genetically engineered microorganisms

Genetically engineered bacteria overexpressing cellulose synthesis proteins form networks around plant roots to enhance water retention and carbon sequestration, addressing water scarcity and soil degradation in agriculture.

JP7741351B2Active Publication Date: 2025-09-18CROBIO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2022533350
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-10-15
Filing Date
2020-12-03
Publication Date
2025-09-18
Estimated Expiration
2040-12-03

AI Technical Summary

Technical Problem

Current agricultural practices face challenges in managing water scarcity and carbon sequestration due to drought and extreme weather conditions, with existing methods failing to effectively enhance crop resilience and soil carbon storage.

Method used

Genetically engineered microorganisms, such as root-associated bacteria, are modified to overexpress proteins involved in cellulose synthesis and secretion, forming an extracellular network around plant roots to increase water retention and convert carbon into cellulose, thereby reducing irrigation needs and enhancing soil carbon sequestration.

Benefits of technology

The approach improves crop resistance to drought, reduces water consumption, and increases soil carbon storage, promoting sustainable agriculture by enhancing soil health and crop production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007741351000006
    Figure 0007741351000006
  • Figure 0007741351000007
    Figure 0007741351000007
  • Figure 0007741351000008
    Figure 0007741351000008
Patent Text Reader

Abstract

The present invention relates to genetically engineered microorganisms, such as bacteria, that have been modified to increase cellulose production, and methods for making said genetically engineered microorganisms. The present invention also relates to the use of these genetically engineered microorganisms in agriculture.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to genetically engineered microorganisms, such as bacteria, that have been modified to increase the production of cellulose, and methods for making said genetically engineered microorganisms. [Background technology]

[0002] Drought and extreme heat are the greatest climate-related threats to global agricultural production. A worsening climate means more extreme and unpredictable weather events, ranging from sudden heavy rains to prolonged droughts. These events directly affect crop yields. When rain falls, soils are at their maximum absorption capacity, and crops are at their maximum uptake retention capacity. The remaining water, which can be substantial during dramatic weather events, remains unused and often runs off land, leading to localized flooding. Water scarcity is a major global concern. Agricultural demand accounts for 70% of global water consumption, which is expected to increase by 19% by 2050. Water consumption is a major obstacle to global crop production. In environments where drought is common, crop yields are low. By increasing crop resilience to environmental drought, the sustainability of global crop supplies can be improved. In hotter climates, rainfall is more sporadic, forcing farmers to continuously irrigate their land. This requires enormous amounts of water, which ultimately evaporates without being utilized by plants. Abiotic stress on crops in drought-prone climates leads to reduced yields and inefficient water management. With population growth and worsening climatic conditions, many strategies have been proposed to mitigate water demand, but to date, no one has used biologically active water-retention strategies for crop water management. Previous strategies have focused on directly genetically modifying crops, enhancing their resistance, or adding additives to the soil. However, none of these approaches have provided an effective solution to the water scarcity problem in global crop production. Crop sustainability is essential for a growing population and for feeding billions of people. Crops not only feed human populations but also support livestock agriculture as a food source. Therefore, now more than ever, dramatic changes are needed to support our growing world, but these solutions must be environmentally friendly and efficient.

[0003] cellulose Cellulose is a polysaccharide consisting of linear chains of hundreds to tens of thousands of β(1→4)-linked D-glucose units. It is an important structural component of the primary cell walls of green plants, many forms of algae, and oomycetes. Furthermore, certain bacteria, primarily the genera Acetobacter, Sarcina ventriculi, and Agrobacterium, secrete cellulose to stiffen biofilms. Bacterial cellulose is currently produced for a variety of commercial applications, including textiles, cosmetics, and food, as well as medical applications. Expression of bacterial cellulose in bacteria has been described in the art. For example, Chinese Patent Application CN108060112 describes the overexpression of the BcsB subunit in bacterial cellulose-producing bacterial strains, specifically Acetobacter xylinum. Furthermore, Buldum et al. (2018) described the recombinant biosynthesis of bacterial cellulose in genetically modified Escherichia coli, while Florea et al. (2016) described the engineered control of bacterial cellulose production in Komagataeibacter rhaeticus using a genetic toolkit.

[0004] Carbon Capture Carbon sequestration on agricultural land is one way to reduce agricultural carbon emissions and mitigate climate change. Atmospheric concentrations of carbon dioxide can be reduced by either reducing emissions or by removing carbon dioxide from the atmosphere and storing it in the soil. The long-term conversion of grasslands and forests to croplands (and rangelands) has led to historic losses of soil carbon worldwide, but there is significant potential for increasing soil carbon through the restoration of degraded soils and the widespread adoption of soil conservation practices. The decline in soil quality is also exacerbated by the use of chemical fertilizers.

[0005] Historically, land use conversion and soil cultivation have been significant sources of greenhouse gases (GHGs) to the atmosphere. They are estimated to account for about one-third of greenhouse gas emissions. However, improved agricultural practices can help mitigate climate change by reducing emissions from agriculture and other sources, and by storing carbon in the soil.

[0006] The development of agriculture over the past few centuries, and especially over the past few decades, has been accompanied by substantial depletion of soil carbon stocks. Agricultural soils are one of the planet's leading carbon reservoirs and offer the potential to expand carbon sequestration (CS), thus offering a promising way to mitigate increasing atmospheric concentrations of CO2. It is generally acknowledged that the technological potential for carbon sequestration in soils is significant, and there is some consensus regarding the magnitude of this potential. The world's croplands have the potential to sequester 0.90 to 1.85 PgC / year, or 26–53% of the 4p1000 Initiative: Soils for Food Security and Climate targets.

[0007] At the same time, this process provides other important benefits to soil, crop and environmental quality, erosion and desertification prevention, and biodiversity enhancement.Land degradation not only reduces crop yields, but often also reduces the carbon content of agricultural ecosystems and can decrease biodiversity.

[0008] Due to the rapid increase in atmospheric GHGs, the Earth's climate is undergoing unprecedented change. Multiple strategies must be devised to offset the current release of GHGs into the atmosphere. Of all atmospheric GHGs, CO2 contributes significantly to global warming. Soil carbon sequestration is a promising method for offsetting the increase in atmospheric CO2. Both partially decomposed soils and agricultural soils have considerable potential for minimizing the rise in atmospheric CO2 levels. Globally, soils can retain twice as much carbon as is present in the atmosphere or captured by plants. Temperature, soil moisture, and increasing CO2 levels are the primary climatic factors affecting soil carbon sequestration. Soil carbon sequestration is also strongly influenced by various soil factors, including soil texture, soil structure, soil porosity, soil compaction, soil mineralogy, and soil microbial community composition. Furthermore, agricultural activities such as land-use change, plant residue management, and pesticides also affect soil organic carbon (SOC) stocks directly (e.g., by altering the amount of carbon added to the soil) or indirectly (e.g., by affecting soil aggregation, thereby facilitating microbial decomposition processes). Soil carbon sequestration not only offsets rapidly increasing atmospheric GHGs but also improves soil quality, potentially promoting food security. As a highly sustainable and environmentally friendly approach, this could play an important role in sustainable agriculture. This can enhance soil quality by improving soil health parameters (i.e., soil water-holding capacity), which subsequently improves crop production on a sustainable basis.

[0009] The present invention has been devised in view of the above points. Summary of the Invention [Means for solving the problem]

[0010] The present invention is based on the overexpression of protein components responsible for the synthesis and secretion of cellulose in microorganisms, such as root-associated bacteria, to achieve increased water retention around plant roots. This increase in water retention around plant roots is believed to reduce the amount of irrigation water required, thereby improving crop resistance to environmental drought.

