Novel microorganism belonging to the genus Lactobacillus, and control agent and method for plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum

Abstract

Provided are: a bacterium which has 16S rRNA gene having a nucleotide sequence having a 98.80% or more identity to the nucleotide sequence represented by SEQ ID NO: 1, is capable of utilizing mannitol, and has a capability of controlling a plant disease; a bacterium having an accession number of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201 or NITE BP-03202; and an agent for controlling a plant disease caused by Ralstonia solanacearum or Ralstonia pseudosolanacearum, the agent comprising cells of the bacterium, a culture of the bacterium, or an extract of the cells or the culture.

Description

[Technical Field]

[0001] The present invention relates to a novel microorganism belonging to the genus Lactobacillus, and to a control agent and method for plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum. [Background technology]

[0002] Ralstonia solanacearum and Ralstonia pseudosolanacearum infect over 200 species of plants, causing bacterial wilt in Solanaceae plants such as tomatoes, eggplants, peppers, and potatoes, Cucurbitaceae plants such as cucumbers, and flowering plants such as statice and lisianthus, and damping-off in tobacco. Plant diseases caused by Ralstonia solanacearum and Ralstonia pseudosolanacearum occur on a global scale, causing significant economic losses.

[0003] As a method for controlling plant diseases, for example, Japanese Patent Application Laid-Open Publication No. 2009-201459 (Patent Document 1) discloses a method for controlling soft rot caused by Erwinia cultovora using a composition containing Lactobacillus kyotoensis FERM P-21500 or Lactobacillus plantarum FERM P-21501. J Gen Plant Pathol 70:115-119 (2004) (Non-Patent Document 1) discloses that infection of tomatoes with Ralstonia solanacearum is suppressed by grafting with resistant tomatoes. Japanese Patent Application Laid-Open Publication No. 2012-211124 (Patent Document 2) discloses a method for controlling bacterial wilt disease by having target plants such as tomatoes absorb L-amino acids. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Japanese Patent Application Laid-Open No. 2009-201459 [Patent Document 2] Japanese Patent Application Laid-Open No. 2012-211124 [Non-patent literature]

[0005] [Non-Patent Document 1] J Gen Plant Pathol 70:115-119 (2004) Summary of the Invention [Problem to be solved by the invention]

[0006] Previous attempts to control plant diseases caused by Ralstonia solanacearum and Ralstonia pseudosolanacearum have involved the use of chemical fumigants, fungicides, resistant varieties, or resistance inducers. However, chemical fumigation has been restricted in use due to its limited range of effectiveness, toxicity to humans, and environmental impact. While validamycin can be used to treat bacterial wilt in potato, no fungicides have been reported that can be used to treat bacterial wilt in other plants. When resistant varieties are used, problems arise: poor taste and productivity, and control efficacy is poor when rootstocks are used. When resistance inducers are used, there are problems with the lack of direct fungicidal action against the pathogen, and their effectiveness depends on the crop variety.

[0007] An object of the present invention is to provide a novel control agent and method for plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum. [Means for solving the problem]

[0008] The present invention relates to the following [1] to

[14] . [1] A bacterium having a 16S rRNA gene containing a base sequence having 98.80% or more identity to the base sequence set forth in SEQ ID NO: 1, having the ability to utilize mannitol, and having the ability to control plant diseases. [2] A bacterium having a 16S rRNA gene containing a base sequence having 99.90% or more identity to the base sequence set forth in SEQ ID NO: 1, and having the ability to control plant diseases. [3] A bacterium according to [1] or [2], having a 16S rRNA gene containing the nucleotide sequence set forth in SEQ ID NO: 1. [4] Bacteria with accession numbers NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202. [5] A bacterial cell or a bacterial cell culture, or an extract thereof, of the bacterium according to any one of [1] to [4]. [6] A control agent for plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising the bacterial cells or bacterial cell culture of the bacterium according to any one of [1] to [4], or an extract thereof. [7] A method for controlling plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising the step of applying the control agent according to [6]. [8] A disinfectant for plants, nutrient solution, soil, hydroponic culture materials or soil-based cultivation materials contaminated with Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising the bacterial cells or bacterial cell culture or an extract thereof of the bacteria described in any one of [1] to [4]. [9] A method for disinfecting plants, nutrient solution, soil, hydroponic culture materials or soil culture materials contaminated with Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising a step of using the disinfectant described in [8].

[10] A growth inhibitor for Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising a bacterial cell or a bacterial cell culture of the bacterium according to any one of [1] to [4], or an extract thereof.

[11] A method for inhibiting the growth of Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising a step of using the growth inhibitor according to

[10] .

[12] A method for cultivating a plant, comprising the step of cultivating a plant in a nutrient solution or soil containing the bacterial cells or a bacterial cell culture of the bacterium according to any one of [1] to [4], or an extract thereof.

[13] A control agent for plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising a bacterium belonging to Lactobacillus plantarum, a bacterium culture, or an extract thereof.

[14] A method for controlling plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising the step of applying the control agent according to

[13] . [Effects of the Invention]

[0009] According to the present invention, it is possible to control plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacearum. [Brief explanation of the drawings]

[0010] [Figure 1] FIG. 1 shows (A) colony morphology and (B) Gram staining results of NITE BP-03197 in Experiment 2. [Figure 2] FIG. 1 shows (A) colony morphology and (B) Gram staining results of NITE BP-03198 in Experiment 3. [Figure 3] FIG. 1 shows (A) colony morphology and (B) Gram staining results of NITE BP-03199 in Experiment 4. [Figure 4] FIG. 1 shows (A) colony morphology and (B) Gram staining results of NITE BP-03200 in Experiment 5. [Figure 5] FIG. 1 shows (A) colony morphology and (B) Gram staining results of NITE BP-03201 in Experiment 6. [Figure 6] FIG. 1 shows (A) colony morphology and (B) Gram staining results of NITE BP-03202 in Experiment 7. [Figure 7] FIG. 10 is a diagram illustrating the antibacterial activity evaluation test in Experiment 8. [Figure 8] These are the results of the antibacterial activity evaluation test of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 in Experiment 8. [Figure 9] FIG. 10 is a diagram illustrating the antibacterial activity evaluation test in Experiment 9. [Figure 10] These are the results of the antibacterial activity evaluation test of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 in Experiment 9. [Figure 11] These are the results of the antibacterial activity evaluation test of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 in Experiment 10. [Figure 12] FIG. 1 is a diagram illustrating the antibacterial activity evaluation test in Experiment 11. [Figure 13] These are the results of the antibacterial activity evaluation test of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 in Experiment 11. [Figure 14] 1 is a graph showing the control effect of the culture supernatant of NITE BP-03201 on bacterial wilt disease in Experiment 13. [Figure 15] 1 is a graph showing the control effect of the culture supernatant of NITE BP-03199 or NITE BP-03200 on bacterial wilt disease in Experiment 13. DETAILED DESCRIPTION OF THE INVENTION

[0011] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The following describes in detail the embodiments of the present invention, but the present invention is not limited to the following embodiments.

[0012] [Microorganisms belonging to the genus Lactobacillus] Bacterium a according to one embodiment of the present invention has a 16S rRNA gene containing a base sequence having 98.80% or more identity to the base sequence set forth in SEQ ID NO: 1, has the ability to assimilate mannitol, and has the ability to control plant diseases.

[0013] Bacterium a preferably has a 16S rRNA gene comprising a nucleotide sequence that has 99.00% or more, 99.20% or more, 99.50% or more, 99.80% or more, or 99.90% or more identity to the nucleotide sequence set forth in SEQ ID NO: 1. Bacterium a may have a 16S rRNA gene comprising a nucleotide sequence set forth in SEQ ID NO: 1. Examples of bacteria having a 16S rRNA gene comprising a nucleotide sequence that has 98.80% or more identity to the nucleotide sequence set forth in SEQ ID NO: 1 include bacteria (lactic acid bacteria) belonging to the genus Lactobacillus.

