In some embodiments of formula (II) or (III), B 1 is A(DMF). In some embodiments of formula (II) or (III), B 1 is C(Bz). In some embodiments of formula (II) or (III), B 1 is G (isobutyryl). In some embodiments of formula (II) or (III), B 1 is T or U. In some embodiments of formula (II) or (III), B 2 is A(Bz) or A(DMF). In some embodiments of formula (II) or (III), B 2 is C(Bz). In some embodiments of formula (II) or (III), B 2 is G (isobutyryl). In some embodiments of formula (II) or (III), B 2 is T or U.

[0321] In some embodiments of formula (II) or (III), B 1 is A(Bz) or A(DMF), and B 2 is A(Bz) or A(DMF). In some embodiments of formula (II) or (III), B 1 is A(Bz) or A(DMF), and B 2 is C(Bz). In some embodiments of formula (II) or (III), B 1 is A(Bz) or A(DMF), and B 2 is G (isobutyryl). In some embodiments of formula (II) or (III), B 1 is A(Bz) or A(DMF), and B 2 is T or U.

[0322] In some embodiments of formula (II) or (III), B 1 is C(Bz) and B 2is A(Bz) or A(DMF). In some embodiments of formula (II) or (III), B 1 is C(Bz) and B 2 is C(Bz). In some embodiments of formula (II) or (III), B 1 is C(Bz) and B 2 is G (isobutyryl). In some embodiments of formula (II) or (III), B 1 is C(Bz) and B 2 is T or U.

[0323] In some embodiments of formula (II) or (III), B 1 is G (isobutyryl) and B 2 is A(Bz) or A(DMF). In some embodiments of formula (II) or (III), B 1 is G (isobutyryl) and B 2 is C(Bz). In some embodiments of formula (II) or (III), B 1 is G (isobutyryl) and B 2 is G (isobutyryl). In some embodiments of formula (II) or (III), B 1 is G (isobutyryl) and B 2 is T or U.

[0324] In some embodiments of formula (II) or (III), B 1 is T or U, and B 2 is A(Bz) or A(DMF). In some embodiments of formula (II) or (III), B 1 is T or U, and B 2 is C(Bz). In some embodiments of formula (II) or (III), B 1 is T or U, and B 2 is G (isobutyryl). In some embodiments of formula (II) or (III), B 1 is T or U, and B 2is T or U. It is understood that any of the embodiments of formula (II) or (III) described herein can also be applied to formula (IV).

[0325] Any of the dimers described herein may be adapted for use in the subject methods. The subject dimers may be prepared from convenient nucleoside monomers according to convenient methods. Nucleoside monomers of interest used to prepare the subject nucleoside dimers include, but are not limited to, monomers 16, 17, 12, and 13 depicted in the synthetic schemes disclosed herein. Dinucleotide dimers of interest include non-phosphitylated dimers used in the preparation of the subject phosphitylated dinucleotide dimers, for example, dimers 18 and 19 used in the preparation of phosphitylated dinucleotide dimers such as 20, or dimer 14 used in the preparation of phosphitylated dinucleotide dimers such as 15.

[0326] In some embodiments, the dimer of formula (III) and (IV) can be prepared according to the following scheme: [ka] wherein B is a compound prepared via the method depicted in 1 and B 2 are each independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; R 15 is hydrogen or an amino protecting group; R 17 is an amino protecting group; R 16 is a hydroxyl protecting group. In certain embodiments, R 15 is hydrogen. In certain embodiments of monomer 16, R 16 is silyl. In certain embodiments of monomer 16, R 16 is TBDMS (tert-butyldimethylsilyl). In certain embodiments of monomer 17, R 17 is trityl (Trt). In certain embodiments of monomer 17, R 17 is monomethoxytrityl (MMT).

[0327] In certain embodiments of monomer 17, R 17 is dimethoxytrityl (DMT). In certain embodiments of monomer 17, R 17 In certain embodiments of dimers 18-20, R 17 is trityl (Trt). In certain embodiments of dimers 18-20, R 17 is monomethoxytrityl (MMT). In certain embodiments of dimers 18-20, R 17 is dimethoxytrityl (DMT). In certain embodiments of dimers 18-20, R 17 is Pixil. In some embodiments, the dimer of formula (III) and (IV) can be prepared according to the following scheme: [ka] wherein monomer 13 is prepared from 11 via monomer 12 and coupled with a nucleoside amidite to give dimer 14, which is then converted to dimer 15; wherein B 1 and B 2 are each independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; R 13 and R 14 are each independently a protecting group. In certain embodiments of monomers 12 and 13, R 13 is trityl. In certain embodiments of monomers 12 and 13, R 13 is pixyl. In particular embodiments of dimers 14 and 15, R 14 is trityl. In certain embodiments of dimers 14 and 15, R 14 is dimethoxytrityl. In particular embodiments of dimers 14 and 15, R 14 is monomethoxytrityl. In particular embodiments of dimers 14 and 15, R 14 is Pixil. Monomers of interest for use in preparing the subject dinucleotide dimers according to the methods described herein include: [ka] where B is a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof, and R is hydrogen or alkyl (e.g., methyl) or halogen (e.g., bromo). In certain cases, B is selected from A(Bz), G(iBu), T, A(DMF), C(Bz), or U.

[0328] Oligonucleotide Composition In addition to the target oligonucleotide, various non-target oligonucleotide synthesis products may be generated during oligonucleotide synthesis. Minor products that may be present in oligonucleotide preparations include, but are not limited to, deletion products (e.g., products lacking one or more nucleoside residues), products containing one or more protecting groups, terminal products (e.g., products containing capped oligonucleotide chains), products lacking one or more nucleobases, products containing partially oxidized phosphoramidite linkages, and products containing partially sulfurized linkages. As used herein, a target oligonucleotide refers to the intended oligonucleotide sequence that is the target product of the preparation method. As used herein, "non-target product" and "minor product" are used interchangeably and refer to oligonucleotide-containing products that are not target products and may be present during and after the synthesis of a target oligonucleotide.

[0329] The subject methods provide compositions comprising target oligonucleotides of improved purity. In some embodiments, the compositions comprise 50% or more target oligonucleotides by weight, e.g., about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, or about 95% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 50% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 55% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 60% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 65% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 70% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 75% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 80% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 85% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 90% or more target oligonucleotides by weight. In certain embodiments, the compositions comprise 95% or more target oligonucleotides by weight.

[0330] In some embodiments, the subject methods provide coupling efficiencies of 95% or greater, eg, 96% or greater, 97% or greater, 98% or greater, or even 98% or greater.

[0331] In some embodiments, the subject methods provide average coupling efficiencies that are 0.5% or greater, e.g., 0.75% or greater, 1.0% or greater, 1.25% or greater, 1.5% or greater, 1.75% or greater, 2.0% or greater, 2.5% or greater, or even 3.0% or greater, greater than the average coupling efficiency of a control synthesis performed using only monomeric subunits. In certain embodiments, the subject methods provide coupling efficiencies of 96% or greater. In certain embodiments, the subject methods provide coupling efficiencies that are 2% or greater than the coupling efficiency of a control synthesis performed using only monomeric subunits.

[0332] After synthesis, the subject compositions undergo one or more purification steps (e.g., HPLC chromatography, affinity chromatography, ion exchange chromatography, gel filtration, etc.) to, for example, remove one or more minor products from the target oligonucleotide. For the subject compositions, the reduction in the amount of minor products and / or the increase in the amount of target oligonucleotide provided by the subject methods of preparation refers to such amount and purity immediately after synthesis and before further purification or separation steps (e.g., HPLC chromatography) are performed. As such, in some cases, the subject compositions may be referred to as synthetic preparations, e.g., crude synthetic preparations. By crude, it is meant that the composition has not undergone chromatographic purification. Chromatographic purification refers to a convenient purification method involving adsorption of the target oligonucleotide to a chromatographic support and subsequent elution of the target oligonucleotide. In some cases, chromatographic purification refers to reverse-phase chromatographic purification.

[0333] The subject method provides a composition comprising one or more minor products in reduced amounts. By reduced amount, it is meant that the amount by weight of the minor product in the composition relative to the target oligonucleotide is reduced compared to a control synthesis, e.g., a synthesis in which the oligonucleotide is prepared using only monomer coupling. In some embodiments, the reduced amount of the minor product is about 20% or less of the amount by weight of the target oligonucleotide, e.g., about 15% or less, about 10% or less, or about 5% or less of the amount by weight of the target oligonucleotide. In certain embodiments, the reduced amount of the minor product is about 20% or less of the amount by weight of the target oligonucleotide, e.g., 15% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, 5% or less, 4% or less, 3% or less, 2% or less, or even 1% or less of the amount by weight of the target oligonucleotide. In certain embodiments, the minor product is an (Nx) product.

[0334] The subject methods of preparation may provide compositions having one or more (Nx) products in reduced amounts relative to a target oligonucleotide of interest, where x is an integer from 1 to N-1, and N is the number of nucleoside residues in the target oligonucleotide. As such, (N-1) product may refer to any and all oligonucleotide products that lack one nucleoside residue compared to the target oligonucleotide (e.g., N product). As such, (N-2) product refers to any and all oligonucleotide products that lack two nucleoside residues compared to the target oligonucleotide (e.g., N product). In certain embodiments, the minor product is the (N-1) product. In certain embodiments, the minor product is the (N-2) product. In certain embodiments, the minor product is the (N-3) product. In certain embodiments, the minor product is the (N-4) product. In certain embodiments, the minor product is the (N-5) product. In certain embodiments, the minor product is the (N-6) product. In certain embodiments, the minor product is the (N-7) product.

[0335] Any of the compositions described herein having one or more (Nx) products in reduced amounts relative to a target oligonucleotide of interest is unpurified.

[0336] In some embodiments, the subject compositions comprise a low ratio of (N-1) product to target oligonucleotide product.In some cases, a low ratio is less than (2.0×N) parts by weight of (N-1) product to target oligonucleotide per 100 parts by weight, where N refers to the number of nucleotide residues in the target oligonucleotide sequence.In certain embodiments, the ratio is less than (1.9×N) parts by weight of (N-1) product to target oligonucleotide per 100 parts by weight, for example, less than (1.8×N) parts by weight of (N-1) product to target oligonucleotide per 100 parts by weight, less than (1.7×N) parts by weight of (N-1) product to target oligonucleotide per 100 parts by weight, less than (1.6×N) parts by weight of (N-1) product to target oligonucleotide per 100 parts by weight, less than (1.5×N) parts by weight of (N-1) product to target oligonucleotide per 100 parts by weight, less than (1.4×N) parts by weight of (N-1) product to target oligonucleotide per 100 parts by weight, less than (1.3×N) parts by weight of (N-1) product to target oligonucleotide per 100 parts by weight, less than (1.2×N) parts by weight of (N-1) product to target oligonucleotide per 100 parts by weight, The ratio is less than (1.1 x N) parts per 100 parts by weight, less than (1.0 x N) parts per 100 parts by weight, less than (0.9 x N) parts per 100 parts by weight, less than (0.8 x N) parts per 100 parts by weight, less than (0.7 x N) parts per 100 parts by weight, less than (0.6 x N) parts per 100 parts by weight, less than (0.5 x N) parts per 100 parts by weight, less than (0.4 x N) parts per 100 parts by weight, less than (0.3 x N) parts per 100 parts by weight, less than (0.2 x N) parts per 100 parts by weight, or even less than (0.1 x N) parts per 100 parts by weight. In certain embodiments, the subject compositions comprise a low ratio of less than (1.5 x N) parts per 100 parts by weight of the (N-1) product to the target oligonucleotide. In certain embodiments, the subject compositions comprise a low ratio of (N-1) product to target oligonucleotide of less than (1.2 x N) parts per 100 parts by weight. In certain embodiments, the subject compositions comprise a low ratio of (N-1) product to target oligonucleotide of less than (1.0 x N) parts per 100 parts by weight. In certain embodiments, the subject compositions comprise a low ratio of (N-1) product to target oligonucleotide of less than (0.5 x N) parts per 100 parts by weight.

