Formulations and methods for preventing and treating tumor metastasis and tumorigenesis - Patent Application 20070122999
The compound of formula (I) effectively targets perinuclear compartments in metastatic tumors, reducing metastasis and providing personalized treatment insights through FoxA1 and FoxO6 expression detection, addressing the limitations of current metastatic cancer therapies.
Patent Information
- Application Number
- JP2024003447
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-05-15
- Filing Date
- 2024-01-12
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2039-05-15
AI Technical Summary
Current therapeutic tools for metastatic cancer are limited, and there is a need for effective formulations and methods to treat metastatic disease, particularly in pancreatic adenocarcinoma, while addressing the underlying mechanisms of metastasis.
A compound of formula (I), potentially a PNC inhibitor, is administered to inhibit perinuclear compartments (PNCs) associated with malignant tumors, and a method for detecting altered expression levels of FoxA1 and FoxO6 to determine responsiveness to the compound is employed.
Metalrestin, a compound of formula (I), selectively inhibits metastasis with high intratumoral exposure and minimal toxicity, reducing PNCs and metastatic burden, and provides insight into patient responsiveness through FoxA1 and FoxO6 expression levels.
Smart Images

Figure 0007736825000045 
Figure 0007736825000046 
Figure 0007736825000047
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62 / 671,964, filed May 15, 2018, which is incorporated herein by reference in its entirety.
[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under Project No. 1ZIABC011267-08 from the National Cancer Institute of the National Institutes of Health. The government has certain rights in this invention.
[0003] Incorporation by reference to electronically submitted materials
[0001] This specification describes a computer readable nucleotide / amino acid sequence listing, which is incorporated by reference in its entirety and which was submitted concurrently and identified as follows: one 12,619 byte ASCII (text) file entitled "743502_ST25.txt" dated May 13, 2019. [Background technology]
[0004] Background technology Metastasis is the cellular mechanism used by disease to spread from one organ to another, non-adjacent part of the body. This process may be involved in the development of solid tumors and may be responsible for the majority of disease-related deaths. Treatment of neoplastic lesions can be associated with a better prognosis if initiated at the premetastatic stage. Over the past decade, progress has been made in understanding the fundamental mechanisms involved in metastasis, but therapeutic tools that specifically influence the metastatic process remain very limited. Therefore, new formulations and methods are needed to treat subjects with metastatic disease.
[0005] Summary of the Invention In one embodiment of the present invention, a compound of formula (I):
[0006] [ka]
[0007] (R 1 , R 2 , R 3 and R 4 as described herein) or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable surfactant including one or more caprylocaproyl polyoxylglycerides and PEG-8 caprylic / capric glycerides.
[0008] In another embodiment of the present invention, a compound of formula (I):
[0009] [ka]
[0010] (R 1 , R 2 , R 3 and R 4 as described herein) or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable surfactant comprising one or more polyoxyethylene esters of 12-hydroxystearic acid.
[0011] In a further embodiment of the present invention, there is provided a method of treating pancreatic adenocarcinoma in a mammal, comprising administering to the mammal an amount of a compound of Formula (I):
[0012] [ka]
[0013] (R 1 , R 2 , R 3 and R 4 The present invention provides a method for treating a rheumatoid arthritis, comprising administering a compound of Formula (I) (as described herein) or a pharmaceutically acceptable salt thereof to a mammal in need thereof.
[0014] In another embodiment of the present invention, there is provided a method for detecting altered expression levels of one or both of FoxA1 and FoxO6 in a pancreatic adenocarcinoma tumor sample from a mammal, wherein the mammal comprises an antibody having a gene encoding a gene encoding an antibody of formula (I):
[0015] [ka]
[0016] (R 1 , R 2 , R 3 and R 4 as described herein) or a pharmaceutically acceptable salt thereof, the method comprising the steps of providing a first pancreatic adenocarcinoma tumor sample from the mammal, assaying the tumor sample to determine the expression level of one or both of forkhead box protein A1 ("FoxA1") and forkhead box protein O6 ("FoxO6"), providing a second pancreatic adenocarcinoma tumor sample from the mammal, assaying the second tumor sample to determine the expression level of one or both of FoxA1 and FoxO6. or both, and detecting a change in the expression level of FoxA1 and / or FoxO6 by comparing one or both of (i) the first determined expression level of FoxA1 to the second determined expression level of FoxA1, and (ii) the first determined expression level of FoxO6 to the second determined expression level of FoxO6, wherein a first tumor sample is removed from the mammal before removing a second tumor sample from the mammal.
[0017] Disclosed as a solution to an unmet need for treating cancer, particularly metastatic cancer, is a formulation containing an inhibitor of the perinuclear compartment (PNC), a nuclear body characterized by its location on the periphery of the nucleolus that may be associated with malignant tumors both in vitro and in vivo. The compound of formula (I) is a PNC inhibitor. Further disclosed as a solution to an unmet need for treating pancreatic adenocarcinoma, particularly metastatic cancer, is a method for treating pancreatic adenocarcinoma by administering a compound of formula (I). Further disclosed as a solution to an unmet need for determining mammals likely to respond positively to administration of a compound of formula (I) as a therapeutic agent for pancreatic adenocarcinoma, is a method for detecting altered expression levels of one or both of FoxA1 and FoxO6 in pancreatic adenocarcinoma tumor samples.
[0018] As shown in the Examples, unexpectedly, metalrestin, a compound of formula (I), was selective for metastasis across different preclinical cancer histologies, with high intratumoral exposure and no appreciable toxicity. Metalrestin inhibits Pol I transcription, induces nucleolar segregation, reduces nucleolar volume, and disrupts PNCs, in part by interfering with eEF1A2 function. Furthermore, the unexpected detection of altered expression levels of FoxA1 and Fox06 in pancreatic adenocarcinoma tumor samples provided valuable insight into which mammals should continue receiving metalrestin.
[0019] Brief description of multiple views of the drawing [Brief explanation of the drawings]
[0020] [Figure 1]Figure 1 shows the concentration-response curve for PNC prevalence in PC3M (a metastatic prostate cancer cell line)-GFP (green fluorescent protein)-PTB (polypyrimidine tract-binding protein) cells (squares; PC3M has a PNC prevalence of 75-85% without treatment), and cytotoxicity (circles) measured by cellular ATP (CELLTITER GLO®). Representative PTB-GFP images of cells at the indicated concentrations (arrowheads indicate PNC) (scale bar = 5 µm) are shown in the top three panels of the graph. Relative signal (%) is along the y-axis, and metalrestin [log M] is along the x-axis. As can be seen from the panels, the amount of fluorescence within the PNC of the cells is reduced, with the left panel representing the brightest fluorescence and the right panel representing the weakest fluorescence. Figures 1-4 demonstrate that metalrestin reduces PNC and inhibits cancer cell invasion at submicromolar concentrations. [Figure 2] Figure 2 is a bar graph showing that 1 μM metalrestin was effective in reducing PNCs in various cancer cell lines (p<0.05 for PNC reduction in all cell lines; a list of cells is in Table 1 below, and see also Example 2 below). DMSO controls are shown in light gray bars, and metalrestin in dark gray bars. PNC prevalence (%) is on the y-axis, and cell line names are along the x-axis. [Figure 3] Figure 3 is a bar graph showing that metalrestin inhibits MATRIGEL gelatinous protein mixture (BD Biosciences, Franklin Lakes, NJ) invasion at submicromolar concentrations (0.6 μM) within 24 hours of treatment (*p<0.05 and **p<0.01 compared to DMSO [control]). Invasion (%) is on the y-axis and metalrestin [microM] is on the x-axis. The cell line PC3M is shown as an open bar, and the cell line PANC1 (human pancreatic) is shown as a black bar. [Figure 4]Figure 4 is a line graph showing that metalrestin at 1 μM affects cell proliferation in PC3M but not in normal fibroblasts (GM02153) (arrows indicate the time of medium change) (*p<0.05, **p<0.01). Confluence (%) is on the y-axis, and time (in hours) is on the x-axis. The top line is GM02153-DMSO, the second line is PC3M-DMSO, the third line is GM02153-metalrestin, and the bottom line is PC3M-metalrestin. [Figure 5] Figure 5 is a graph showing that pancreatic cancer cell lines derived from either pancreatic primary tumors or metastatic lesions showed a higher PNC prevalence in cells derived from metastases than in cells derived from primary tumors (cell line description in Table 1 below; *p<0.05). The figure shows that metalrestin treatment reduces lung and liver metastases in NOD / IL2gamma(null)PANC1 mice. PNC prevalence (%) is on the y-axis, and tumor type (primary or metastatic) is on the x-axis. [Figure 6] Figure 6 includes a mouse graphic and bar graph showing increased PNC prevalence in metastatic tissues (indicated by circles with arrows representing liver, spleen, and lung in the mouse graphic) derived from primary tumor tissues (35% [center of mouse graphic]) of NOD / IL2gamma(null)PANC1 mice harvested 8 weeks after implantation. PNC prevalence was determined on frozen tissue sections stained with the SH54 antibody. PNC prevalence (%) is on the y-axis, and tumor type (i.e., pancreas, spleen, liver, and lung) is on the x-axis (*p<0.05, **p<0.01, ***p<0.001). [Figure 7]Figure 7 is a graph showing that after 6 weeks of treatment, metastatic deposits, as measured by organ / tumor ratios in the liver and lungs, were reduced in mice treated with 25 mg / kg of metallestin once daily compared to vehicle-treated animals (n=10 mice randomly assigned to each cohort) (*p<0.05, **p<0.01). Organ / tumor ratios are on the y-axis, and treatment (vehicle, 5 mg / kg, or 25 mg / kg) for liver (left) and lung (right) tissues is on the x-axis. [Figure 8] Figure 8 is a graph showing the results of pathology examination demonstrating that the livers and lungs of animals treated with metalrestin had a reduced metastatic burden compared to vehicle-treated animals (bar = 250 μm; n = 4 per group analyzed) (***p < 0.001). Metastatic deposits are on the y-axis and treatment (vehicle or 25 mg / kg) for liver (left) and lung (right) tissues is on the x-axis. [Figure 9] Figure 9 is an illustration of an example of histological examination demonstrating reduced metastatic burden in the liver and lungs of animals treated with metalrestin compared to vehicle-treated animals. Arrows indicate metastatic tumors. [Figure 10] Figure 10 is a graph showing that the primary tumors of treated animals did not change after metalrestin treatment. Body weight change is on the y-axis. Vehicle (triangles), 5 mg / kg (squares), and 25 mg / kg (circles) are shown on the graph. Metalrestin treatment was well tolerated, and no significant differences in body weight were observed between treatment groups over the course of the study. [Figure 11] Figure 11 is a set of panels showing that metalrestin degrades PNCs in primary pancreatic tumors and metastases in NSG PANC1 mice. PNCs within tumors were visualized by immunofluorescence 12 weeks after inoculation (PNCs are the lightest color and are marked with arrows). Images from primary tumors and liver metastases are shown (scale bar = 5 μm). Vehicle-treated animals showed typical, easily detectable PNCs. The prevalence of PNCs was reduced, and the remaining PNCs appeared smaller in metalrestin-treated animals (25 mg / kg IP, administered daily for 6 weeks; n = 4 per group analyzed). [Figure 12] Figure 12 shows the effect of metalrestin on PNC prevalence in primary pancreatic tumors and metastatic sites. PNC prevalence (y-axis) was reduced by metalrestin treatment (25 mg / kg IP, administered daily for 6 weeks) in primary tumors (pancreas) and metastatic tumors in the lung, liver, and spleen (**p<0.01). Tumor types (pancreas, lung, liver, and spleen) are along the x-axis. [Figure 13] Figure 13 is a graph showing the survival rate of mice after treatment with metalrestin or vehicle. This graph shows that metalrestin treatment prolongs survival in the NSG PANC1 pancreatic cancer metastasis model. Metalrestin treatment was provided via drug-supplemented chow (70 ppm designed to deliver 10 mg / kg per day) beginning 6 weeks after 3D PANC1 tumor cell inoculation, when animals generally do not display macrometastases on organ surfaces. Metalrestin treatment prevented death beyond 90 days of treatment. Survival rate is shown on the y-axis, and days after treatment on the x-axis. Metalrestin treatment is the solid gray line at 100% survival rate, while the descending black line is vehicle (***p<0.001). [Figure 14] Figure 14 is a graph showing the survival rate of mice after treatment with metalrestin or vehicle. This graph shows that metalrestin treatment prolongs survival in the NSG PANC1 pancreatic cancer metastasis model. After mice developed macrometastases containing visible liver surface deposits, metalrestin treatment was provided via drug-supplemented chow (70 ppm designed to deliver 10 mg / kg per day). Metalrestin treatment prolonged survival time compared to vehicle-treated mice (NIH 31 Haslan diet). Survival rate is shown on the y-axis, and days after treatment are shown on the x-axis. Metalrestin treatment is shown as a solid gray line, while the black line is vehicle (***p=0.007). [Figure 15]Figure 15 is a series of panels showing exemplary tissues after complete necropsy of mice at the time of death. These panels demonstrate a reduction in metastatic disease burden in the livers of metalrestin-treated animals without a detectable effect on primary tumor size. Control animals showed near-total or complete tumor replacement, particularly in the liver (* indicates thick right septum), but less so in the lungs. Pancreatic tumors were comparable in both groups for comparison. Tissues from vehicle-treated animals are in the left two columns, and tissues from metalrestin-treated animals are in the right two columns. Liver tissue is shown in the top row, lung tissue in the middle row, and pancreatic tissue in the bottom row. [Figure 16] Figure 16 is a graph showing the average size of liver (including metastatic tumors) and primary pancreatic tumors in vehicle- and metalrestin-treated mice from the study in Figure 14 (*p<0.05). Organ size (mm x mm) is on the y-axis, and tumor type (metastatic liver and primary pancreas) is on the y-axis. Vehicle is represented by black bars, and metalrestin by gray bars. [Figure 17] 17 is a graph showing that daily treatment with metalrestin significantly reduced lung metastases as measured by a quantitative in vivo imaging system ("IVIS") (n=6 per group). Luminescence (photons) is on the y-axis, and treatment (i.e., vehicle, metalrestin 5 mg / kg, and 25 mg / kg) is on the y-axis (*p<0.05). [Figure 18] Figure 18 is a graph showing that metalrestin treatment had a small effect on the growth of SC-inoculated PC3M primary tumors, as measured by tumor volume (y-axis, units: mm). Days after tumor implantation are along the x-axis (*p<0.05). [Figure 19] Figure 19 shows that metalrestin treatment effectively inhibited the growth of PDXs composed of metastatic cells from patient pleural effusions (n=5 per group) as measured by tumor volume (y-axis, in mm) and tumor weight at the end of the experiment. Days after treatment initiation are along the y-axis (**p<0.01). [Figure 20]20 is a graph showing that the weekly weight assessment did not show significant differences between the treatment group and the control group. The weight of treated animals did not change. In contrast to the animals treated with vehicle, the animals treated with metalrestin remained alert and well-groomed. [Figure 21] Figures 21A-21C are a set of panels showing that nucleoli lose their typical three substructures (arrows indicate the DFC, dense filamentous portion, FC, filamentous portion, and GC, granular portion) and develop nucleolar capping (enlarged inserts) in HeLa cells and tumor tissues treated with metalrestin. Representative electron micrographs are shown for HeLa cells (Figure 21A; treated with 1 μM for 24 hours), primary pancreatic tumors (Figure 21B), and liver metastases (Figure 21C) from NSG PANC1 mice treated with vehicle (top) or 10 mg / kg metalrestin (bottom) for 7 days. Mice were harvested 1 hour after the last metalrestin administration (inserts show nucleoli). Scale bar = 1 μm. Figures 21A-24 show that metalrestin treatment induces changes in nucleolar structure. [Figure 22] Figures 22A-22C are three graphs showing quantitative evaluation of EM images demonstrating that mean nucleolar area was reduced in HeLa cells (Figure 22A), primary pancreatic tumors (Figure 22B), and liver metastases (Figure 22C) in cell lines and tissues treated with metalrestin compared to vehicle controls (P<0.0001). One hundred nucleoli were randomly