[0014] Bacterium a may have a 16S rRNA gene containing a nucleotide sequence in which one or several bases have been substituted, deleted, or added compared to the nucleotide sequence set forth in SEQ ID NO: 1. The one or several bases may be, for example, 1 to 18 bases, preferably 1 to 10 bases, and more preferably 1 to 5 bases.

[0015] Bacterium a may have a 16S rRNA gene containing a nucleotide sequence that hybridizes under stringent conditions to a continuous sequence of about 15 or more nucleotides, preferably about 18 to about 500 nucleotides, more preferably about 18 to about 200 nucleotides, and even more preferably about 18 to about 50 nucleotides, contained in the nucleotide sequence set forth in SEQ ID NO: 1, or to its complementary sequence. Stringent conditions refer to conditions under which nonspecific hybrids are not formed, and include, for example, conditions in which the strain is washed one or more times at 60°C, 1×SSC, 0.1% SDS, preferably at 68°C, 0.1×SSC, 0.1% SDS.

[0016] In this specification, analysis of the nucleotide sequence of the 16S rRNA gene can be performed, for example, by the following method. First, genomic DNA is extracted from the target microorganism using a known method, and the 16S rRNA gene is amplified. The method for amplifying the 16S rRNA gene is not particularly limited, and examples include PCR using universal primers commonly used by those skilled in the art. The amplified product obtained by PCR can be purified as necessary and subjected to a DNA sequencer or the like to determine the nucleotide sequence. The obtained nucleotide sequence is compared with the sequence set forth in SEQ ID NO: 1.

[0017] In this specification, the 16S rRNA gene is preferably an endogenous 16S rRNA gene that bacteria naturally possess, but may also be an artificially mutated 16S rRNA gene. The mutation in the 16S rRNA gene is a mutation that does not result in the loss of expression and function of 16S rRNA.

[0018] Bacterium a has the ability to assimilate mannitol. The ability to assimilate mannitol can be determined based on a sugar assimilation test that is commonly performed in microbial identification tests. For example, a target microorganism is cultured in a medium containing mannitol under an anaerobic environment, and if fermentation occurs, the microorganism can be determined to have the ability to assimilate mannitol. A commercially available kit, such as API50CHB (bioMerieux, France), can be used for the sugar assimilation test.

[0019] Bacterium a has the ability to control plant diseases, including preventing infection of plants by pathogenic microorganisms, preventing plant diseases, preventing the spread of plant diseases, and killing, decomposing, and inhibiting the growth of disease-causing microorganisms.

[0020] In this specification, the plant disease is, for example, a plant disease caused by Ralstonia solanacealum or Ralstonia pseudosolanacealum. Plants infected with Ralstonia solanacealum or Ralstonia pseudosolanacealum develop bacterial wilt or damping-off disease and die.

[0021] Whether a target microorganism has the ability to control plant diseases can be verified, for example, by culturing a disease-causing microorganism in the presence of the target microorganism or by culturing a disease-causing microorganism in the presence of a bacterial cell culture of the target microorganism. If the disease-causing microorganism is killed or its growth is inhibited under the above conditions, it can be determined that the target microorganism has the ability to control plant diseases. If a plant is cultivated in the presence of a pathogen of a plant disease and the target microorganism inhibits infection of the plant by the disease-causing microorganism or inhibits the onset of the disease, it can also be determined that the target microorganism has the ability to control plant diseases.

[0022] Bacterium b according to one embodiment of the present invention has a 16S rRNA gene comprising a base sequence that is 99.90% or more identical to the base sequence set forth in SEQ ID NO: 1, and has the ability to control plant diseases. Bacterium b may have a 16S rRNA gene comprising the base sequence set forth in SEQ ID NO: 1. Examples of bacteria having a 16S rRNA gene comprising a base sequence that is 99.90% or more identical to the base sequence set forth in SEQ ID NO: 1 include bacteria (lactic acid bacteria) belonging to the genus Lactobacillus.

[0023] Bacterium b may have a 16S rRNA gene containing a nucleotide sequence in which one nucleotide has been deleted or added compared to the nucleotide sequence set forth in SEQ ID NO:1.

[0024] Bacterium b may have a 16S rRNA gene containing a nucleotide sequence that hybridizes under stringent conditions to a continuous sequence of about 15 or more nucleotides, preferably about 18 to about 500 nucleotides, more preferably about 18 to about 200 nucleotides, and even more preferably about 18 to about 50 nucleotides, contained in the nucleotide sequence set forth in SEQ ID NO: 1, or to its complementary sequence. Stringent conditions refer to conditions under which nonspecific hybrids are not formed, and include, for example, conditions in which the strain is washed one or more times at 60°C, 1×SSC, 0.1% SDS, preferably at 68°C, 0.1×SSC, 0.1% SDS.

[0025] Bacterium b has the ability to control plant diseases. The plant diseases are, for example, plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum. The ability to control plant diseases can be evaluated by the method described above.

[0026] Representative examples of bacteria a and b include Lactobacillus sp. SC-2001. Lactobacillus sp. SC-2001 is a newly isolated strain of the genus Lactobacillus closely related to Lactobacillus mali. Lactobacillus sp. SC-2001 has been internationally deposited under the Budapest Treaty with the National Institute of Technology and Evaluation (NPMD), Patent Microorganisms Depositary Center (NPMD), 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818, Japan, under accession number NITE BP-03197 (original deposit date: April 9, 2020). The bacteriological properties of this strain are shown in Tables 1, 2, and 1, described below.

[0027] Lactobacillus lactic acid bacteria, including bacteria a and bacteria b, are found in the natural environment and are therefore considered to be highly safe for use as food and feed. Bacteria a and bacteria b may be isolated bacteria. Bacteria a and bacteria b may be the same bacteria.

[0028] Bacterium c according to one embodiment of the present invention may be any of the bacteria internationally deposited under the Budapest Treaty at the National Institute of Technology and Evaluation, Patent Microorganisms Depositary (NPMD, address: Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818) under accession number NITE BP-03198 (original deposit date: April 9, 2020), accession number NITE BP-03199 (original deposit date: April 9, 2020), accession number NITE BP-03200 (original deposit date: April 9, 2020), accession number NITE BP-03201 (original deposit date: April 9, 2020), and accession number NITE BP-03202 (original deposit date: April 9, 2020). Bacteria c all belong to the genus Lactobacillus plantarum. The bacteriological properties of the strains are shown in Tables 3 to 12 and Figures 2 to 6, which will be described later.

[0029] Bacterium c has the ability to control plant diseases. The plant diseases are, for example, plant diseases caused by Ralstonia solanacealum or Ralstonia pseudosolanacealum. The ability to control plant diseases can be evaluated by the method described above. Furthermore, Lactobacillus plantarum, to which bacterium c belongs, is thought to have the ability to control plant diseases caused by Ralstonia solanacealum or Ralstonia pseudosolanacealum.

[0030] Lactobacillus lactic acid bacteria, including bacterium c, are present in the natural environment and are therefore considered to be highly safe for use as food and feed. Bacterium c may be an isolated bacterium.

[0031] [Bacterial cells or cell cultures, or extracts thereof] The bacterial cells according to one embodiment of the present invention are cells of any of bacteria a, b, and c. The bacterial cells may be isolated from the environment or may be cultured. The bacterial cells may be killed or live. The bacterial cells may be present in a culture solution, a buffer solution, or the like, or may be concentrated to remove the liquid, or a freeze-dried product thereof. The bacterial cells of bacteria a, b, and c each have the ability to control plant diseases.