[0337] In some embodiments, the subject compositions comprise a low ratio of (N-2) product to target oligonucleotide product. In some cases, the low ratio is less than (2.0 x N) parts per 100 parts by weight of (N-2) product to target oligonucleotide, where N refers to the number of nucleotide residues in the target oligonucleotide sequence. In certain embodiments, the ratio is less than (1.9 x N) parts per 100 parts by weight of (N-2) product to target oligonucleotide, for example, less than (1.8 x N) parts per 100 parts by weight of (N-2) product to target oligonucleotide, less than (1.7 x N) parts per 100 parts by weight, less than (1.6 x N) parts per 100 parts by weight, less than (1.5 x N) parts per 100 parts by weight, less than (1.4 x N) parts per 100 parts by weight, less than (1.3 x N) parts per 100 parts by weight, less than (1.2 x N) parts per 100 parts by weight, less than ... The N-2 product is preferably less than (1.1 x N) parts per 100 parts by weight, less than (1.0 x N) parts per 100 parts by weight, less than (0.9 x N) parts per 100 parts by weight, less than (0.8 x N) parts per 100 parts by weight, less than (0.7 x N) parts per 100 parts by weight, less than (0.6 x N) parts per 100 parts by weight, less than (0.5 x N) parts per 100 parts by weight, less than (0.4 x N) parts per 100 parts by weight, less than (0.3 x N) parts per 100 parts by weight, less than (0.2 x N) parts per 100 parts by weight, or even less than (0.1 x N) parts per 100 parts by weight. In certain embodiments, the subject compositions comprise a low ratio of less than (1.5 x N) parts per 100 parts by weight of the (N-2) product to the target oligonucleotide. In certain embodiments, the subject compositions comprise a low ratio of (N-2) product to target oligonucleotide of less than (1.2 x N) parts per 100 parts by weight. In certain embodiments, the subject compositions comprise a low ratio of (N-1) product to target oligonucleotide of less than (1.0 x N) parts per 100 parts by weight. In certain embodiments, the subject compositions comprise a low ratio of (N-2) product to target oligonucleotide of less than (0.5 x N) parts per 100 parts by weight.

[0338] In some embodiments, the subject compositions comprise (N-1) products in an amount of 20% or less of the total non-target oligonucleotides in the composition, e.g., 15% or less, 10% or less, or even 5% or less of the total non-target oligonucleotides.

[0339] The methods described herein can be used to prepare any of a wide variety of oligonucleotide compositions.Various classes and types of oligonucleotides are suitable for preparation using the subject methods (e.g., as described herein).Oligonucleotides suitable for preparation using the subject methods include, but are not limited to, antisense oligonucleotides, RNA oligonucleotides, siRNA oligonucleotides, RNAi oligonucleotides, DNA aptamers, microRNAs, etc.

[0340] Oligonucleotides complementary to the RNA component of telomerase Aspects of the present disclosure include compounds and compositions, and methods for making them, that contain oligonucleotides complementary to the RNA component of human telomerase, which inhibit telomerase activity in cells with high potency and have cellular uptake properties.

[0341] As summarized above, the subject methods provide reduced amounts of synthetic non-target oligonucleotide products. In certain cases, the subject methods provide increased amounts of synthetic target oligonucleotide products. In some embodiments, the subject methods provide for the preparation of compositions having reduced amounts of one or more (Nx) products relative to a target oligonucleotide of interest. Table 1 shows the target amounts of some non-target oligonucleotide products.

[0342] In certain embodiments, the compositions described herein having reduced amounts of one or more (Nx) products relative to a target oligonucleotide of interest are unpurified.

[0343] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0344] In certain embodiments, the composition has an (N-1) product of less than (2.0 x N) parts of compound per 100 parts by weight, wherein the compound comprises a polynucleotide having a sequence of N nucleoside subunits that are complementary to an RNA component of human telomerase, and at least two of the nucleoside subunits are linked by an N3'→P5' phosphoramidate intersubunit linkage. In certain embodiments, the ratio is less than (1.9×N) parts per 100 parts by weight of the (N−1) product to the N product, e.g., less than (1.8×N) parts per 100 parts by weight, less than (1.7×N) parts per 100 parts by weight, less than (1.6×N) parts per 100 parts by weight, less than (1.5×N) parts per 100 parts by weight, less than (1.4×N) parts per 100 parts by weight, less than (1.3×N) parts per 100 parts by weight, less than (1.2 ... less than (1.1 x N) parts per 100 parts by weight, less than (1.0 x N) parts per 100 parts by weight, less than (0.9 x N) parts per 100 parts by weight, less than (0.8 x N) parts per 100 parts by weight, less than (0.7 x N) parts per 100 parts by weight, less than (0.6 x N) parts per 100 parts by weight, less than (0.5 x N) parts per 100 parts by weight, less than (0.4 x N) parts per 100 parts by weight, less than (0.3 x N) parts per 100 parts by weight, less than (0.2 x N) parts per 100 parts by weight, or even less than (0.1 x N) parts per 100 parts by weight.

[0345] In some embodiments, the composition has an (N-1) product for less than 1 part compound per 4 parts by weight (e.g., less than 1 part at 5 parts by weight, less than 1 part at 6 parts by weight, less than 1 part at 7 parts by weight, less than 1 part at 8 parts by weight, less than 1 part at 9 parts by weight, less than 1 part at 10 parts by weight, less than 1 part at 15 parts by weight, less than 1 part at 20 parts by weight, less than 1 part at 25 parts by weight, less than 1 part at 50 parts by weight, less than 1 part at 100 parts by weight), wherein the compound comprises a polynucleotide having a sequence of 10 or more nucleoside subunits complementary to an RNA component of human telomerase, and at least two of the nucleoside subunits are linked by an N3'→P5' thiophosphoramidate or oxophosphoramidate intersubunit linkage. In certain embodiments, the polynucleotide has a sequence of 10 or more nucleoside subunits, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleoside subunits, that is complementary to the RNA component of human telomerase.

[0346] In particular examples, the polynucleotide comprises a sequence of 13 or more nucleoside subunits that are complementary to the RNA component of human telomerase, e.g., 15 or more, 20 or more, 30 or more, 50 or more nucleoside subunits that are complementary to the RNA component of human telomerase.

[0347] In certain embodiments, the polynucleotide comprises a sequence of 7 or more nucleoside subunits that are complementary to the RNA component of human telomerase, e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleoside subunits that are complementary to the RNA component of human telomerase. In certain embodiments, the polynucleotide comprises a sequence of between 11 and 18 nucleoside subunits that are complementary to the RNA component of human telomerase, e.g., between 11 and 16 adjacent nucleoside subunits that are complementary to the RNA component of human telomerase.

[0348] In some embodiments, the polynucleotide comprises between 3 and 50 contiguous nucleoside subunits, e.g., between 5 and 40, between 10 and 40, between 10 and 30, between 10 and 25, between 10 and 20, or between 12 and 15 nucleoside subunits, that are complementary to the RNA component of human telomerase. In certain embodiments, the oligonucleotide comprises 10 or more contiguous nucleoside subunit sequences that are complementary to the RNA component of human telomerase. In certain embodiments, the composition has an (N-1) product for less than 1 part compound in 10 parts by weight. In certain embodiments, the composition has an (N-1) product for less than 1 part compound in 20 parts by weight. In certain embodiments, the composition has an (N-1) product for less than 1 part compound in 25 parts by weight. In certain embodiments, the composition has an (N-1) product for less than 1 part compound in 30 parts by weight. In certain embodiments, the composition has an (N-1) product for less than 1 part compound in 50 parts by weight.

[0349] In some embodiments, the composition has an (Nx) product of less than 1 part compound at 4 parts by weight, for example, less than 1 part at 5 parts by weight, less than 1 part at 6 parts by weight, less than 1 part at 7 parts by weight, less than 1 part at 8 parts by weight, less than 1 part at 9 parts by weight, less than 1 part at 10 parts by weight, less than 1 part at 20 parts by weight, less than 1 part at 25 parts by weight, less than 1 part at 30 parts by weight, or even less than 1 part at 50 parts by weight.

[0350] In some embodiments, the composition has (Nx) polynucleotide-containing product to compound less than 40 parts per 100 total parts by weight, for example, less than 35 parts per 100 parts by weight, less than 30 parts per 100 parts by weight, less than 25 parts per 100 parts by weight, less than 20 parts per 100 parts by weight, or even less than 15 parts per 100 parts by weight of the compound.

[0351] In some embodiments, the composition has a product of (N-2) and (N-3) for at least 5 parts by weight of the compound in 100 parts by weight, e.g., at least 10 parts by weight of the compound in 100 parts by weight, at least 12 parts by weight of the compound in 100 parts by weight, at least 14 parts by weight of the compound in 100 parts by weight, at least 15 parts by weight of the compound in 100 parts by weight, at least 20 parts by weight of the compound in 100 parts by weight, at least 30 parts by weight of the compound in 100 parts by weight, or at least 40 parts by weight of the compound in 100 parts by weight.

[0352] In some embodiments, the composition has the following profile: The (Nx) polynucleotide-containing product comprises: (N-1) product for less than 1 part N product in 4 parts by weight, and (N-2) and (N-3) products for at least 10 parts N product in 100 parts by weight.

[0353] In certain embodiments, the oligonucleotide N product comprises a 3'-terminal nucleoside subunit that is not present in the (N-1) product.

[0354] The oligonucleotide compound has the formula: O-(x'-L') n where O represents an oligonucleotide comprising a sequence of nucleoside subunits that is complementary to the RNA component of human telomerase, x' is an optional linker group, L' represents a lipid moiety, and n is an integer from 1 to 5.

[0355] Thus, the design of a compound requires the selection of two entities, O and L', and the determination of the structural linkage between these entities, which may involve an optional linker group x'.

[0356] In some embodiments, the oligonucleotide compound has the formula: O-(x'-L') n wherein O represents an oligonucleotide comprising a sequence of nucleoside subunits that are complementary to the RNA component of human telomerase, x' is an optional linker group, L' represents a lipid moiety, and n is 1, and in formula (I), Z is a lipid moiety, L is an optional linker, and the B group corresponds to the sequence of nucleoside subunits that are complementary to the RNA component of human telomerase.

[0357] The oligonucleotide component O may be considered the "effector" component of the compound in that it is this component that achieves inhibition of the telomerase enzyme by binding to the RNA component of telomerase. Thus, the sequence of O is selected such that it contains a region that is complementary to the telomerase RNA, and is shown in SEQ ID NO:1. While the region that is complementary to the telomerase RNA component could theoretically be targeted to a portion of the telomerase RNA, specific regions of the telomerase RNA are preferred targets for inhibitory oligonucleotides. One preferred target region is the region spanning nucleotides 30-67 of SEQ ID NO:1, which includes the "template region," an 11-nucleotide region of the sequence 5'-CUAACCCUAAC-3' (SEQ ID NO:2) spanning nucleotides 46-56 of SEQ ID NO:1. The template region functions to specify the sequence of telomeric repeats that telomerase adds to chromosome ends and is essential for the activity of the telomerase enzyme (see Chen et al., Cell, 100:503-514, 2000; Kim et al., Proc. Natl. Acad. Sci., USA, 98(14):7982-7987, 2001). Therefore, compounds of the invention containing an oligonucleotide portion that contains sequence complementarity to all or a portion of the template region are particularly preferred. Another preferred target region is the region spanning nucleotides 137-179 of hTR (see Pruzan et al., Nucl. Acids Research, 30:559-588, 2002). Within this region, the sequence spanning nucleotides 141-153 is a preferred target. PCT Publication WO 98 / 28442 describes the use of oligonucleotides at least 7 nucleotides in length to inhibit telomerase, where the oligonucleotides are designed to be complementary to accessible portions of the hTR sequence outside of the template region containing nucleotides 137-196, 290-319, and 350-380 of hTR.