selected and analyzed, and nucleolar area was calculated as ((longest diameter + shortest diameter) / 2) × π). Comparison of mean nucleolar area was performed using a 2-tailed Mann-Whitney U test, n=4 per group. [Figure 23]Figure 23 is a series of panels showing changes in nucleolar structure induced by metalrestin treatment (upper left panel), reflected by the redistribution of the Pol I transcription factor UBF to cap-like structures (arrows), corresponding to the loss of PNC. As shown in the merge panel, the capping of UBF reflects the separation of the granular from the filamentous regions, as seen in the EM images in Figures 21A-21C. Scale bar = 5 μm. [Figure 24] Figure 24 is a panel showing that metalrestin interferes with ribosome biogenesis. An inducible RPL29-GFP-expressing cell line synthesizes RPL29-GFP upon treatment with tetracycline (second column). When cells were treated with 1 μM metalrestin before tetracycline induction, the newly synthesized protein accumulated in the nucleoli and nuclei (far right panel) compared to cells treated with the DMSO control (second panel from the right). Scale bar = 5 μm. [Figure 25] Figure 25 is a pair of panels showing altered Pol I transcription patterns, as demonstrated by the redistribution of BrU incorporation signals to pinpoints 5 min after typical nucleolar labeling (second from left column), corresponding to changes in nucleolar structure shown as a loss of nucleolar labeling for C23 / nucleolin (left column). All cells treated with metalrestin showed changes in BrU labeling in nucleoli compared to only a small proportion of cells treated with DMSO (right panel). Figures 25-34 show that metalrestin treatment reduces pre-RNA synthesis and Pol I occupancy at rDNA without altering the rDNA chromatin state. [Figure 26] FIG. 26 shows the results of RT-PCR (left panel) and qRT-PCR (right panel) demonstrating a reduction in the 5′ETS of pre-rRNA in metalrestin-treated cells. [Figure 27] FIG. 27 shows the results of a Western blot demonstrating no changes in the protein expression of RPA194, the large subunit of Pol I, and UBF present in metalrestin-treated cells. [Figure 28]FIG. 28 shows the results of a psoralen-crosslinking experiment, demonstrating that exposure to metalrestin does not alter the ratio of active to inactive rDNA chromatin. [Figure 29] FIG. 29 shows the structure of rDNA. [Figure 30] Figures 30A-30E are a set of graphs showing quantitative ChIP assessments demonstrating that metalrestin treatment reduces the occupancy of RPA194 on rDNA through the promoter and coding regions, but not UBF (Figure 30A is rDNA promoter, Figure 30B is 5'ETS, Figure 30C is 5.8S, Figure 30D is 28S, and Figure 30E is U12). [Figure 31] Figure 31 shows that knockdown of pol I by siRNA resulted in a reduction of RPA194 as measured by Western blot, the amount of which was quantified relative to control siRNA-treated cells (set at 1). [Figure 32] FIG. 32 is a set of panels showing that knockdown of RPA194 by siRNA reduced PNC prevalence and increased the number of crescent-shaped PNCs (gray areas). [Figure 33] Figure 33 is a graph showing PNC prevalence, with PNC prevalence (%) on the y-axis and cell type on the x-axis (*p<0.05). [Figure 34] Figure 34 is a pair of panels showing that RPA194 knockdown (top row, second from left, white arrow) also disrupted nucleoli compared to untreated and control oligo-treated cells (bottom two panels). PNC structure was altered to a crescent shape (top row, left column, arrow) compared to untreated and control oligo-treated cells (bottom two columns) (*p<0.05, **p<0.01). Scale bar for all images = 5 μm. [Figure 35]Figure 35 is a Western blot showing that metalrestin effectively outcompeted recombinant eEF1A from binding to the anchored biotinylated metalrestin-eEF1A complex. Figures 35-40C show that metalrestin specifically binds eEF1A2. Increased eEF1A2 promotes PNC and metastasis formation. [Figure 36] Figure 36 is a gel showing that metalrestin treatment stabilized eEF1A in a thermostability assay using PC3M cell lysates, DMSO is the top panel and metalrestin is the bottom panel. [Figure 37] FIG. 37 shows Western blot analysis demonstrating that treatment with 1 μM metalrestin for 24 hours did not change the amount of eEF1A protein. [Figure 38] Figure 38 shows a set of graphs and panels. Top: Overexpression of HA-eEF1A2 increased the number of PNCs per nucleus (scattered PNC prevalence: number of cells containing two or more PNCs); n=300 cells (bar=2 μm). The graph shows that it did not significantly increase overall PNC prevalence. Scattered is represented by light gray bars, and no scatter is represented by black bars. PNC prevalence (%) is on the y-axis, and eEF1A2, eEF1A1, and untreated are along the x-axis (*p<0.05, **p<0.01). [Figure 39] Figure 39 is a graph showing that overexpression of eEF1A2 in PC3M cells increased the IC50 of metalrestin for PNC degradation. PNC prevalence (%) is on the y-axis, and log[M]metalrestin is on the y-axis. eEF1A2 is represented by circles, and the control vector is represented by squares. [Figure 40]Figures 40A-40B show the results of injecting 6 x 10 PANC1 3D spheres transduced with empty vector (control) or eEF1A2 (eEF1A2 OE) into the pancreatic tail of NSG mice. Mice from both groups were harvested 6 weeks after transplantation and subjected to necropsy. Figure 40A shows pre- (upper panel) and post- (lower panel) macroscopic images of the liver surface, demonstrating a higher metastatic burden in PANC1 eEF1A2 animals than in empty vector controls (left, harvested liver). Histopathological images (H&E staining) of the liver (black scale bar = 250 µm, white scale bar = 100 µm) are shown to the right of the macroscopic images. The inset shows a representative metastatic lesion. Figure 40B shows quantification of liver metastases, demonstrating that liver metastases had a higher metastatic burden in PANC1 eEF1A2 OE animals (n = 4 animals analyzed per group) (*p < 0.05). Number of liver metastases (mm3) is on the y-axis, control and eEF1A2 OE are on the x-axis. [Figure 41] Figure 41 is a gel showing that 72 hours after siRNA transfection into HeLa cells, eEF1A2 RNA, but not eEF1A1 RNA, was reduced as measured by RT-PCR. Figures 41-45B show that reduction of eEF1A2 induces disruption of nucleoli and PNCs similar to metalrestin. [Figure 42] Figure 42 is a graph showing that qRT-PCR showed a decrease in eEF1A2 RNA in siRNA-transfected cells. Relative levels of eEF1A2 RNA are on the y-axis (**p<0.01). [Figure 43] FIG. 43 is a graph showing that 72 hours after transfection with eEF1A2 siRNA, the amount of 5′ETS RNA was reduced as measured by qRT-PCR. [Figure 44]Figure 44 is a panel showing that disruption of nucleoli and PNCs was detected using immunofluorescence in siRNA-transfected cells. PNCs in eEF1A2 knockdown cells generally showed crescent shapes (arrows) and separated nucleoli (capping, arrowheads) immunolabeled with an antibody that recognizes the pre-RNA processing factor fibrillarin; n = 500 cells. Scale bar = 5 μm. [Figure 45] Figures 45A-45B are graphs showing a modest decrease in PNC prevalence (Figure 45A) and an increase in nucleolar disruption (Figure 45B). Transfection of HA-eEF1A2 (black bars) after an additional 24 hours of siRNA partially rescued PNC prevalence (Figure 45A, black bars) and nucleolar disruption (Figure 45B, gray bars) (*p<0.05, **p<0.01). [Figure 46] Figure 46 shows the plasma pharmacokinetics ("PK") of metalrestin when administered as a single intraperitoneal injection. Female BALB / c mice (n=3) received a single dose of metalrestin, while SCID-beige mice (n=3) received repeated doses at different time points. Mice in the repeated dose study received daily intraperitoneal injections for 4 weeks, with concentrations measured 24 hours after the last dose. Metalrestin was formulated in 5% NMP + 20% PEG400 + 75% (10% HP-β-CD in water). [Figure 47] Figure 47 is a set of panels showing metalrestin-induced nucleolar structural changes observed by electron microscopy. Nucleolar structures lose the typical three substructures (DFC, dense filamentous portion; FC, filamentous portion; and GC, granular portion; identified by arrows and labels) seen in untreated or DMSO-treated cells and become highly segregated (metalrestin panel) after 24 hours of treatment with 1 μM metalrestin in HeLa cells. However, cessation of treatment allows for recovery of the nucleoli (metalrestin recovery panel). Scale bar = 500 nm. [Figure 48] Figure 48 is a pair of panels showing that similar changes are observed in PANC1 and PC3M cells (left two panels) but not in treated normal liver tissue (right panel). Scale bar = 1 μm. [Figure 49] Figures 49A-49C are graphs showing quantitative evaluation of the EM images in Figure 48. Figure 49 demonstrates that nucleolus volume was reduced in treated cancer cell lines (Figures 49A-49B), but not in treated normal liver tissue (Figure 49C) (****p<0.0001). [Figure 50] Figure 50 is a set of panels showing changes in nucleolar structure in metalrestin-treated cells. The changes in nucleolar structure (UBF labeling in the arrows) are closely associated with the loss of PNCs. Metalrestin treatment (1 μM, 18 h) was tested in three cell lines: PANC1, PC3M, and HeLa. Capping of the Pol I transcription factor UBF in metalrestin-treated cells is evident as shown in the merged image (indicated by the arrow). Scale bar = 10 μm. [Figure 51] Figure 51 is a set of panels showing the capping structures of Pol I transcription factors in metalrestin-treated cells. The Pol I transcription factors UBF (second column from the left), RPA194 (left column), and the pre-ribosomal RNA processing factor NOPP140 (center column) showed similar capping structures in metalrestin-treated cells. Scale bar = 10 μm. [Figure 52] Figure 52 is a pair of panels showing that immunolabeling of two pre-ribosomal RNA processing factors, fibrillarin and NOPP140, demonstrated cap-like structures in metalrestin-treated cells (arrows). Scale bar = 5 μm. [Figure 53] Figure 53 is a set of panels showing that capping of Pol I transcription factors was not evident in the normal fibroblast cell line GM02153 treated with metalrestin using the same protocol (1 μM, 18 hours). These cells do not have PNCs, as PTB labeling did not show perinuclear enrichment. In these cells, UBF did not become fully capped even with treatment at 5 μM. Scale bar = 5 μm. [Figure 54]Figure 54 is a set of panels showing that nucleoli modified by nucleolar capping can be detected by immunolabeling of UBF in metalrestin-treated cells. Newly synthesized GFP-RPL29 entered the nucleus and localized to distorted nucleoli, but was not assembled into mature ribosomes or transported to the cytoplasm in metalrestin-treated cells. Scale bar = 10 μm. [Figure 55] Figure 55 is a gel showing that GFP-RPL29 expression did not change significantly when stably transfected HeLa cells were induced to express the GFP-RPL29 fusion protein after treatment with metalrestin (1 μM, 5 hours). Figures 54 and 55 together show that metalrestin treatment had no effect on Pol II transcription, translation, or cytoplasm-nuclear trafficking in metalrestin-treated cells. [Figure 56] Figure 56 is a Western blot showing that there is no effect on DNA damage response, cell cycle, or Pol II transcription in metalrestin-treated cells. Specifically, Western blot analysis of phosphorylated proteins of the DNA damage response signature or p53. [Figure 57] Figures 57A-57C are graphs showing that there was no significant change when cells were treated with 1 μM metalrestin for 24 hours. Figure 57A shows phosphorylated yH2AX, Figure 57B shows p53BP1, and Figure 57C shows p-p53. Cell lines are along the x-axis and change is on the y-axis. DMSO is represented by black bars, and metalrestin is represented by gray bars. [Figure 58] Figure 58 is a graph showing cell cycle analysis of DNA content by flow cytometry. This study shows that there is no significant cell cycle block within 24 hours of metalrestin treatment at two different concentrations. Cell cycle phase (%) is on the y-axis. [Figure 59]Figure 59 is a pair of panels showing that immunolabeling of CUGBP and SC35 in metalrestin-treated cells did not exhibit the signature changes in their labeling patterns seen during Pol II transcription inhibition by α-amanitin. α-amanitin treatment induces cytoplasmic relocation of the protein but does not affect proteins localized to PNCs (upper right panel, arrows), whereas metalrestin treatment disassembled PNCs without causing cytoplasmic relocation of CUGBP (upper middle panel). Similarly, metalrestin treatment did not significantly affect the punctate distribution pattern (lower middle panel), unlike α-amanitin, which induces round aggregates (lower right panel, arrows). Scale bar = 5 μm. [Figure 60] Figure 60 is a set of panels showing the effect of biotin-metalrestin on the degradation of PNCs. The effects of metalrestin and biotin-metalrestin were compared in PC3M cells treated with 1 μM for 24 hours or in untreated PC3M cells. Arrows indicate PNCs. Scale bar = 5 μm. [Figure 61] Figure 61 shows the expression of eEF1A2-HA in transfected cells. The protein is predominantly cytoplasmic. Immunolabeling with SH54 demonstrates the nucleoplasmic and PNC distribution of PTB. Transfection efficiency was approximately 70%. (***p<0.001). Scale bar = 20 μm. [Figure 62] Figure 62 is a graph showing that metalrestin treatment had no effect on Pol II transcription, translation, or cytoplasm-nuclear trafficking in metalrestin-treated cells. Specifically, stably transfected HeLa cells were induced to express a GFP-RPL29 fusion protein after metalrestin treatment (1 μM, 5 hours). GFP-RPL29 expression did not change significantly. [Figure 63]Figure 63 is a graph showing the drug response of PANC1 cells after metalrestin treatment. Relative cell proliferation was measured by CELLTITERGLO® after 72 hours, normalized to the DMSO control sample (set to 1.0). Mean cell viability values are plotted with the standard error of the mean (SEM) from at least two independent experiments performed in triplicate. [Figure 64] Figure 64 shows metastatic cancer progression in PANC1 NSG mice. After intrapancreatic injection of 60,000 luciferase-expressing 3D PANC1-luc cells derived from PANC-luc cells grown as spheroids into NSG mice, micrometastases (black arrows) with periportal invasion (white arrows) developed approximately 4 weeks later (representative H&E staining, -scale bar = 250 μm, white scale bar = 100 μm). Macrometastases (indicated by -) with surface-visible metastases developed after 8 weeks. * indicates necrosis. The timeline is depicted at the top. [Figure 65]Figure 65 shows the synthesis of N-(6-(3-((3-(trans-4-hydroxycyclohexyl)-4-imino-5,6-diphenyl-3,4-dihydro-7H-pyrrolo[2,3-d]pyrimidin-7-yl)methyl)phenyl)hex-5-yn-1-yl)-5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide (biotin-metalrestin). Specifically, a modified Voigt reaction / Knoevenagel condensation sequence was performed using the procedure of Roth and Eger (Synthesis of 2-amino-3-cyano-pyrroles (author's transl), ArchPharm (Weinheim), 308: 179-85 (1975)). Thus, benzoin (5.26 g, 24.8 mmol), 3-bromobenzylamine (4.61 g, 24.8 mmol), and trifluoroacetic acid (0.14 g, 1.24 mmol, 0.05 equiv.) were heated at reflux connected to a Dean-Stark trap for 1 hour, and the mixture was removed from the oil bath. Malononitrile (4.91 g, 74.3 mmol, 3.0 equiv.) was added to the mixture, and the reaction was again heated at reflux connected to a Dean-Stark trap for 1 hour. The reaction mixture was cooled to room temperature and stirred for 19 hours to give the crude pyrrole as a dark red solid. The product was precipitated with ethyl ether, and the solid was washed with additional ethyl ether until the filtrate was colorless, affording the pale purple pyrrole product (6.80 g, 15.87 mmol, 64% yield), which was used without purification.Rf = 0.53 (50% EtOAc / hexane); mp = 184-190 °C; 1H NMR (400 MHz, DMSO-d6) δ 4.96 (s, 2 H), 6.80 (d, J = 7.8 Hz, 1 H), 7.03-7.28 (complex, 12 H), 7.43 (d, J = 9.0 Hz, 1 H); 13C NMR (101 MHz, DMSO-d6, APT pulse sequence) δ d (CH, CH3): 125.6, 126.6, 128.3, 128.5, 128.9, 129.0, 129.6, 130.4, 131.1, 131.5; u: (C, CH2): 45.4, 118.4, 120.7, 122.0, 124.0, 131.3, 133.9, 140.4, 149.1; IR 2203, 1632 cm-1; HRMS (ESI) m / z calculated for C24H19BrN3 [M + H]+ 428.0757 is 428.0749. [Figure 66] Figures 66A-66B are graphs showing the relative expression of the biomarkers FoxA1 (Figure 66A) and FoxO6 (Figure 66B). Relative expression is on the y-axis, and the AUC of metalrestin (hr*ng / mL) is on the x-axis in both graphs (R2=0.9999; p=0.0076 for FoxA1 and R2=0.9952; p=0.0440 for FoxO6). Summary of the Invention
[0021] Detailed Description of the Invention formulation In an embodiment of the invention, a compound of formula (I):
[0022] [ka]
[0023] (In the formula, R 1 alkyl, hydroxyalkyl, thioalkyl, alkoxyalkyl, alkylthioalkyl, cycloalkyl, hydroxycycloalkyl, hydroxycycloalkylalkyl, thiocycloalkyl, alkoxycycloalkyl, alkylthiocycloalkyl, dialkylaminoalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, arylalkyl, arylalkylpiperidin-4-yl, arylpiperazinylalkyl or heteroarylalkyl, R 2 phenyl, which may be substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; R 3 phenyl, which may be substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; and R 4 is alkyl, cycloalkyl, cycloalkylalkyl, aryl, heteroaryl, arylalkyl, or heteroarylalkyl; R 1 and R 4 or a pharmaceutically acceptable salt thereof, wherein the aryl and / or alkyl moieties are optionally substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, aminosulfonyl, hydroxyl, perfluoroalkoxy, alkylenedioxy, and alkylcarbonyl.