[0032] A bacterial cell culture according to one embodiment of the present invention is a cell culture of any one of bacteria a, b, and c. The cell culture contains bacterial secretions, metabolites, etc., including peptides, proteins, sugars, enzymes, organic acids produced by the bacteria, and media (liquid media and solid media) containing these. The cell culture may also be a supernatant obtained by culturing the bacteria. The culture supernatant can be obtained by removing the bacteria from the liquid medium in which the bacteria have been cultured, for example, by centrifugation, filtration, or the like. The cell cultures of bacteria a, b, and c each have the ability to control plant diseases.

[0033] Bacteria a, b, and c can be cultured according to the usual culture method for bacteria belonging to the genus Lactobacillus. A typical method includes culturing them at a temperature of 30°C using MRS (de Man, Rogosa, and Sharpe) liquid medium or MRS agar medium.

[0034] An extract according to one embodiment of the present invention is an extract of bacterial cells or a bacterial cell culture of any of Bacteria a, Bacteria b, and Bacteria c. The extract is prepared so as not to lose the plant disease control ability of the bacterial cells or bacterial cell culture. The extract can be obtained, for example, by subjecting the bacterial cells or bacterial cell culture to treatments such as ultrasonic disruption, bead milling, freeze-thawing, or chemical lysis. The extract may also be obtained by subjecting the bacterial cells or bacterial cell culture to salting out, ultrafiltration, ion exchange chromatography, or liquid-phase extraction using an organic solvent. These treatments can be used in combination as appropriate. The extract may contain bacterial cell fragments, nucleic acids, peptides, proteins, and enzymes.

[0035] [Control agent and control method for plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum] Herein, bacterial cells or cell cultures, or extracts thereof, are also referred to as "cell preparations." The cell preparation may be any one or more of the group consisting of bacterial cells, cell cultures, and extracts thereof. A control agent according to one embodiment of the present invention contains a cell preparation of any one of bacteria a to c. A control agent according to one embodiment of the present invention contains a cell preparation of a bacterium belonging to Lactobacillus plantarum (hereinafter also referred to as "bacterium d"). The control agent may contain two or more cell preparations selected from the group consisting of bacteria a to d. The control agent according to the present invention has the ability to control plant diseases caused by Ralstonia solanacealum or Ralstonia pseudosolanacealum. The control ability can be evaluated by the method described above.

[0036] The form of the control agent may be the solid, liquid, or gaseous form that ordinary pesticides can take, and is not particularly limited to, for example, dust, DL (Drift less) dust, granules, tablets, wettable powder, water dispersible granules, dry flowable, emulsifiable concentrate, liquid, oil, microcapsule, flowable, emulsion, microemulsion, AL (applicable liquid) agent, fumigation agent, etc., and can be prepared into any dosage form and used according to the purpose.

[0037] When formulated, the control agent may contain a carrier, anti-aggregating agent, anti-decomposition agent, extender, dispersant, binder, disintegrant, and surfactant. Examples of solid carriers that can be used include diatomaceous earth, vermiculite, clay, talc, bentonite, perlite, white carbon, rice husks, bone meal, and calcium carbonate. Examples of liquid carriers include water, alcohols, ketones (e.g., acetone, methyl ethyl ketone, cyclohexanone), aromatic hydrocarbons (e.g., benzene, toluene, xylene, ethylbenzene, methylnaphthalene), aliphatic hydrocarbons (e.g., n-hexane, kerosene), esters, nitriles, ethers, amides, and halogenated hydrocarbons. Examples of gaseous carriers include LPG, air, nitrogen, carbon dioxide, and dimethyl ether.

[0038] As the surfactant or dispersant, alkyl sulfates, alkyl (aryl) sulfonates, polyoxyalkylene alkyl (aryl) ethers, polyhydric alcohol esters, lignin sulfonates, etc. can be used.

[0039] The control agent may contain microorganisms other than bacteria a to d, chemical control substances, etc., as long as the control agent does not lose its ability to control plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacearum.

[0040] The control agent of the present invention has a low environmental impact and is less toxic to humans. It is believed that the control agent of the present invention has a direct antibacterial effect on plant disease-causing microorganisms, regardless of the variety of agricultural crop. The control agent of the present invention enables stable agricultural production.

[0041] One embodiment of the present invention is the use of a preparation of at least one kind of bacterial cell selected from the group consisting of bacteria a to d in the production of an agent for controlling plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacearum.

[0042] A control method according to one embodiment of the present invention comprises applying the above-described control agent. According to the control method according to the present invention, plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum can be controlled.

[0043] An example of a step of applying a control agent is a step of applying a liquid control agent to a plant. The step of applying a liquid control agent to a plant includes a step of applying the control agent to seeds, such as by spraying or immersing the seeds in the control agent. The step of applying a liquid control agent to a plant also includes a step of immersing seedlings before planting or the roots of plants grown from seedlings in the control agent, a step of spraying the control agent on roots, leaves, stems, etc.

[0044] Another example of the step of applying a control agent is a step of applying a liquid control agent to a nutrient solution or soil. The step of applying a liquid control agent to a nutrient solution includes a step of adding the control agent to the nutrient solution or diluting the control agent with the nutrient solution. The step of applying a liquid control agent to soil includes a step of spraying, sprinkling, or irrigating the control agent onto the soil. The application of the control agent to the soil may be carried out before planting the plants or before sowing the seeds, or after planting or sowing.

[0045] Another example of the step of applying a control agent is a step of applying a powdered or granular control agent to a plant. The step of applying a powdered or granular control agent to a plant includes a step of applying the powdered or granular control agent to seeds, such as a step of attaching the powdered or granular control agent to the surface of seeds, or a step of mixing the powdered or granular control agent with seeds and sowing the mixture.

[0046] Another example of the step of applying a control agent is a step of applying a powdered or granular control agent to a nutrient solution or soil. The step of applying a powdered or granular control agent to a nutrient solution includes a step of spraying or dispersing the control agent in the nutrient solution. The step of applying a powdered or granular control agent to soil includes a step of mixing the powdered or granular control agent into the soil, a step of spraying the powdered or granular control agent on the soil, etc.

[0047] Solid or liquid control agents may be applied by suspending or diluting them in water or a nutrient solution. When the control agent is applied to a nutrient solution, the control agent preferably contains at least one fungal cell and / or fungal cell culture selected from the group consisting of bacteria a to d. When the control agent is applied to soil, the control agent preferably contains at least one fungal cell and / or fungal cell culture selected from the group consisting of bacteria a to d, and more preferably contains at least one live bacterium selected from the group consisting of bacteria a to d. The control agent may be applied multiple times, or multiple steps described above may be combined.

[0048] The step of applying the control agent may be carried out under conditions that do not result in a loss of control ability, and may be carried out, for example, under conditions of a temperature of 20 to 40° C. or 25 to 30° C. The pH may be 3.0 to 8.0 or 4.0 to 6.0.

[0049] The total concentration of bacteria a to d in the control agent is not particularly limited, and is 1 × 10 3 ~1×10 12 cfu (colony forming units) / g, or 1 x 10 4 ~1×10 12 cfu / g, or 1 x 10 5 ~1×10 12 The control agent may be, for example, a solution prepared by culturing at least one species selected from the group consisting of bacteria a to d in water to the above concentration, and the solution may be mixed in an amount of 0.01 to 100 mL per 50 g of soil. The control agent may be, for example, a solution prepared by culturing at least one species selected from the group consisting of bacteria a to d in water to the above concentration, and the solution may be mixed in an amount of 0.01 to 100 mL per 50 g of soil. The control agent may be, for example, a solution prepared by culturing at least one species selected from the group consisting of bacteria a to d in a ratio of 1 / 10,000 to 1 / 10 of the nutrient solution. The control agent may be applied in an amount appropriate for the weather conditions, formulation, application time, application method, application location, target plants, etc.