[0358] The region of O targeted to the hTR sequence is preferably exactly complementary to the corresponding hTR sequence. While mismatches may be tolerated in certain instances, they are expected to reduce the specificity and activity of the resulting oligonucleotide conjugate. In certain embodiments, therefore, the sequence of oligonucleotide O is selected to include at least 5 nucleotides exactly complementary to the telomerase RNA; enhanced telomerase inhibition may be achieved by employing longer lengths of complementary sequence, e.g., at least 8, at least 10, at least 12, at least 13, or at least 15 nucleotides exactly complementary to the telomerase RNA. In other embodiments, the sequence of the oligonucleotide includes at least 5-20, at least 8-20, at least 10-20, or at least 10-15 nucleotides exactly complementary to the telomerase RNA sequence. Optimal telomerase inhibitory activity may be achieved when the full-length oligonucleotide O is selected to be complementary to the telomerase RNA. However, the full-length oligonucleotide component need not be exactly complementary to the target sequence; the oligonucleotide sequence may include regions that are not complementary to the target sequence. Such regions may be added to confer other properties to the compound, for example, by adding sequences that facilitate purification. If oligonucleotide component O is to contain a region that is not complementary to the target sequence, such a region may be located at either the 5' or 3' end, or both. In instances where a region of precise complementarity is targeted to a template region, effective telomerase inhibition may be achieved by a short (5-8 nucleotide) region of precise complementarity to which a telomerase-like (G-rich) sequence is attached at the 5' end.

[0359] Exemplary sequences that are complementary to human telomerase RNA and that may be included as part of or used as the entire oligonucleotide component O are listed below.

[0360] hTR complementary sequence (region of SEQ ID NO: 1 of the oligonucleotide sequence of US Publication No. 2012329858).

[0361] GGGUUGCGGA GGGUGGGCCU GGGAGGGGUG GUGGCCAUUU UUUGUCUAAC CCUAACUGAG AAGGGCGUAG GCGCCGUGCU UUUGCUCCCC GCGCGCUGUU UUUCUCGCUG ACUUUCAGCG GGCGGAAAAG CCUCGGCCUG CCGCCUUCCA CCGUUCAUUC UAGAGCAAAC AAAAAAUGUC AGCUGCUGGC CCGUUCGCCC CUCCCGGGGA CCUGCGGCGG GUCGCCUGCC CAGCCCCCGA ACCCCGCCUG GAGGCCGCGG UCGGCCCGGG GCUUCUCCG AGGCACCCAC UGCCACCGCG AAGAGUUGGG CUCUGUCAGC CGCGGGUCUC UCGGGGGCGA GGGCGAGGUU CAGGCCUUUC AGGCCGCAGG AAGAGGAACG GAGCGAGUCC CCGCGCGCGG CGCGAUUCCC UGAGCUGUGG GACGUGCACC CAGGACUCGG CUCACACAUG C (SEQ ID NO: 1)

[0362] GCTCTAGAATGAACGGTGGAAGGCGGCAGG 137-166 (SEQ ID NO: 6)

[0363] GTGGAAGGCGGCAGG 137-151 (SEQ ID NO: 7)

[0364] GGAAGGCGGCAGG 137-149 (SEQ ID NO: 8)

[0365] GTGGAAGGCGGCA 139-151 (SEQ ID NO: 9)

[0366] GTGGAAGGCGG 141-151 (SEQ ID NO: 10)

[0367] CGGTGGAAGGCGG 141-153 (SEQ ID NO: 11)

[0368] ACGGTGGAAGGCG 142-154 (SEQ ID NO: 12)

[0369] AACGGTGGAAGGCGGC 143-155 (SEQ ID NO: 13)

[0370] ATGAACGGTGGAAGGCGG 144-158 (SEQ ID NO: 14)

[0371] ACATTTTTTGTTTGCTCTAG 160-179 (SEQ ID NO: 15)

[0372] TAGGGTTAGACAA 42-54 (SEQ ID NO: 3)

[0373] GTTAGGGTTAG 46-56 (SEQ ID NO: 4)

[0374] GTTAGGGTTAGAC 44-56 (SEQ ID NO: 16)

[0375] GTTAGGGTTAGACAA 42-56 (SEQ ID NO: 17)

[0376] GGGTTAGAC 44~52

[0377] CAGTTAGGG 50~58

[0378] CCCTTCTCAGTT 54-65 (SEQ ID NO: 18)

[0379] CGCCCTTCTCAG 56-67 (SEQ ID NO: 19)

[0380] In some embodiments, the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4); TAGGGTTAGACAA (SEQ ID NO: 3); and CAGTTAGGGTTAG (SEQ ID NO: 5).

[0381] The type of internucleoside linkage used in the synthesis of the O component may be selected from any of the available oligonucleotide chemistries, including, but not limited to, phosphodiester, phosphotriester, methylphosphonate, P3'→N5' phosphoramidate, N3'→P5' phosphoramidate, N3'→P5' thiophosphoamidate, and phosphorothioate linkages.

[0382] In some embodiments, the oligonucleotide component O has at least one N3'→P5' phosphoramidate (e.g., N3'→P5' thiophosphoramidate) linkage. In certain embodiments, all of the nucleoside subunits complementary to the RNA component of human telomerase are linked by N3'→P5' phosphoramidate intersubunit linkages. In certain cases, the N3'→P5' phosphoramidate intersubunit linkages are N3'→P5' thiophosphoramidate intersubunit linkages. In certain cases, the N3'→P5' phosphoramidate intersubunit linkages are N3'→P5' oxo-phosphoramidate intersubunit linkages.

[0383] In certain cases, the N3'→P5' thiophosphoramidate intersubunit linkage has the structure: 3'-NH-P(S)(OR)-O-5' where R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group. It is understood that some of the oligonucleotide components O that contain intersubunit linkages described by the above formula where R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group may also exist in salt form. Such forms, to the extent that they may exist, are intended to be included within the scope of this disclosure.

[0384] In some instances, the N3'→P5' thiophosphoramidate intersubunit linkage has the following structure: 3'-NH-P(S)(OR)-O-5' where R is hydrogen. For any of the oligonucleotide components O described herein that include such intersubunit linkages, it is understood that such oligonucleotide components O may also include convenient salt forms of the linkages. As such, the intersubunit linkages may be in the form of a salt with a convenient counterion.

[0385] The compounds of the present invention are more effective in causing telomerase inhibition in cells than the corresponding oligonucleotides that are not bound to lipid moieties.The lipid moiety L' is thought to function to enhance the uptake of the compound into cells, particularly by facilitating its passage through the cell membrane.The mechanism by which this occurs has not been fully elucidated, but one possibility is that the lipid moiety, either as a single molecule or in the form of an aggregate (micelle), can facilitate the binding of the compound to the cell membrane and subsequent internalization.However, understanding the exact mechanism is not required for the present invention to be utilized.

[0386] The lipid component may be a lipid or lipid derivative that provides enhanced cellular uptake compared to unmodified oligonucleotides. Preferred lipids are hydrocarbons, fats (e.g., glycerides, fatty acids, and fatty acid derivatives such as fatty amides), and sterols. When the lipid component is a hydrocarbon, the L' component may be a substituted or unsubstituted cyclic hydrocarbon or an aliphatic straight-chain or branched-chain hydrocarbon, which may be saturated or unsaturated. Preferred examples are straight-chain unbranched hydrocarbons that are fully saturated or polyunsaturated. The length of the hydrocarbon chain may vary from C2 to C30, although optimal telomerase inhibition may be achieved with carbon chains that are C8 to C22. Preferred examples of saturated hydrocarbons (alkanes) are listed below.

[0387] [Systematic name / carbon chain]

[0388] Tetradecane C 14 H 30

[0389] Pentadecane C 15 H32

[0390] Hexadecane C 16 H 34

[0391] Heptadecane C 17 H 36

[0392] Octadecane C 18 H 38

[0393] Nonadecane C 19 H 40

[0394] Eicosan C 20 H 42

[0395] Mono- and poly-unsaturated forms of hydrocarbons (alkenes and polyenes, e.g., alkadienes and alkatrienes) may also be selected, and compounds with more double bonds may be employed, although compounds with 1 to 3 double bonds are preferred. Alkynes (containing one or more triple bonds) and alkenynes (triple and double bonds) may also be utilized.

[0396] Substituted forms of hydrocarbons may be employed in the compounds of the present invention, with substituents that are inert in vivo and in vitro being preferred. A particularly preferred substituent is fluorine. Exemplary general structures of polyfluorinated hydrocarbons include CF3(CF2) n -(CH2) m -, where m is at least 1, preferably at least 2, and n=1 to 30, such as fluorotridecane CF3(CF2)9(CH2)3; and CH3(CH2) a (CF2) b (CH2) c -, and a, b, and c are independently 1 to 30.

[0397] Other suitable lipid components include simple fatty acids and fatty acid derivatives, more complex lipids such as glycerides and sterols, e.g., cholesterol. The fatty acids and fatty acid derivatives may be fully saturated or mono- or poly-unsaturated. The carbon chain length may vary from C2 to C30, although optimal telomerase inhibition may be achieved with carbon chains that are C8 to C22. Preferred examples of saturated fatty acids are listed below:

[0398] [Strain name / Usual name / Carbon chain]

[0399] Tetradecanoic acid Myristic acid 14:0

[0400] Hexadecanoic acid Palmitic acid 16:0

[0401] Octadecanoic acid Stearic acid 18:0

[0402] Eicosanoic acid Arachidic acid 20:0

[0403] Mono- and poly-unsaturated forms of fatty acids may also be employed, and compounds with more double bonds may also be employed, although compounds with 1 to 3 double bonds are preferred. Examples of common mono- and poly-unsaturated fatty acids that may be employed include:

[0404] [Strain name / Usual name / Carbon chain]

[0405] Cis-9-Hexadecanoic Acid Palmitoleic Acid 16:1(n-7)

[0406] Cis-6-octadecanoic acid Petroselinic acid 18:1(n-12)

[0407] cis-9-octadecanoic acid Oleic acid 18:1(n-9)

[0408] 9,12-Octadecadienoic acid Linoleic acid 18:2(n-6)

[0409] 6,9,12-Octadecatrienoic acid Gamma-linoleic acid 18:3(n-6)

[0410] 9,12,15-Octadecatrienoic Acid Alpha-Linoleic Acid 18:3(n-3)

[0411] 5,8,11,14-Eicosatetraenoic acid Arachidonic acid 20:4(n-6)

[0412] Branched chain fatty acids may be employed in the compounds of the present invention, as well as fatty acids with one or more triple bonds in the carbon chain. Substituted forms of fatty acids may also be employed in the compounds of the present invention. As with hydrocarbon groups, substituents that are inert in vivo and in vitro are preferred, with fluorine being particularly preferred. An exemplary general structure of polyfluorinated derivatives of fatty acids suitable for use in the present invention is CF3(CF2), where m is at least 1, preferably at least 2, and n=1-30. n -(CH2) m CO- and CH3(CH2) where a, b, and c are independently 1 to 30 a (CF2) b (CH2) c It is CO-.