[0024] In one embodiment, R 1is a 5- or 6-membered heterocyclyl group having at least one heteroatom selected from the group consisting of O, N, and S; a hydroxy C1-C7 cycloalkyl group; a hydroxy C1-C6 alkyl group; an N,N-di(C1-C6 alkyl)amino C1-C6 alkyl group; a C1-C6 alkoxy C1-C6 alkyl group; a heteroaryl C1-C6 alkyl group; a heterocyclyl C1-C6 alkyl group; a phenyl C1-C6 alkyl group in which the phenyl ring is substituted with one or more C1-C6 alkoxy groups; N-benzylpiperazinyl; N-phenylpiperazinylalkyl; a phenyl C1-C6 alkyl group in which the alkyl is substituted with a hydroxy group; or a 5- or 6-membered heteroarylamino C1-C6 alkyl group (in which the heteroaryl group has at least one heteroatom selected from the group consisting of O, N, and S).
[0025] In one embodiment, R 1 is chosen from:
[0026] [ka]
[0027] In one embodiment, R 2 is phenyl, R 3 is phenyl, R 4 is benzyl, and R 1 may have any of the following structures:
[0028] [ka]
[0029] In one embodiment, R 2 is phenyl, R 3 is phenyl, R 4 is benzyl, and R 1 may have any of the following structures:
[0030] [ka]
[0031] In one embodiment, R 4 is methoxybenzyl, R 2 is phenyl, R 3 is phenyl, and R 1 may have any of the following structures:
[0032] [ka]
[0033] In one embodiment, R 4 is phenylethyl, R 2 is phenyl, R 3 is phenyl, and R 1 may have any of the following structures:
[0034] [ka]
[0035] In one embodiment, R 4 is 4-aminosulfonylbenzyl, 4-trifluoro methoxybenzyl, 4-methoxybenzyl or cyclopropylmethyl, and R 1 may have any of the following structures:
[0036] [ka]
[0037] In one embodiment, R 4 is heteroarylC1-C6 alkyl.
[0038] In one embodiment, R 2 is phenyl, R 3 is phenyl, R 4 teeth
[0039] [ka]
[0040] and R 1 is chosen from:
[0041] [ka]
[0042] In one embodiment, R 2 is phenyl, R 3 is phenyl, R 4 is benzyl, and R 1 is:
[0043] [ka]
[0044] In one embodiment, the compound of formula (I) is metalrestin (see US Patent No. 9,663,521, incorporated herein in its entirety).
[0045] In one embodiment of the present invention, a formulation is provided comprising a pharmaceutically acceptable surfactant comprising one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides. In one embodiment, the formulation is administered by any one of the following routes: orally, aerosol, nasally, pulmonary, parenterally (e.g., intravenously ["IV"], subcutaneously, intradermally, or intramuscularly), subcutaneously, intravenously, intramuscularly, intraperitoneally, intrathecally, intratumorally, topically, rectally, and vaginally. Preferably, the formulation is suitable for oral administration.
[0046] A suitable source of one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides is LABROSOL® (available from Gattefosse, Lyon, France). Preferably, The source of one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides is LABROSOL® ALF ( Gattefosse).
[0047] In one embodiment, the oral formulation comprises LABROSOL® (available from Gattefosse). Includes L®ALF (Gattefosse).
[0048] The formulation may contain about 0.1 to about 90 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 1 to about 90 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 50 to about 85 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 65 to about 85 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 75 to about 85 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 80 wt% of a pharmaceutically acceptable surfactant.
[0049] The oral formulation may contain about 0.1 to about 90 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 1 to about 90 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 50 to about 85 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 65 to about 85 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 75 to about 85 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 80 wt% of a pharmaceutically acceptable surfactant.
[0050] The formulation may contain about 0.1 to about 75 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 1 to about 70 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 25 to about 65 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 30 to about 60 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 40 to about 50 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the formulation contains about 45 wt% of a pharmaceutically acceptable surfactant.
[0051] The oral formulation may contain about 0.1 to about 75 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 1 to about 70 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 25 to about 65 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 30 to about 60 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 40 to about 50 wt% of a pharmaceutically acceptable surfactant. In one embodiment, the oral formulation contains about 45 wt% of a pharmaceutically acceptable surfactant.
[0052] Additionally, formulations containing one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides may contain caprylic acid. In one embodiment, the formulation contains about 0.1 to about 50 wt% caprylic acid. In one embodiment, the formulation contains about 1 to about 50 wt% caprylic acid. In one embodiment, the formulation contains about 3 to about 40 wt% caprylic acid. In one embodiment, the formulation contains about 5 to about 30 wt% caprylic acid. In one embodiment, the formulation contains about 5 to about 15 wt% caprylic acid. In one embodiment, the formulation contains about 10 wt% caprylic acid.
[0053] In one embodiment, a formulation containing one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides also contains about 15 to about 25 wt% caprylic acid. In one embodiment, the formulation contains about 20 wt% Contains caprylic acid.
[0054] Oral formulations containing one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides also contain caprylic acid. In one embodiment, the oral formulation contains about 0.1 to about 50 wt% caprylic acid. In one embodiment, the oral formulation contains about 1 to about 50 wt% caprylic acid. In one embodiment, the oral formulation contains about 3 to about 40 wt% caprylic acid. In one embodiment, the oral formulation contains about 5 to about 30 wt% caprylic acid. In one embodiment, the oral formulation contains about 5 to about 15 wt% caprylic acid. In one embodiment, the oral formulation contains about 10 wt% caprylic acid.
[0055] In one embodiment, an oral formulation comprising one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides also comprises about 15 to about 25 wt% caprylic acid, hi one embodiment, the oral formulation comprises about 20 wt% caprylic acid.
[0056] Formulations containing one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides may also contain water. The formulation may contain about 0.1 to about 95 wt% water. In one embodiment, the oral formulation contains about 0.1 to about 90 wt% water. In one embodiment, the formulation contains about 0.1 to about 85 wt% water. In one embodiment, the formulation contains about 0.1 to about 80 wt% water. In one embodiment, the formulation contains about 0.1 to about 75 wt% water. In one embodiment, the formulation contains about 1 to about 70 wt% water. In one embodiment, the formulation contains about 25 to about 65 wt% water. In one embodiment, the formulation contains about 30 to about 60 wt% water. In one embodiment, the formulation contains about 40 to about 50 wt% water. In one embodiment, the formulation contains about 45 wt% water.
[0057] Oral formulations containing one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides may also contain water. The oral formulation may contain about 0.1 to about 95 wt% water. In one embodiment, the oral formulation contains about 0.1 to about 90 wt% water. In one embodiment, the oral formulation contains about 0.1 to about 85 wt% water. In one embodiment, the oral formulation contains about 0.1 to about 80 wt% water. In one embodiment, the oral formulation contains about 0.1 to about 75 wt% water. In one embodiment, the oral formulation contains about 1 to about 70 wt% water. In one embodiment, the oral formulation contains about 25 to about 65 wt% water. In one embodiment, the oral formulation contains about 30 to about 60 wt% water. In one embodiment, the oral formulation contains about 40 to about 50 wt% water. In one embodiment, the oral formulation comprises about 45 wt% water.
[0058] In addition to a pharmaceutically acceptable surfactant, formulations suitable for oral administration include (a) liquid solutions, such as a therapeutically effective amount of the compound dissolved in a diluent (e.g., water, saline, or juice); (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient as a solid or granule; (c) powders; (d) suspensions in a suitable liquid; and (e) suitable emulsions. Liquid formulations can contain diluents, such as ethanol, benzyl alcohol, and polyethylene alcohol, with or without the addition of a pharmaceutically acceptable surfactant, suspending agent, or emulsifying agent. Capsule forms can be of the conventional hard- or soft-shell gelatin type, containing, for example, additional surfactants, lubricants, and inert fillers (such as lactose, sucrose, calcium phosphate, and corn starch). Tablet forms can be made of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, or microcrystalline cellulose. The formulation may contain one or more of the following: acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, coloring agents, diluents, buffers, disintegrating agents, wetting agents, preservatives, flavoring agents, and pharmacologically compatible excipients. Lozenge forms may contain the active ingredient in a flavoring agent (usually sucrose and acacia or tragacanth), and similarly, pastilles may contain the active ingredient in an inert base (gelatin and glycerin, or sucrose and acacia). Emulsions, gels, and the like contain excipients known in the art in addition to the active ingredient.
[0059] Preferably, the formulations comprising one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides are oral formulations and suspensions.
[0060] Preferably, the formulations comprising one or more caprylocaproyl polyoxylglycerides and one or more PEG-8 caprylic / capric glycerides are oral formulations and pills, which are tablets or capsules (hard or soft).
[0061] In one embodiment of the present invention, a formulation is provided comprising a pharmaceutically acceptable surfactant comprising one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the formulation is administered by any one of the following routes: oral, aerosol, nasal, pulmonary, parenteral (e.g., IV, subcutaneous, intradermal, or intramuscular), subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intratumoral, topical, rectal, and vaginal. Preferably, the formulation is suitable for intravenous administration.
[0062] A suitable source of one or more polyoxyethylene esters of 12-hydroxystearic acid is Solutol HS 15.
[0063] In one embodiment, the formulation contains about 1 to about 60 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the formulation contains about 5 to about 55 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the formulation contains about 10 to about 50 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the formulation contains about 15 to about 45 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the formulation contains about 20 to about 40 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the formulation contains about 25 to about 35 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the formulation contains about 30 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid.
[0064] In one embodiment, the IV formulation contains about 1 to about 60 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the IV formulation contains about 5 to about 55 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the IV formulation contains about 10 to about 50 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the IV formulation contains about 15 to about 45 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the IV formulation contains about 20 to about 40 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the IV formulation contains about 25 to about 35 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid. In one embodiment, the IV formulation comprises about 30 wt% of one or more polyoxyethylene esters of 12-hydroxystearic acid.
[0065] In one embodiment, the formulation contains about 1 to about 60 wt% Solutol HS 15. In one embodiment, the formulation contains about 5 to about 55 wt% Solutol HS 15. In one embodiment, the formulation contains about 10 to about 50 wt% Solutol HS 15. In one embodiment, the formulation contains about 15 to about 45 wt% Solutol HS 15. In one embodiment, the formulation contains about 20 to about 40 wt% Solutol HS 15. In one embodiment, the formulation contains about 25 to about 35 wt% Solutol HS 15. In one embodiment, the formulation contains about 30 wt% Solutol HS 15.
[0066] In one embodiment, the IV formulation contains about 1 to about 60 wt% Solutol HS 15. In one embodiment, the IV formulation contains about 5 to about 55 wt% Solutol HS 15. In one embodiment, the IV formulation contains about 10 to about 50 wt% Solutol HS 15. In one embodiment, the IV formulation contains about 15 to about 45 wt% Solutol HS 15. In one embodiment, the IV formulation contains about 20 to about 40 wt% Solutol HS 15. In one embodiment, the IV formulation contains about 25 to about 35 wt% Solutol HS 15. In one embodiment, the IV formulation contains about 30 wt% Solutol HS 15.
[0067] Preferably, the IV formulation comprises water.
[0068] Preferably, the IV formulation comprises saline.
[0069] Treatment method In one embodiment of the present invention, there is provided a method of treating pancreatic adenocarcinoma in a mammal, the method comprising administering to a mammal in need thereof a compound of formula (I):
[0070] [ka]
[0071] (R 1 , R 2 , R 3 and R 4 comprises administering to a mammal a compound of Formula (I) or a pharmaceutically acceptable salt thereof (as described herein in accordance with an embodiment of the present invention) in an amount effective to treat pancreatic adenocarcinoma.
[0072] In one embodiment, the method comprises administering a compound of Formula (I) in combination with another treatment. The additional treatment may be radiation treatment. The radiation treatment may be any suitable radiation treatment used to treat pancreatic adenocarcinoma.
[0073] The additional treatment may be a chemotherapeutic agent. The chemotherapeutic agent may be any suitable chemotherapeutic agent, for example, asparaginase, busulfan, carboplatin, cysteine, or the like. The chemotherapeutic agent may be selected from the group consisting of suplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and vincristine. Preferably, the chemotherapeutic agent is gemcitabine.
[0074] The chemotherapeutic agent can be administered sequentially together with the compound of formula (I). The chemotherapeutic agent can be administered before the compound of formula (I). The chemotherapeutic agent can be administered after the compound of formula (I).
[0075] Gemcitabine can be administered sequentially with the compound of formula (I). Gemcitabine can be administered before the compound of formula (I). Gemcitabine can be administered after the compound of formula (I).
[0076] The chemotherapeutic agent may be administered simultaneously with the compound of formula (I).
[0077] Gemcitabine may be administered simultaneously with the compound of formula (I).
[0078] When administered, a compound of Formula (I) reduces the likelihood of pancreatic cancer metastasis. If the tumor has already metastasized, administration of a compound of Formula (I) may reduce the number or volume of metastatic tumors. In one embodiment, the mammal has stage I pancreatic adenocarcinoma. In one embodiment, the mammal has stage II pancreatic adenocarcinoma. In one embodiment, the mammal has stage III pancreatic adenocarcinoma. In one embodiment, the mammal has stage IV pancreatic adenocarcinoma.
[0079] In one embodiment, the mammal has metastatic pancreatic adenocarcinoma.
[0080] In further embodiments, administration of a compound of Formula (I) reduces or delays further metastasis of established metastatic lesions. Additionally, administration of a compound of Formula (I) may reduce the amount or size of metastases (e.g., by about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 10%, or about 5%).
[0081] The compound of formula (I) may be administered before one or more pancreatic adenocarcinoma tumors are removed from the mammal. The compound of formula (I) may be administered after one or more pancreatic adenocarcinoma tumors are removed from the mammal. The tumors may be removed, for example, by surgery.
[0082] In one embodiment, the method of treatment results in the disruption of the perinuclear compartment in mammalian cells.
[0083] In one embodiment, the method of treatment results in a reduction in the prevalence of perinuclear compartments in mammalian cells.
[0084] In one embodiment, the method of treatment results in a decrease in the levels of adenosine triphosphate (ATP) produced by metastatic cancer cells in a mammal.
[0085] In one embodiment, the method of treatment results in a reduction in colony formation of cancer cells in a mammal.
[0086] In one embodiment, the method of treatment results in a decrease in migration of cancer cells in a mammal.
[0087] As used herein, the term "treat" and its root words mean It does not necessarily mean 100% or complete treatment. Rather, there are various degrees of treatment that those skilled in the art will recognize as having potential benefits or therapeutic effects. In this regard, the methods of the present invention can provide any amount and level of treatment for cancer in a mammal. Furthermore, the treatment provided by the methods of the present invention can include treatment of one or more conditions or symptoms of the cancer being treated or prevented. For example, treatment can include promoting tumor regression.