[0011] Thus, in its broadest sense, the present invention provides a genetically engineered microorganism that has been modified to overexpress at least one protein involved in cellulose synthesis and / or secretion relative to a reference microorganism, and optionally the cellulose is bacterial cellulose. Preferably, the microorganism (and reference microorganism) is a bacterium, such as a root-associated bacterium.

[0012] In one aspect of the present invention, a genetically engineered microorganism for producing cellulose is provided, wherein the microorganism is genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and modified with exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, and the ccpAx gene. In some embodiments, the microorganism is further modified with an exogenous cmcAx gene and / or an exogenous bglAx gene. In some embodiments, the microorganism is modified with an exogenous nucleic acid including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, and at least the ccpAx gene. In some embodiments, the genes are heterologous. In some embodiments, each of the genes is isolated from K. xylinus.

[0013] In some embodiments, the genetically engineered microorganism is a bacterium, optionally a root-associated bacterium. In some embodiments, the genetically engineered microorganism is a plant growth-promoting rhizobacterium. In some embodiments, the microorganism is a Pseudomonas bacterium. In some embodiments, the rhizobacterium is not Komagataeibacter xylinus (also known as Acetobacter xylinum and Gluconacetobacter xylinus). In some embodiments, expression of the gene is regulated by a cell density quorum-sensing system. In some embodiments, a quorum-sensing operon is inserted into the host cell. In some embodiments, the quorum-sensing system comprises a gene encoding a sensor kinase and a gene encoding a response regulator. In further embodiments, the quorum-sensing system further comprises a quorum-sensing-regulated promoter. In an alternative embodiment, the quorum sensing system comprises a gene encoding a signaling molecule (autoinducer) and a gene encoding a transcription / response regulator. In a further embodiment, the quorum sensing system further comprises a promoter regulated by quorum sensing.

[0014] In some aspects, methods are provided for increasing cellulose production in a microorganism compared to a reference microorganism, comprising modifying the microorganism to overexpress at least one protein involved in cellulose synthesis and / or secretion, wherein the microorganism is modified with exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, and the ccp gene. In some embodiments, the microorganism is further modified with an exogenous cmc gene and / or an exogenous bgl gene. In some embodiments, the microorganism is a bacterium, optionally a plant growth-promoting rhizobacterium.

[0015] The present invention provides genetically engineered microorganisms for producing cellulose, the microorganisms being genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. In some embodiments, the cellulose produced by the genetically engineered microorganisms is bacterial cellulose. In some embodiments, the microorganisms are genetically modified to overexpress at least one protein from a cellulose synthase complex. In some embodiments, the microorganisms are modified to overexpress at least one, at least two, at least three, or at least four proteins from the cellulose synthase complex. In some embodiments, the cellulose synthase complex is a bacterial cellulose synthase complex. In some embodiments, cellulose production is increased in the genetically modified microorganisms compared to a reference microorganism. In some embodiments, the reference microorganism is of the same species as the modified microorganism. The reference microorganism may be the same strain as the modified microorganism. In some embodiments, the microorganism is a wild-type microorganism. In some embodiments, the reference microorganism of the same species or strain is a wild-type microorganism of the same species or strain. In some embodiments, the genetically engineered microorganism is selected from bacterial cells, fungal cells, or algal cells. In some aspects, the genetically engineered microorganism is a bacterium. In further aspects, the genetically engineered microorganism is a root-associated bacterium.

[0016] In some embodiments, the genetically engineered microorganisms of the present invention are modified to overexpress a cellulose synthase complex. In some embodiments, the genetically modified microorganisms are modified with an exogenous nucleic acid encoding at least one protein from the cellulose synthase complex. In other embodiments, overexpression of at least one protein from the cellulose synthase complex is achieved by increasing the transcription and / or translation of at least one protein from the endogenous cellulose synthase complex.

[0017] In some embodiments, the genetically modified microorganism is modified with an exogenous nucleic acid encoding at least one protein from the cellulose synthase complex. In some embodiments, the microorganism is modified with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four proteins from the cellulose synthase complex. In some embodiments, the genetically engineered microorganism is modified with at least one of the following genes of the bcs operon: bcsA; bcsB; bcsC; and / or bcsD. In further embodiments, the exogenous nucleic acid comprises the bcs operon. In another further embodiment, the bcs operon encodes four protein subunits, BcsA, BcsB, BcsC, and BcsD. In some embodiments, the exogenous nucleic acid further comprises at least one of the following genes or operons: cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and / or dgc gene. In some embodiments, the exogenous nucleic acid comprises the bcs operon, the cmcAx gene, the ccpAx gene, and the bglAx gene. In some embodiments, the exogenous nucleic acid comprises the bcs operon, the cmc gene, the ccp gene, the bgl gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In some embodiments, the exogenous nucleic acid consists of the bcs operon, the cmc gene, the ccp gene, the bgl gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In some embodiments, the bcs operon, the cmc gene, the ccp gene, the bgl gene, the pgm gene, the galU gene, the cdg operon, and / or the dgc gene are each isolated from K. xylinus.

[0018] In some embodiments, the microorganism is selected from Pseudomonas fluorescens and Bacillus megaterium. In a further embodiment, the microorganism is Pseudomonas fluorescens. In another further embodiment, the microorganism is Pseudomonas fluorescens SBW25. In another further embodiment, the microorganism is Pseudomonas fluorescens F113. In another further embodiment, the microorganism is Pseudomonas fluorescens CHA0. In another further embodiment, the microorganism is Pseudomonas fluorescens Pf-5. In another further embodiment, the microorganism is Pseudomonas fluorescens FW300 N2E2.

[0019] In some embodiments, the cellulose produced by the genetically engineered microorganism of the present invention is secreted extracellularly. In a further embodiment, the secreted cellulose forms an extracellular network. In some embodiments, the secreted network forms around the plant roots. In some embodiments, the secreted cellulose network increases water retention around the plant roots. In some embodiments, the plant is a cereal plant, corn, rice, wheat, or soybean.

[0020] In a second aspect of the present invention, there is provided a method for increasing cellulose production in a microorganism compared to a reference microorganism, the method comprising modifying the microorganism to overexpress at least one protein involved in cellulose synthesis and / or secretion. In some embodiments, the microorganism is modified to overexpress at least one protein from a cellulose synthase complex. In some embodiments, the reference microorganism is of the same species as the modified microorganism. In some embodiments, the reference microorganism is a wild-type microorganism. In some embodiments, the reference microorganism of the same species is a wild-type microorganism of the same species. In some embodiments, the genetically engineered microorganism is modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In some embodiments, the exogenous nucleic acid encoding at least one protein from a cellulose synthase complex is integrated into the genome of the microorganism. In some embodiments, the cellulose is bacterial cellulose. In some embodiments, the exogenous nucleic acid comprises the bcs operon. In further embodiments, the exogenous nucleic acid of the vector further comprises at least one of the cmcAx gene, the ccpAx gene, the bglAx gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In some embodiments, the genetically engineered microorganism is selected from a bacterial cell, a fungal cell, or an algal cell. In some embodiments, the genetically engineered microorganism is a bacterium. In further embodiments, the genetically engineered microorganism is a root-associated bacterium.

[0021] In a third aspect of the present invention, a vector is provided comprising an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In some embodiments, the exogenous nucleic acid of the vector comprises the bcs operon. In further embodiments, the exogenous nucleic acid of the vector further comprises at least one of the cmcAx gene, the ccpAx gene, the bglAx gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In some embodiments, the exogenous nucleic acid of the vector comprises the bcs operon, the cmcAx gene, the ccpAx gene, and the bglAx gene. In some embodiments, the exogenous nucleic acid of the vector comprises the bcs operon, the cmcAx gene, the ccpAx gene, the bglAx gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In some embodiments, the exogenous nucleic acid of the vector consists of the bcs operon, cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and dgc gene. In some embodiments, the bcs operon, cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and / or dgc gene are each isolated from K. xylinus. In some embodiments, the vector is an isolated vector. In some embodiments, the genes are heterologous.