[0413] In some cases, between 1 and 5 L' moieties (n=1-5) are covalently linked to the O moiety, optionally via a linker. More usually, 1 or 2 L' moieties are utilized (n=1 or 2). When more than one L' moiety is linked to the O moiety, each L' moiety is independently selected.

[0414] It will be appreciated that compounds of the invention described as having a specified hydrocarbon as the L' moiety and compounds described as having a specified fatty acid (having the same number of carbon atoms as the specified hydrocarbon) are closely related and differ structurally only in the nature of the bond linking the L' moiety to the oligonucleotide, resulting from the synthetic procedures used to prepare the compounds. For example, and as described in more detail below, when synthesizing a compound (having a phosphoramidate or thiophosphoramidate internucleoside linkage) having an L' moiety attached to the 3'-amino terminus of an oligonucleotide, use of the aldehyde form of the fatty acid (fatty aldehyde) as the starting material results in the formation of an amine bond between the lipid chain and the oligonucleotide, and therefore the lipid group appears as a hydrocarbon. In contrast, use of a carboxylic acid, acid anhydride, or acid chloride of the same fatty acid results in the formation of an amide bond, and therefore the lipid group appears as a fatty acid derivative, specifically, in this example, a fatty amide. (As noted in the definitions section above, for simplicity, the term "fatty acid" is used broadly herein to include fatty acid derivatives, including fatty amides, when describing an attached L' group.) This is illustrated in the following schemes, which depict the 3'-amino terminus of a phosphoramidate oligonucleotide linked to a C14 lipid moiety: In Scheme A, L' is tetradecanoic acid (myristic acid), where the connection between the L' and O groups is an amide; in Scheme B, L' is tetradecane, where the connection between the L' and O groups is an amine. [ka]

[0415] The bond between the O and L' components may be a direct bond or may be via an optional linker moiety, such as x' in Formula (I) or the optional linker L. The linker group may serve to facilitate chemical synthesis of the compound. Whether or not a linker group is used to mediate the bond between the O and L' components, there are multiple sites on the oligonucleotide component O to which the L' component may be covalently attached. Suitable points of attachment include the 5' and 3' termini, one or more sugar rings, the internucleoside backbone, and the nucleobases of the oligonucleotide. In some cases, the L' moiety is linked to the 3' or 5' terminus of the oligonucleotide.

[0416] If the L' moiety is to be linked to the 3' terminus, the linkage can be directly to the 3' substituent, which in the case of preferred phosphoramidate and thiophosphoramidate oligonucleotides is the 3'-amino group, and in other cases, such as conventional phosphodiester oligonucleotides, it can be the 3'-hydroxy group. Alternatively, the L' moiety can be linked via a 3'-linked phosphate group, with the hexadecane hydrocarbon being linked to the 3' phosphate of the thiophosphoramidate oligonucleotide via an O-alkyl linker. If the L' moiety is to be linked to the 5' terminus, it can be linked via a 5'-linked phosphate group. The linkage to the base in the O moiety can be via any suitable atom, for example, to the N2 amino group of guanosine. When n>1, such that multiple lipid moieties are to be linked to the O moiety, the individually selected L' moieties can be linked at any suitable site. For example, one L' group can be linked to each terminus, various L' groups can be linked to the base, or two or more L' groups can be linked to one terminus.

[0417] An optional linker moiety x' may be used to link the O and L' moieties of the compound. It is understood that an optional linker (e.g., x' or L in formula (I)) may be linked to the polynucleotide (e.g., O) via a terminal phosphate group, e.g., a 3'-linked or 5'-linked phosphate group. If a linker is to be employed, it is incorporated into the synthetic procedures as described herein. Examples of suitable linker groups include those having the general structure: [ka] Examples include aminoglycerol-type and O-alkylglycerol-type linkers, which can be depicted by:

[0418] wherein R'=H, OH, NH2, or SH; Y=O, S, or NR; R=H, alkyl, or substituted alkyl; and n and m are independently integers between 1 and 18.

[0419] A specific example of a suitable linker is an aminoglycerol linker where R' = OH, Y = O and m and n are each 1: [ka]

[0420] A bis-aminoglycerol linker where R' = OH, Y = NH, and m and n are each 1: [ka]

[0421] O-alkylglycerol linker where R=H [ka] is.

[0422] Exemplary lipid-modified oligonucleotides that may be prepared according to the subject methods include those compounds described in Figure 1 (e.g., Figures 1A-1DD) of U.S. Patent Application US20120329858 to Gryaznov et al., "Modified Oligonucleotides for Telomerase Inhibition," the disclosure of which is incorporated herein by reference in its entirety.

[0423] In certain embodiments, the composition has the structure: [ka] where "nps" represents a thiophosphoramidate linkage (e.g., -NH-P(=O)(SH)-O-) connecting the 3'-carbon of one nucleoside to the 5'-carbon of an adjacent nucleoside.

[0424] It is understood that all embodiments referring to compounds also apply to salt forms of said compounds.

[0425] In certain embodiments, the composition has the structure [ka] or a salt thereof, wherein "nps" represents a thiophosphoramidate linkage (e.g., -NH-P(=O)(SH)-O-, or a tautomer thereof, or a salt thereof) connecting the 3'-carbon of one nucleoside to the 5'-carbon of the adjacent nucleoside. In certain embodiments, the composition comprises a pharmaceutically acceptable salt of the compound. In certain examples, the composition comprises a sodium salt of the compound. In certain embodiments, the composition comprises a divalent cation salt of the compound, such as a magnesium salt of the compound. In certain embodiments, the composition comprises a trivalent cation salt of the compound, such as an aluminum salt of the compound.

[0426] In certain embodiments, the composition has the following structure: [ka] wherein M x+ is independently hydrogen or a convenient counterion of a salt, each x is independently 1, 2, or 3, and n is an integer from 5 to 13, e.g., 5, 6, 7, 8, 9, 10, 11, 12, or 13, e.g., n is 13. In certain examples, each x is independently 1. In certain examples, each x is independently 1 or 2. In certain examples, each x is independently 1 or 3. In certain examples, M x+ is hydrogen.

[0427] In certain embodiments, the composition has the following structure: [ka] and optionally a salt with a convenient cationic counterion.

[0428] In certain embodiments, the composition has the structure: [ka] The compounds include those described by:

[0429] Also provided is a compound active pharmaceutical ingredient composition that contains a compound that contains oligonucleotide.As used herein, active pharmaceutical ingredient refers to the composition that is produced by the subject method of preparation, and this composition may optionally be subjected to one or more additional purification steps after synthesis.Generally, active pharmaceutical ingredient is a composition that is suitable for formulation into pharmaceutical composition.In some cases, the compound active pharmaceutical ingredient composition is not purified after synthesis, so the oligonucleotide-containing component of the composition reflects the products that are produced during oligonucleotide synthesis.

[0430] In some embodiments, the compound active pharmaceutical ingredient has less than 9% by weight of (N-1) products, wherein the compound comprises a polynucleotide having a sequence of 10 or more nucleoside subunits that is complementary to an RNA component of human telomerase, and at least two of the nucleoside subunits are linked by an N3'→P5' thiophosphoramidate or oxophosphoramidate intersubunit linkage (e.g., as described herein).

[0431] In some embodiments, the compound active pharmaceutical ingredient has less than 9% by weight of (N-1) products, wherein the compound or a pharmaceutically acceptable salt thereof comprises a polynucleotide having a sequence of 10 or more nucleoside subunits that is complementary to an RNA component of human telomerase, wherein at least two of the nucleoside subunits are linked by an N3'→P5' thiophosphoramidate or oxophosphoramidate intersubunit linkage (e.g., as described herein).

[0432] In some embodiments of the compound active pharmaceutical ingredient, all of the nucleoside subunits that are complementary to the RNA component of human telomerase are linked by N3'→P5' thiophosphoramidate intersubunit linkages.

[0433] In some embodiments of the compound active pharmaceutical ingredient, the N3'→P5' thiophosphoramidate intersubunit linkage has the following structure: 3'-NH-P(S)(OR)-O-5' where R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group. It is understood that when R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group, some of the internucleoside subunit linkages described by the above formula may exist in salt form. Such forms, to the extent they may exist, are intended to be included within the scope of the present disclosure.

[0434] In some embodiments of the compound active pharmaceutical ingredient, the N3'→P5' thiophosphoramidate intersubunit linkage has the following structure: 3'-NH-P(S)(OR)-O-5' where R is hydrogen. For any of the compound active pharmaceutical ingredients described herein that include such an intersubunit bond, it is understood that such compound active pharmaceutical ingredients may also include a convenient pharmaceutically acceptable salt form of the bond. As such, the intersubunit bond may be in a pharmaceutically acceptable salt form, including a convenient counterion of the salt.

[0435] In some embodiments of the compound active pharmaceutical ingredient, the polynucleotide comprises between 10 and 50 contiguous nucleoside subunits that are complementary to the RNA component of human telomerase (e.g., as described herein).

[0436] In some embodiments of the compound active pharmaceutical ingredient, the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4); TAGGGTTAGACAA (SEQ ID NO: 3); and CAGTTAGGGTTAG (SEQ ID NO: 5).

[0437] In some embodiments of the compound active pharmaceutical ingredient, the polynucleotide comprises a 3' amino terminal group or a 3'-hydroxyl terminal group. In certain embodiments of the compound active pharmaceutical ingredient, the polynucleotide comprises a 3' amino terminal group. In certain embodiments of the compound active pharmaceutical ingredient, the polynucleotide comprises a 3'-hydroxyl terminal group.

[0438] In some embodiments of the compound active pharmaceutical ingredient, the compound has the structure: [ka] where "nps" represents a thiophosphoramidate linkage, --NH--P(=O)(SH)--O--, connecting the 3'-carbon of one nucleoside to the 5'-carbon of an adjacent nucleoside.

[0439] It is understood that all embodiments referring to a compound active pharmaceutical ingredient are also applicable to salt forms of said compound active pharmaceutical ingredient.

[0440] In some embodiments of the compound active pharmaceutical ingredient, the compound has the structure: [ka] or a pharmaceutically acceptable salt thereof, where "nps" represents a thiophosphoramidate linkage -NH-P(=O)(SH)-O- (or a tautomer thereof, as described herein, or a pharmaceutically acceptable salt thereof) connecting the 3'-carbon of one nucleoside to the 5'-carbon of the adjacent nucleoside. In certain embodiments of the compound active pharmaceutical ingredient, the composition comprises a sodium salt of the compound. In certain embodiments, the composition comprises a divalent cation salt of the compound, such as, for example, a magnesium salt of the compound. In certain embodiments, the composition comprises a trivalent cation salt of the compound, such as, for example, an aluminum salt of the compound.

[0441] In certain embodiments of the compound active pharmaceutical ingredient, the compound has the following structure: [ka] where each M x+ is independently hydrogen or a convenient counterion of a salt, each x is independently 1, 2, or 3, and n is an integer from 5 to 13, e.g., 5, 6, 7, 8, 9, 10, 11, 12, or 13, e.g., n is 13. In particular examples, each x is 1. In particular examples, each x is independently 1 or 2. In particular examples, each x is independently 1 or 3. In particular examples, M x+ is hydrogen.

[0442] In certain embodiments of the compound active pharmaceutical ingredient, the compound has the following structure: [ka] which may include any convenient cationic counterion of the salt.