[0088] dosage The therapeutically effective amount of the compound administered can vary depending on the desired effect and the factors mentioned above. In one embodiment, the dosage is between 0.1 mg / kg and 80 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 70 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 60 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 50 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 40 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 30 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 20 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 10 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 9 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 8 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 7 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 6 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 5 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 4 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 3 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 2 mg / kg of the subject's body weight. In one embodiment, the dosage is between 0.1 mg / kg and 1 mg / kg of the subject's body weight.
[0089] In one embodiment, the dosage is between 0.5 mg / kg and 1.5 mg / kg of the subject's body weight, hi one embodiment, the dosage is between 0.8 mg / kg and 1.2 mg / kg of the subject's body weight, hi one embodiment, the dosage is about 1 mg / kg.
[0090] In one embodiment, the dosage is between 1.5 mg / kg and 2.5 mg / kg of the subject's body weight, hi one embodiment, the dosage is between 1.8 mg / kg and 2.2 mg / kg of the subject's body weight, hi one embodiment, the dosage is about 2 mg / kg.
[0091] In one embodiment, the dosage is between 4.5 mg / kg and 5.5 mg / kg of the subject's body weight, hi one embodiment, the dosage is between 4.8 mg / kg and 5.2 mg / kg of the subject's body weight, hi one embodiment, the dosage is about 5 mg / kg.
[0092] The dosages disclosed herein can be administered daily. The dosages can be administered once a day, or more than once a day. The dosages can be administered simultaneously with other treatments or sequentially.
[0093] mammal The method herein comprises administering an effective amount of a compound of formula (I) to an animal suffering from pancreatic adenocarcinoma. Preferably, the animal is a mammal. More preferably, the mammal is a human.
[0094] The term "mammal" includes, but is not limited to, the order Rodentia, such as mice, and the order Logomorpha, such as rabbits. More preferably, the mammal belongs to the order Carnivora, such as the order Felinidae (cats) or the order Canis (dogs). More preferably, the mammal belongs to the order Artiodactyla, such as bovines (cattle) and porcines (pigs), or the order Perssodactyla, which includes rhesus (horses). Most preferably, the mammal belongs to the order Primates, Ceboids, Simioides (monkeys), or Anthropoids (humans and apes). A particularly preferred mammal is a human. Furthermore, the subject can be a fetus of any of the aforementioned hosts, particularly a mammal (e.g., a human), in which case any screening of the subject or the subject's cells, or administration of a compound to the subject or the subject's cells, can be performed in utero.
[0095] Biomarkers One embodiment of the present invention provides a method for detecting altered expression levels of one or both of FoxA1 and FoxO6 in a pancreatic adenocarcinoma tumor sample from a mammal, wherein the mammal has been administered a compound of Formula (I). The method includes the steps of: providing a first pancreatic adenocarcinoma tumor sample from the mammal; assaying the tumor sample to determine the expression levels of one or both of FoxA1 and FoxO6; providing a second pancreatic adenocarcinoma tumor sample from the mammal; assaying the second tumor sample to determine the expression levels of one or both of FoxA1 and FoxO6; and detecting altered expression levels of one or both of FoxA1 and FoxO6 by comparing one or both of (i) the first determined expression level of FoxA1 to the second determined expression level of FoxA1 and (ii) the first determined expression level of FoxO6 to the second determined expression level of FoxO6, wherein the first tumor sample is removed from the mammal before removing the second tumor sample from the mammal.
[0096] FoxA1 is also known as hepatocyte nuclear factor 3-alpha (HNF-3A). FoxA1 is encoded by the human gene FOXA1. The sequence of FOXA1 is publicly available (see, for example, the NCBI database, Gene ID: 3169).
[0097] FoxO6 is encoded by the gene FOXO6 in humans, the sequence of which is publicly available (see, for example, the NCBI database, Gene ID: 100132074).
[0098] In one embodiment, the method comprises obtaining a first sample from subject.In one embodiment, the first sample is pancreatic adenocarcinoma tissue sample.The first sample can be obtained from subject by any suitable method known in the art, and the sample can be from any suitable source, for example, tumor resection material or tumor biopsy (i.e., gross biopsy or fine needle biopsy).
[0099] In one embodiment, the method comprises obtaining a second sample from subject.In one embodiment, the second sample is pancreatic adenocarcinoma tissue sample.The second sample from subject can be obtained by any suitable method known in the art, and the sample can be from any suitable source, for example, tumor resection material or tumor biopsy (i.e., gross biopsy or fine needle biopsy).
[0100] The first and second samples may be obtained by different methods, or may be obtained from different sites of a tumor or different sites of an organ.
[0101] In one embodiment, the method includes assaying a first and a second sample to detect the level of FoxA1 in the samples. For example, FoxA1 protein can be purified (either partially or substantially) from the samples and assayed via immunohistochemical techniques (e.g., Western blotting, ELISA, immunoprecipitation, etc.) using antibodies that recognize one or more FoxA1 proteins. In this case, the assay may include contacting the sample with an antibody that specifically binds to FoxA1 protein, thereby forming a complex and detecting the complex. In one embodiment, the first and second samples are purified and assayed via the same or similar techniques.
[0102] In one embodiment, the FoxA1 protein comprises the amino acid sequence of SEQ ID NO: 19. In one embodiment, the FoxA1 protein can be at least about 30%, about 50%, about 75%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to SEQ ID NO: 19.
[0103] In one embodiment, the method includes assaying a first and a second sample to detect the level of FOXO6 in the samples. For example, FoxO6 protein can be purified (either partially or substantially) from the sample and assayed via an immunohistochemical technique (e.g., Western blotting, ELISA, immunoprecipitation, etc.) using an antibody that recognizes one or more FoxO6 proteins. In this case, the assay may include contacting the sample with an antibody that specifically binds to FoxO6 protein, thereby forming a complex and detecting the complex. In one embodiment, the first and second samples are purified and assayed via the same or similar technique.
[0104] In one embodiment, the FoxO6 protein comprises the amino acid sequence of SEQ ID NO: 20. In one embodiment, the FoxO6 protein may be at least about 30%, about 50%, about 75%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to SEQ ID NO: 20.
[0105] The first and second samples can be assayed to determine changes in the level of biomarker expression. In one embodiment, the first sample is taken from the mammal prior to administering a compound of Formula (I) to the mammal. In one embodiment, the level of one or both biomarkers in the second sample is compared to the mammal's pre-treatment level of each biomarker (known from assaying in the first sample).
[0106] In one embodiment, the first sample is taken from the mammal within one week of the first administration of the compound of Formula (I). In one embodiment, the first sample is taken from the mammal within two weeks of the first administration of the compound of Formula (I).
[0107] In one embodiment, the first sample is taken from the mammal at least one week before the second sample is taken from the mammal, hi one embodiment, the first sample is taken from the mammal at least two weeks before the second sample is taken from the mammal.
[0108] In one embodiment, the first sample is taken from the mammal at least three weeks before the second sample is taken from the mammal. In one embodiment, the first sample is collected from the mammal at least 4 weeks before the second sample is collected from the mammal. In one embodiment, the first sample is collected from the mammal at least 5 weeks before the second sample is collected from the mammal. In one embodiment, the first sample is collected from the mammal at least 6 weeks before the second sample is collected from the mammal. In one embodiment, the first sample is collected from the mammal at least 7 weeks before the second sample is collected from the mammal. In one embodiment, the first sample is collected from the mammal at least 8 weeks before the second sample is collected from the mammal.
[0109] If the level of FoxA1 expression of the mammal in the second sample is lower than the level of FoxA2 expression of the mammal in the first sample, it is predicted that the mammal will have a favorable response to the compound of formula (I) (fewer or smaller metastatic tumors) compared to not being administered the compound of formula (I).If the level of FoxO6 expression of the mammal in the second sample is higher than the level of FoxO6 expression in the first sample, it is predicted that the mammal will have a favorable response to the compound of formula (I) (fewer or smaller metastatic tumors) compared to not being administered the compound of formula (I).
[0110] In one embodiment, a method for treating pancreatic adenocarcinoma comprises determining that the mammal has a lower level of FoxA1 and / or a higher level of FoxO6 expression in a second sample compared to a first sample (the lower level of FoxA1 or higher level of FoxO6 expression being determined by a method according to an embodiment of the invention), predicting a clinical response to administration of a compound of formula (I), and treating pancreatic adenocarcinoma in the mammal by administering a compound of formula (I) to the mammal if the mammal has a lower level of FoxA1 and / or a higher level of FoxO6 expression in the second sample compared to the first sample.
[0111] As used herein, the phrase "predicting clinical response" refers to determining whether the number or size or volume of metastatic tumors is likely to decrease in a subject following administration of a compound of formula (I).
[0112] As claimed herein, the term "biomarker" refers to FoxA1 or FoxO6.
[0113] Compounds of formula (I) Now, referring to the terminology generally used herein, the term "alkyl" refers to a straight or branched chain alkyl substituent containing, for example, from about 1 to about 6 carbon atoms, preferably from about 1 to about 4 carbon atoms, and more preferably from about 1 to about 2 carbon atoms. Such substituents include methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, pentyl, isoamyl, hexyl, and the like.
[0114] As used herein, the term "alkenyl" refers to a straight-chain alkenyl substituent containing at least one carbon-carbon double bond and, for example, from about 2 to about 6 carbon atoms (branched alkenyls are from about 3 to about 6 carbon atoms), preferably from about 2 to about 5 carbon atoms (branched alkenyls are preferably from about 3 to about 5 carbon atoms), and more preferably from about 3 to about 4 carbon atoms. Such substituents include vinyl, propenyl, isopropenyl, n-butenyl, sec-butenyl, isobutenyl, tert-butenyl, pentenyl, isopentenyl, hexenyl, and the like.
[0115] As used herein, the term "alkynyl" refers to an alkynyl group having at least one carbon-carbon triple bond and, for example, from 2 to about 6 carbon atoms (branched alkynyl is from about 3 to about 6 carbon atoms). ), preferably straight chain alkynyl substituents containing from 2 to about 5 carbon atoms (branched alkynyl is preferably from about 3 to about 5 carbon atoms), more preferably from about 3 to about 4 carbon atoms. Such substituents include ethynyl, propynyl, isopropynyl, n-butynyl, sec-butynyl, isobutynyl, tert-butynyl, pentynyl, isopentynyl, hexynyl, and the like.
[0116] The term "cycloalkyl" as used herein refers to a cyclic alkyl substituent containing, for example, about 3 to about 8 carbon atoms, preferably about 4 to about 7 carbon atoms, and more preferably about 4 to about 6 carbon atoms. Such substituents include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like. The cyclic alkyl group may be unsubstituted or further substituted with an alkyl group such as a methyl group, an ethyl group, and the like. The term "cycloalkylalkyl" as used herein refers to an alkyl group linked to a cycloalkyl group and an alkyl group further linked to the molecule via an alkyl group.
[0117] As used herein, the term "heterocyclyl" refers to a monocyclic or bicyclic five- or six-membered ring system containing one or more heteroatoms selected from the group consisting of O, N, S, and combinations thereof. The heterocyclyl group can be any suitable heterocyclyl group, and can be an aliphatic heterocyclyl group, an aromatic heterocyclyl group, or a combination thereof. The heterocyclyl group can be a monocyclic heterocyclyl group or a bicyclic heterocyclyl group. Suitable bicyclic heterocyclyl groups include C6-C 10Monocyclic heterocyclyl rings fused to an aryl ring are included. When the heterocyclyl group is a bicyclic heterocyclyl group, both ring systems can be aliphatic or aromatic, and one ring system can be aromatic and the other aliphatic, such as dihydrobenzofuran. Non-limiting examples of suitable aromatic heterocyclyl groups include tetrahydrofuranyl, tetrahydropyranyl, tetrahydrothiophenyl, pyrrolidinyl, piperidinyl, and morpholinyl. Non-limiting examples of suitable aromatic heterocyclyl groups include furanyl; thiophenyl; pyrrolyl; pyrazolyl; imidazolyl; 1,2,3-triazolyl; 1,2,4-triazolyl; isoxazolyl; oxazolyl; isothiazolyl; thiazolyl; 1,3,4-oxadiazol-2-yl; 1,2,4-oxadiazol-2-yl; 5-methyl-1,3,4-oxadiazole; 3-methyl-1,2,4-oxadiazole; pyridinyl; pyrimidinyl; pyrazinyl; triazinyl; benzofuranyl; benzothiophenyl; indolyl; quinolinyl; isoquinolinyl; benzimidazolyl; benzoxazolinyl; benzothiazolinyl; and quinazolinyl. Heterocyclyl groups may be substituted with 1, 2, 3, 4, or 5 substituents, as described herein, such as alkyl groups, e.g., methyl, ethyl, etc., or aryl groups, e.g., phenyl, naphthyl, etc. (aryl groups may be further substituted, e.g., with halo, dihaloalkyl, trihaloalkyl, nitro, hydroxy, alkoxy, aryloxy, amino, substituted amino, alkylcarbonyl, alkoxycarbonyl, arylcarbonyl, aryloxycarbonyl, thio, alkylthio, arylthio, etc., and the optional substituents may be present at any open position on the heterocyclyl group).
[0118] The term "heterocyclylalkyl," as used herein, refers to an alkyl group linked to a heterocyclyl group, and to a heterocyclyl group further linked to a molecule via an alkyl group.
[0119] As used herein, the term "arylalkyl" refers to a C-C 10The term "alkylaryl" as used herein refers to an alkyl group connected to an aryl ring and further connected to the molecule through an alkyl group. 10 C6-C further linked to the molecule via an aryl ring and an aryl group 10 Aryl Refers to the ring.
[0120] The term "alkylcarbonyl," as used herein, refers to an alkyl group linked to a carbonyl group and further linked to a molecule through a carbonyl group, such as alkyl-C(=O)-. The term "alkoxycarbonyl," as used herein, refers to an alkoxy group linked to a carbonyl group and further linked to a molecule through a carbonyl group, such as alkyl-C(=O)-.
[0121] The range of atoms in the structure (e.g., C1-C 12 , C1-C8, C1-C6, C1-C4, or C2-C 12, C2-C8, C2-C6, C2-C4 alkyl, alkenyl, alkynyl, etc.), it is specifically contemplated that any subrange or individual number of carbon atoms falling within the stated range can also be used. Thus, for example, as used herein with respect to any chemical group (e.g., alkyl, alkylamino, etc.), a reference to a range of 1-8 carbon atoms (e.g., C1-C8), 1-6 carbon atoms (e.g., C1-C6), 1-4 carbon atoms (e.g., C1-C4), 1-3 carbon atoms (e.g., C1-C3), or 2-8 carbon atoms (e.g., C2-C8) is intended to include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 carbon atoms and combinations thereof, as appropriate, and any subranges thereof (e.g., 1-2 carbon atoms, 1-3 carbon atoms, 1-4 carbon atoms, 1-5 carbon atoms, 1-6 carbon atoms, 1-7 carbon atoms, 1-8 carbon atoms, 1-9 carbon atoms, 1-10 carbon atoms, 1 The term "aryl" includes and specifically describes groups of 6-10 carbon atoms (e.g., C6-C6), 1-11 carbon atoms, 1-12 carbon atoms, 2-3 carbon atoms, 2-4 carbon atoms, 2-5 carbon atoms, 2-6 carbon atoms, 2-7 carbon atoms, 2-8 carbon atoms, 2-9 carbon atoms, 2-10 carbon atoms, 2-11 carbon atoms, 2-12 carbon atoms, 3-4 carbon atoms, 3-5 carbon atoms, 3-6 carbon atoms, 3-7 carbon atoms, 3-8 carbon atoms, 3-9 carbon atoms, 3-10 carbon atoms, 3-11 carbon atoms, 3-12 carbon atoms, 4-5 carbon atoms, 4-6 carbon atoms, 4-7 carbon atoms, 4-8 carbon atoms, 4-9 carbon atoms, 4-10 carbon atoms, 4-11 carbon atoms, and / or 4-12 carbon atoms, etc., as appropriate. Similarly, the term "aryl" includes and specifically describes groups of 6-10 carbon atoms (e.g., C6-C6), 1-11 carbon atoms, 1-12 carbon atoms, 2-3 carbon atoms, 2-4 carbon atoms, 2-5 carbon atoms, 2-6 carbon atoms, 2-7 carbon atoms, 2-8 carbon atoms, 2-9 carbon atoms, 2-10 carbon atoms, 2-11 carbon atoms, 2-12 carbon atoms, 3-4 carbon atoms, 3-5 carbon atoms, 3-6 carbon atoms, 3-7 carbon atoms, 3-8 carbon atoms, 3-9 carbon atoms, 3-10 carbon atoms, 3-11 carbon atoms, 3-12 carbon atoms, 4-5 carbon atoms, 4-6 carbon atoms, 4-7 carbon atoms, 4-8 carbon atoms, 4-9 carbon atoms, 4-10 carbon atoms, 4-11 carbon atoms, and / or 4-12 carbon atoms, etc., as appropriate. 10 ) ranges include and specify 6, 7, 8, 9, and / or 10 carbon atoms, as appropriate, and any subranges thereof (e.g., 6-10 carbon atoms, 6-9 carbon atoms, 6-8 carbon atoms, 6-7 carbon atoms, 7-10 carbon atoms, 7-9 carbon atoms, 7-8 carbon atoms, 8-10 carbon atoms, and / or 8-9 carbon atoms, etc., as appropriate).