[0022] In a fourth aspect, the present invention provides a method of producing a genetically engineered microorganism for producing cellulose, the method comprising the steps of: a) isolating the microorganism; and b) introducing the vector of the present invention into a microorganism The present invention provides a method for producing a cellulose synthase complex comprising the step of modifying a microorganism with an exogenous nucleic acid encoding at least one protein from the cellulose synthase complex, the exogenous nucleic acid comprising:

[0023] In some embodiments, the microorganism is modified with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four proteins from the cellulose synthase complex. In some embodiments, the genetically engineered microorganism is selected from a bacterial cell, a fungal cell, or an algal cell. In some embodiments, the genetically engineered microorganism is a bacterium. In further embodiments, the genetically engineered microorganism is a root-associated bacterium.

[0024] In some embodiments, the vectors of the present invention are introduced into the microorganism by electroporation. In some embodiments, the vectors of the present invention are introduced into the microorganism by transfection. In some embodiments, an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex is integrated into the genome of the microorganism. In some embodiments, at least one, at least two, at least three, or at least four of the proteins from the cellulose synthase complex are integrated into the genome of the microorganism. In some embodiments, the vectors of the present invention are introduced into the microorganism so that two copies, three copies, four copies, etc. are integrated into the genome of the microorganism to increase the copy number of one or more genes thereof. In some embodiments, cellulose production is increased in the genetically engineered microorganism compared to a reference microorganism. In some embodiments, the reference microorganism is of the same species or strain. In some embodiments, the reference microorganism is a wild-type microorganism. In some embodiments, the reference microorganism is a wild-type microorganism of the same species or strain. In some embodiments, the cellulose is bacterial cellulose. In some embodiments, the cellulose synthase complex is a bacterial cellulose synthase complex.

[0025] In a fifth aspect, a genetically engineered microorganism obtained by the method for producing a genetically engineered microorganism for cellulose production is provided. In another aspect, the present invention provides an isolated genetically engineered microorganism of the present invention. In an alternative aspect, a population comprising a genetically engineered microorganism of the present invention is provided. In some embodiments, the genetically engineered microorganism is selected from a bacterial cell, a fungal cell, or an algal cell. In some embodiments, the genetically engineered microorganism is a bacterium. In a further aspect, the genetically engineered microorganism is a root-associated bacterium.

[0026] In another aspect, the present invention provides compositions comprising a genetically engineered population of microorganisms of the present invention. In some embodiments, the composition is applied to the plant in a liquid formulation. In alternative embodiments, the composition is applied to the plant as an inoculant. In some embodiments, the inoculant is a peat-based formulation. In further embodiments, the formulation is used to coat seeds or pellets for in-furrow planting. In some embodiments, the genetically modified microorganisms of the present invention are delivered to the plant in microbeads. In further embodiments, the microbeads are alginate microbeads. In some embodiments, the composition further comprises a fertilizer and / or a biofertilizer. In some embodiments, the composition is applied to the plant after planting but before harvesting the plant. In some embodiments, the composition is applied to the soil before planting the plant. In some embodiments, the plant is a cereal plant, corn, rice, wheat, or soybean. In some embodiments, the genetically engineered microorganism is selected from a bacterial cell, a fungal cell, or an algal cell. In some embodiments, the genetically engineered microorganism is a bacterium. In further embodiments, the genetically engineered microorganism is a root-associated bacterium.

[0027] In another aspect, the present invention provides a method for increasing water retention around plant roots, comprising applying a genetically engineered microorganism to the soil surrounding the plant root, wherein the microorganism is genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. In some embodiments, the microorganism is selected from the genetically engineered microorganism of the present invention, the isolated genetically engineered microorganism of the present invention, the population of genetically engineered microorganisms of the present invention, or the composition of the present invention. In some embodiments, the plant is a cereal plant, corn, rice, wheat, or soybean. In some embodiments, the genetically engineered microorganism is selected from bacterial cells, fungal cells, or algal cells. In some embodiments, the genetically engineered microorganism is a bacterium. In a further embodiment, the genetically engineered microorganism is a root-associated bacterium.

[0028] In another aspect, the present invention provides a method for reducing water consumption in agriculture, comprising applying genetically engineered microorganisms to soil surrounding plant roots, wherein the microorganisms are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. In some embodiments, the microorganism is selected from the genetically engineered microorganisms of the present invention, the isolated genetically engineered microorganisms of the present invention, the population of genetically engineered microorganisms of the present invention, or the composition of the present invention. In some embodiments, the plant is a cereal plant, corn, rice, wheat, or soybean. In some embodiments, the genetically engineered microorganism is selected from bacterial cells, fungal cells, or algal cells. In some embodiments, the genetically engineered microorganism is a bacterium. In further embodiments, the genetically engineered microorganism is a root-associated bacterium.

[0029] In another aspect, the present invention provides a plant comprising a genetically engineered microorganism of the present invention, an isolated genetically engineered microorganism of the present invention, a population of genetically engineered microorganisms of the present invention, or a composition of the present invention, wherein the genetically engineered microorganism, isolated genetically engineered microorganism, or population of genetically engineered microorganisms is associated with a plant root. In some embodiments, the plant is a cereal plant, corn, rice, wheat, or soybean. In some embodiments, the genetically engineered microorganism is selected from a bacterial cell, a fungal cell, or an algal cell. In some embodiments, the genetically engineered microorganism is a bacterium. In a further embodiment, the genetically engineered microorganism is a root-associated bacterium.

[0030] In another aspect, the invention provides a method of capturing carbon, comprising applying genetically engineered microorganisms to soil surrounding plant roots, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and wherein the carbon is converted to cellulose by the microorganisms.

[0031] In some embodiments, the genetically engineered microorganism is a microorganism of the present invention, an isolated genetically engineered microorganism of the present invention, a population of genetically engineered microorganisms of the present invention, or a composition of the present invention. In some embodiments, carbon is absorbed as carbohydrates secreted by plants, and the carbohydrates are converted into cellulose by the microorganism. In some embodiments, the production of cellulose leads to increased water retention around plant roots. In some embodiments, the genetically engineered microorganism is selected from bacterial cells, fungal cells, or algal cells. In some embodiments, the genetically engineered microorganism is a bacterium. In further embodiments, the genetically engineered microorganism is a root-associated bacterium. In some embodiments, the microorganism is a mycorrhizal fungus (e.g., arbuscular mycorrhizal fungus, ectomycorrhizal fungus, ericoid mycorrhizal fungus, and / or orchid mycorrhizal fungus).

[0032] Another aspect of the present invention provides the use of genetically modified microorganisms in agriculture, wherein the microorganisms are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. Another aspect of the present invention provides the use of genetically modified microorganisms to increase water retention around plant roots, wherein the microorganisms are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. Another aspect of the present invention provides the use of genetically modified microorganisms in carbon capture, wherein the microorganisms are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and carbon is converted to cellulose by the microorganisms. In some embodiments, the genetically modified microorganisms are selected from bacterial cells, fungal cells, or algal cells. In some embodiments, the genetically modified microorganisms are bacteria. In further embodiments, the genetically modified microorganisms are root-associated bacteria. In some embodiments, the methods and uses described herein result in increased plant viability.