[0443] In some embodiments of the compound active pharmaceutical ingredient, the compound has the structure: [ka] It is described by:

[0444] In some embodiments, the compound active pharmaceutical ingredient has less than 9% by weight of (N-1) product, for example, less than 8% by weight, less than 7% by weight, less than 6% by weight, less than 5% by weight, less than 4% by weight, less than 3% by weight, less than 2% by weight, or even less than 1% by weight of (N-1) product. In certain embodiments, the compound active pharmaceutical ingredient has less than 5% by weight of (N-1) product. In certain embodiments, the compound active pharmaceutical ingredient has less than 2% by weight of (N-1) product.

[0445] In some embodiments, the active pharmaceutical ingredient has less than 9% by weight of (Nx) products, e.g., less than 8% by weight, less than 7% by weight, less than 6% by weight, less than 5% by weight, less than 4% by weight, less than 3% by weight, less than 2% by weight, or even less than 1% by weight of (Nx) products.

[0446] In some embodiments, the compound active pharmaceutical ingredient has less than 9% by weight of (Nx) polynucleotide-containing products overall, for example, less than 8% by weight, less than 7% by weight, less than 6% by weight, less than 5% by weight, less than 4% by weight, less than 3% by weight, less than 2% by weight, or even less than 1% by weight of (Nx) polynucleotide-containing products overall.

[0447] In some embodiments, the compound active pharmaceutical ingredient has the following profile: (N-1) product to N product less than 1 part in 4 parts by weight; and At least 10 parts by weight of N product to (N-2) and (N-3) product (Nx) polynucleotide-containing products.

[0448] formulation Also provided are pharmaceutical compositions comprising the oligonucleotide compositions (e.g., as described herein). The oligonucleotide compositions (e.g., as described herein) can also be formulated as pharmaceutical compositions for inhibiting transcription or translation in cells in disease states associated with overexpression of a target gene.

[0449] In some embodiments, the pharmaceutical composition comprises an oligonucleotide composition (e.g., as described herein) formulated in a pharmaceutically acceptable excipient. In certain embodiments, the oligonucleotide composition is a compound active pharmaceutical ingredient having less than 9% by weight of (N-1) products, wherein the compound comprises a polynucleotide having a sequence of 10 or more nucleoside subunits complementary to the RNA component of human telomerase, at least two of the nucleoside subunits being linked by an N3'→P5' thiophosphoramidate intersubunit linkage.

[0450] The present invention provides compounds that can specifically and potently inhibit telomerase activity and thus may be used to inhibit the proliferation of telomerase-positive cells, such as tumor cells. A wide variety of cancer cells have been shown to be telomerase-positive, including cells derived from cancers of the skin, connective tissue, adipose tissue, breast, lung, stomach, pancreas, ovary, cervix, uterus, kidney, bladder, colon, prostate, central nervous system (CNS), retina, and hematological tumors (e.g., myeloma, leukemia, and lymphoma). Cancers of interest include, but are not limited to, myelofibrosis, thrombocythemia, myelodysplastic syndrome, and myeloid leukemia.

[0451] The subject compounds can be used to treat hematological malignancies and myeloproliferative disorders, including, but not limited to, essential thrombocythemia (ET), polycythemia vera (PV), chronic myeloid leukemia (CML), myelofibrosis (MF), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML). The subject compounds can be used to treat myelodysplastic syndromes, including diseases such as refractory anemia, refractory anemia with excess blasts, refractory cytopenia with multilineage dysplasia, and chronic myelomonocytic leukemia (CMML). The subject compounds can be used to treat hematological disorders, such as those described in PCT Patent Application No. PCT / US13 / 070437, filed November 15, 2013, the disclosure of which is incorporated herein by reference in its entirety.

[0452] Thus, the compounds provided herein are broadly useful in treating a wide range of malignancies. More importantly, the compounds of the present invention can be useful in providing treatments that are highly discriminatory between malignant and normal cells, avoiding many of the adverse side effects present in most current chemotherapy regimens that rely on agents that indiscriminately kill dividing cells. Furthermore, the compounds of the present invention are more potent than comparable unconjugated oligonucleotides, meaning they can be administered at lower doses, providing increased safety and significantly reduced treatment costs. Accordingly, one aspect of the present invention is a method of treating cancer in a patient, comprising administering to the patient a therapeutically effective dose of a compound of the present invention. Telomerase inhibitors, including compounds of the present invention, may be employed in conjunction with other cancer treatments, including surgical removal of the primary tumor, chemotherapy, and radiation therapy. Thus, the present invention relates to compounds and compositions provided herein for use as medicaments. The present invention also relates to compounds and compositions provided herein for use in treating or preventing any one of the malignancies mentioned above.

[0453] For therapeutic applications, the compounds of the present invention are formulated in a therapeutically effective amount with a pharmaceutically acceptable carrier. One or more compounds of the present invention (e.g., with different L' or O moieties) may be included in a given formulation. Pharmaceutical carriers can be solid or liquid. Liquid carriers can be used in preparing solutions, emulsions, suspensions, and pressurized compositions. The compound is dissolved or suspended in a pharmaceutically acceptable liquid excipient. Suitable examples of liquid carriers for parenteral administration of oligonucleotide preparations include water (optionally containing additives, such as cellulose derivatives, preferably sodium carboxymethylcellulose solution), phosphate-buffered saline (PBS), alcohols (including monohydric and polyhydric alcohols, e.g., glycols) and their derivatives, and oils (e.g., fractionated coconut oil and peanut oil). Liquid carriers may contain other suitable pharmaceutical additives, including, but not limited to, solubilizers, suspending agents, emulsifiers, buffers, thickeners, colorants, viscosity adjusters, preservatives, stabilizers, and osmolality adjusters.

[0454] For parenteral administration of the compound, the carrier can also be an oily ester such as, for example, ethyl oleate and isopropyl myristate. Sterile carriers are useful in sterile liquid form compositions for parenteral administration.

[0455] Sterile liquid pharmaceutical compositions, solutions or suspensions can be utilized intravenously or topically, for example, by intraperitoneal injection, subcutaneous injection, etc. Oligonucleotides can also be administered intravascularly or via a vascular stent.

[0456] The liquid carrier for pressurized compositions can be halogenated hydrocarbon or other pharmaceutically acceptable propellant.Such pressurized compositions can be encapsulated liquid for delivery via inhalation.For administration by inhalation or insufflation in the nose or bronchial tubes, oligonucleotides can be formulated into aqueous or partially aqueous solution, which can then be utilized in the form of aerosol.

[0457] The compounds may also be administered topically as solutions, creams, or lotions by formulation with a pharmaceutically acceptable vehicle containing the active compound.

[0458] The pharmaceutical compositions of the present invention may be orally administered in acceptable dosages, including, but not limited to, formulation in capsules, tablets, powders, or granules, and as suspensions or solutions in aqueous or non-aqueous media. Pharmaceutical compositions and / or formulations containing the oligonucleotides of the present invention may also contain carriers, lubricants, diluents, thickeners, flavorings, emulsifiers, dispersing aids, or binders. For tablets for oral use, commonly used carriers include lactose and cornstarch. Lubricants such as magnesium stearate may also be added. For oral administration in capsule form, effective diluents include lactose and dried cornstarch. When an aqueous suspension is required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweeteners, flavors, or coloring agents may also be added.

[0459] While the compounds of the present invention have excellent properties for cell and tissue penetration, they can also be formulated to provide even greater benefits, for example, in liposome carriers.The use of liposomes to promote cellular uptake is described, for example, in U.S. Patent Nos. 4,897,355 and 4,394,448.Many publications describe the formulation and preparation of liposomes.The compounds can also be formulated by mixing with additional penetration enhancers, such as the unbound forms of the above-mentioned lipid moieties, including fatty acids and their derivatives. Examples include oleic acid, lauric acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, resinoleate, monoolein (aka 1-monooleoyl-rac-glycerol), dilaurate, caprylic acid, arachidonic acid, 1-glyceryl monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, mono- and diglycerides, and physiologically acceptable salts thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.).

[0460] Complex formulations containing one or more penetration enhancers may also be used. For example, bile salts may be used in combination with fatty acids to form complex formulations. Exemplary combinations include chenodeoxycholic acid (CDCA), typically used at a concentration of 0.5-2%, combined with sodium caprate or sodium laurate, typically used at a concentration of about 0.5-5%.

[0461] Pharmaceutical compositions and / or formulations containing the oligonucleotides of the present invention may also contain chelating agents, surfactants, and non-surfactants. Chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate, and homovanillate), N-acyl derivatives of collagen, laureth-9, and N-aminoacyl derivatives of beta-diketones (enamines). Surfactants include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, and polyoxyethylene-20-cetyl ether; and emulsions of perfluorocompounds such as FC-43. Non-surfactants include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacycloalkanone derivatives, and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin, and phenylbutazone.

[0462] Thus, in another aspect of the present invention, there is provided a method of formulating a pharmaceutical composition, the method comprising providing a compound as described herein and combining the compound with a pharmaceutically acceptable excipient. Preferably, the compound is provided in pharmaceutical purity, as defined below. The method may further comprise adding the compound before or after the addition of the excipient, a penetration enhancer.

[0463] Pharmaceutical compositions may meet pharmaceutical standards of purity. In some cases, for use as active ingredients in pharmaceutical preparations, the compounds of interest are purified from reactive or potentially immunogenic components present in the mixture from which they are prepared.

[0464] The pharmaceutical compositions may be aliquoted and packaged in single or multi-dose units. The dosage requirements for treatment with oligonucleotide compounds will vary depending on the particular composition employed, the route of administration, the severity of the symptoms presented, the form of the compound, and the particular subject being treated.

[0465] The pharmaceutical compositions of the present invention can be administered to a subject in formulations and amounts effective to achieve clinically desired outcomes. For cancer treatment, desirable outcomes include reduction in tumor mass (as determined by palpation or imaging, e.g., by radiography, radionucleotide scanning, CAT scanning, or MRI), reduced rate of tumor growth, reduced rate of metastasis formation (e.g., as determined by histochemical analysis of biopsy specimens), reduced biochemical markers (including general markers such as ESR and tumor-specific markers such as serum PSA), and improved quality of life (as determined by clinical assessment, e.g., Karnofsky score), increased time to progression, increased disease-free survival, and increased overall survival.

[0466] The amount of compound per dose and number of doses required to achieve such an effect will vary depending on the disease indication, characteristics of the patient being treated, and the mode of administration. In some cases, the formulation and route of administration will provide a local concentration of compound at the disease site of between 1 μM and 1 nM.

[0467] Generally, the compound is administered at a concentration that provides effective results without causing harmful or adverse side effects. Such a concentration can be achieved by administering a single unit dose or by administering a dose divided into convenient subunits at suitable intervals throughout the day.

[0468] usefulness For example, as described above, the methods and compositions of the present invention find use in a variety of applications, including, but not limited to, therapeutic, diagnostic, research, and screening applications, as outlined in more detail below.

[0469] The subject compounds are used in a variety of therapeutic applications. In some embodiments, methods for manufacturing oligonucleotides are applied to prepare oligonucleotides that provide therapeutic benefit. The types of diseases that can be treated using the compositions of the invention are limitless. For example, the compositions may be used to treat numerous genetic diseases. In some embodiments, the subject methods and compositions have antisense applications. In some embodiments, the subject methods and compositions have antigene applications. In certain embodiments, the subject methods and compositions have telomerase inhibition applications, such as those described in U.S. Pat. No. 6,835,826 and U.S. Publication No. 20120329858, the disclosures of which are incorporated herein by reference in their entireties. The subject compounds and methods find use in a variety of diagnostic applications, including, but not limited to, clinical diagnostics, e.g., in vitro diagnostics or the development of in vivo tumor imaging agents. Such applications are useful for diagnosing or confirming a disease state or susceptibility thereto. The methods are also useful for monitoring disease progression and / or response to treatment in patients previously diagnosed with the disease. [Example]

[0470] The following examples are presented so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should be accounted for. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is about atmospheric. By "average" is meant the arithmetic mean value. Standard abbreviations may be used, such as bp, base pairs; kb, kilobase; pl, picoliter; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acid; kb, kilobase; bp, base pairs; nt, nucleotide; im, intramuscular; ip, intraperitoneal; sc, subcutaneous, etc.