[0050] As used herein, plants refer to plants that are affected by diseases caused by Ralstonia solanaceae or Ralstonia pseudosolananaceae. Examples of such plants include agricultural and horticultural plants, specifically Solanaceae, Cucurbitaceae, Cruciferae, Zingiberaceae, Rosaceae, Asteraceae, Leguminosae, Musaceae, Lamiaceae, Myrtaceae, Pesamiaceae, Mulberry, Trifoliaceae, Euphorbiaceae, Plumaginaceae, and Gentianaceae. Examples of Solanaceae plants include tomatoes, eggplants, bell peppers, shishito peppers, chili peppers, paprika, potatoes, and tobacco. Examples of Cucurbitaceae plants include cucumbers, pumpkins, bitter melons, watermelons, melons, and zucchinis. Examples of Brassicaceae plants include radish, turnip, rapeseed, bok choy, komatsuna, cauliflower, broccoli, and kale. Examples of Zingiberaceae plants include ginger and mioga. Examples of Rosaceae plants include strawberries. Examples of Asteraceae plants include garland chrysanthemum and lettuce. Examples of Leguminosae plants include peanuts, kidney beans, broad beans, peas, and soybeans. Examples of Musaceae plants include bananas and bananas. Examples of Lamiaceae plants include perilla and basil. Examples of Myrtaceae plants include cloves. Examples of Pedaliaceae plants include sesame. Examples of Moraceae plants include mulberry. Examples of Paralichthyaceae plants include strelitzia. Examples of Euphorbiaceae plants include cassava. Examples of Plumaginaceae plants include statice. Examples of Gentianaceae plants include lisianthus. As specific examples of plant species, mainly agricultural plants have been mentioned, but the plants may also be floricultural plants.

[0051] One embodiment of the present invention is use of the control agent for controlling plant diseases caused by Ralstonia solanacealum or Ralstonia pseudosolanacealum. One embodiment of the present invention is use of a preparation of at least one fungal cell selected from the group consisting of bacteria a to d for controlling plant diseases caused by Ralstonia solanacealum or Ralstonia pseudosolanacealum.

[0052] [Disinfectant and disinfection method for plants, nutrient solution, soil, hydroponic culture materials, or soil culture materials contaminated with Ralstonia solanacearum or Ralstonia pseudosolanacearum] A disinfectant according to one embodiment of the present invention contains a bacterial cell preparation of any one of bacteria a to c. A disinfectant according to one embodiment of the present invention contains a bacterial cell preparation of bacteria d. The disinfectant may contain two or more bacterial cell preparations selected from the group consisting of bacteria a to d. The disinfectant according to the present invention can disinfect plants, nutrient solutions, soil, hydroponics materials, or soil cultivation materials contaminated with Ralstonia solanacealum or Ralstonia pseudosolanacealum. When plants are cultivated using the disinfected plants, nutrient solutions, soil, hydroponics materials, or soil cultivation materials, the occurrence of plant diseases caused by Ralstonia solanacealum or Ralstonia pseudosolanacealum can be suppressed. The disinfectant according to the present invention also has an effect as a fungicide against Ralstonia solanacealum or Ralstonia pseudosolanacealum.

[0053] The effectiveness of a disinfectant can be evaluated by culturing Ralstonia solanacealum or Ralstonia pseudosolanacealum in the presence of the disinfectant of the present invention and verifying whether Ralstonia solanacealum or Ralstonia pseudosolanacealum is killed, decomposed, or growth is inhibited.

[0054] The disinfectant may be the same as the control agent described above. The disinfectant may also contain substances used to disinfect other pathogenic microorganisms.

[0055] Plants include seeds, seedlings, roots, tubers, bulbs, rhizomes, and stems and leaves (including flowers). From the viewpoint of preventing infection by pathogenic bacteria, disinfection of plant seedlings, roots, etc. is particularly useful.

[0056] Hydroponics is a cultivation method that uses liquid fertilizer (nutrient solution) to provide the nutrients and moisture necessary for plant growth without using soil. Typical examples of hydroponics include hydroponics, in which roots are grown in a nutrient solution; solid medium cultivation, in which crops are planted in a solid medium instead of soil; and spray cultivation, in which a nutrient solution is sprayed on the roots. The nutrient solution contains nitrogen (N), phosphate (P2O5), potassium (K2O), etc. Hydroponics materials used in hydroponics include cultivation beds, cultivation sheets, planting panels, seedling pots, solid medium (rock wool, etc.), nutrient solution tanks, nutrient solution tubes, irrigation tubes, and small farm tools (pruning shears, thermometers, hygrometers, etc.).

[0057] Soil cultivation is a cultivation method that uses soil. Soil includes seedbed media, seedling media, sand, pumice, field soil, etc. Soil cultivation materials include planters, seedling pots, cultivation sheets, cultivation containers, sprayers, irrigation tubes, small farm tools (pruning shears, thermometers, hygrometers, etc.), etc.

[0058] One embodiment of the present invention is the use of a preparation of at least one bacterial cell selected from the group consisting of bacteria a to d in the production of a disinfectant or bactericide for plants, nutrient solutions, soil, hydroponic culture materials, or soil-based cultivation materials contaminated with Ralstonia solanacealum or Ralstonia pseudosolanacealum.

[0059] A disinfection method according to one embodiment of the present invention includes a step of using the disinfectant described above, and can disinfect plants, nutrient solutions, soil, hydroponic culture materials, and soil culture materials contaminated with Ralstonia solanacealum or Ralstonia pseudosolanacealum.

[0060] The disinfectant may be applied to plants, nutrient solutions, soil, hydroponics materials, or soil-based growing materials that are or may be contaminated with Ralstonia solanacealum or Ralstonia pseudosolanacealum. In methods for disinfecting soil, nutrient solutions, or plants, the step of using the disinfectant may be carried out in the same manner as the step of applying the control agent described above. In methods for disinfecting hydroponics materials or soil-based growing materials, the step of using the disinfectant may include, for example, spraying, dusting, or immersing the hydroponics materials or soil-based growing materials with a liquid disinfectant or a diluted or suspended disinfectant. The step of using the disinfectant may be carried out simultaneously with known methods for disinfecting plants, nutrient solutions, soil, hydroponics materials, or soil-based growing materials, such as soil fumigation.

[0061] The total concentration of bacteria a to d in the disinfectant is not particularly limited, and is 1 × 10 3 ~1×10 12 cfu / g, or 1 x 10 4 ~1×10 12 cfu / g, or 1 x 10 5 ~1×10 12 The concentration of the bacterial culture or extract in the disinfectant is not particularly limited and may be 0.1 to 100,000 ppm, 1 to 100,000 ppm, or 10 to 100,000 ppm. The disinfectant may be used in an amount appropriate for weather conditions, formulation, time of use, method of use, place of use, target plants, etc.

[0062] One embodiment of the present invention is use of the disinfectant described above for disinfecting or sterilizing plants, nutrient solutions, soil, hydroponic culture materials, or soil-based growing materials contaminated with Ralstonia solanacealum or Ralstonia pseudosolanacealum. One embodiment of the present invention is use of a preparation of at least one bacterial cell selected from the group consisting of bacteria a to d for disinfecting or sterilizing plants, nutrient solutions, soil, hydroponic culture materials, or soil-based growing materials contaminated with Ralstonia solanacealum or Ralstonia pseudosolanacealum.