[0122] As used herein, the term "halo" or "halogen" refers to a substituent selected from Group VIIA, such as fluorine, bromine, chlorine, and iodine.
[0123] The term "aryl" as commonly understood in the art refers to an unsubstituted or substituted aromatic carbocyclic substituent, and the term "C-C 10 "Aryl" includes phenyl and naphthyl. It is understood that the term "aryl" applies to cyclic substituents that are planar and contain 4n+2 pi electrons according to Huckel's rule.
[0124] The phrase "pharmaceutically acceptable salt" is intended to include non-toxic salts synthesized from parent compounds containing basic or acidic moieties by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base form of these compounds with a stoichiometric amount of an appropriate base or acid in water or an organic solvent, or a mixture thereof. Generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. A list of suitable salts can be found in Remington's Pharmaceutical Sciences, 22nd ed., Pharmaceutical Press, (2012). are.
[0125] Suitable bases include inorganic bases such as alkali metal bases and alkaline earth metal bases containing metal cations such as sodium, potassium, magnesium, and calcium. Non-limiting examples of suitable bases include sodium hydroxide, potassium hydroxide, sodium carbonate, potassium carbonate, and the like. Suitable acids include inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, and phosphoric acid, and organic acids such as p-toluenesulfonic acid, methanesulfonic acid, benzenesulfonic acid, oxalic acid, p-bromophenylsulfonic acid, carbonic acid, succinic acid, citric acid, benzoic acid, acetic acid, maleic acid, tartaric acid, fatty acids, and long-chain fatty acids. Preferred pharmaceutically acceptable salts of compounds having an acidic moiety include sodium and potassium salts. Preferred pharmaceutically acceptable salts of compounds having a basic moiety (e.g., dimethylaminoalkyl group) include hydrochloride and hydrobromide salts. Compounds having an acidic or basic moiety are useful in the form of a free base or acid, or in the form of their pharmaceutically acceptable salts.
[0126] It should be recognized that the particular counterion forming part of any salt of the present invention is not usually a critical property, so long as the overall salt is pharmacologically acceptable and the counterion does not contribute undesirable qualities to the overall salt.
[0127] It is further understood that the above-mentioned compounds and salts may form solvates or exist in substantially uncomplexed forms, such as anhydrous forms.As used herein, the term "solvate" refers to a molecular complex in which solvent molecules, such as crystallization solvent, are incorporated into a crystal lattice.When the solvent incorporated into the solvate is water, the molecular complex is called a hydrate.Pharmaceutically acceptable solvates include hydrates, methanolates, ethanolates, alcoholates such as acetonitriles, etc.In addition, these compounds may exist in polymorphic forms.
[0128] In any of the above embodiments, the compound or salt of formula (I) can have at least one asymmetric carbon atom.When the compound or salt has at least one asymmetric carbon atom, the compound or salt can exist in racemic form, in the form of its pure optical isomer, or in the form of a mixture in which one isomer is enriched relative to the other isomer.In particular, according to the present invention, when the compound has a single asymmetric carbon atom, the compound can exist in the form of a racemate, i.e., in the form of a mixture of equal amounts of optical isomers, i.e., in the form of equal amounts of two enantiomers, or in the form of a single enantiomer.As used herein, "single enantiomer" is intended to include compounds containing more than 50% of a single enantiomer (i.e., an enantiomeric excess up to 100% pure enantiomer).
[0129] Thus, if a compound or salt has two or more asymmetric centers, the compound or salt may exist as a mixture of diastereomers or in the form of a single diastereomer. As used herein, "single diastereomer" is intended to mean a compound that contains more than 50% of a single diastereomer (i.e., a diastereomeric excess over 100% pure diastereomer).
[0130] The embodiments of the present subject matter described herein may be useful alone or in combination with one or more other embodiments. Without limiting the foregoing, specific, non-limiting embodiments numbered 1-44 of the present disclosure are provided below. As will be apparent to those skilled in the art upon reading this disclosure, each individually numbered embodiment can be used or combined with any of the preceding or subsequent individually numbered embodiments. This is intended to provide support for all such combinations of embodiments. The present invention is not limited to the combinations of embodiments explicitly provided below. (1) Pharmaceutical preparations containing: (a) Formula (I):
[0131] [ka]
[0132] (In the formula, R 1 is selected from the group consisting of alkyl, hydroxyalkyl, thioalkyl, alkoxyalkyl, alkylthioalkyl, cycloalkyl, hydroxycycloalkyl, hydroxycycloalkylalkyl, thiocycloalkyl, alkoxycycloalkyl, alkylthiocycloalkyl, dialkylaminoalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, arylalkyl, arylalkylpiperidin-4-yl, arylpiperazinylalkyl, and heteroarylalkyl; R 2 is a phenyl group optionally substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; R 3 phenyl, which may be substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; R 4 is selected from the group consisting of alkyl, cycloalkyl, cycloalkylalkyl, aryl, heteroaryl, arylalkyl, and heteroarylalkyl; R 1 and R 4is optionally substituted on the aryl and / or alkyl portion with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, aminosulfonyl, hydroxyl, perfluoroalkoxy, alkylenedioxy, and alkylcarbonyl), or a pharmaceutically acceptable salt thereof; and (b) a pharmaceutically acceptable surfactant comprising one or more caprylocaproyl polyoxylglycerides and PEG-8 caprylic / capric glycerides.
[0133] (2) The formulation of embodiment (1), further comprising caprylic acid.
[0134] (3) The formulation of embodiment (1) or (2), wherein the formulation is a suspension formulation.
[0135] (4) The formulation of embodiment (1) or (2), wherein the formulation is a pill.
[0136] (5) Pharmaceutical preparations containing: (a) Formula (I):
[0137] [ka]
[0138] (In the formula, R 1 is selected from the group consisting of alkyl, hydroxyalkyl, thioalkyl, alkoxyalkyl, alkylthioalkyl, cycloalkyl, hydroxycycloalkyl, hydroxycycloalkylalkyl, thiocycloalkyl, alkoxycycloalkyl, alkylthiocycloalkyl, dialkylaminoalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, arylalkyl, arylalkylpiperidin-4-yl, arylpiperazinylalkyl, and heteroarylalkyl; R 2phenyl, which may be substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; R 3 phenyl, which may be substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; R 4 is selected from the group consisting of alkyl, cycloalkyl, cycloalkylalkyl, aryl, heteroaryl, arylalkyl, and heteroarylalkyl; R 1 and R 4 is optionally substituted on the aryl and / or alkyl portion with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, aminosulfonyl, hydroxyl, perfluoroalkoxy, alkylenedioxy, and alkylcarbonyl), or a pharmaceutically acceptable salt thereof; and (b) a pharmaceutically acceptable surfactant comprising one or more polyoxyethylene esters of 12-hydroxystearic acid.
[0139] (6) The formulation of any of embodiments (1)-(3) and (5), wherein the formulation comprises water.
[0140] (7) The formulation of embodiment (5), wherein the formulation comprises saline.
[0141] (8)R 1is a 5- or 6-membered heterocyclyl group having at least one heteroatom selected from the group consisting of O, N, and S; a hydroxy C1-C7 cycloalkyl group; a hydroxy C1-C6 alkyl group; an N,N-di(C1-C6 alkyl)amino C1-C6 alkyl group; a C1-C6 alkoxy C1-C6 alkyl group; a heteroaryl C1-C6 alkyl group; a heterocyclyl C1-C6 alkyl group; a phenyl C1-C6 alkyl group in which the phenyl ring is substituted with one or more C1-C6 alkoxy groups; N-benzylpiperazinyl; N-phenylpiperazinylalkyl; a phenyl C1-C6 alkyl group in which the alkyl is substituted with a hydroxy group; or a 5- or 6-membered heteroarylamino C1-C6 alkyl group (in which the heteroaryl group has at least one heteroatom selected from the group consisting of O, N, and S).
[0142] (9)R 1 But the following:
[0143] [ka]
[0144] The formulation of any of embodiments (1)-(8), selected from the group consisting of:
[0145] (10)R 2 But phenyl, R 3 is phenyl, R 4 is benzyl, and R 1 But below:
[0146] [ka]
[0147] The formulation of embodiment (9), selected from the group consisting of:
[0148] (11)R 4 is 4-methoxybenzyl, R 2 is phenyl, R 3is phenyl, and R 1 But below:
[0149] [ka]
[0150] The formulation of embodiments (1) to (10), selected from the group consisting of:
[0151] (12)R 4 is phenylethyl, R 2 is phenyl, R 3 is phenyl, and R 1 But below:
[0152] [ka]
[0153] The formulation of any of embodiments (1)-(10), selected from the group consisting of:
[0154] (13)R 4 is selected from 4-aminosulfonylbenzyl, 4-trifluoromethoxybenzyl, 4-methoxybenzyl, and cyclopropylmethyl, and R 1 But below:
[0155] [ka]
[0156] The formulation of any of embodiments (1)-(11), selected from:
[0157] (14)R 4 The formulation of any of embodiments (1)-(11), wherein is heteroarylC1-C6 alkyl.
[0158] (15)R 2 is phenyl, R 3 is phenyl, R 4 but
[0159] [ka]
[0160] and R 1 But below:
[0161] [ka]
[0162] The formulation of embodiment (14), selected from the group consisting of:
[0163] (16) A method for treating pancreatic adenocarcinoma in a mammal, comprising administering to a mammal in need thereof 1. A compound of formula (I):
[0164] [ka]
[0165] (In the formula, R 1 is selected from the group consisting of alkyl, hydroxyalkyl, thioalkyl, alkoxyalkyl, alkylthioalkyl, cycloalkyl, hydroxycycloalkyl, hydroxycycloalkylalkyl, thiocycloalkyl, alkoxycycloalkyl, alkylthiocycloalkyl, dialkylaminoalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, arylalkyl, arylalkylpiperidin-4-yl, arylpiperazinylalkyl, and heteroarylalkyl; R 2 phenyl, which may be substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; R 3phenyl, which may be substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; R 4 is selected from the group consisting of alkyl, cycloalkyl, cycloalkylalkyl, aryl, heteroaryl, arylalkyl, and heteroarylalkyl; R 1 and R 4 is optionally substituted on the aryl and / or alkyl portion with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, aminosulfonyl, hydroxyl, perfluoroalkoxy, alkylenedioxy, and alkylcarbonyl), or a pharmaceutically acceptable salt thereof.
[0166] (17)R 1 is a 5- or 6-membered heterocyclyl group having at least one heteroatom selected from the group consisting of O, N, and S; a hydroxy C1-C7 cycloalkyl group; a hydroxy C1-C6 alkyl group; an N,N-di(C1-C6 alkyl)amino C1-C6 alkyl group; a C1-C6 alkoxy C1-C6 alkyl group; a heteroaryl C1-C6 alkyl group; a heterocyclyl C1-C6 alkyl group; a phenyl C1-C6 alkyl group substituted on the phenyl ring with one or more C1-C6 alkoxy groups; N-benzylpiperazinyl; N-phenylpiperazinylalkyl; a phenyl C1-C6 alkyl group in which the alkyl is substituted with a hydroxy group; or a 5- or 6-membered heteroarylamino C1-C6 alkyl group (wherein the heteroaryl group has at least one heteroatom selected from the group consisting of O, N, and S).
[0167] (18)R 1 But the following:
[0168] [ka]
[0169] The method of embodiment (16), wherein the compound is selected from the group consisting of:
[0170] (19)R 2 But phenyl, R 3 is phenyl, R 4 is benzyl, and R 1 But below:
[0171] [ka]
[0172] The method of embodiment (16), wherein the compound is selected from the group consisting of:
[0173] (20)R 4 is 4-methoxybenzyl, R 2 is phenyl, R 3 is phenyl, and R 1 But below:
[0174] [ka]
[0175] The method of embodiment (16), wherein the compound is selected from the group consisting of:
[0176] (21)R 4 is phenylethyl, R 2 is phenyl, R 3 is phenyl, and R 1 But below:
[0177] [ka]
[0178] The method of embodiment (16), wherein the compound is selected from the group consisting of:
[0179] (22)R 4 is selected from 4-aminosulfonylbenzyl, 4-trifluoromethoxybenzyl, 4-methoxybenzyl, and cyclopropylmethyl, and R 1 But below:
[0180] [ka]
[0181] The method of embodiment (16), wherein the
[0182] (23)R 4 The method of embodiment (16), wherein is heteroarylC1-C6 alkyl.
[0183] (24)R 2 is phenyl, R 3 is phenyl, R 4 but
[0184] [ka]
[0185] and R 1 But below:
[0186] [ka]
[0187] The method of embodiment (23), wherein the compound is selected from the group consisting of:
[0188] (25) The method of any of embodiments (16)-(24), further comprising administering to the mammal a chemotherapeutic agent or subjecting the mammal to radiation treatment.
[0189] (26) The method of any of embodiments (16)-(25), wherein the treatment results in one or more of (I)-(V): (I) disrupting the perinuclear compartment in mammalian cells; (II) reducing the prevalence of perinuclear compartments in mammalian cells; (III) reducing the level of adenosine triphosphate (ATP) produced by metastatic cancer cells in mammals; (IV) reducing colony formation of mammalian cancer cells; and (V) Reducing mammalian cancer cell migration.
[0190] (27) The method of any of embodiments (16)-(26), wherein the mammal has stage I pancreatic adenocarcinoma.
[0191] (28) The method of any of embodiments (16)-(26), wherein the mammal has stage II pancreatic adenocarcinoma.
[0192] (29) The method of any of embodiments (16)-(26), wherein the mammal has stage III pancreatic adenocarcinoma.
[0193] (30) The method of any of embodiments (16)-(26), wherein the mammal has stage IV pancreatic adenocarcinoma.
[0194] (31) The method of any of embodiments (16)-(26), wherein the mammal has metastatic pancreatic adenocarcinoma.
[0195] (32) The method of embodiment (25), comprising administering a chemotherapeutic agent to the mammal.
[0196] (33) The method of embodiment (32), wherein the chemotherapeutic agent is gemcitabine.
[0197] (34) The method of embodiment (32) or (33), wherein the chemotherapeutic agent is administered sequentially in any order together with the compound of formula (I).
[0198] (35) The method of embodiment (32) or (33), wherein the chemotherapeutic agent is administered simultaneously with the compound of formula (I).
[0199] (36) The method of any of embodiments (16)-(26) and (29)-(35), wherein the compound of formula (I) reduces or delays further metastasis of established metastatic lesions.
[0200] (37) The method of any of embodiments (16)-(36), wherein the compound of formula (I) is administered after removal of one or more pancreatic adenocarcinomas from the mammal.
[0201] (38) The method of embodiment (37), wherein the one or more pancreatic adenocarcinomas are surgically removed from the mammal.
[0202] (39) The method of embodiment (38), wherein administering a compound of formula (I) reduces the amount or size of metastases.
[0203] (40) The method of any of embodiments (16)-(26) and (29)-(39), wherein administration of a compound of formula (I) reduces or slows the growth of metastatic foci.