[0033] In some embodiments, genetically modified microorganisms are provided that contain one or more heterologous genes, wherein the genes include a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, a cmcAx gene, a ccpAx gene, and / or a bglAx gene. In some embodiments, the microorganism is a bacterium. In further embodiments, the microorganism is a plant growth-promoting rhizobacterium.

[0034] In some aspects, the present invention provides genetically engineered root-associated bacteria for producing cellulose, wherein the bacteria are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. In some embodiments, the cellulose produced by the genetically engineered root-associated bacteria is bacterial cellulose. In some embodiments, the bacteria are genetically modified to overexpress at least one protein from a cellulose synthase complex. In some embodiments, the bacteria are modified to overexpress at least one, at least two, at least three, or at least four proteins from the cellulose synthase complex. In some embodiments, the cellulose synthase complex is a bacterial cellulose synthase complex. In some embodiments, cellulose production is increased in the genetically modified bacteria compared to a reference bacterium. In some embodiments, the reference bacterium is of the same species as the modified bacterium. The reference bacterium may be the same strain as the modified bacterium. In some embodiments, the bacterium is a wild-type bacterium. In some embodiments, the reference bacterium of the same species or strain is a wild-type bacterium of the same species or strain.

[0035] In some embodiments, the genetically engineered root-associated bacteria of the present invention are modified to overexpress a cellulose synthase complex. In some embodiments, the genetically modified bacteria are modified with an exogenous nucleic acid encoding at least one protein from the cellulose synthase complex. In other embodiments, overexpression of at least one protein from the cellulose synthase complex is achieved by increasing the transcription and / or translation of at least one protein from the endogenous cellulose synthase complex.

[0036] In some embodiments, the genetically modified root-associated bacterium is modified with an exogenous nucleic acid encoding at least one protein from the cellulose synthase complex. In some embodiments, the bacterium is modified with an exogenous nucleic acid encoding at least one, at least two, at least three, or at least four of the proteins from the cellulose synthase complex. In some embodiments, the genetically engineered bacterium is modified with at least one of the following genes of the bcs operon: bcsA; bcsB; bcsC; and / or bcsD. In further embodiments, the exogenous nucleic acid comprises the bcs operon. In another further embodiment, the bcs operon encodes four protein subunits, BcsA, BcsB, BcsC, and BcsD. In some embodiments, the exogenous nucleic acid comprises at least one of the following genes or operons: cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and / or dgc gene. In some embodiments, the exogenous nucleic acid comprises the bcs operon, the cmcAx gene, the ccpAx gene, and the bglAx gene. In some embodiments, the exogenous nucleic acid comprises the bcs operon, the cmcAx gene, the ccpAx gene, the bglAx gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In some embodiments, the exogenous nucleic acid consists of the bcs operon, the cmcAx gene, the ccpAx gene, the bglAx gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In some embodiments, the bcs operon, the cmcAx gene, the ccpAx gene, the bglAx gene, the pgm gene, the galU gene, the cdg operon, and / or the dgc gene are each isolated from K. xylinus.

[0037] In some embodiments, the root-associated bacterium is selected from Pseudomonas fluorescens and Bacillus megaterium. In a further embodiment, the root-associated bacterium is Pseudomonas fluorescens. In another further embodiment, the root-associated bacterium is Pseudomonas fluorescens SBW25. In another further embodiment, the root-associated bacterium is Pseudomonas fluorescens F113. In another further embodiment, the root-associated bacterium is Pseudomonas fluorescens CHA0. In another further embodiment, the root-associated bacterium is Pseudomonas fluorescens Pf-5. In another further embodiment, the root-associated bacterium is Pseudomonas fluorescens FW300 N2E2.

[0038] In some aspects, the cellulose produced by the genetically engineered root-associated bacteria of the present invention is secreted extracellularly. In a further aspect, the secreted cellulose forms an extracellular network. In some aspects, the secreted network forms around the plant root. In some aspects, the secreted cellulose network increases water retention around the plant root. In some aspects, the plant is a cereal plant, corn, rice, wheat, or soybean.

[0039] In a second aspect of the present invention, there is provided a method for increasing cellulose production in a root-associated bacterium compared to a reference root-associated bacterium, the method comprising modifying the bacterium to overexpress at least one protein involved in cellulose synthesis and / or secretion. In some embodiments, the bacterium is modified to overexpress at least one protein from a cellulose synthase complex. In some embodiments, the reference bacterium is of the same species as the modified bacterium. In some embodiments, the reference bacterium is a wild-type bacterium. In some embodiments, the reference bacterium of the same species is a wild-type bacterium of the same species. In some embodiments, the genetically engineered root-associated bacterium is modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In some embodiments, the exogenous nucleic acid encoding at least one protein from a cellulose synthase complex is integrated into the genome of the root-associated bacterium. In some embodiments, the cellulose is bacterial cellulose. In some embodiments, the exogenous nucleic acid comprises a bcs operon. In a further embodiment, the exogenous nucleic acid of the vector further comprises at least one of a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon, and a dgc gene.

[0040] In a third aspect of the present invention, a vector is provided comprising an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. In some embodiments, the exogenous nucleic acid of the vector comprises the bcs operon. In further embodiments, the exogenous nucleic acid of the vector further comprises at least one of the cmcAx gene, the ccpAx gene, the bglAx gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In some embodiments, the exogenous nucleic acid of the vector comprises the bcs operon, the cmcAx gene, the ccpAx gene, and the bglAx gene. In some embodiments, the exogenous nucleic acid of the vector comprises the bcs operon, the cmcAx gene, the ccpAx gene, the bglAx gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In some embodiments, the exogenous nucleic acid of the vector consists of the bcs operon, cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and dgc gene. In some embodiments, the bcs operon, cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and / or dgc gene are each isolated from K. xylinus. In some embodiments, the vector is an isolated vector.

[0041] In a fourth aspect, the present invention provides a method for producing a genetically engineered root-associated bacterium for producing cellulose, comprising the steps of: a) isolating root-associated bacteria; and b) introducing the vector of the present invention into root-associated bacteria The present invention provides a method for producing a cellulose synthase complex comprising the step of modifying a microorganism with an exogenous nucleic acid encoding at least one protein from the cellulose synthase complex, the exogenous nucleic acid comprising:

[0042] In some embodiments, the bacterium is modified with exogenous nucleic acids encoding at least one, at least two, at least three, or at least four of the proteins from a cellulose synthase complex.

[0043] In some embodiments, the vectors of the present invention are introduced into root-associated bacteria by electroporation. In some embodiments, the vectors of the present invention are introduced into root-associated bacteria by transfection. In some embodiments, an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex is integrated into the genome of the root-associated bacterium. In some embodiments, at least one, at least two, at least three, or at least four of the proteins from the cellulose synthase complex are integrated into the genome of the root-associated bacterium. In some embodiments, the vectors of the present invention are introduced into bacteria so that two copies, three copies, four copies, etc. are integrated into the bacterial genome to increase the copy number of one or more genes. In some embodiments, cellulose production is increased in the genetically modified bacterium compared to a reference bacterium. In some embodiments, the reference bacterium is of the same species or strain. In some embodiments, the reference bacterium is a wild-type bacterium. In some embodiments, the reference bacterium is a wild-type bacterium of the same species or strain. In some embodiments, the cellulose is bacterial cellulose. In some embodiments, the cellulose synthase complex is a bacterial cellulose synthase complex.

[0044] In a fifth aspect, the present invention provides a genetically engineered root-associated bacterium obtained by the method of producing a genetically engineered root-associated bacterium for producing cellulose. In another aspect, the present invention provides an isolated genetically engineered root-associated bacterium of the present invention. In an alternative aspect, the present invention provides a bacterial population comprising the genetically engineered root-associated bacterium of the present invention.