[0471] General synthetic procedure Numerous general references are available that provide commonly known chemical synthetic schemes and conditions useful for synthesizing the disclosed compounds (e.g., Smith and March, March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th Edition, Wiley-Interscience, 2001; or Vogel, A Textbook of of Practical Organic Chemistry, Including Qualitative Organic Analysis, 4th ed., New York: Longman, 1978).

[0472] Compounds as described herein can be purified by purification protocols known in the art, including, for example, chromatography such as HPLC, preparative thin-layer chromatography, flash column chromatography, and ion-exchange chromatography. Suitable stationary phases, including normal and reverse phase as well as ionic resins, can be used. In certain embodiments, the disclosed compounds are purified via chromatography on silica gel and / or alumina. See, for example, Introduction to Modern Liquid Chromatography, 2nd Edition, eds. L.R. Snyder and J.J. Kirkland, John Wiley and Sons, 1979; and Thin Layer Chromatography, ed. E. Stahl, Springer-Verlag, New York, 1969.

[0473] During any of the processes for preparation of the compounds of interest, it may be necessary and / or desirable to protect sensitive or reactive groups on any of the molecules concerned. This is described, for example, in J.F.W.M. Comie, "Protective Groups in Organic Chemistry", Plenum Press, London and New York, 1973, in T.W. Greene and P.G.M. Buts, "Protective Groups in Organic Chemistry", Synthesis”, 3rd Edition, Wiley, New York, 1999, in “The Peptides”, Vol. 3 (editors: E. Gross and J. Meienhofer), Academic Press, London and New York, 1981, in “Methoden der organischen Chemie”, Houben-Weyl, 4th Edition, Vol. 15 / 1, Georg Thieme Verlag, Stuttgart, 1974, in H. D. Jakubke and H. Jescheit, “Aminosaurens, Peptides, Proteines”, Verlag Chemie, Weinheim, Deerfield Beach, and Basel, 1982, and / or in Jochen Lehmann, “Chemie der Kohlenhydrate: Monosaccharide and Derivate”, Georg Thieme Verlag, Stuttgart, 1974. The protecting groups may be removed at a convenient subsequent stage using methods known in the art.

[0474] The compounds of interest can be synthesized via a variety of different synthetic routes using commercially available starting materials and / or starting materials prepared by conventional synthetic methods. Various examples of synthetic routes that can be used to synthesize the compounds disclosed herein are set forth in the following schemes.

[0475] Example 1 Synthesis of Imetelstat Sodium Using Dimeric Phosphoramidites

[0476] A solid support (controlled pore glass or polymeric solid support) and the following sequence: A in 5'R-TAGGGTTAGACAA-NH2-3' (SEQ ID NO: 3) (R = lipid linker group) Bz or A dmf , C, G iBu Imetelstat sodium is synthesized using a monomeric phosphoramidite such as methyl and T amidite.

[0477] [Table 2-1] [Table 2-2] [Table 2-3]

[0478] Because the backbone of Imetelstat is NPS, similar to the starting phosphoramidite, the coupling efficiency is approximately 92%. The use of dimeric phosphoramidites allows for fewer coupling steps, which can result in higher yields and higher purity at intermediate stages in the synthesis. The following dimeric phosphoramidites: TA, AA, GA, GG, and GT were prepared as shown below using the method described in Synthesis Scheme 1.

[0479] The synthesis of dimeric phosphoramidites required three monomeric amidites (4a–4c in Scheme 1) and three 5'-TBDMS-3' aminonucleoside intermediates (3a–3c in Scheme 1) for A, G, and T nucleosides. TBDMS is tert-butyldimethylsilyl. The intermediates (3a–3c in Scheme 1) were prepared from two starting materials: 5'-OH-3'-NH-Tr-2'-deoxy-N-benzoyladenosine (1a), 5'-OH-3'-NH-Tr-2'-deoxy-N-isobutyrylguanosine (1b), and 5'-OH-3'-aminothymidine (2). Tr or Trt refers to trityl.

[0480] The 5'-hydroxyl group of 1a and 1b was protected with a TBDMS group using t-butyldimethylsilyl chloride and imidazole in DMF (N,N-dimethylformamide), and then the trityl group at the 3'-amino position was deprotected by treatment with aqueous acetic acid. The resulting intermediates 3a-3c were coupled to the corresponding amidates 4a-4c in dimethylformamide using benzylmercaptotetrazole (BMT) as an activating agent, followed by subsequent sulfurization (PIII-PV) using xanthan gum and pyridine (Scheme 1). Generally, the sulfurization reaction was easily completed. The results of the coupling reaction varied depending on the moisture content, reaction time, and the identity of the amidate. Since long reaction times lead to more by-products, such as P(V) oxidation products, anhydrous conditions using nitrogen or argon gas and rapid coupling reactions are preferred. The dimeric P(III) intermediates have different stabilities. The TA intermediate was stable enough to monitor the completion of the reaction by TLC and HPLC. The other P(III) intermediates were not stable enough to monitor the coupling reaction, and the completion of the reaction was checked after sulfurization was complete (Scheme 1). The P(V) species is more stable for the dimers AA, GA, GG, and GT. For the TA dimer (5e), ​​1.3 equivalents of amidate (4c) were used in the coupling, while the other four dimers (5a–5d) required approximately 3 equivalents of amidates (4a and 4b) (Scheme 1). Amidate monomers 4a–4c were prepared by adapting the method described in U.S. Pat. No. 5,859,233.

[0481] Scheme 1. Synthesis scheme of dimeric amidates (P-reagent is cyanoethoxy-bis(N,N-diisopropylamino)phosphine) [ka]

[0482] The TBDMS protecting group on the 5'-hydroxyl group was deprotected using HF pyridine in acetonitrile, followed by final phosphitylation with a phosphitylation reagent in the presence of BMT and N-methylimidazole (NMI) to generate dimeric thiophosphoramidates 7a–7e (Scheme 1). The final product (7) and three intermediates (3, 5, and 6) were purified by column chromatography. The overall yield of the reaction according to the reaction steps and the amount of final amidate obtained are listed in Table 3. A summary of the analytical results for the five dimeric amidates is shown in Table 4.

[0483] [Table 3]

[0484] [Table 4]

[0485] Synthetic Procedure for Dimeric Thiophosphoramidates

[0486] (1) Preparation of 5'-TBDMS-3' aminonucleosides (for adenosine and guanosine)

[0487] (a) 5'-OH-3'-NH-Tr-2'-deoxynucleoside (1.0 equivalent) and imidazole (5.0 equivalents) are dissolved in DMF and heated to 60°C.

[0488] (b) To the heated solution, TBDMSCl (1.2 eq) is added, followed by stirring at 60° C. for 1 hour.

[0489] (c) Saturated aqueous NaHCO3 solution is added to the reaction mixture, which is then extracted with ethyl acetate.

[0490] (d) Wash the organic layer with saturated aqueous NaHCO3 and brine.

[0491] (e) Anhydrous Na2SO4 is added to the separated organic layer to dry it, and then filtered.

[0492] (f) Concentrating the filtrate.

[0493] (g) To the concentrated reaction mixture is added 80% aqueous acetic acid, followed by stirring at room temperature for 1 hour.

[0494] (h) Remove the product solid by filtration, add saturated aqueous NaHCO3 to the filtrate, and then extract four times with ethyl acetate.

[0495] (i) Dry the organic layer over anhydrous Na2SO4 and then remove the solids by filtration.

[0496] (j) The filtrate was concentrated and purified by column chromatography (eluent, ethyl acetate:methanol=9:1→5:1).

[0497] (k) 5'-TBDMS-3'amino-2'-deoxynucleoside is obtained as a white solid.

[0498] (2) Preparation of 5'-TBDMS-3' aminonucleoside (for thymidine)

[0499] (a) 5'-OH-3'-amino-2'-deoxynucleoside (1.0 equivalent) and imidazole (5.0 equivalents) are dissolved in DMF and heated to 60°C.

[0500] (b) To the heated solution, TBDMSCl (1.2 eq) is added, followed by stirring at 60° C. for 1 hour.

[0501] (c) Saturated aqueous NaHCO3 solution is added to the reaction mixture, which is then extracted four times with ethyl acetate.

[0502] (d) Add anhydrous Na2SO4 to the separated organic layer to dry it and filter.

[0503] (e) Concentrating the filtrate.

[0504] (f) The concentrated crude mixture is purified by column chromatography (eluent, ethyl acetate:methanol=15:1→5:1).

[0505] (g) 5'-TBDMS-3'-aminothymidine is obtained as a white solid.

[0506] (3) Preparation of 5'-TBDMS-3'-NH-Tr dimer

[0507] (a) To remove moisture, 5'-TBDMS-3' aminonucleoside (1.0 equivalent) and BMT (benzylmercaptotetrazole, 1.0 to 5.0 equivalents) were azeotroped three times with acetonitrile, and then dissolved in DMF at room temperature under a N2 atmosphere.

[0508] (b) The monomeric amidate (3.0 equivalents) in DMF (using the minimum amount necessary to dissolve the monomeric amidate) is added dropwise to the reaction mixture, which is then stirred at room temperature under a nitrogen atmosphere for 1 hour. The monomeric amidate is prepared according to the method described in U.S. Patent No. 5,859,233.

[0509] (c) Xanthan gum (2.0 equivalents) and pyridine (4.0 equivalents) are added to the reaction solution, which is then stirred at room temperature under a nitrogen atmosphere for 1 hour.

[0510] (d) Saturated aqueous NaHCO3 solution is added to the reaction mixture, which is then extracted with ethyl acetate.

[0511] (e) Extract the aqueous layer with ethyl acetate.

[0512] (f) The separated organic layers are combined and then washed with saturated aqueous NaHCO3 and brine solutions.

[0513] (g) Anhydrous Na2SO4 is added to the separated organic layer to dry it, filtered, and then the filtrate is concentrated.

[0514] (h) The concentrated crude mixture is purified by column chromatography (eluent, ethyl acetate:methanol=1.5:1→EA only).

[0515] (i) 5'-TBDMS-3'-NH-Tr dimer is obtained as a pale yellow solid.

[0516] (4) Preparation of 5'-OH-3'-NH-Tr dimer

[0517] (a) Under a nitrogen atmosphere, 5'-TBDMS-3'-NH-Tr dimer (1.0 equivalent) was dissolved in ACN (20 mL), and then HF-pyridine solution was added with stirring at room temperature for 1.5 hours.

[0518] (b) Saturated aqueous NaHCO3 solution is added to the reaction mixture, which is then extracted with ethyl acetate.

[0519] (c) The separated organic layer is washed with saturated aqueous NaHCO3 and brine solutions.

[0520] (d) Anhydrous Na2SO4 is added to the separated organic layer for drying and filtration, and then the filtrate is concentrated.

[0521] (e) The concentrated crude mixture is purified by column chromatography (eluent, ethyl acetate, methanol, methylene chloride cosolvent).

[0522] (f) The 5'-OH-3'-NH-Tr dimer is obtained as a white solid.