[0204] (41) A method for detecting changes in the expression levels of one or both of FoxA1 and FoxO6 in a mammal, wherein the mammal has a gene encoding a gene of formula (I):
[0205] [ka]
[0206] (In the formula, R 1 is selected from the group consisting of alkyl, hydroxyalkyl, thioalkyl, alkoxyalkyl, alkylthioalkyl, cycloalkyl, hydroxycycloalkyl, hydroxycycloalkylalkyl, thiocycloalkyl, alkoxycycloalkyl, alkylthiocycloalkyl, dialkylaminoalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, arylalkyl, arylalkylpiperidin-4-yl, arylpiperazinylalkyl, and heteroarylalkyl; R 2phenyl, which may be substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; R 3 phenyl, which may be substituted with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, and alkylcarbonyl; R 4 is selected from the group consisting of alkyl, cycloalkyl, cycloalkylalkyl, aryl, heteroaryl, arylalkyl, and heteroarylalkyl; R 1 and R 4 has been administered a compound of the formula (I) or a pharmaceutically acceptable salt thereof, wherein the compound (I) is optionally substituted on the aryl and / or alkyl portion with one or more substituents selected from the group consisting of halo, alkyl, hydroxyalkyl, thioalkyl, alkoxy, alkylthioalkyl, alkoxycarbonyl, alkylthiocarbonyl, amino, alkylamino, dialkylamino, aminosulfonyl, hydroxyl, perfluoroalkoxy, alkylenedioxy, and alkylcarbonyl, or a pharmaceutically acceptable salt thereof, comprising the steps of: (a) providing a first pancreatic adenocarcinoma tumor sample from a mammal; (b) assaying the tumor sample to determine the expression level of one or both of Forkhead box protein A1 (FoxA1) and Forkhead box protein O6 (FoxO6); (c) providing a second pancreatic adenocarcinoma tumor sample from the mammal; (d) assaying the second tumor sample to determine the expression level of one or both of FoxA1 and FoxO6; and (e) detecting a change in the expression level of one or both of FoxA1 and FoxO6 by comparing one or both of: (i) the first determined expression level of FoxA1 to the second determined expression level; and (ii) comparing the first determined expression level of FoxO6 to the second determined expression level of FoxO6; Wherein a first tumor sample is removed from the mammal prior to removing a second tumor sample from the mammal.
[0207] 42. A method of treating pancreatic adenocarcinoma in a mammal, the method comprising: a) determining a change in the expression level of one or both of FoxA1 and FoxO6, wherein the change is determined by: (i) a second determined level of FoxA1 expression; and (ii) the second determined level of FoxO6 expression is higher than the first determined level of FoxO6 expression, wherein the change in the expression level of one or both of FoxA1 and FoxO6 is determined by the method of embodiment 41; b) predicting the clinical response to administration of a compound of formula (I); and c) treating pancreatic adenocarcinoma in a mammal by administering a compound of formula (I) to the mammal when the change is either or both of (i) the second determined level of FoxA1 expression is lower than the first determined level of FoxA1 expression, and (ii) the second determined level of FoxO6 expression is higher than the first determined level of FoxO6 expression.
[0208] (43) The method of any of embodiments (16)-(42), wherein about 0.1 to about 80 mg / kg of the compound of formula (I) is administered to the mammal.
[0209] (44) The method of any of embodiments (16)-(43), wherein the mammal is a human.
[0210] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope. [Example]
[0211] Example 1 This example describes how compounds of formula (I) were identified using PNC as a phenotypic marker and surrogate for metastatic behavior.
[0212] To screen for small molecules that effectively degrade PNC, the metastatic prostate cancer cell line PC3M was developed (see Pettaway, et al. "Selection of highly metastatic variants of different human prostatic carcinomas using orthotopic implantation in nude mice," Clin. Cancer Res., (2): 1627-36 (1996), incorporated herein in its entirety). PC3M is a protein that encodes the PNC (see Huang, et al. "The perinucleolar compartment and transcription," Journal of Cell Biology, (143): 35-47 (1998), the entire contents of which are incorporated herein by reference). The cells stably express GFP-PTB (polypyrimidine track-binding protein), an essential component of the perinucleolar cell line (Figure 1, top), resulting in a 75-85% PNC prevalence (Figure 1, top). Compounds that could reduce PNC prevalence by 50% were filtered in a secondary assay to remove compounds that induce apoptosis, DNA damage, general cytotoxicity, or cell cycle inhibition (see Norton et al., "Automated high-content screening for compounds that disassemble the perinuclear compartment," J Biomol Screen, (14): 1045-53 (2009) and Frankowski et al., "Discovery and Development of Small Molecules That Reduce PNC Prevalence," in Probe Reports from the NIH Molecular Libraries Program, Bethesda, MD. (2010), both of which are incorporated herein in their entireties). The remaining hits were evaluated for inhibition of invasion through a MATRIGEL gelatinous protein mixture and anchor-independent growth inhibition using a soft agar assay.
[0213] 24-well Transwell-permeable MATRIGEL gelatinous protein mixture invasion assay: The effect of metalrestin on the invasive activity of PANC1 and PC3M cells was measured using a 24-well Transwell-permeable MATRIGEL gelatinous protein mixture invasion chamber with 8 μm pores (Corning, Cat# 354480). The membranes were filled with serum-free DMEM (Thermo The cells were rehydrated in 500 μL of PBS (Fisher, Cat# 11965084) and incubated at 37°C, 5% CO for 2 hours. Cells were detached, washed, resuspended in serum-free DMEM, counted, and plated at 1 x 10 in six separate 15 mL conical tubes. 5 Final concentration of cells / mL As shown in Figure 3, decreasing concentrations of metalrestin or vehicle were added to each tube, and 500 μL of cells resuspended in medium containing metalrestin or vehicle were placed in triplicate in the upper chamber. 750 μL of DMEM + 10% FBS, which acts as a chemisorbent, was placed in the base well. The plate was incubated at 37°C and 5% CO2 for 24 hours. To count the number of invaded cells, the medium was removed from the upper insert, and non-invaded cells were wiped off from the upper side of the membrane on the insert using a cotton swab. Invaded cells on the lower side of the membrane on the insert were fixed and stained using a three-step DIFF QUIK Rapid Stain Set (Siemens), followed by three water washes and air drying. Cell invasion for each compound treatment was performed in triplicate. Representative photographs of each insert were taken.
[0214] Based on its potency as a PNC inhibitor, its potency as a soft agar growth inhibitor, its ability to block invasion, and its lack of cytotoxicity, a compound designated MLS000556915 was selected for further study.
[0215] Based on the screening results, additional pharmacological and chemical studies were then used to design metalrestin, a compound of formula (I) (structure below).
[0216] [ka]
[0217] Throughout the examples and figures, data are presented as mean values + / - SD. Student's t-tests were performed for all experiments except where indicated. Mean nucleolus area was analyzed using a 2-tailed Mann Whitney U test.
[0218] Example 2 This example demonstrates that metalrestin, a compound of formula (I), disrupts PNC in cancer cell types.
[0219] In summary, several cell types (see the list below in Table 1) were treated with 1 μM (IC100 for PC3M cells) of metalrestin for 24 hours. Specifically, PC-3M cells were maintained in RPMI 1640 medium. Other cell lines, including HeLa, Panc1, PACADD159, PACADD183, PA-TU-8988T, KP-3, PK-8, NOR-P1, L3.6sl, Colo357, Suit-2, and HPAC, were maintained in DMEM with 10% FBS (GEMINITM Bio Products) and 100 units / mL penicillin and streptomycin. Cells were generally plated for approximately 24 hours before treatment with 1 μM metalrestin for 5 or 24 hours.
[0220] [Table 1]
[0221] Surprisingly, we found that metalrestin reduced PNC prevalence in different human cancer cell lines (Figure 2). For example, in PC3M-GFP-PTB cells, metalrestin was not associated with acute cytotoxicity (Figure 1, bottom graph, circles), but rather with IC 50 At 0.39 μM (Figure 1, bottom graph, squares), metalrestin disrupted PNC. Furthermore, analysis of the MATRIGEL gelatinous protein mixture invasion assay showed that metalrestin effectively blocked the invasion of PC3M and PANC1 cells within 24 hours at a concentration (0.6 M) that did not affect PC3M and PANC1 cell proliferation after 24 hours (Figure 4 for PC3M cells, Figure 4 for PANC1 cells). When PC3M cells and normal human fibroblasts (GM02153) were treated with metalrestin at a concentration of 1 μM for extended periods using the INCUCYTE™ system, metalrestin preferentially inhibited cell proliferation of PC3M cancer cells (Figure 4).
[0222] Example 3 This example demonstrates that metalrestin, a compound of formula (I), inhibits metastasis and prolongs survival in a mouse model of human pancreatic cancer xenografts.
[0223] Because metastasis-related mortality is particularly high in pancreatic cancer patients, we evaluated the in vivo efficacy of metalrestin against metastasis in an orthotopic model of pancreatic cancer. null (NSG)PANC-1 mice (see Suemizu et al., “Identification of a key molecular regulator of liver metastasis in human pancreatic carcinoma using a quantitative novel model of metastasis in NOD / SCID / gammacnull (NOG) mice,” Int. J. Oncol., (31): 741-51 (2007), The 3D PANC1 cell sphere model, deployed in a pancreatic tumor (the entirety of which is incorporated herein), recapitulates human cancer progression and the metastatic phenotype of the disease without the limitations of early mortality due to complications of local invasion, such as gastric outlet obstruction and common bile duct impingement. Sixty thousand 3D luciferase-expressing PANC1-luc cell spheres were orthogonally injected into the pancreas of NSG mice. Histopathological examination revealed that measurable metastases, in the form of occasional periportal infiltration and micrometastatic deposits, had developed in the liver in the form of parenchymal infiltration approximately four weeks after implantation. By eight weeks, macrometastases were observed on the liver surface. The mouse lifespan was 10-14 weeks (see Figure 63).
[0224] To determine whether the preclinical model used retained the PNC characteristics previously observed in clinical specimens, we measured the prevalence of PNC in a panel of pancreatic cancer cell lines derived from primary tumors and metastatic lesions from various organs of NSG PANC1 mice. Results showed that PNCs were more abundant in human cancer lines of metastatic origin and metastatic lesions compared to those derived from primary tumors (Figure 5, cell line description, see Table 2 below). When examining cryopreserved tissue sections, PNCs were detected by immunolabeling with the monoclonal anti-human-specific PTB antibody SH54, which labels PNCs and allows for specific identification of human xenograft tissue over mouse tissue. PNC prevalence was higher in metastatic lesions than in primary tumors harvested 8 weeks after implantation (Figure 6).
[0225] [Table 2]
[0226] Example 4 The Examples show that the compound of formula (I), metalrestin, has a favorable PK profile and administration of metalrestin successfully suppresses metastasis-related death in mice treated with metalrestin.
[0227] This study (and subsequent studies) was randomized, unblinded, and conducted in accordance with the NIH Guide for The study was conducted in accordance with the Care and Use of Laboratory Animals. Animals were sacrificed at predetermined time points or when there were signs of distress (immobility or ≥15% weight loss). Animal data were excluded as outliers if they affected less than 10% of the initially enrolled mice, were unspecified dead, or were sacrificed before the predetermined endpoint.
[0228] BALB / c mice (17-19 g, n=66) were purchased and given free access to food and water. They were administered 5 or 25 mg / kg (10 ml / kg) of metalrestin in 5% NMP [NMP (Sigma-Aldrich cat#270458), 20% PEG400 (Sigma-Aldrich cat#202398), and 75% 10% HPBCD (Sigma-Aldrich cat#H107)] via left lower abdominal quadrant injection (n=33 for each dose). Animals were anesthetized with isoflurane and manually restrained at the indicated time points. Approximately 120 μL of blood was collected from the animals in K2EDTA tubes via retroorbital puncture. Blood samples were placed on ice and centrifuged (2000 g, 4°C, 5 min) to obtain plasma samples within 15 min. A 20 μL aliquot of the plasma sample was protein precipitated with 200 μL of acetonitrile containing 50 ng / mL IS (dexamethasone). The mixture was vortexed for 2 minutes and centrifuged at 14,000 rpm for 5 minutes. A 30 μL aliquot of the supernatant was diluted with 70 μL MeOH:HO (1:1, v / v) and vortexed for 2 minutes. A 2 μL aliquot of the supernatant was injected into a UPLC-MS / MS system. Sample analysis was performed using an LC-MS / MS-02 (API 4000) with a Waters-BEH-C18 (2.1 x 50 mm, 1.7 μm) column at a flow rate of 0.6 mL / min, with a mobile phase consisting of solvent A (HO-0.025% FA-1 mM NHOAc) and solvent B (MeOH-0.025% FA-1 mM NHOAc). A gradient of 10, 90, 90, and 10% B was performed at 0.30, 0.60, 1.20, 1.21, and 1.80 (stop) minutes. The retention times of metalrestin and dexamethasone were 1.09 and 1.08 minutes, respectively. A calibration curve was established using serially diluted concentrations of known metalrestin prior to analysis. SCID Beige mice were purchased and administered 5 and 25 mg / kg of metalrestin once daily at 24-hour intervals for 4 weeks as described above. Plasma metalrestin concentrations were analyzed 24 hours after the final administration.
[0229] PK studies in mice using single and multiple daily IP doses of 5 and 25 mg / kg of metalrestin (Figure 46) demonstrated good in vivo exposure, distribution, and tolerability with a half-life of 4.6-5.5 hours, predicting a moderate risk of accumulation (Figure 46, Tables 3 and 4). Metalrestin exhibited high bioavailability, and plasma concentrations were consistent with its PNC degradation IC in P3CM cells over time. 50 The IC 90 This was more than 10-fold the 0.75M (Figure 1) concentration, and was even higher in metastatic deposits of tumor-bearing NSG PANC1 animals 1 hour after cessation of 7-day administration of 10 mg / kg metalrestin by oral PO administration (see Table 5 below).
[0230] [Table 3]
[0231] [Table 4]
[0232] [Table 5]
[0233] Four weeks after inoculation, mice were treated once daily with IP injections of either metalrestin (5 mg / kg or 25 mg / kg) or vehicle for 6 weeks. At the end of week 10 after the initial inoculation, the cohort exposed to daily 25 mg / kg metalrestin showed reduced metastatic burden in both the liver (p<0.01) and lungs (p<0.05) compared to vehicle-treated controls, as measured by the Xenogen Photon Organ / Tumor Ratio (Figure 7) and standard histopathological examination (Figures 8 and 9, p<0.001). Primary tumor weight did not change significantly between cohorts (Figure 10). Treatment was well tolerated, and animals maintained their body weight (Figure 11). After chronic, uninterrupted feeding of autologous sibling KPC mice with 10 mg / kg of metalrestin supplemented diet (70 ppm) (see Table 6 below, "U" indicates undetermined) for 3 months or oral gavage of 25 mg / kg of metalrestin for 2 weeks, veterinary histopathological review of 12 organ systems and standard clinical chemistry failed to identify any histopathological or laboratory abnormalities in treated animals compared with control mice.
[0234] [Table 6-1]
[0235] [Table 6-2]
[0236] [Table 6-3]
[0237] To determine whether PNCs in treated animals were affected by metalrestin, we examined PNC prevalence in primary tumors and metastatic lesions from control and metalrestin-treated animals (25 mg / kg) 12 weeks after tumor inoculation. Results demonstrated a significant reduction in PNC prevalence in metastatic and primary tumor tissues (Figures 2, 12, and 33, p<0.01), suggesting that PNC suppression is associated with the antimetastatic activity of this compound. PNC prevalence in untreated animals was higher in these tumor and metastatic lesion groups than in tumors harvested at earlier time points (Figure 6) or in cultured PANC1 cells (Figure 2), consistent with previous findings that late-stage cancers have higher PNC prevalence.
[0238] To assess whether metalrestin treatment confers a survival advantage by preventing metastatic progression, we repeated the experiment described above, but followed mice until death or until the animals reached the study endpoint. NSG mice were injected with 60,000 3D PANC1 cells (details of the assay are described below). Six weeks after tumor cell implantation, when histopathological examination revealed limited metastasis to micrometastases, we initiated daily treatment with metalrestin-supplemented diet (10 mg / kg; 70 ppm, micronized particles added to NIH 31 Haslan rodent diet) (Figure 6C). Animals in the control group receiving normal diet began dying 25 days after the start of treatment, whereas no deaths were observed in the metalrestin-treated group for over 90 days after the start of treatment (Figure 6D).