[0063] [Growth inhibitor and growth inhibitor method for Ralstonia solanacearum or Ralstonia pseudosolanacealum] A growth inhibitor according to one embodiment of the present invention contains a bacterial cell preparation of any one of bacteria a to c. A growth inhibitor according to one embodiment of the present invention contains a bacterial cell preparation of bacteria d. The growth inhibitor may contain two or more bacterial cell preparations selected from the group consisting of bacteria a to d. The growth inhibitor according to the present invention is capable of inhibiting the growth of Ralstonia solanacealum or Ralstonia pseudosolanacealum. Inhibition of the growth of Ralstonia solanacealum or Ralstonia pseudosolanacealum suppresses the occurrence of plant diseases caused by these bacteria.

[0064] The growth inhibitor can be the same as the control agent described above. The growth inhibitor may contain a substance that inhibits the growth of other pathogenic microorganisms.

[0065] The effect of a growth inhibitor can be evaluated by culturing Ralstonia solanacealum or Ralstonia pseudosolanacealum in the presence of the growth inhibitor and verifying whether the growth of Ralstonia solanacealum or Ralstonia pseudosolanacealum is inhibited.

[0066] One embodiment of the present invention is the use of a preparation of at least one kind of bacteria selected from the group consisting of bacteria a to d in the production of a growth inhibitor for Ralstonia solanacearum or Ralstonia pseudosolanacearum.

[0067] A method for inhibiting growth according to one embodiment of the present invention includes the step of using the growth inhibitor described above. The growth inhibitor according to the present invention can inhibit the growth of Ralstonia solanacealum or Ralstonia pseudosolanacealum, and can suppress the occurrence of plant diseases caused by Ralstonia solanacealum or Ralstonia pseudosolanacealum.

[0068] The step of using the growth inhibitor is not particularly limited, and the growth inhibitor may be used so that it comes into contact with or is close to Ralstonia solanacearum or Ralstonia pseudosolanacealum. The growth inhibitor may be used in the same manner as the above-mentioned control agent.

[0069] The total concentration of bacteria a to d in the growth inhibitor is not particularly limited, and is 1 × 10 3 ~1×10 12 cfu / g, or 1 x 10 4 ~1×10 12 cfu / g, or 1 x 10 5 ~1×10 12 The concentration of the bacterial cell culture or extract in the growth inhibitor is not particularly limited, and may be 0.1 to 100,000 ppm, 1 to 100,000 ppm, or 10 to 100,000 ppm.

[0070] One embodiment of the present invention is use of the growth inhibitor described above for inhibiting the growth of Ralstonia solanacealum or Ralstonia pseudosolanacealum. Another embodiment of the present invention is use of a preparation of at least one kind of bacteria selected from the group consisting of bacteria a to d for inhibiting the growth of Ralstonia solanacealum or Ralstonia pseudosolanacealum.

[0071] [How to grow plants] A method for cultivating a plant according to one embodiment of the present invention comprises cultivating a plant in a nutrient solution or soil containing a bacterial cell preparation of at least one bacterium selected from the group consisting of bacteria A to C. According to the method for cultivating a plant according to the present invention, plant diseases caused by Ralstonia solanacealum or Ralstonia pseudosolanacealum can be suppressed.

[0072] The method for adding a bacterial cell preparation of at least one bacterium selected from the group consisting of bacteria a to c to a nutrient solution or soil is not particularly limited, and can be the same as the method for applying the control agent described above.A bacterial cell preparation of at least one bacterium selected from the group consisting of bacteria a to c can be added to a nutrient solution or soil as the control agent described above.

[0073] The plant cultivation method is hydroponics or soil cultivation. Examples of the plant cultivation method include the steps of preparing a nutrient solution or soil, sowing seeds, irradiating with light, thinning, and growing plants. A nutrient solution or soil containing a bacterial cell preparation of at least one bacterium selected from the group consisting of bacteria a to c may be used in at least some of these steps, or may be used in all steps.

[0074] One embodiment of the present invention is use of the control agent in a method for cultivating a plant in a nutrient solution or soil. One embodiment of the present invention is use of a bacterial cell preparation of at least one type selected from the group consisting of bacteria a to d in a method for cultivating a plant in a nutrient solution or soil. [Example]

[0075] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0076] [Experiment 1: Isolation of new microorganisms] The isolation source (Quercus serrata) was ground with sterilized water. The ground liquid was diluted appropriately and added to 1 / 2 MRS liquid medium for enrichment culture. The enrichment culture was smeared on MRS agar medium containing calcium carbonate, and microorganisms that formed halos were isolated. Hereafter, this isolate will be referred to as isolate A. When the culture liquid of isolate A was suspended in hydrogen peroxide, no bubbles were generated. Isolate A was confirmed to be a lactic acid bacterium because it did not have catalase activity.

[0077] [Experiment 2: Identification of isolate A] Isolate A was identified by 16S rRNA gene analysis, morphological observation, and physiological and biochemical tests.

[0078] (1) 16S rRNA gene analysis Genomic DNA was extracted from isolate A, and the resulting genomic DNA was used as a template for PCR amplification of the 16S rRNA gene using the forward cloning primer 9F and the reverse cloning primer 1510R (Yasuyoshi Nakagawa et al., Genetic Analysis Method: 16S rRNA Gene Sequencing Method, Japanese Society of Actinomycetes, Classification and Identification of Actinomycetes, pp. 88-117, Japan Society Administration Center, 2001). PCR amplification was performed using Tks Gflex DNA polymerase (Takara Bio), and the amplified product was purified.

[0079] The purified PCR amplification product was used for cycle sequencing. Cycle sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit. The resulting reaction mixture was purified, and the purified solution was subjected to DNA sequence analysis (3130xl DNA Analyzer) to determine the nucleotide sequence of the 16S rRNA gene of template DNA extracted from isolate A (SEQ ID NO: 1). The primers used for sequence analysis were 9F, 515F, 1099F, 536R, 926R, and 1510R (Yasuyoshi Nakagawa et al., "Gene Analysis Method: 16S rRNA Gene Sequencing Method," in Japanese Society for Actinomycete Classification and Identification, pp. 88-117, Japan Society for Actinomycete Management Center, 2001).

[0080] A BLAST homology search was performed on the 16S rRNA gene sequence of isolate A using the microbial identification system "ENKI" (Techno Suruga Lab.) against the microbial identification database DB-BA15.0 (Techno Suruga Lab.) and the international nucleotide sequence database (DDBJ / ENA (EMBL) / GenBank). The sequence showed 99.87% identity to the 16S rRNA gene sequence of Lactobacillus mali (NBRC 102159), 98.72% identity to the 16S rRNA gene sequence of Lactobacillus cacaonum (LMG24285), and 97.58% identity to the 16S rRNA gene sequence of Lactobacillus aquatius (IMCC1736). However, no microorganisms possessing 16S rRNA genes completely matched the sequence of isolate A.

[0081] (2) Morphological observation and physiological and biochemical property tests Isolate A was plated on MRS agar medium and cultured aerobically at 30°C for 48 hours. Cell morphology, Gram staining, motility, and colony morphology were observed using the following methods. Physiological and biochemical responses of the bacteria were examined using an API50CHB kit (bioMerieux, France).