[0523] (5) Preparation of dimeric phosphorothioamidates (dimeric amidates)

[0524] (A) 5'-hydroxy-3'-NH-Tr dimer was azeotroped three times with acetonitrile to remove water, and then dissolved in ACN at room temperature under a nitrogen atmosphere.

[0525] (b) BMT (1.3 equivalents), NMI (N-methylimidazole, 0.3 equivalents), and a phosphitylation reagent (2.0 equivalents) are added to the reaction solution, and the mixture is stirred at room temperature for 1 hour.

[0526] (c) Saturated aqueous NaHCO3 solution is added to the reaction mixture, which is then extracted with ethyl acetate.

[0527] (d) Wash the separated organic layer with brine solution.

[0528] (e) Anhydrous Na2SO4 is added to the organic layer for drying and filtration, and then the filtrate is concentrated.

[0529] (f) The concentrated reaction mixture is dissolved in methylene chloride (10 mL) and then hexane is added to precipitate a solid.

[0530] (g) The upper solution layer is decanted to remove excess phosphitylation reagent (the decanting step is repeated five times).

[0531] (h) Purify the remaining solid by column chromatography (eluent, ethyl acetate, acetone, methylene chloride cosolvent).

[0532] (i) The dimer is obtained as a white solid.

[0533] Synthesis of imetelstat using dimeric amidates

[0534] Five dimeric amidates were used instead of the monomeric amidates as building blocks for the synthesis of imetelstat, and the results were compared to those obtained with the monomeric amidates. For coupling of C nucleosides to imetelstat, the monomeric building blocks shown in the following sequences were used. The synthesis was carried out on an Akta Oligopilot 100 at a 140 micromolar scale.

[0535] 5'R-[TA][GG][GT][TA][GA]C[AA]-NH23' (SEQ ID NO: 3)

[0536] Imetelstat was prepared using dimeric amidates as building blocks. Using the reagents and synthesis parameters listed in Tables 5A and 5B, five dimeric amidates (AA, TA, GG, GA, and GT) and one monomeric amidate (C) as shown above were coupled at low loading CPG (PALM0051, 64.6 μmol / g) to generate the imetelstat sequence. The coupling time was 500 s, and 10 equivalents of amidate were used. After solid-phase synthesis, the support was treated with an ethanolic ammonium solution (NH4OH:EtOH = 3:1 (v / v)) at 65 °C for 15 h. The crude product was isolated by evaporation of the solvent and analyzed by UV spectroscopy and HPLC.

[0537] Table 5. Exemplary synthesis parameters (A) and reagent composition (B) for oligonucleotide synthesis. ACN is acetonitrile. DCA is dichloroacetic acid. PADS is phenylacetyl disulfide. ETT is 5-ethylthio-1H-tetrazole. [Table 5]

[0538] Synthetic runs were performed on a 140 micromolar scale using the monomer block and dimer block methods on an Akta Oligopilot 100. The synthetic conditions for the synthetic runs were similar to those listed in Tables 5A-B.

[0539] [Table 6]

[0540] Analysis of the oligonucleotides by HPLC-MS showed that the purity of the FLP (full-length product) improved when five dimer blocks were used in the synthesis, with 72% purity obtained by HPLC, as summarized in Tables 7 and 8. Crude oligos prepared using monomer blocks exhibited only 45% FLP purity. Furthermore, the total OD (optical density) increased more than two-fold, from 5,299 to 11,623, resulting in a crude yield of 3.34 g / mmol. The (N-1) product level and PO content decreased from 11.2% to 2.4% and from 20% to 5%, respectively.

[0541] Advantages of using dimer blocks include shorter preparation times and reduced amounts of solvent used during solid phase synthesis.

[0542] [Table 7]

[0543] The synthesis of five dimeric amidates was successfully completed in 9% to 19% yields, yielding 1.7 g to 3.4 g, from 5'-hydroxy-3'-aminonucleosides or 5'-hydroxy-3'-tritylaminonucleosides. Optimization of reaction conditions for each step was not extensively explored. The synthesis of the dimeric blocks of imetelstat was carried out on a 140 micromolar scale, and the results were compared with data obtained from the synthesis using the monomeric amidates. The dimeric block strategy for the preparation of imetelstat was shown to offer substantial improvements, as purity and yield were substantially improved at the 140 micromolar scale (HPLC purity: 74.0% dimer (Figure 8), 44.4% monomer (Figure 7); crude yield by TOD (total optical density): 468 mg dimer, 213 mg monomer). Additionally, the synthesis using the dimers involved fewer coupling steps, resulting in less n-po bond formation.

[0544] Coupling efficiencies for the dimer (140 micromolar scale synthesis) indicate that the dimer synthesis had a coupling efficiency of 96% compared to 94% for the monomer synthesis. Because there were only seven couplings for the dimer, the FLP for the dimer was 71.6%, close to the theoretically calculated 72% for the full-length product, while the monomer with 13 couplings reported an FLP of 45.6% compared to the theoretically predicted 44%.

[0545] [Table 8]

[0546] The synthesis of imetelstat utilizing fewer coupling steps provides both substantially higher purity and yield of the full-length product. Elimination of impurities provides easier purification of imetelstat, reducing the amount of minor products that migrate closely to the major peak on HPLC, resulting in compositions having imetelstat of higher purity. This improvement is desirable for lower cost of goods for the production of imetelstat sodium; for example, cost of goods can be reduced by 30-40% when implemented on a manufacturing scale.

[0547] Scheme 2. Synthesis scheme of GA dimer amidate [ka]

[0548] 85 g of TBAG was prepared from 300 g of APG2 according to the methods described herein via the steps shown in Scheme 2.

[0549] Scheme 3. Synthesis scheme of AA dimer amidates [ka]

[0550] According to the method described herein through the steps shown in Scheme 3, 430 g of TBAPA1 was obtained from 800 g of crude APA1 (purity: 46%).

[0551] Scheme 4. Synthesis of TA dimer amidates [ka]

[0552] TA dimer amidate (5) was prepared according to the method described herein via the steps shown in Scheme 4 on a synthesis scale of 100 mg to 1 g.

[0553] Scheme 5. Synthesis of dimeric amidates during coupling and sulfurization [ka]

[0554] [Table 9]

[0555] Various nucleoside monomers were prepared according to the methods described herein used in the preparation of dimeric compounds.

[0556] Scheme 6. Synthesis of levulinic acid protected monomers [ka]

[0557] Scheme 7. Synthesis of bis-DMF Amidite [ka]

[0558] Scheme 8. Synthesis scheme of MMT, DMT, and pixyl monomers (A amidites) [ka] [Table 10]

[0559] While the present invention has been described with reference to specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made, and equivalents may be substituted, without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, method, method step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.

[0560] Embodiment The present disclosure provides a composition having an (N-1) product to 4 parts by weight of less than 1 part compound or salt thereof, wherein the compound comprises a polynucleotide having a sequence of 10 or more nucleoside subunits, at least two of the nucleoside subunits being linked by an N3'→P5' phosphoramidate intersubunit linkage. In some embodiments of the composition, the N3'→P5' phosphoramidate intersubunit linkage is an N3'→P5' thiophosphoramidate intersubunit linkage having the structure 3'-NH-P(S)(OR)-O-5', where R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group, or a salt thereof.

[0561] In some composition embodiments, the compound comprises a polynucleotide having a sequence of 10 or more nucleoside subunits that is complementary to the RNA component of human telomerase. In some composition embodiments, the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits that is complementary to the RNA component of human telomerase. In some composition embodiments, the polynucleotide comprises between 3 and 50 adjacent nucleoside subunits that are complementary to the RNA component of human telomerase. In some composition embodiments, all nucleoside subunits that are complementary to the RNA component of human telomerase are linked by N3'→P5' phosphoramidate intersubunit linkages. In some composition embodiments, the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4), TAGGGTTAGACAA (SEQ ID NO: 3), and CAGTTAGGGTTAG (SEQ ID NO: 5). In some composition embodiments, the polynucleotide comprises a 3' amino or 3'-hydroxyl terminal group.

[0562] In some embodiments of the composition, the compound has the structure: [ka] or a salt thereof, wherein "nps" represents a thiophosphoramidate linkage -NH-P(=O)(SH)-O- connecting the 3' carbon of one nucleoside to the 5' carbon of an adjacent nucleoside. In some embodiments of the composition, the salt is a pharmaceutically acceptable salt.

[0563] In some embodiments of the composition, the compound has the structure: [ka] wherein M x+ are independently hydrogen or a salt counterion, each x is independently 1, 2, or 3, and n is an integer from 5 to 13. In particular examples, M x+ is hydrogen.

[0564] In some embodiments of the composition, the compound has the structure: [ka] It has.

[0565] In some embodiments, the composition has an (N-1) product for less than 1 part compound in 6 parts by weight. In some embodiments, the composition has an (N-1) product for less than 1 part compound in 10 parts by weight. In some embodiments, the composition has an (N-1) product for less than 1 part compound in 20 parts by weight. In some embodiments, the composition has an (Nx) product for less than 1 part compound in 4 parts by weight. In some embodiments, the composition has an (Nx) polynucleotide-containing product for less than 40 parts compound in 100 total parts by weight. In some embodiments, the composition has the following profile of (Nx) polynucleotide-containing product: (N-1) product for less than 1 part compound in 4 parts by weight; (N-2) and (N-3) products for at least 10 parts compound in 100 parts by weight.

[0566] The present disclosure provides a compound active pharmaceutical ingredient having less than 11% by weight of (N-1) products, wherein the compound, or a pharmaceutically acceptable salt thereof, comprises a polynucleotide having a sequence of 10 or more nucleoside subunits that are complementary to an RNA component of human telomerase, wherein at least two of the nucleoside subunits are linked by an N3'→P5' phosphoramidate intersubunit linkage.

[0567] In some embodiments of the compound active pharmaceutical ingredient, all of the nucleoside subunits complementary to the RNA component of human telomerase are linked by N3'→P5' thiophosphoramidate intersubunit linkages. In some embodiments of the compound active pharmaceutical ingredient, the N3'→P5' phosphoramidate intersubunit linkage is an N3'→P5' thiophosphoramidate intersubunit linkage having the structure 3'-NH-P(S)(OR)-O-5', where R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group, or a pharmaceutically acceptable salt thereof.

[0568] In some embodiments of the compound active pharmaceutical ingredient, the polynucleotide comprises between 10 and 50 contiguous nucleoside subunits that are complementary to the RNA component of human telomerase. In some embodiments of the compound active pharmaceutical ingredient, the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGGTTAG (SEQ ID NO: 4); TAGGGTTAGACAA (SEQ ID NO: 3); and CAGTTAGGGTTAG (SEQ ID NO: 5). In some embodiments of the compound active pharmaceutical ingredient, the polynucleotide comprises a 3' amino or 3' hydroxyl terminal group.

[0569] In some embodiments of the compound active pharmaceutical ingredient, the compound has the structure: [ka] or a pharmaceutically acceptable salt thereof, wherein "nps" represents a thiophosphoramidate linkage --NH--P(.dbd.O)(SH)--O-- connecting the 3' carbon of one nucleoside to the 5' carbon of an adjacent nucleoside.

[0570] In some embodiments of the compound active pharmaceutical ingredient, the compound has the structure: [ka] wherein M x+are independently hydrogen or a pharmaceutically acceptable salt counterion, each x is independently 1, 2, or 3, and n is an integer from 5 to 13. In particular examples, M x+ is hydrogen.

[0571] In some embodiments of the compound active pharmaceutical ingredient, the compound has the structure: [ka] It has.