[0239] To assess whether metalrestin administration affects the survival of mice with advanced metastases, NSG mice were injected with 60,000 3D PANC1 cells. After macrometastases were confirmed on the liver surface, the animals were placed on a diet supplemented with metalrestin (10 mg / mL). Mice were randomly assigned to receive either a 2000 mg / kg (70 ppm) or vehicle diet. Mice receiving the vehicle diet began to die within the first week of the treatment course (Fig. 14). Metarestin treatment more than doubled the median overall survival compared with the control group. Complete necropsy at the end of the study revealed a significantly greater burden of metastatic disease in the vehicle-treated group (p<0.05) (Figs. 15 and 16). Most animals in the control group showed near-to-complete organ replacement by tumor, particularly in the liver and, to a lesser extent, the lungs, whereas organs were spared in the metarestin-fed mice (Fig. 15). There was no significant difference in the growth of primary pancreatic tumors between treated and untreated animals (Fig. 16). These results suggest that metarestin-treated mice suppressed metastasis-related deaths and improved survival.
[0240] To determine whether the anti-metastatic activity of metalrestin (observed in NSG PANC1 mice and in vitro pancancer PNC suppression) translates to anti-metastatic activity in additional cancer models, we tested metalrestin in PC3M xenografted mice. Two weeks after subcutaneous implantation of PC3M cells, mice were treated with daily IP injections of 5 mg / kg or 25 mg / kg metalrestin or vehicle for an additional 4 weeks. Tumor progression was tracked by both in vivo imaging system (IVIS) spectroscopy and tumor volume. Lung metastasis was assessed ex vivo by IVIS spectroscopy and by histopathology at the end of the experiment. Metalrestin treatment at 25 mg / kg (P<0.05) reduced the incidence of lung metastases compared to vehicle-treated mice (Figure 17) and modestly reduced the growth of primary tumor xenografts (Figure 18). The weight and behavior of treated animals were not significantly different from control animals (Figure 19). To evaluate the effects of metalrestin on malignant xenografts, which are considered to be the closest to in vivo conditions, we used a patient-derived breast cancer xenograft model (PDX). Metastatic breast cancer cells collected from the pleural effusion of a patient with stage IV ductal breast cancer were inoculated into mice, and third-passaged tumors were cultured in the NOD.Cg-Prkdc mouse model. scidIl2rg tm1Sug The tumors were transplanted into the mammary fat pad of JicTac mice. The tumors were 150–200 mm 3 After reaching a tumor size of 1000 mg / kg, treatment with metalrestin was initiated. Metalrestin (25 mg / kg) or vehicle was administered by IP injection daily for 4 weeks on a 5-day on, 2-day off schedule. Tumor size and total body weight were measured twice weekly, and tumor weight was measured at the end of the experiment.
[0241] The results show that metalrestin effectively inhibited the growth of PDXs formed entirely from patient-derived metastatic cells without in vitro culture (Figure 20). Furthermore, this treatment was well tolerated, with no apparent effects on animal weight or behavior (Figure 4E).
[0242] Pancreatic cancer model: Nod / IL2gamma (null) mice were injected with 60,000 luciferase-labeled PANC1 spheres into their pancreases (obtained from the NCI Mouse Repository, Frederick, MD; under ACUC-approved animal protocol SB-211-2). Four weeks after inoculation, mice were treated with metalrestin (5 mg / kg or 25 mg / kg) or vehicle via IP injection once daily for an additional 6 weeks. Mice were injected with luciferin 5 minutes before being sacrificed by CO2 euthanasia. Organs were then individually dissected, subjected to quantitative xenogeneic imaging, and fixed in 4% unbuffered formaldehyde. The impact of metastatic burden was calculated and graphed as a liver-to-lung / primary tumor ratio based on 5-minute liver photon counts normalized to liver weight (g), and compared to the average photon count per gram of primary pancreatic tumor weight from the same animal. This calculation corrects for variations in luciferin injection, mouse heart rate, and perfusion. For eEF1A2 overexpression, 6 x 10^4 PANC1 3D mice transfected with eEF1A2 (eEF1A2 OE) were used. Spheres were injected into the tail of the pancreas of NSG mice. Mice from both groups were harvested and necropsied 6 weeks after transplantation. Liver metastases / mm 2 was calculated as the sum of the volumes of the individual metastases. Tumor volume (m m 3) was calculated as (L × W²) (L = length (mm) and W = width (mm)). Animal survival was measured from the first day of treatment until death. Animals in the control and metalrestin-treated cohorts were progressed under continuous treatment conditions until the predetermined study endpoints were reached (15% weight loss, recognizable signs of morbidity, general lack of reflexes, abnormal posture, loss of ambulatory ability, respiratory distress, inability to drink or feed). To prevent animal suffering, animals were euthanized according to local animal care guidelines. Only "warm" necropsy specimens (blood, primary tumor, liver, and lungs) were used for PK analysis. All applicable institutional guidelines for animal care and use were followed.
[0243] Breast Cancer Model: This model was derived from 0.2 liters of pleural effusion from a breast cancer patient (Model No. 373342). These cancer cells had metastasized from the initial tumor detected in the breast to the lung pleura. The pleural effusion was centrifuged at 5000 RPM for 10 minutes. The supernatant was removed, and the cells were inoculated into the mouse mammary fat pad along with a MATRIGEL gelatinous protein mixture. After the tumor reached 1 cm in size, a 2 x 2 mm fragment of the mammary fat pad was re-implanted into the mammary fat pad of another mouse. The tumor used in this experiment had undergone four passages. NOD.Cg-Prkdc scid Il2rg tm1Sug JicTac mice (Taconic) were used in the experiment. The animals were acclimated for 7 days before tumor inoculation. Tumors of 2 × 2 mm were inoculated into the mammary fat pad. Tumors were 150–200 mm. 3 The study began after the tumor size reached 100 mg / kg. A dose of 25 mg / kg of metalrestin in 5% NMP, 20% PEG400, and 10% 2-hydroxypropyl-β-cyclodextrin (HP-β-CD) (75% aqueous solution) was injected IP, 5 days a week for 4 weeks. Tumor size and total body weight were measured twice a week.
[0244] Prostate cancer model: Mice were implanted with 3 x 10 human PC-3M-luc-C6 pancreatic tumor cells (Caliper Life Sciences) in the flank and divided into four groups of 10 mice. Treatment with 5 or 25 mg / kg of drug or vehicle alone (negative control) began 2 weeks after implantation and continued until the experimental endpoint, 6 weeks after implantation. Primary tumor size (measured by caliper), viable tumor cell content (measured by biophotonic imaging), and total body weight were determined weekly. At the endpoint, animals were euthanized, metastatic organs were removed, and metastases were quantified by biophotonic imaging of the organs.
[0245] Example 5 This example demonstrates that metalrestin treatment disrupts nucleolar structure and inhibits Pol I transcription.
[0246] To investigate the mechanism by which metalrestin inhibits metastasis, we observed cellular changes after metalrestin treatment with primary antibodies: SH54 (anti-PTB antibody) at a dilution of 1:300; Nopp140 (anti-human Nopp140 rabbit polyclonal serum RS8) at a dilution of 1:300; UBF(F-9) (Santa Cruz Biotechnology) at a dilution of 1:50; RPA194 (Santa Cruz Biotechnology) at a dilution of 1:100; CUG-BP1(3B1) (Santa Cruz Biotechnology) at a dilution of 1:10; fibrillarin (Sigma Cat#: ANA-N) at a dilution of 1:1000; SC35 at a dilution of 1:1000; paxillin (ab32084) at a dilution of 1:300; and vinculin (Sigma V9131) at a dilution of 1:600. Fluorescein-conjugated secondary antibodies (Jackson ImmunoResearch) and ALEXA FLUOR antibody (Thermofisher Scientific) were used at a dilution of 1:200. Samples were visualized on a Nikon ECLIPSE Ti-E inverted fluorescence microscope using NIS-Elements AR 3.2 software (Nikon).
[0247] At a concentration of 1 μM, metalrestin induced nuclear disintegration from the three typically integrated substructures (arrows in Figure 47): the filamentous core (FC), the dense filamentous core (DFC), and the granular core (GC), resulting in the separation of the filaments from the granular core within the nucleus, as observed by electron microscopy (EM) (Figures 21A-21C, lower panel). The nucleolar disruption was reversible within 48 hours upon cessation of metalrestin treatment (Figure 47). Similar disruption was observed in other treated cell lines, such as PANC1 and PC3M cells (Figure 48), primary tumors, and liver metastases in a PANC1 xenograft model (Figure 21, right panel). Quantitative evaluation of EM images showed that nucleolar volume was significantly reduced (p<0.0001) in treated cell lines and cancer tissues (Figure 22 and Figures 49A-49C), but was unchanged in treated normal mouse hepatocytes (Figures 49A-49C). The separation of nucleolar compartments observed by EM appears to correspond to the nucleolar capping structures detected by immunofluorescence of nucleolar proteins (Figures 21A-21C, Figure 23, Figure 50). The association between nucleolar separation and PNC loss was confirmed across several cell lines by immunolabeling with antibodies against the nucleolar Pol I transcription initiation factor, UBF (upstream binding transcription factor) (Figures 23 and 50), or the Pol I polymerase, RPA194 (Figure 51). Factors involved in ribosome maturation, such as fibrillarin and NOPP140 (Figures 51 and 52), were similarly reorganized. On the other hand, when normal human fibroblast GM02153 cell line was treated with the same concentration of metalrestin, the UBF distribution did not change (FIG. 53).
[0248] To examine whether disruption of nucleolar structure affects ribosome synthesis, we used a cell line expressing inducible GFP-RPL29 (ribosomal subunit). GFP-RPL29 induced by the addition of tetracycline (Figure 24) showed a similar subcellular distribution to endogenous ribosomal subunits, localizing to the nucleolus and cytoplasm as ribosomes assembled and translocated to the cytoplasm (Figure 24). After 5 hours of exposure to metalrestin (which degraded PNC and altered nucleolar structure), GFP-RPL29 expression was induced. Despite the alteration of nucleolar structure, GFP-RPL29 production (Figures 55 and 62) and its nucleolar localization remained unchanged (Figure 24, right panel). However, newly synthesized GFP-RPL29 was barely detectable in the cytoplasm of treated cells (Figure 24, right panel; Figure 54, bottom panel). This indicates that newly synthesized ribosomal proteins are not incorporated into ribosomal particles and exported to the cytoplasm, which is one of the phenotypes of ribosome synthesis defects. These results demonstrate that metalrestin induces disruption of the nucleolar ultrastructure while altering the intracellular distribution of ribosomal subunits in vitro and in vivo, suggesting that the mechanism of action of this compound involves regulation of ribosome synthesis.
[0249] Example 6 This example demonstrates that metalrestin treatment reduces pre-RNA synthesis and Pol I occupancy at the rDNA promoter.
[0250] To determine which step in ribosome biogenesis is disrupted by metalrestin, we assessed rDNA transcription using a BrU incorporation assay, an in situ run-on assay that detects the localization pattern of newly synthesized RNA. Cells were washed once with glycerol buffer (20 mM Tris-HCl pH 7.4, 5 mM MgCl2, 25% glycerol, 0.5 mM PMSF, 0.5 mM EGTA) and subjected to the BrU incorporation assay protocol. Cells were co-immunolabeled with C23 (Santa Cruz Biotechnology) at a 1:100 dilution and anti-BrdU (Sigma) at a 1:50 dilution, which recognizes BrU.
[0251] Incubation of semipermeabilized cells with a transcription cocktail containing BrU (Figure 25) for 5 min resulted in disruption of nucleolar structure, as exemplified by the change in the organization of newly synthesized rRNA (reflecting transcription sites) into tight, small clusters and the dispersion of C23 / nucleolin, a protein involved in many aspects of nucleolar function, from the nucleolus (Figure 25). To assess the effect on rDNA transcription in metalrestin-treated cells, we quantified the amount of 5'ETS RNA. The amount of 5'ETS correlates with the amount of rDNA transcript, as the 5'ETS in nascent pre-rRNA transcripts is rapidly removed. Quantitative RT-PCR of 5'ETS in metalrestin-treated and DMSO-treated control cells showed a significant decrease in 5'ETS RNA in metalrestin-treated cells (Figure 26).
[0252] ChIP-qPCR: 2-5 x 10 cells were used for each ChIP assay according to the previously described protocol. Briefly, HeLa cells, with or without metalrestin treatment, were crosslinked with 1% formaldehyde for 10 minutes at room temperature with rotation, and then crosslinking was stopped by the addition of glycine. Fixed chromatin was sonicated in a Covaris and used for immunoprecipitation with the indicated antibodies. Isolated DNA was analyzed by qPCR using SYBR Green on a CFX Connect Real-Time PCR Detection System (BioRad). The comparative cycle threshold method was applied to assess occupancy from replicate PCR reactions relative to input levels. The primer sets used were: rDNA promoter (F: 5'-GCT GCG ATG GTG GCG TTT TTG GGG (SEQ ID NO: 1) and R: 5'-ATA TAA CCC GGC GGC CCA AAA TTG CC) (SEQ ID NO: 2), 5'ETS (F: 5'-CGTGCCTGAGGTTTCTCC (SEQ ID NO: 3) and R: 5'-CCACCAACGGACGTGAAG (SEQ ID NO: 4)), 5.8S (F: 5'- GCA GGA CAC ATT GAT CAT CGA CAC (SEQ ID NO: 5) and R: 5'- GCG CGG CGG CAA GAG GAG (SEQ ID NO: 6)), 28S (F: 5' GGAGGAAAAGAAACTAACCAGGAT (SEQ ID NO: 7) and R: 5' GCCTCGATCAGAAGGACTTG (SEQ ID NO: 8)), and U12 (F: 5'GATCTGCCCGACCTTATTCA (SEQ ID NO: 9) and 5'AAACGCATTCACCACCTACC (SEQ ID NO: 10)).
[0253] RT-PCR: Total RNA was isolated from cells using TRIZOL Reagent (Invitrogen) according to the manufacturer's instructions. cDNA was synthesized using Random Hexamer (IDT DNA Technologies) or M-MLV Reverse Transcriptase (Invitrogen 28025-013) with gene-specific primers. DNA was amplified by PCR using gene-specific primers. 5'ETS-F: CCTCCAGTGGTTGTCGACTT (SEQ ID NO: 11); 5'ETS-R: GAACGACACACCACCGTTC (SEQ ID NO: 12); eEF1A1-F: AACATTGTCGTCATTGGACA (SEQ ID NO: 13; eEF1A1-R: TTGATCTTTCCCTTTCTGGT (SEQ ID NO: 14); eEF1A2-F: 5'CCATGTGTGTGGAGAGCTTCTC (SEQ ID NO: 15); eEF1A2-R: 5'TCTCCACGTTCTTGATGACGCC (SEQ ID NO: 16; GAPDH-F: 5'ACCACAGTCCATGCCATCAC (SEQ ID NO: 17); GAPDH-R: 5'TCCACCACCCTGTTGCTGTA (SEQ ID NO: 18). PCR products were separated on 1-2% agarose gels. Real-time PCR was performed using an ABI PRISM 7900HT instrument and Power PCR was performed at the Northwestern University Core Facility using SYBR Green PCR Master Mix (Life Technologies Cat# 4367659).
[0254] To investigate the mechanism by which metalrestin disrupts Pol I transcription, we assessed the overall state of the transcription machinery and rDNA chromatin structure in treated cells.
[0255] Western blotting was performed according to the manufacturer's protocol (Li-COR). Transfer membranes were from Millipore (cat. no. IPFL00010). The primary antibody used was phospho-γH2AX (Upstate 07-164, rabbit, 1:1000); p53 (Santa Cruz Biotechnology sc-6243 rabbit, 1:500); UBF(F-9) (Santa Cruz Biotechnology, mouse, 1:500); RPA194 ( Santa Cruz Biotechnology, sc-48385, mouse, 1:500); p53BP1 (Novus, NB100-304, rabbit, 1:10,000); EF1a (Millipore 05-235, mouse, 1:1000), HA-tag (C29F4, Cell Signaling, rabbit, 1:1000), and actin (Sigma A5060, rabbit, 1:3000; A4700, mouse, 1:1000) as a loading control. The sections were visualized using LI-COR IRDy secondary antibodies (1:10,000), goat anti-mouse 680RD (926-68070), goat anti-mouse 800CW (926-32210), goat anti-rabbit 680RD (926-68071), and goat anti-rabbit 800CW (926-32211). Protein bands were detected using the LI-COR Odyssey Image Studio (LI-COR Biosciences).