[0045] In another aspect, the present invention provides a bacterial composition comprising the genetically engineered root-associated bacterial population of the present invention. In some embodiments, the composition is applied to the plant in a liquid formulation. In alternative embodiments, the composition is applied to the plant as a bacterial inoculant. In some embodiments, the bacterial inoculant is a peat-based formulation. In further embodiments, the formulation is used to coat seeds or pellets for in-furrow planting. In some embodiments, the genetically modified bacteria of the present invention are delivered to the plant in microbeads. In further embodiments, the microbeads are alginate microbeads. In some embodiments, the bacterial composition further comprises a fertilizer and / or a biofertilizer. In some embodiments, the bacterial composition is applied to the plant after planting but before harvesting the plant. In some embodiments, the bacterial composition is applied to the soil before planting the plant. In some embodiments, the plant is a cereal plant, corn, rice, wheat, or soybean.

[0046] In another aspect, the present invention provides a method for increasing water retention around plant roots, comprising applying a genetically engineered root-associated bacterium of the present invention, an isolated genetically engineered root-associated bacterium of the present invention, a population of genetically engineered root-associated bacteria of the present invention, or a bacterial composition of the present invention to soil surrounding the plant. In some aspects, the plant is a cereal plant, corn, rice, wheat, or soybean.

[0047] In another aspect, the present invention provides a method for reducing water consumption in agriculture, comprising applying a genetically engineered root-associated bacterium of the present invention, an isolated genetically engineered root-associated bacterium of the present invention, a population of genetically engineered root-associated bacteria of the present invention, or a bacterial composition of the present invention to soil surrounding a plant. In some aspects, the plant is a cereal plant, corn, rice, wheat, or soybean.

[0048] In another aspect, the present invention provides a plant comprising the genetically engineered root-associated bacterium of the present invention, the isolated genetically engineered root-associated bacterium of the present invention, the population of genetically engineered root-associated bacteria of the present invention, or the bacterial composition of the present invention, wherein the genetically engineered root-associated bacterium, the isolated genetically engineered root-associated bacterium, or the population of genetically engineered root-associated bacteria is associated with the plant root. In some embodiments, the plant is a cereal plant, corn, rice, wheat, or soybean.

[0049] In another aspect, the invention provides a method of capturing carbon, comprising applying genetically engineered root-associated bacteria to soil surrounding plant roots, wherein the bacteria have been genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and wherein the carbon is converted to cellulose by the bacteria.

[0050] In some aspects, the genetically engineered root-associated bacterium is a root-associated bacterium of the present invention, an isolated genetically engineered root-associated bacterium of the present invention, a population of genetically engineered root-associated bacteria of the present invention, or a bacterial composition of the present invention. In some aspects, carbon is absorbed as carbohydrates secreted by the plant, and the carbohydrates are converted into cellulose by the bacteria. In some aspects, the production of cellulose increases water retention around the plant roots.

[0051] Another aspect of the present invention provides the use of genetically modified root-associated bacteria in agriculture, wherein the bacteria are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. Another aspect of the present invention provides the use of genetically modified root-associated bacteria to increase water retention around plant roots, wherein the microorganisms are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. Another aspect of the present invention provides the use of genetically modified root-associated bacteria in carbon capture, wherein the microorganisms are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and carbon is converted to cellulose by the bacteria. In some embodiments, the methods and uses described herein result in increased plant viability.

[0052] In some aspects, the methods described herein result in increased plant viability. In some embodiments of the present invention, the root-associated bacterium is genetically modified with an exogenous nucleic acid comprising one or more heterologous genes, the genes being selected from the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the cmcAx gene, the ccpAx gene, and the bglAx gene.

[0053] In some aspects, the present invention provides genetically modified bacteria for producing cellulose, wherein the bacterium is genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, the genetically modified bacterium being modified with an exogenous bcs operon, the bcs operon including the bcsA, bcsB, bcsC, and bcsD genes. In some embodiments, genetically modified bacteria are provided, wherein the bacterium is genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, the genetically modified bacterium being modified with one or more heterologous genes, the genes including the bcsA, bcsB, bcsC, bcsD genes, and optionally the cmcAx, ccpAx, and / or bglAx genes. In some embodiments, the bacterium is not Komagataibacter xylinus (also known as Acetobacter xylinum and Gluconacetobacter xylinus).

[0054] In some embodiments of the invention, the bacterium is genetically modified with an exogenous nucleic acid comprising one or more heterologous genes, the genes being selected from the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the cmcAx gene, the ccpAx gene, and the bglAx gene.

[0055] In some embodiments, the present invention provides genetically engineered plant growth-promoting rhizobacteria for producing cellulose, wherein the rhizobacteria are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. In some embodiments, the rhizobacteria are modified with an exogenous nucleic acid comprising the bcs operon, wherein the bcs operon comprises the bcsA gene, the bcsB gene, the bcsC gene, and the bcsD gene. In some embodiments, the exogenous nucleic acid further comprises at least the ccpAx gene. In some embodiments, the exogenous nucleic acid further comprises the cmcAx gene, the ccpAx gene, and / or the bglAx gene. In some embodiments, the genes are heterologous. In some embodiments of the present invention, the rhizobacteria are genetically modified with an exogenous nucleic acid comprising one or more heterologous genes, wherein the genes are selected from the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the cmcAx gene, the ccpAx gene, and the bglAx gene.

[0056] In some embodiments, genetically engineered plant growth-promoting rhizobacteria for producing cellulose are provided, wherein the rhizobacteria are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and the genetically modified rhizobacteria are modified with one or more heterologous genes, wherein the genes include a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and optionally a cmcAx gene, a ccpAx gene, and / or a bglAx gene. In some embodiments, the rhizobacter is not Komagataibacter xylinus (also known as Acetobacter xylinum and Gluconacetobacter xylinus).

[0057] The present invention includes combinations of the described aspects and preferred features except where such combinations are clearly impermissible or clearly avoided. BRIEF DESCRIPTION OF THE DRAWINGS Embodiments and experiments illustrating the principles of the present invention will now be described with reference to the accompanying drawings. [Brief explanation of the drawings]

[0058] [Figure 1] Depiction of gene crossover from a shuttle vector (pEX18Ap) containing the bacterial cellulose gene of interest to locus -6- on the chromosome of P. fluorescens, e.g., P. fluorescens SBW25. [Figure 2] Depiction of gene crossover from the Mini CTX1 vector containing the bacterial cellulose gene of interest into the attb site (attB-5'TGAGTTCGAATCTCACCGCCTCCGCCATAT 3') of the P. fluorescens chromosome. [Figure 3] A depiction of a construct containing the cellulose synthesis genes cmcAx, ccpAx, BcsA, BcsB, BcsC, BcsD, and BglAx, and GFP as a reporter gene. In this particular example, the construct also contains the pBAD promoter and pBAD terminator. [Figure 4] a) Representation of the construct containing the Pseudomonas synxantha strain 2-79 chromosome-phzl / R operon. b) Representation of the construct containing the insertion into a host microorganism, e.g., Pseudomonas fluorescens. [Figure 5] a) Representation of a construct containing the Pseudomonas putida strain KT2440 chromosomal rox quorum sensing system. b) Representation of a construct containing the KT2440 QS system for recombinant protein production in Pseudomonas, utilizing the upstream region of the roxS / roxR regulated genes shown in Figure 5c. c) Representation of a construct for insertion into a host microorganism, e.g., Pseudomonas fluorescens. DETAILED DESCRIPTION OF THE INVENTION

[0059] Aspects and embodiments of the present invention will now be described with reference to the accompanying drawings. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned herein are incorporated by reference.