[0082] Colonies were observed using a stereomicroscope (Nikon) SMZ800N, morphological observations using a light microscope (Olympus) BX50F4, and tests for catalase reaction, oxidase reaction, acid / gas production from glucose, and glucose oxidation / fermentation (O / F) were performed according to the method described in Barrow & Feltham (Cowan and Steel's Manual for the Identification of Medical Bacteria, 3rd ed. Cambridge: Cambridge University Press; 1993). Gram staining was performed using Faber G "Nissui" (Nissui Pharmaceutical). As shown in Figure 1(A), isolate A formed circular colonies. As shown in Figure 1(B), isolate A was Gram-stain positive. The results of physiological and biochemical characterization and fermentation tests for isolate A are shown in Tables 1 and 2. Isolate A is a motile, Gram-positive rod-shaped bacterium that ferments glucose and showed negative catalase and oxidase reactions. These properties were consistent with those of the genus Lactobacillus, which was assigned by 16S rDNA partial base sequence analysis. Fermentation tests using the API CHL50 kit showed that isolate A fermented fructose, mannose, mannitol, and salicin, but did not ferment galactose or lactose. It also grew at 15°C and did not exhibit arginine dihydrolase activity. These properties were nearly identical to those of L. mali, which was suggested to be closely related based on partial 16S rDNA sequence analysis, except for the fact that it ferments mannitol (Hammes WP and Hertel C. Lactobacillus. In: Whitman WB, Rainey F, Kampfer P, Trujillo M, Chun J et al. (editors). Bergey's Manual of Systematics of Archaea and Bacteria. Chichester: John Wiley & Sons; 2015. doi:10.1002 / 9781118960608.gbm00604).As described above, isolate A belongs to the genus Lactobacillus and is most closely related to L. mali among known species. However, the results of 16S rDNA sequence analysis and physiological and biochemical property tests suggest that isolate A is somewhat different from L. mali, indicating that it is a new isolate closely related to L. mali. Isolate A was named Lactobacillus sp. SC-2001 and deposited internationally under NITE BP-03197.

[0083] [Table 1]

[0084] [Table 2]

[0085] [Experiment 3: Isolation and identification of isolate B] Isolate B was isolated using the same method as in Experiment 1, except that salted squid was used as the isolation source. Isolate B was identified using the same method as in Experiment 2.

[0086] The nucleotide sequence of the 16S rRNA gene of isolate B showed 99.87% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus pentosus (JCM1558), 99.87% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus plantarum subsp. plantarum (JCM1149), and 99.73% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus paraplantarum (DSM10667). However, there was no microorganism with a 16S rRNA gene that completely matched the nucleotide sequence of the 16S rRNA gene of isolate B.

[0087] As shown in Figure 2(A), isolate B formed circular colonies. As shown in Figure 2(B), isolate B was Gram-stain positive. The physiological and biochemical properties and fermentation test results for isolate B are shown in Tables 3 and 4. Isolate B is a non-motile, Gram-positive bacillus, does not form spores, exhibits negative catalase and oxidase reactions, and ferments glucose. These properties are consistent with those of the genus Lactobacillus, which was identified as a possible Lactobacillus species by partial 16S rDNA sequence analysis. Fermentation tests performed using an API kit revealed that isolate B fermented galactose, fructose, and melezitose, but not glycerol or D-xylose. Furthermore, it did not exhibit arginine dihydrolase activity and grew at 15°C. These properties were consistent with those of L. plantarum, which was suggested to belong to L. pentosus and L. plantarum by 16S rDNA partial sequence analysis, but differed from L. pentosus in that it did not exhibit glycerol or D-xylose fermentation. Therefore, isolate B was determined to be a new isolate belonging to Lactobacillus plantarum. Isolate B was deposited internationally under the accession number NITE BP-03198.

[0088] [Table 3]

[0089] [Table 4]

[0090] [Experiment 4: Isolation and identification of isolate C] Isolate C was isolated using the same method as in Experiment 1, except that Waxgrass was used as the source. Isolate C was identified using the same method as in Experiment 2.

[0091] The nucleotide sequence of the 16S rRNA gene of isolate C showed 100.0% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus pentosus (JCM1558), 100.0% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus plantarum subsp. plantarum (JCM1149), and 99.80% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus paraplantarum (DSM10667).

[0092] As shown in Figure 3(A), isolate C formed circular colonies. As shown in Figure 3(B), isolate C was Gram-stain positive. The physiological and biochemical properties and fermentation test results for isolate C are shown in Tables 5 and 6. Isolate C is a non-motile, Gram-positive bacillus, does not form spores, exhibits negative catalase and oxidase reactions, and ferments glucose. These properties are consistent with those of the genus Lactobacillus, which was identified as a possible Lactobacillus species by partial 16S rDNA sequence analysis. Fermentation tests performed using an API kit revealed that isolate C fermented galactose, fructose, α-methyl-D-mannoside, and melezitose, but not glycerol or D-xylose. Furthermore, it did not exhibit arginine dihydrolase activity and grew at 15°C. These properties were consistent with those of L. plantarum, which was suggested to belong to L. pentosus and L. plantarum by 16S rDNA partial sequence analysis, but differed from L. pentosus in that it did not exhibit glycerol or D-xylose fermentation. Therefore, isolate C was determined to be a new isolate belonging to Lactobacillus plantarum. Isolate C was deposited internationally under the accession number NITE BP-03199.

[0093] [Table 5]

[0094] [Table 6]

[0095] [Experiment 5: Isolation and identification of isolate D] Isolate D was isolated using the same method as in Experiment 1, except that Pandanus orbicularis was used as the isolation source. Isolate D was identified using the same method as in Experiment 2.

[0096] The nucleotide sequence of the 16S rRNA gene of isolate D showed 99.87% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus pentosus (JCM1558), 99.87% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus plantarum subsp. plantarum (JCM1149), and 99.66% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus paraplantarum (DSM10667). However, there was no microorganism with a 16S rRNA gene that completely matched the nucleotide sequence of the 16S rRNA gene of isolate D.

[0097] As shown in Figure 4(A), isolate D formed circular colonies. As shown in Figure 4(B), isolate D was Gram-stain positive. The physiological and biochemical properties and fermentation test results for isolate D are shown in Tables 7 and 8. Isolate D is a non-motile, Gram-positive bacillus, does not form spores, exhibits negative catalase and oxidase reactions, and ferments glucose. These properties are consistent with those of the genus Lactobacillus, which was identified as a possible Lactobacillus species by partial 16S rDNA sequence analysis. Fermentation tests performed using an API kit revealed that isolate D fermented galactose, fructose, α-methyl-D-mannoside, and melezitose, but not glycerol or D-xylose. Furthermore, it did not exhibit arginine dihydrolase activity and grew at 15°C. These properties were consistent with those of L. plantarum, which was shown to be closely related to L. pentosus and L. plantarum as a result of 16S rDNA partial sequence analysis, but differed from L. pentosus in that it did not exhibit glycerol or D-xylose fermentation. Therefore, isolate D was found to be a new isolate belonging to Lactobacillus plantarum. Isolate D was deposited internationally under the accession number NITE BP-03200.

[0098] [Table 7]

[0099] [Table 8]

[0100] [Experiment 6: Isolation and identification of isolate E] Isolate E was isolated using the same method as in Experiment 1, except that Guillain's dogwood was used as the isolation source. Isolate E was identified using the same method as in Experiment 2.

[0101] The nucleotide sequence of the 16S rRNA gene of isolate E showed 99.93% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus pentosus (JCM1558), 99.93% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus plantarum subsp. plantarum (JCM1149), and 99.73% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus paraplantarum (DSM10667). However, there was no microorganism with a 16S rRNA gene that completely matched the nucleotide sequence of the 16S rRNA gene of isolate E.

[0102] As shown in Figure 5(A), isolate E formed circular colonies. As shown in Figure 5(B), isolate E was Gram-stain positive. The physiological and biochemical properties and fermentation test results for isolate E are shown in Tables 9 and 10. Isolate E is a non-motile, Gram-positive bacillus, does not form spores, exhibits negative catalase and oxidase reactions, and ferments glucose. These properties are consistent with those of the genus Lactobacillus, which was identified as a possible Lactobacillus species by partial 16S rDNA sequence analysis. Fermentation tests performed using an API kit revealed that isolate E fermented galactose, fructose, and melezitose, but not glycerol or D-xylose. Furthermore, it did not exhibit arginine dihydrolase activity and grew at 15°C. These properties were consistent with those of L. plantarum, which was suggested to belong to L. pentosus and L. plantarum by partial 16S rDNA sequence analysis, but differed from L. pentosus in that it did not exhibit glycerol or D-xylose fermentation. Therefore, isolate E was determined to be a new isolate belonging to Lactobacillus plantarum. Isolate E was deposited internationally under the accession number NITE BP-03201.