[0572] In some embodiments, the compound active pharmaceutical ingredient has less than 9% by weight of the (N-1) product. In some embodiments, the compound active pharmaceutical ingredient has less than 5% by weight of the (N-1) product. In some embodiments, the compound active pharmaceutical ingredient has less than 11% by weight of the (Nx) product. In some embodiments, the compound active pharmaceutical ingredient has less than 45% by weight of the (Nx) polynucleotide-containing products overall. In some embodiments, the compound active pharmaceutical ingredient has the following profile: less than 5% by weight of the (N-1) product and at least 10% by weight of the (N-2) and (N-3) products (Nx) polynucleotide-containing products.

[0573] Also provided are pharmaceutical compositions comprising a composition (e.g., of any one of the embodiments described herein) formulated in a pharmaceutically acceptable excipient. Also provided are pharmaceutical compositions comprising a compound active pharmaceutical ingredient (e.g., of any one of the embodiments described herein) formulated in a pharmaceutically acceptable excipient.

[0574] The present disclosure provides methods for synthesizing polynucleotides. In some embodiments, the methods include: (a) deprotecting a protected 3' amino group of a terminal nucleoside linked to a solid support, wherein said deprotection forms a free 3' amino group; (b) contacting the free 3' amino group with a 3'-protected amino-dinucleotide phosphoramidate-5'-phosphoramidite dimer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidite linkage; and (c) oxidizing the linkage.

[0575] In some embodiments, the method further includes (a) deprotecting the protected 3' amino group of the terminal nucleoside linked to the solid support, said deprotection forming a free 3' amino group; (b) contacting the free 3' amino group with a 3'-protected aminodinucleotide-5'-phosphoramidite monomer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidite linkage; and (c) oxidizing the linkage. In some embodiments of the method, oxidizing the linkage includes sulfurization to generate a thiophosphoramidate linkage. In some embodiments of the method, oxidizing the linkage generates an oxophosphoramidate linkage.

[0576] In some embodiments of the method, the 3′-protected amino-dinucleotide phosphoramidate-5′-phosphoramidite dimer has the formula: [ka] wherein X is O or S, and B 1 and B 2 and each independently is a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof. 1 and B 2 are each independently selected from a protected adenine, a protected cytosine, a protected guanine, a thymine, and a uracil. 1 and B 2are each independently selected from A(Bz), A(DMF), C(Bz), G(isobutyryl), T, and U. In some embodiments of the method, X is S.

[0577] In some embodiments of the method, the polynucleotide has the formula: [ka] or a salt thereof, wherein each B is independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; each X is independently oxygen or sulfur; and each R 3 is hydrogen, fluoro or hydroxyl, substituted alkoxy, or protected hydroxyl; L is an optional linker; Z is H, lipid, support, carrier, oligonucleotide, PEG, polypeptide, detectable label or tag; R 6 is amino, hydroxyl, protected amino, protected hydroxy, -OLZ, or -NH-LZ; R is hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a phosphate protecting group; and n is an integer between 1 and 1000; the method comprises the steps of (a) deprotecting a protected 3' amino group of a terminal nucleoside linked to a solid support, said deprotection forming a free 3' amino group; and (b) converting the free 3' amino group into (i) a 3'-protected amino-dinucleotide phosphoramidate-5'-phosphoramidite dimer, or (ii) reacting the aminonucleotide with any of the 3'-protected aminonucleotide-5'-phosphoramidite monomers to form an internucleoside N3'→P5' phosphoramidite linkage; (c) oxidizing the linkage; and (d) repeating steps (a) to (c) until a polynucleotide is synthesized, wherein repeating steps (a) to (c) comprises performing step (b)(i) at least once.

[0578] In some embodiments of the method, oxidizing the bond comprises sulfurization, resulting in a thiophosphoramidate bond. In some embodiments of the method, oxidizing the bond results in an oxophosphoramidate bond. In some embodiments of the method, the polynucleotide comprises a sequence of nucleoside subunits complementary to the RNA component of human telomerase, wherein at least two of the nucleoside subunits are linked by an N3'→P5' phosphoramidate intersubunit linkage. In some embodiments of the method, the N3'→P5' phosphoramidate intersubunit linkage is an N3'→P5' thiophosphoramidate intersubunit linkage having the structure 3'-NH-P(S)(OR)-O-5', where R is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and a phosphate protecting group or a salt thereof.

[0579] In some embodiments of the method, the polynucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments of the method, all of the internucleotide intersubunit linkages of the TAGGGTTAGACAA sequence are N3'→P5' phosphoramidate intersubunit linkages. In some embodiments of the method, the polynucleotide has the structure: [ka] or a salt thereof; where "nps" represents a thiophosphoramidate linkage --NH--P(.dbd.O)(SH)--O-- connecting the 3' carbon of one nucleoside to the 5' carbon of an adjacent nucleoside.

[0580] In some embodiments of the method, the polynucleotide has the structure: [ka] wherein M x+ are independently hydrogen or a pharmaceutically acceptable salt counterion, each x is independently 1, 2, or 3, and n is an integer from 5 to 13. In particular examples, M x+ is hydrogen.

[0581] In some embodiments of the method, the polynucleotide has the structure: [ka] It has.

[0582] In some embodiments of the method, the C11 nucleotide of the TAGGGTTAGACAA sequence is derived from a 3'-protected aminonucleoside-5'-phosphoramidite monomer. In some embodiments, the method includes sequentially coupling the following 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimers TA, GG, GT, TA, GA, and AA and a 3'-protected aminonucleoside-5'-phosphoramidite monomer C to a solid support. In some embodiments of the method, the 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimer is of formula X 1 X 2 wherein X 1 and X 2 are independently selected from protected adenine, protected cytosine, protected guanine, thymine, and uracil. In some embodiments of the method, the 3'-protected aminonucleoside-5'-phosphoramidite dimer is selected from protected adenine, protected cytosine, protected guanine, thymine, and uracil.

[0583] The present disclosure provides a compound of formula (II): [ka] or a salt thereof, wherein B 1 and B 2 are each independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; R 11 is hydrogen, a protecting group, or a phosphoramidite group; R 12 and R 13are each independently hydrogen or a protecting group.

[0584] In some embodiments of the compound, B 1 and B 2 are each independently selected from protected adenine, protected cytosine, protected guanine, thymine, and uracil. 1 and B 2 are each independently selected from A(Bz), A(DMF), C(Bz), G(isobutyryl), T, and U. In some embodiments of the compound, R 11 is a 5'-phosphoramidite; R 12 is a protecting group; R 13 is a protecting group. In some embodiments of the compound, B 1 is A(Bz) or A(DMF), and B 2 is A(Bz) or A(DMF). In some embodiments of the compound, B 1 is A(Bz) or A(DMF), and B 2 is C(Bz). In some embodiments of the compound, B 1 is A(Bz) or A(DMF), and B 2 is G (isobutyryl). In some embodiments of the compound, B 1 is A(Bz) or A(DMF), and B 2 is T. In some embodiments of the compound, B 1 is A(Bz) or A(DMF), and B 2 is U. In some embodiments of the compound, B 1 is C(Bz) and B 2 is A(Bz) or A(DMF). In some embodiments of the compound, B 1 is C(Bz) and B 2 is C(Bz). In some embodiments of the compound, B 1 is C(Bz) and B 2 is G (isobutyryl). In some embodiments of the compound, B 1 is C(Bz) and B 2 is T. In some embodiments of the compound, B1 is C(Bz) and B 2 is U. In some embodiments of the compound, B 1 is G (isobutyryl) and B 2 is A(Bz) or A(DMF). In some embodiments of the compound, B 1 is G (isobutyryl) and B 2 is C(Bz). In some embodiments of the compound, B 1 is G (isobutyryl) and B 2 is G (isobutyryl). In some embodiments of the compound, B 1 is G (isobutyryl) and B 2 is T. In some embodiments of the compound, B 1 is G (isobutyryl) and B 2 is U. In some embodiments of the compound, B 1 is T or U, and B 2 is A(Bz) or A(DMF). In some embodiments of the compound, B 1 is T or U, and B 2 is C(Bz). In some embodiments of the compound, B 1 is T or U, and B 2 is G (isobutyryl). In some embodiments of the compound, B 1 is T or U, and B 2 is T. In some embodiments of the compound, B 1 is T or U, and B 2 is U.

[0585] All possible combinations of the above-described embodiments are considered to fall within the scope of the present invention.

Claims

1. a polynucleotide compound having a sequence of N nucleoside subunits or a salt thereof; 3'-protected amino-dinucleotide phosphoramidate-5'-phosphoramidite dimer and wherein at least two of said nucleoside subunits are linked by an N3'→P5' oxophosphoramidate or N3'→P5' thiophosphoramidate intersubunit linkage, said synthetic composition having less than 1 part (N-1) product per 10 parts by weight of said polynucleotide compound or salt thereof, and N is 10 or greater.

2. The at least two of the nucleoside subunits have the structure: 3'-NH-P(S)(OR)-O-5' 2. The composition of claim 1, wherein the N3'→P5' thiophosphoramidate intersubunit linkages have the formula:

3. The composition of any one of claims 1 to 2, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits that is complementary to the RNA component of human telomerase.

4. 4. The composition of claim 3, wherein the polynucleotide comprises between 3 and 50 contiguous nucleoside subunits that are complementary to the RNA component of human telomerase.

5. 5. The composition of any one of claims 1 to 4, wherein all of the nucleoside subunits are linked by N3'→P5' oxophosphoramidate or N3'→P5' thiophosphoramidate intersubunit linkages.

6. The composition of any one of claims 1 to 5, wherein the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4), TAGGGTTAGACAA (SEQ ID NO: 3) and CAGTTAGGGTTAG (SEQ ID NO: 5).

7. The composition of any one of claims 1 to 6, wherein the polynucleotide comprises a 3' amino terminal group or a 3'-hydroxyl terminal group.

8. The compound has the structure: 【Chemistry 51】 or a salt thereof, wherein "nps" represents a thiophosphoramidate linkage -NH-P(=O)(SH)-O- connecting the 3' carbon of one nucleoside to the 5' carbon of an adjacent nucleoside.

9. The composition of claim 8, wherein the salt is a pharmaceutically acceptable salt.

10. The compound has the structure: 【Chemistry 52】 wherein each M x+ are independently hydrogen or a salt counterion; each x is independently 1, 2, or 3; and n is an integer from 5 to 13.

11. The compound has the structure: 【Chemistry 53】 The composition of claim 6 having the formula:

12. The composition of any one of claims 1 to 11 having less than 1 part (N-1) product per 15 parts by weight of said compound.

13. The composition of claim 12 having less than 1 part (N-1) product per 20 parts by weight of said compound.

14. The composition of claim 12 having less than 1 part (N-1) product per 25 parts by weight of said compound.

15. The composition of any one of claims 1 to 14, having less than 1 part of any one (N-x) product per 10 parts by weight of said compound, where x in (N-x) is 1 to (N-1).

16. 16. The composition of claim 15, having a total of less than 40 parts per 100 parts by weight of all (N-x) polynucleotide-containing products relative to the compound, where x in (N-x) is 1 to (N-1).

17. The following profiles: less than 1 part of (N-1) product per 10 parts by weight of said compound; At least 10 parts per 100 parts by weight of the compound (N-2) and (N-3) products:

17. The composition of any one of claims 1 to 16, having (Nx) polynucleotide-containing products, wherein x in (Nx) is 1 to (N-1).

18. A pharmaceutical composition comprising the composition according to any one of claims 1 to 17 formulated in a pharmaceutically acceptable excipient.

Citation Information

Patent Citations

  • Oligonucleotide n3'-&gt;p5' thiophosphoramidate, and synthesis and use thereof

    JP2009046483A