[0060] The present invention provides genetically engineered microorganisms, e.g., root-associated bacteria, for producing cellulose, wherein the genetically engineered root-associated bacteria are genetically modified to increase cellulose production relative to a reference bacterium, typically of the same species. Typically, the genetically engineered root-associated bacteria are modified to overexpress proteins required for the synthesis and / or secretion of cellulose, preferably a cellulose synthase complex.

[0061] As used herein, one or more "root-associated" bacteria refer to one or more bacteria that live on or around the surface of plant roots. In some embodiments, a microorganism is "root-associated," which refers to a microorganism that lives on or around the surface of a plant root. In further embodiments, the root-associated bacteria are rhizobacteria. Root-associated bacteria can form a symbiotic relationship with plants and promote plant growth. (Such plant growth-promoting rhizobacteria are called PGPR.) Without being bound by theory, it is expected that once root-associated bacteria are separated from the roots, they are unable to maintain viability and are therefore unlikely to survive in the wider environment, thereby preventing the spread of genetically modified bacteria in the environment.

[0062] Examples of root-associated bacteria include Agrobacterium (Agrobacterium) radiohacter, Bacillus acidocaldarms, Bacillus acidoterrestris (acidoterresiris), Bacillus agri, Bacillus aizawai, Bacillus albolactis, Bacillus alcalophilus, Bacillus alvei, Bacillus aminoglucosidicus, Bacillus aminovorans, and Bacillus amylolyticus. amylolyticus (also known as Paenibacillus (Paenibacilhis) amylolyticus), Bacillus amyloliquefaciens (amyloliquefacieris), Bacillus aneurinolyticus (aneiirinolyticus), Bacillus atrophaeus (atropkaeus), Bacillus azotoformans, Bacillus badius, Bacillus cereus (synonyms: Bacillus endorythmos, Bacillus medusae) medusa), Bacillus chinosporus (chiiinosporus), Bacillus circulans, Bacillus coagulans, Bacillus endoparasiticusendoparasiticus, Bacillus fastidiosus, Bacillus firmus, Bacillus kurstaki, Bacillus (Bacillus) lacticola, Bacillus (Bacillus) lacimorbus, Bacillus laciis, Bacillus laterosporus (Iaierospoms) (also known as Brevibacillus laterosporus), Bacillus lautus, Bacillus lemimorbus (leniimorbus), Bacillus leniimorbus lenius, Bacillus licheniformis, Bacillus maroccanus, Bacillus megaterium, Bacillus meiens, Bacillus mycoides, Bacillus natto, Bacillus nematocida, Bacillus nigrificans, Bacillus nigrum, Bacillus pantothenticus, Bacillus papillae, Bacillus psychrosaccharolyticus, Bacillus pumilus pumilus, Bacillus siamensis, Bacillus smithii, Bacillus sphaericus, Bacillus subtilis (subiilis), Bacillus thuringiensisthuringiensis, Bacillus tmiflagellatus, Bradyrhizobium japonicum, Brevibacillus brevis, Brevibacillus laterosporus (formerly Bacillus laterosporus), Chromobacterium subtsugae(suhisugae), Delftia acidovorans, Lactobacillus acidophilus, Lysobacter antibioticus, Lysobacter enzymogenes enzymogenes, Paenibacillus (Paenibacilhis) alvei, Paenibacillus polymyxa, Paenibacillus popilliae (formerly Bacillus popilliae), Pantoea agglomerans, Pasteuria penetrans (formerly Bacillus penetrans), Pasteuria usgae, Pectobacterium carotovorum (formerly Erwinia carotovord), Pseudomonas aeruginosa, Pseudomonas aureofaciens aureofaciens, Pseudomonas cepacia (formerly known as Burkholderia cepacia), Pseudomonas chlororaphischlororaphis, Pseudomonas fluorescens, Pseudomonas proradix, Pseudomonas putida, Pseudomonas syringae, Serratia entomophila, Serratia marcescens, Streptomyces colombiensis, Streptomyces galbus, Streptomyces goshikiensis, Streptomyces griseoviridis, Streptomyces lavendulae lavendulae, Streptomyces prasinus, Streptomyces saraceticus, Streptomyces venezuelae, Xanthomonas campestris, Xenorhabdus luminescens, Xenorhabdus nematophila, Rhodococcus globalis globerulus AQ719 (NRRL Accession No. B-21663), Bacillus sp. AQ175 (ATCC Accession No. 55608), Bacillus sp. AQ177 (ATCC Accession No. 55609), Bacillus sp. AQ178 (ATCC Accession No. 53522), and Streptomyces sp. strain NRRL Accession No. B-30145.

[0063] In some embodiments, the bacterium is Pseudomonas fluorescens or Bacillus megaterium. In a further embodiment, the bacterium is Pseudomonas fluorescens. In a preferred aspect, the bacterium is Pseudomonas fluorescens SWB25. In another further embodiment, the bacterium is Pseudomonas fluorescens F113. In another further embodiment, the bacterium is Pseudomonas fluorescens CHA0. In another further embodiment, the bacterium is Pseudomonas fluorescens Pf-5. In another further embodiment, the bacterium is Pseudomonas fluorescens FW300 N2E2.

[0064] Rhizobacteria colonize the surface or intercellular spaces of host plant roots, often forming root nodules. In some embodiments, the root-associated bacteria are plant growth-promoting rhizobacteria (PGPR). Some common examples of PGPR genera that exhibit plant growth-promoting activity include Pseudomonas, Azospirillum, and Bacillus. Other known PGPRs include Mesorhizobium ciceri, Burkholderia ambifaria, Mycobacterium phlei, and G. diazotrophicus. Those skilled in the art will recognize that PGPRs describe soil bacteria that colonize plant roots and enhance plant growth. The PGPR is not intended to encompass bacteria that have pathogenic effects on plants, such as harmful rhizobacteria (DRB). Six strains of rhizobacteria have been identified as DRB, including the genera Enterobacter, Klebsiella, Citrobacter, Flavobacterium, Achromobacter, and Arthrobacter.

[0065] In some embodiments, the bacterium is a Gram-negative bacterium. In some embodiments, the bacterium is a Pseudomonas bacterium. In some embodiments, the bacterium is not Komagataibacter xylinus (also known as Acetobacter xylinum and Gluconacetobacter xylinus).

[0066] In some embodiments, the bacterium is selected from the following Pseudomonas fluorescens strains: Pseudomonas fluorescens CHA0 (CP043179.1), Pseudomonas fluorescens F113 (CP003150.1); Pseudomonas fluorescens FW300 N2E2 (CP015225.1); Pseudomonas fluorescens Pf-275 (CP031648.1); Pseudomonas fluorescens Pf-5 (CP000076.1); Pseudomonas fluorescens Pf0-1 (CP000094.2); Pseudomonas fluorescens FR1 (CP025738.1); Pseudomonas fluorescens DR133 (CP048607.1); and Pseudomonas fluorescens 2P24 (CP025542.1). Strains CHA0 and Pf-5 are currently believed to belong to the novel bacterial species Pseudomonas protegens, a widely distributed Gram-negative plant-protecting bacterium. However, in the art, these particular strains (CHA0 and Pf-5) are also referred to as strains of Pseudomonas fluorescens. Thus, in some instances, the bacterium is Pseudomonas protegens, particularly when referring to strains CHA0 and Pf-5. In a further aspect, the bacterium is Pseudomonas fluorescens F113.