[0103] [Table 9]

[0104] [Table 10]

[0105] [Experiment 7: Isolation and identification of isolate F] Isolate F was isolated using the same method as in Experiment 1, except that pine cones were used as the isolation source. Isolate F was identified using the same method as in Experiment 2.

[0106] The nucleotide sequence of the 16S rRNA gene of isolate F showed 99.93% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus pentosus (JCM1558), 99.93% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus plantarum subsp. plantarum (JCM1149), and 99.73% identity to the nucleotide sequence of the 16S rRNA gene of Lactobacillus paraplantarum (DSM10667). However, no microorganisms possessing 16S rRNA genes completely matched the nucleotide sequence of isolate F.

[0107] As shown in Figure 6(A), isolate F formed circular colonies. As shown in Figure 6(B), isolate F was Gram-stain positive. The physiological and biochemical properties and fermentation test results for isolate F are shown in Tables 11 and 12. Isolate F is a non-motile, Gram-positive bacillus, does not form spores, exhibits negative catalase and oxidase reactions, and ferments glucose. These properties are consistent with those of the genus Lactobacillus, which was identified as a possible Lactobacillus species by partial 16S rDNA sequence analysis. Fermentation tests performed using an API kit revealed that isolate F fermented galactose, fructose, α-methyl-D-mannoside, and melezitose, but not glycerol or D-xylose. Furthermore, it did not exhibit arginine dihydrolase activity and grew at 15°C. These properties were consistent with those of L. plantarum, which was suggested to belong to L. pentosus and L. plantarum by 16S rDNA partial sequence analysis, but differed from L. pentosus in that it did not exhibit glycerol or D-xylose fermentation. Therefore, isolate F was determined to be a new isolate belonging to Lactobacillus plantarum. Isolate F was deposited internationally under the NITE BP-03202.

[0108] [Table 11]

[0109] [Table 12]

[0110] [Experiment 8: Antibacterial activity evaluation test of bacterial cultures] The antibacterial activity of bacterial cell cultures of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 was examined. The procedure for Experiment 8 is described with reference to Figure 7. The R. solanacearum strains 1 to 6 listed in Table 13 were used in this experiment. The turbidity of the preculture solution of each R. solanacearum strain was measured at a wavelength of 600 nm. R. solanacearum strain 1 was mixed into soft agar medium 11 to give a concentration of 0.1 OD unit, and the other strains were mixed into soft agar medium 11 to give a concentration of 0.4 OD unit. The amount of bacteria contained in 1 mL of culture solution with an OD600 of 1 was defined as 1 OD unit. Soft agar medium 11 containing each R. solanacearum strain was layered on agar medium 12, and the surface was dried to prepare growth media for each strain. NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 were each cultured in MRS liquid medium at 30°C, and the bacterial cells were precipitated by centrifugation to prepare the culture supernatant (bacterial culture) as Sample 13. 10 μL of Sample 13 was added dropwise to the growth medium of each R. solanacearum strain and cultured under aerobic conditions at 30°C for 20 hours. When the bacterial culture supernatant possesses antibacterial activity against R. solanacearum, a growth inhibition zone 14 is formed. Tetracycline (50 μg / mL), which has antibacterial activity, was used as a control.

[0111] [Table 13]

[0112] The results of Experiment 8 are shown in Figure 8. Culture supernatants from NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 all formed growth inhibition zones on the growth medium for Ralstonia solanacearum strains 1 to 6. Fungal cultures from NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 all inhibited the growth of Ralstonia solanacearum and Ralstonia pseudosolanacealum.

[0113] [Experiment 9: Antibacterial activity evaluation test of bacterial cells and mixtures of bacterial cell cultures] We investigated whether the bacterial cells and bacterial cell cultures of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 possess antibacterial activity. Experiment 9 was the same as Experiment 8, except that a mixture of bacterial cells and culture supernatant was used as Sample 13. The experimental procedure is shown in Figure 9. First, growth media for each R. solanacearum fungus were prepared using the same method as in Experiment 8. NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 were cultured in MRS liquid medium at 30°C, and a mixture of bacterial cells and culture supernatant (bacterial cell culture) was prepared as Sample 13. The filter 15 soaked in 60 μL of sample 13 was placed in a growth medium for each bacterial wilt pathogen and cultured under aerobic conditions at a temperature of 30° C. for 20 hours. After the culture, it was confirmed whether a growth inhibition zone had been formed.

[0114] The results of Experiment 9 are shown in Figure 10. Mixtures of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 fungal cells and culture supernatants all formed growth inhibition zones on the growth medium of R. solanacearum strains 1 to 6. Mixtures of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 fungal cells and culture supernatants all inhibited the growth of Ralstonia solanacearum and R. pseudosolanacealum.

[0115] [Experiment 10: Evaluation of long-term antibacterial activity of bacterial cells and mixtures of bacterial cell cultures] We investigated whether the bacterial cells and bacterial cell cultures of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 retain antibacterial activity over a long period of time. Experiment 10 was performed in the same manner as Experiment 9, except that strain 5 of the R. solanacearum fungus shown in Table 13 was used as the bacterial wilt pathogen, and the incubation period after placing filter 15 in the growth medium for the R. solanacearum fungus was extended to 3, 7, or 15 days. Control experiments used lactic acid bacteria medium, no treatment, or tetracycline (50 μg / mL).

[0116] The results of Experiment 10 are shown in Figure 11. Filters soaked in cells and culture supernatants of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 were placed in a growth medium for Ralstonia solanacearum. Growth inhibition zones were still formed even after 15 days. It was found that the cells and cell culture mixtures of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 were all able to inhibit the growth of Ralstonia solanacearum over a long period of time.

[0117] [Experiment 11: Evaluation test of antibacterial activity against bacterial wilt in nutrient solution] We investigated whether bacterial cell cultures of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 could inhibit the growth of Ralstonia solanacearum in nutrient solution. The experimental procedure is explained with reference to Figure 12. NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, and NITE BP-03202 were each cultured in MRS liquid medium at 30°C, and the bacterial cells were precipitated by centrifugation to obtain the culture supernatant (bacterial cell culture) as Sample 23. The nutrient solution 22 used was OAT Agrio's OAT A formulation (aqueous solution containing 1.5 g / L of OAT House No. 1 and 1.0 g / L of OAT House No. 2). Ralstonia wilt bacteria 21 was suspended in the nutrient solution 22 at 0.01 OD units to prepare a nutrient solution 22 contaminated with the bacterial wilt bacteria. 10 μL of sample 23 was added dropwise to 90 μL of the nutrient solution 22, stirred, and then cultured at 30°C for 5 hours. This culture solution was diluted 100-fold and spread on an agar medium 24 for detecting the bacterial wilt bacteria, followed by further culture at 30°C for 48 hours. After culture, the number of colonies 25 on the agar medium 24 was counted. The bacterial wilt bacteria strain 5 listed in Table 13 was used. For control experiments, a lactic acid bacteria medium or tetracycline (50 μg / mL) was used instead of the sample.

[0118] The results of Experiment 11 are shown in Figure 13. The development of colonies of Ralstonia solanacearum was suppressed in the nutrient solution to which the culture supernatant of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 had been added dropwise. It was found that bacterial cell cultures of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 either killed or inhibited the growth of Ralstonia solanacearum in the nutrient solution.