[0256] Western blot analysis showed that 24-hour treatment with metalrestin at a concentration of 1 μM did not significantly alter the abundance of the Pol I large subunits RPA194 and UBF in three cell lines: PANC1, PC3M, and HeLa (Figure 27). To investigate whether changes in the chromatin state of rDNA clusters were involved in the rRNA reduction, we performed psoralen crosslinking experiments to determine the ratio of active / inactive rDNA chromatin in metalrestin-treated and DMSO-treated cells. Psoralen crosslinks active, accessible DNA under UV light without displacing nucleosomes or transcription factors or altering the chromatin state. Psoralen-crosslinked DNA migrated slowly on agarose gels and could be distinguished from non-crosslinked DNA by Southern blot analysis. The results suggested that rDNA chromatin was not significantly altered, and the ratio of active / inactive rDNA chromatin was nearly identical in treated and untreated cells (Figure 28). To investigate the interaction between Pol I transcription factors and rDNA, quantitative ChIP experiments were performed using primer sets spanning the promoter and coding regions of rDNA (Figures 29-30E). Metalrestin treatment significantly reduced RPA194 occupancy on the promoter and coding regions of rDNA without significantly affecting UBF binding (Figures 30A-30E, p<0.01). As a control, ICE1, a component of the small elongation complex, did not show significant association with rDNA sequences or altered association with the target gene U12 transcribed by Pol II. These observations suggest that metalrestin regulates the transcription of Pol II. This indicates that it disrupts the I-rDNA interaction.
[0257] Genotoxic agents that intercalate or alkylate DNA, such as actinomycin D, induce nucleolar segregation similar to that observed with metalrestin treatment. To determine whether metalrestin induces nucleolar changes through genotoxic effects or general cytotoxicity, we evaluated the effects of metalrestin on DNA damage repair, cell cycle, and general Pol II transcription status in three cell lines: PANC1, PC3M, and HeLa. Cells were treated with 1 μM metalrestin or DMSO for 24 h before fixation for flow cytometry, immunolabeling, or Western blot analysis. Evaluation of DNA damage response signature factors in treated cells (Figure 56) demonstrated that neither phosphorylated γH2AX or p53BP1, nor phosphorylated p53 (HeLa and PC3M have little p53) was altered in these cell lines upon metalrestin treatment (Figures 57A-57C). Cell cycle analysis of DNA content by flow cytometry showed no significant changes in cell cycle patterns after metalrestin treatment at two different concentrations within 24 hours (Figure 58). Assessment of the apoptotic index showed that less than 1% of cells underwent apoptosis in response to metalrestin treatment.
[0258] To further determine whether metalrestin interferes with Pol II transcription in general, we immunolabeled CUGBP, a multifunctional hnRNP protein abundant in PNCs. The steady-state nuclear distribution of CUGBP was found to depend on Pol II transcription. Selective inhibition of Pol II by α-amanitin induces a cytoplasmic localization shift of CUGBP, except for CUGBP localized in the PNC (Figure 59, upper right panel). If metalrestin treatment significantly affected Pol II transcription, we expected that the cytoplasmic redistribution of CUGBP would predominate, as shown in α-amanitin-treated cells, but this was not the case (Figure 59, upper center panel). Furthermore, SC35, an essential pre-mRNA splicing factor, normally exhibits a speckle-like distribution pattern in the nucleus (Figure 59, lower left panel), but this changed to isolated large dots in α-amanitin-treated cells (Figure 59, lower right panel). In contrast, the SC35 pattern did not change significantly in metalrestin-treated cells (Figure 59, lower center panel). Together with the observation that metalrestin treatment (Fig. 24) does not affect the induction of GFP-RPL29 expression (Fig. 54) and its nucleolar localization (Fig. 24, Fig. 54), these findings suggest that metalrestin inhibits Pol II transcription within its effective concentration range. These results suggest that it does not globally inhibit transcription, general protein synthesis, or nucleocytoplasmic trafficking, but has selective effects on Pol I transcription and ribosome synthesis.
[0259] Example 7 This example demonstrates that reduction of RPA194 partially phenocopies the destruction of nucleoli and PNC by metalrestin.
[0260] RNA interference: Cells were transfected with 75 nM Pol I1 Stealth siRNA (Invitrogen Cat#: 10620318) or Stealth Negative Control siRNA (Invitrogen Cat#: 12935-300) using Lipofectamine RNAiMAX Transfection Reagent (Thermofisher Scientific) according to the manufacturer's instructions. Experiments were performed 72 hours post-transfection. For eEF1A2 knockdown, cells were transfected with 50 nM eEF1A2 DsiRNA (IDT Duplex pool HSC.RNAI.N001958.12 / HSC.RNAI.N001958.12.2) or DS-scrambled negative control siRNA (IDT) for 3 days using Lipofectamine RNAiMAX as described above. The pcDNA3.1-HA-eEF1A2 plasmid was transfected with Lipofectamine 2000 after 1 day of DsiRNA RNAi. Cells were then fixed and subjected to immunofluorescence labeling.
[0261] Next, we determined whether metalrestin disrupts Pol I function and disrupts nucleoli, thereby disassembling PNCs. RPA194, the large subunit of Pol I, was knocked down by specific siRNAs, as evidenced by a reduction in protein 72 hours after transfection with siRNA oligos in the cell lines PANC1, HeLa, and PC3M (Figure 31). The reduction of RPA194 was sufficient to inhibit ribosome synthesis at the single-cell level, as shown in HeLa cells expressing inducible GFP-RPL29, where knockdown of RPA194 rendered cytoplasmic GFP-RPL29 nearly undetectable (Figure 32, right panel). The reduction of RPA194 reduced the prevalence of PNCs (Figure 33), although not to the same extent as in metalrestin-treated cells (Figure 2). In addition, some PNCs showed structural changes (Figure 33), becoming crescent-shaped around distorted nucleoli in RPA194-depleted cells (Figure 34, top panel, arrows), similar to cells treated with metalrestin at concentrations that did not completely eliminate PNCs (Figure 1, top, middle panel). siRNA against RPA194 also disrupted nucleolar structure into capping structures, as indicated by labeling of residual RPA194 with anti-RPA194 (Figure 34, top, second panel, white arrow). The changes in PNCs and nucleoli in RPA194-silenced cells were similar to those observed with metalrestin treatment. These data indicate that downregulating Pol I activity partially reproduces the disruption of nucleolar and PNC structure induced by metalrestin treatment, supporting the idea that metalrestin disrupts the PNC, at least in part, through inhibition of Pol I function.
[0262] Example 8 This example demonstrates that metalrestin binds the translation elongation factor eEFIA.
[0263] To identify the molecular targets of metalrestin and upstream factors involved in ribosome and Pol I function, we identified proteins that bind metalrestin by affinity purification using biotin-conjugated metalrestin (see Figure 65 for structure and synthesis), where its efficacy against PNC degradation in cultured cells was maintained (Figure 60). Competition studies using untagged metalrestin and proteomic analysis identified eukaryotic translation elongation factor 1A (eEF1A) as a metalrestin-binding protein (Figure 35). eEF1A has two isoforms, eEF1A1 and eEF1A2. eEF1A1 is ubiquitously expressed in all tissues, whereas eEF1A2 is expressed only in the brain, heart, and skeletal muscle. eEF1A has two isoforms, eEF1A1 and eEF1A2. While eEF1A1 is ubiquitously expressed in all tissues, eEF1A2 is expressed only in the brain, heart, and skeletal muscle. However, its overexpression or re-expression, including stage-specific expression, has been documented in many cancers, including pancreatic cancer. The binding of metalrestin to eEF1A was further confirmed in cells using a cell thermal shift assay (CETSA), which showed that the aggregation temperature of eEF1A increased upon metalrestin treatment (Figure 36). However, binding did not significantly alter the amount of protein, and Western blot analysis showed that the total amount of eEF1A protein remained unchanged even after 24 hours of treatment with 1 μM metalrestin (Figure 37).
[0264] eEF1A is a multifunctional protein involved in translation elongation, actin bundling, nuclear transport, tRNA export, and other processes. To assess whether eEF1A mediates the effects of metalrestin on cancer cells, we overexpressed eEF1A or reduced it by siRNA silencing. While overexpression of HA-eEF1A1 or HA-eEF1A2 did not significantly increase total PNC prevalence (Figure 38), overexpression of HA-eEF1A2 rather than HA-eEF1A1 increased the scatter pattern (number of PNCs per cell) of existing PNCs in PNC-containing cells (Figure 38). Thus, eEF1A2 enhances PNC structure, but is not sufficient alone to induce significant PNC formation in PNC-negative cells. To assess the functional link between metalrestin-induced PNC degradation and eEF1A2 phenotypes, we analyzed PNC degradation in wild-type and eEF1A2-overexpressing cancer cells. Cells with and without eEF1A2-HA overexpression (48 hours after transfection at approximately 70% efficiency, Figures 61 and 64) were treated with 10 concentrations of metalrestin, and PNC prevalence was assessed at a 63-fold magnification. As a result, increased eEF1A2 expression significantly reduced the inhibitory concentration of metalrestin on PNC degradation (IC50). 50 ) was found to be increased (Figure 39). To assess whether eEF1A2 truly regulates the metastatic phenotype, PANC1 cells with (PANC1 eEF1A2 OE) or without (PANC1 control) overexpression of eEF1A2 were orthotopically injected into NSG mice. Six weeks after transplantation, organs were subjected to histopathological evaluation. NSG PANC1 eEF1A2 OE mice exhibited significantly increased metastatic disease burden compared to PANC1 control animals (Figures 40A-40B, P<0.05), suggesting that metalrestin is involved in targeting that governs the metastatic phenotype.
[0265] To determine whether the reduction of eEF1A2 reflects the effects of metalrestin on PNC and nucleolar structure, we reduced the expression of eEF1A2 using siRNA oligos. Seventy-two hours after transfection, qRT-PCR demonstrated a selective reduction in eEF1A2 (Figures 41 and 42). To assess whether eEF1A2 reduction affected Pol I transcription, we compared 5'ETS RNA expression in cells with and without eEF1A2 knockdown, which revealed a significant reduction in rDNA transcription (Figure 43, P < 0.01). Correspondingly, immunofluorescence detection of nucleoli with anti-fibrillarin antibody and PNC with SH54 demonstrated that eEF1A2 reduction, while less effective than metalrestin (nearly 100% PNC disassembly and nucleolar distortion at 1 μM, Figures 1 and 23), disrupted nucleolar structure (nucleolar separation) and PNC structure (loss or elongated crescent shape, arrows in Figures 44 and 45A-45B), similar to metalrestin-treated cells (Figure 1) or Pol I knockdown cells (Figure 34). The disruption could be partially rescued by overexpression of HA-eEF1A2 (Figure 45, gray bars). Taken together, these findings support the idea that eEF1A2 is involved in the metastatic progression of pancreatic cancer, and that disruption of its expression significantly phenocopied the structural changes in the nucleolus and PNC and the inhibition of Pol I induced by metalrestin, supporting the idea that eEF1A2 mediates, at least in part, the changes in the nucleolus and PNC induced by metalrestin treatment.
[0266] The above examples demonstrate through in vitro assays and in vivo xenograft models that metalrestin effectively inhibits PNC, cancer cell proliferation, cell invasion, tumor growth and metastasis in pancreatic cancer models.
[0267] All references cited in this specification, including publications, patent applications, and patents, are incorporated by reference to the same extent as if each reference were individually indicated to be incorporated by reference, and are incorporated by reference in their entirety as if each reference were individually indicated to be incorporated by reference.
[0268] The use of the terms "a," "an," "the," and similar reference words in the context of describing the present invention (particularly in the context of the claims below) is to be construed to cover both the singular and the plural unless otherwise stated herein or clearly contradicted by context. The terms "comprise," "have," "include," and "comprises" are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise stated. The recitation of ranges of values set forth herein is merely intended to serve as a shorthand method for individually referencing each separate value falling within the range, unless otherwise stated, and each separate value is incorporated herein as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise stated herein or clearly contradicted by context. The use of any and all exemplary or exemplary language (e.g., "such as") provided herein is intended merely to better describe the invention and does not pose a limitation on the scope of the invention unless otherwise asserted. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0269] Preferred embodiments of the present invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect that skilled artisans will adopt such variations as appropriate, and the inventors intend to practice the invention otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, this invention includes all possible combinations of the elements described above in any possible variations unless otherwise indicated herein or clearly contradicted by context.
Claims
1. A pharmaceutical formulation for treating cancer, comprising: (a) Formula (I): 【Chemical 1】 (wherein R 1 is 【Chemistry 2】 is selected from the group consisting of R 2 is phenyl; R 3 is phenyl, and R 4 is benzyl; or a pharmaceutically acceptable salt thereof; (b) a pharmaceutically acceptable surfactant comprising one or more caprylocaproyl polyoxylglycerides and PEG-8 caprylic / capric glycerides; and (c) caprylic acid; wherein one or more of caprylocaproyl polyoxylglycerides and PEG-8 caprylic / capric glycerides are present in an amount of 0.1 to 1.0 wt %, and caprylic acid is present in an amount of 0.1 to 1.0 wt %.
2. The pharmaceutical formulation of claim 1, wherein the compound of formula (I) is metalrestin.
3. A pharmaceutical formulation as described in claim 1 or 2 for the treatment of human pancreatic adenocarcinoma.
4. The pharmaceutical formulation of any one of claims 1 to 3, wherein administration of the formulation to a human results in one or more of (I)-(V): (I) disrupting the perinuclear compartment in human cells; (II) reducing the prevalence of perinuclear compartments in human cells; (III) reducing the level of adenosine triphosphate (ATP) produced by human metastatic cancer cells; (IV) reducing colony formation of human cancer cells; and (V) Reducing the migration of human cancer cells.
5. A pharmaceutical formulation described in any one of claims 1 to 4, wherein the human has pancreatic adenocarcinoma at a stage selected from the group consisting of stage I pancreatic adenocarcinoma, stage II pancreatic adenocarcinoma, stage III pancreatic adenocarcinoma, and stage IV pancreatic adenocarcinoma.
6. A pharmaceutical preparation described in any one of claims 1 to 4, wherein the human has metastatic pancreatic adenocarcinoma.
7. A pharmaceutical formulation according to any one of claims 1 to 6, wherein administration of a compound of formula (I) to a human reduces or delays further metastasis of established metastatic lesions.
8. A pharmaceutical preparation according to any one of claims 1 to 7, wherein the human is a human from whom one or more pancreatic adenocarcinomas have been surgically removed.
9. The pharmaceutical preparation of any one of claims 1 to 8, wherein administration of a compound of formula (I) to a human reduces the amount and size of metastatic foci.
10. A pharmaceutical formulation according to any one of claims 1 to 9, wherein administration of a compound of formula (I) to a human reduces or slows the growth of metastatic foci.
11. The pharmaceutical formulation of any one of claims 1 to 10, wherein 0.1 to 80 mg / kg of the compound of formula (I) is administered to a human.
12. A pharmaceutical combination for treating pancreatic adenocarcinoma in humans, the pharmaceutical comprising a combination of (i) a pharmaceutical formulation according to any one of claims 1 to 11 and (ii) a chemotherapeutic agent or radiation treatment.
13. The combination pharmaceutical of claim 12, which comprises a chemotherapeutic agent.
14. The combination drug of claim 13, wherein the chemotherapeutic agent is gemcitabine.
15. The pharmaceutical combination of any one of claims 12 to 14, wherein the chemotherapeutic agent is administered sequentially in any order with the compound of formula (I).
16. The pharmaceutical combination of any one of claims 12 to 14, wherein a chemotherapeutic agent is administered simultaneously with the compound of formula (I).
Citation Information
Patent Citations
Pharmaceutical compositions of paclitaxel, paclitaxel analogues, or paclitaxel conjugates, as well as related preparation methods and methods of use.
JP2011516587A
Compounds and methods for the prevention and treatment of tumor metastasis and tumor formation.
JP2015502367A
Pharmaceutical compositions and dosage forms for administration of hydrophobic drugs
US20100136105A1
Compositions and methods for the preparation of nanoemulsions
WO2009121069A2
Oral taxane compositions and methods
WO2017054754A1