[0067] cellulose In some embodiments, the cellulose is bacterial cellulose. In some embodiments, the cellulose produced by genetically modified microorganisms or bacteria is secreted extracellularly. Without being bound by theory, bacterial cellulose is believed to have properties different from plant cellulose, characterized by high purity, strength, moldability, and high water retention. While the water retention value of plant cellulose is around 60%, the water retention value of bacterial cellulose has been shown to be 1000% of the weight of the cellulose sample (Klemm et al., 2001). In some embodiments, the secreted bacterial cellulose forms a network around the plant root. In some embodiments, the bacterial cellulose network forms a spongy network. In some embodiments, the cellulose network is generated around the plant root.

[0068] The bacterial cellulose network produced by the genetically modified microorganisms or bacteria of the present invention is expected to facilitate water management. Typically, the bacterial cellulose network retains water and provides an osmotic effect when roots need water. Furthermore, the bacterial cellulose network may create an environment conducive to an increased soil microbiome, resulting in healthier soil and crops. Furthermore, the bacterial cellulose network has the potential to prevent localized flooding due to dramatic weather events. Furthermore, the bacterial cellulose network is expected to have the ability to act as a bioscaffold to retain more nutrients from biofertilizers around the roots and prevent fertilizer runoff.

[0069] In some embodiments, bacterial cellulose retains water. Increased water retention is expected to result in increased crop viability and yield. In further embodiments, bacterial cellulose facilitates reduced water evaporation. Reduced water evaporation is believed to reduce inefficient water use. Thus, the genetically modified microorganisms or bacteria of the present invention are expected to increase the amount of water retained around plant root systems, thereby increasing crop viability and yield in climates with reduced rainfall and / or drought. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria are applied to plants after planting but before harvesting the plants. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria are applied to the soil before planting the plants. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria are applied to plant seeds before planting.

[0070] The terms "increased cellulose production" and "increasing cellulose production" are used herein to describe a greater amount of cellulose produced in a genetically engineered microorganism or bacterium compared to a reference microorganism or bacterium, optionally of the same strain or species. In some embodiments, the reference microorganism is a wild-type microorganism of the same strain or species. In some embodiments, the reference bacterium is a wild-type bacterium of the same strain or species. The increase in cellulose production can be 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, etc., compared to the reference microorganism or bacterium. The amount of cellulose produced by a genetically engineered microorganism or bacterium can be quantified by techniques measuring the dry and / or wet weight of the cellulose biomass. The genetically engineered microorganisms or bacteria of the present invention are expected to increase the dry and / or wet weight of the cellulose biomass compared to the reference microorganism or bacterium, respectively. Bacterial cellulose can be quantified as described in Jozala AF et al., 2014 (incorporated by reference). For example, bacterial cellulose can be collected, rinsed with distilled water, and immersed in NaOH 1N at 60°C for 90 minutes to remove attached cells. The bacterial cellulose was then washed with distilled water and dried at 50°C for 24 hours to obtain the bacterial cellulose yield concentration in mg mL -1 It can be evaluated as (mass of BC (mg) / volume of medium (mL)).

[0071] Cellulose synthesis and secretion The synthesis of bacterial cellulose is a multistep process involving two major mechanisms: the synthesis of uridine diphosphate (UDP-glucose) and the subsequent polymerization of glucose into long unbranched chains by cellulose synthase.

[0072] The proteins described herein are proteins involved in cellulose synthesis and / or secretion. In some embodiments, the microorganism or bacterium is modified to overexpress at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, or at least twelve of the proteins involved in cellulose synthesis and / or secretion.

[0073] The bacterial cellulose biosynthesis (bcs) operon, which encodes the cellulose synthase complex for cellulose biosynthesis and secretion, was first identified in Komagataibacter xylinus (also known as Acetobacter xylinum and Gluconacetobacter xylinus). In some embodiments, the microorganism or bacterium is genetically modified to overexpress at least one protein from the cellulose synthase complex. In some embodiments, the microorganism or bacterium is modified to overexpress at least one, at least two, at least three, or at least four of the proteins from the cellulose synthase complex.

[0074] K. xylinus has been identified as the most efficient bacterial cellulose producer among cellulose-producing fungal species. In particular, bacterial cellulose produced by Komagataebacter species exhibits unique properties, including high mechanical strength, high water absorption capacity, high crystallinity, and an ultrafine, highly purified fibrous network structure (Vandamme et al., 1998). Without being bound by theory, genetic modification of microorganisms, bacteria, or root-associated bacteria with cellulose synthesis proteins from K. xylinus is expected to result in increased and more efficient cellulose production.

[0075] In some embodiments, the genetically engineered microorganism, bacterium, or root-associated bacterium is genetically modified with an exogenous nucleic acid encoding at least one protein from a bacterial cellulose synthase complex. In some embodiments, the genetically engineered microorganism, bacterium, or root-associated bacterium is modified with at least one protein from a cellulose synthase complex derived from K. xylinus. For purposes of the present invention, components of the cellulose synthase complex are described herein.

[0076] For purposes of the present invention, the "bcs operon" encodes four protein subunits, BcsA, BcsB, BcsC, and BcsD, that form the cellulose synthase complex. The BcsA subunit, located on the cytoplasmic face of the inner membrane, possesses a catalytic β-1,4-glycosyltransferase domain responsible for polymerizing uridine diphosphate glucose (UDP-glucose) monomers into the β-1,4-glucan chains of cellulose. The activity of the catalytic domain is regulated by bis-(3'→5')-cyclic diguanylate, an allosteric activator of bacterial cellulose synthesis. BcsB binds to BcsA in the periplasm via a single C-terminal transmembrane helix, where it stabilizes BcsA and directs the glucan chains into the periplasmic space using two sugar-binding domains. Secretion of bacterial cellulose from the periplasm to the extracellular environment is thought to be facilitated through the action of BcsC, which, based on its structure, is predicted to form a pore in the outer membrane of K. xylinus. Consistent with the view that BcsC is an outer membrane porin, it has been observed that BcsC is essential in vivo but not for bacterial cellulose synthesis in vitro. Ultimately, bacterial cellulose crystallization is achieved through the action of BcsD, a cylindrical octameric periplasmic protein containing four helical channels that facilitates hydrogen bonding of the four glucan chains during BcsC-mediated extrusion. Furthermore, in K. xylinus, a BcsC mutant was shown to be unable to produce cellulose fibers, whereas a BcsD mutant produced approximately 40% less cellulose than the wild type (Wong et al., 1990). Bacterial cellulose is distinguished from its plant counterpart by its high crystallinity index. In particular, K. xylinus produces two crystalline pseudomorphs of bacterial cellulose, known as cellulose I and cellulose II, which require the cellulose synthase-related BcsD subunit. This subunit has been characterized as linking cellulose polymerization and crystallization.

[0077] In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress at least one of the genes bcsA, bcsB, bcsC, and bcsD. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress the bcsA and bcsB genes. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress the bcsA and bcsB genes as well as at least one of the bcsC and bcsD genes. In further embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress at least bcsA, bcsB, and bcsD. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress the bcs operon. In further embodiments, the bcsA, bcsB, bcsC, bcsD, and bcs operon are each isolated from K. xylinus.

[0078] cmcAx (also known as bcsZ) is located upstream of the bcs operon and encodes an endo-β-1,4-glucanase with cellulose hydrolysis ability. It has been shown that exogenous CmcAx enhances bacterial cellulose production in K. xylinus at low levels, while endogenous overexpression of cmcAx increases bacterial cellulose yield. Without being bound by theory, it is expected that the cellulose hydrolysis activity of CmcAx exerts a regulatory effect on bacterial cellulose biosynthesis. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress the cmcAx gene. In some embodiments, the microorganism is modified with a cmc gene. In further embodiments, the cmcAx gene is isolated from K. xylinus.