[0119] [Experiment 12: Evaluation of antibacterial activity against bacterial wilt in soil] To verify whether NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 fungi can inhibit the growth of Ralstonia solanacearum in soil, 2.5 mL of Ralstonia solanacearum 5 solution, adjusted to 0.06 OD units with distilled water (Otsuka Pharmaceutical Factory), was added to 50 g of soil (Akagi Gardening, flower and vegetable potting soil), to prepare contaminated soil. One gram of reducing material (organic matter such as molasses, manufactured by Sun Pillars, Omaras 95) and bacterial cells of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 were mixed with the soil and cultured at 30°C for 14 days under anaerobic conditions. The bacterial cells were cultured in MRS liquid medium at 30°C, adjusted to 0.5 OD units with distilled water (manufactured by Otsuka Pharmaceutical Factory), and 2.5 mL was mixed per 50 g of soil. The reducing material was used as a soil fumigant. Microbial DNA was purified from the soil using the ISOIL for Beads Beating Kit (Nippon Gene Co., Ltd.) and amplified by PCR using a R. solanacearum universal primer set (759: GTCGCCGTCAACTCAACTTTCC (SEQ ID NO: 2), 760: GTCGCCGTCAGCAATGCGGAATCG (SEQ ID NO: 3)) and a PCR primer set specific to R. solanacearum 5 (Nmult21: 1F CGTTGATGAGGCGCGCAATTT (SEQ ID NO: 4), Nmult21: RR TTCGCTTGACCCTATAACGAGT (SEQ ID NO: 5)). PCR amplification was performed using KOD-Plus Ver. 2 DNA polymerase (Toyobo Co., Ltd.), and the amplified product was purified. The purified PCR amplification product was electrophoresed on 4% E-Gel (Thermo Fisher Scientific), and the 144 base pair band amplified with the PCR primer set specific to Ralstonia solanacearum 5 was observed using an image analyzer LAS-3000 (Fujifilm Corporation).

[0120] In soil mixed with cells of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202, the 144 base pair band specific to Ralstonia solanacearum 5 is reduced. Cells of NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202 kill or inhibit the growth of Ralstonia solanacearum in soil.

[0121] [Experiment 13: Testing the effectiveness of bacterial wilt control in hydroponics] We investigated whether bacterial wilt disease could be controlled by adding a culture of NITE BP-03199, NITE BP-03200, or NITE BP-03201 to the nutrient solution in hydroponic culture. First, we used an LED Planter Grinteria (manufactured by DeAgostini) to grow tomatoes (cultivar: Reiyo) in a nutrient solution formulated with OAT A at 25°C, 20-30% humidity, and a photoperiod of 16 hours light and 8 hours dark until they reached the 4- to 5-leaf stage. Eight tomato plants were used in each test and control plot.

[0122] In the test group, a culture supernatant prepared from NITE BP-03201 culture solution with an OD600 value of 10 was added to the nutrient solution at 1 / 100 volume before inoculation with the R. solanacearum bacteria. In the control group, a culture supernatant prepared from NITE BP-03201 culture solution with an OD600 value of 10 was added to the nutrient solution at 1 / 100 volume before inoculation with the R. solanacearum bacteria. Next, 2 x 10 7 After adding the bacteria to the nutrient solution to a concentration of cfu / mL, the tips of the tomato roots were cut off and the bacteria was inoculated. For 10 to 12 days from the date of inoculation to the end of the test, the disease symptoms that appeared on the plants were evaluated on the following 5-point scale according to the evaluation criteria described in Non-Patent Document 1. 0: No disease 1:1 Leaves wilted 2: Two or more leaves wilted 3: Wilted except for terminal leaf 4: Whole body withering and death Disease symptom index = (0×N0+1×N1+2×N2+3×N3+4×N4) / 4×(N0+N1+N2+N3+N4) N0 to N4 are the number of individuals showing the corresponding value. The symptom index indicates the degree of damage caused by the disease, and the higher the symptom index value, the more advanced the disease.

[0123] Figure 14 shows the change in the symptom index over time after inoculation with the bacterial wilt pathogen. While severe symptoms were observed in the control plot, no such symptoms were observed in the test plot. This demonstrates that the fungal culture of NITE BP-03201 is effective in controlling bacterial wilt in hydroponic culture.

[0124] Using a similar method, we added 1 / 100 the amount of culture supernatant of NITE BP-03199 or NITE BP-03200 to the nutrient solution to examine whether it could control bacterial wilt. The results are shown in Figure 15. Severe disease symptoms were observed in the control area, while the symptom index was clearly lower in the test area. Therefore, it was found that the fungal culture of NITE BP-03199 or NITE BP-03200 is also effective in controlling bacterial wilt in hydroponic culture.

[0125] [Experiment 14: Testing the effectiveness of bacterial wilt control in soil cultivation] This study examines whether bacterial wilt can be controlled by applying a culture of NITE BP-03200 fungus in soil. One week before planting, the culture supernatant of NITE BP-03200 is diluted 10x, 50x, or 100x and 50mL per plant is irrigated at the base of the plant. Next, tomato seedlings are planted in a field contaminated with bacterial wilt, inoculating the bacteria. After planting in the field, the culture supernatant of NITE BP-03200 is diluted 10x, 50x, or 100x and 500mL per plant is irrigated at the base of the plant at weekly intervals. The disease symptoms that appear on the plants are compared between treated and untreated areas to evaluate the control effect.

[0126] While withering and wilting were observed in the untreated area, such symptoms were suppressed in the area treated with irrigation of the culture supernatant of NITE BP-03200. Therefore, it is clear that the fungal culture of NITE BP-03200 is effective in controlling bacterial wilt in soil cultivation. [Explanation of symbols]

[0127] 11 Soft agar medium, 12 Agar medium, 13 Sample, 14 Growth inhibition circle, 15 Filter, 21 Ralstonia solanacearum, 22 Nutrient solution, 23 Sample, 24 Agar medium, 25 Colony.

Claims

1. A bacterium having a 16S rRNA gene containing a base sequence having 98.80% or more identity to the base sequence set forth in SEQ ID NO: 1, having the ability to assimilate mannitol, and having the ability to control plant diseases.

2. A bacterium having a 16S rRNA gene containing a base sequence having 99.90% or more identity to the base sequence set forth in SEQ ID NO: 1, and having the ability to control plant diseases.

3. The bacterium according to claim 1 or 2, having a 16S rRNA gene comprising the base sequence set forth in SEQ ID NO:

1.

4. Bacteria having accession numbers NITE BP-03197, NITE BP-03198, NITE BP-03199, NITE BP-03200, NITE BP-03201, or NITE BP-03202.

5. A bacterial cell or cell culture, or an extract thereof, of the bacterium according to any one of claims 1 to 4.

6. A control agent for plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising the bacterium according to any one of claims 1 to 4, or a culture of the bacterium or an extract thereof.

7. A method for controlling plant diseases caused by Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising a step of applying the control agent according to claim 6.

8. A disinfectant for plants, nutrient solution, soil, hydroponic culture materials, or soil culture materials contaminated with Ralstonia solanacealum or Ralstonia pseudosolanacealum, comprising the bacterial cells or bacterial cell culture of the bacterium according to any one of claims 1 to 4, or an extract thereof.

9. A method for disinfecting a plant, nutrient solution, soil, hydroponics material, or soil-based cultivation material contaminated with Ralstonia solanacealum or Ralstonia pseudosolanacealum, the method comprising a step of using the disinfectant according to claim 8.

10. A growth inhibitor for Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising the bacterial cells or bacterial cell culture of the bacterium according to any one of claims 1 to 4, or an extract thereof.

11. A method for inhibiting the growth of Ralstonia solanacearum or Ralstonia pseudosolanacealum, comprising a step of using the growth inhibitor according to claim 10.

12. A method for cultivating a plant, comprising the step of cultivating a plant in a nutrient solution or soil containing the bacterial cells or bacterial cell culture of the bacterium according to any one of claims 1 to 4, or an extract thereof.

Images