[0079] ccpAx (also known as bcsH) is located in the same upstream operon as cmcAx and encodes the cellulose complementation protein (ccpAx), which is required for bacterial cellulose biosynthesis in vivo. CcpAx has been shown to interact with BcsD in the periplasm. This unique mechanism is believed to explain the extremely high activity of K. xylinus. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress the ccpAx gene. In some embodiments, the microorganism is modified with a ccp gene. In further embodiments, the ccpAx gene is isolated from K. xylinus.

[0080] Downstream of the BC synthesis operon is bglAx (also known as bglxA), which encodes β-glucosidase, which is secreted and has the ability to hydrolyze more than three β-1,4-glucose units (cellotriose). This enzyme is not essential for bacterial cellulose production, but disruption of the bglAx gene has been shown to reduce bacterial cellulose production (Tajima et al., 2001; Kawano et al., 2002). In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress the bglAx gene. In some embodiments, the microorganism is modified with a bgl gene. In further embodiments, the bglAx gene is isolated from K. xylinus.

[0081] Phosphoglucomutase, also known as celB, catalyzes the interconversion between glucose-1-phosphate (G-1-P) and glucose-6-phosphate (G-6-P). Without being bound by theory, it is believed that the conversion of G-6-P to G-1-P promotes cellulose production. Phosphoglucomutase has been shown to be essential for the formation of extracellular cellulose, as pgm mutants are unable to produce cellulose. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress the pgm gene. In a further embodiment, the pgm gene is isolated from K. xylinus.

[0082] UTP-glucose-1-phosphate is an enzyme involved in carbohydrate metabolism, synthesizing UDP-glucose from glucose-1-phosphate (G-1-P) and UTP. UDP-glucose is an important component in the production of cellulose. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress the galU gene. In further embodiments, the galU gene is isolated from K. xylinus.

[0083] Diguanylate cyclase is an enzyme that catalyzes the conversion of two GTPs into two diphosphates and cyclic GMP. It can be introduced into bacterial cells as the dcg gene or cdg operon. The cdg operon contains cyclic di-GMP phosphodiesterase (pdeA) and diguanylate cyclase (dcg). Diguanylate cyclase catalyzes the formation of cyclic di-GMP, while phosphodiesterase A catalyzes its degradation. Without being bound by theory, it is believed that cyclic di-GMP is an allosteric activator of bacterial cellulose synthesis. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress the dcg gene and / or cdg operon. In further embodiments, the dcg gene and cdg operon, respectively, are isolated from K. xylinus.

[0084] In some embodiments, the genetically engineered microorganism, bacterium, or root-associated bacterium is modified to overexpress at least one or more genes selected from the group including: the bcsA gene; the bcsB gene; the bcsC gene; the bcsD gene; the cmcAx gene; the ccpAx gene; the bglAx gene; the pgm gene; the galU gene; the cdg operon; and the dgc gene.

[0085] In some embodiments, the genetically engineered microorganism, bacterium, or root-associated bacterium contains the bcs operon and the following genes: a) cmcAx gene; b) the ccpAx gene; c) bglAx gene; d) pgm gene; e) galU gene; f) the cdg operon; and / or g) dgc gene or at least one of the operons is modified to overexpress.

[0086] In further embodiments, the genetically engineered microorganism, bacterium, or root-associated bacterium further comprises at least one, at least two, at least three, at least four, at least five, or at least six of the genes or operons described by a) through g). In some embodiments, the genetically engineered microorganism, bacterium, or root-associated bacterium further comprises the genes and operons of a) through g). In some embodiments, the genetically engineered microorganism, bacterium, or root-associated bacterium further consists of the genes and operons of a) through g). In some embodiments, the genetically modified microorganism, bacterium, or root-associated bacterium of the present invention comprises the bcs operon and at least the cmcAx, ccpAx, and bglAx genes. In some embodiments, the genetically modified microorganism, bacterium, or root-associated bacterium of the present invention comprises the bcs operon and at least the cmc, ccp, and bgl genes. In some embodiments, the genetically modified microorganisms, bacteria, or root-associated bacteria of the present invention comprise the bcs operon and at least the cmcAx, ccpAx, and bglAx genes. In some embodiments, the genetically modified microorganisms, bacteria, or root-associated bacteria of the present invention comprise the bcs operon and at least the cmc, ccp, and bgl genes. In some embodiments, the genes are heterologous.

[0087] In some embodiments, microorganisms, bacteria, or root-associated bacteria that contain an endogenous bcs operon that does not contain all of BcsA, BcsB, BcsC, and BcsD can be modified with at least one of the genes of the bcs operon (bcsA, bcsB, bcsC, bcsD). Typically, bacteria are modified with a bcs gene that is not normally expressed. For example, Pseudomonas fluorescens SBW25 expresses only BcsA, BcsB, and BcsC of the bcs operon and is therefore modified to express BcsD according to the present invention. In some embodiments, the root-associated bacterium Pseudomonas fluorescens SBW25 is modified with an exogenous nucleic acid containing bcsD.

[0088] Without being bound by theory, it is expected that the bcs operon and any combination of the cmcAx, ccpAx, bglAx, pgm, galU, dcg, and / or cdg operons promote the synthesis and secretion of cellulose in the host bacterium. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the invention can include multiple copies of any of the genes or operons described herein.

[0089] In some aspects, the present invention relates to introducing cellulose synthesis genes (preferably cmcAX, ccpAX, bcsA, bcsB, bcsC, bscD, and / or bglxA) into a foreign host present in soil. In some aspects, the present invention provides a microorganism genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, wherein the genetically modified bacterium is modified with one or more heterologous genes, and the genes include the bcsA gene, the bcsB gene, the bcsC gene, and / or the bcsD gene. In some embodiments, the genes include the bcsA gene, the bcsB gene, the bcsC gene, and the bcsD gene. In some embodiments, the genes further include the cmcAx gene, the ccpAx gene, and / or the bglAx gene.

[0090] In some embodiments, the genetically modified bacterium is genetically modified with an exogenous nucleic acid comprising a bcs operon, wherein the bcs operon comprises the bcsA gene, the bcsB gene, the bcsC gene, and the bcsD gene. In some embodiments, the genetically modified bacterium is further modified with an exogenous nucleic acid comprising at least one of a cmcAx gene, a ccpAx gene, and a bglAx gene.

[0091] In some aspects, the present invention provides genetically engineered microorganisms for producing cellulose, wherein the microorganism is genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and the genetically modified bacterium is modified to overexpress at least one or more exogenous genes, wherein the exogenous genes are selected from the group consisting of bcsA, bcsB, bcsC, bcsD, and optionally, ccpAx. In some embodiments, the microorganism is a bacterium, and optionally a root-associated bacterium. In some aspects, genetically engineered microorganisms are provided comprising one or more heterologous genes encoding the production of cellulose, wherein the genes are bcsA, bcsB, bcsC, and / or bcsD. In some embodiments, the genes are bcsA, bcsB, bcsC, and bcsD. In some embodiments, the genes further comprise cmcAx, ccpAx, and / or bglAx. In some embodiments, the microorganism is a bacterium. In further embodiments, the microorganism is a root-associated bacterium. In some aspects, each of the genes is isolated from K. xylinus.

[0092] In some embodiments, the genetically engineered microorganism further comprises a gene encoding green fluorescent protein (GFP). Without being bound by theory, it is believed that providing a host cell that expresses GFP is useful for tracking the genetically modified microorganism (e.g., bacteria) in the environment. Thus, in some embodiments, the genetically engineered microorganism comprises one or more heterologous genes that encode the production of cellulose, where the genes are bcsA, bcsB, bcsC, and / or bcsD, and further comprises a gene encoding GFP.

[0093] Overexpression The genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention are modified to overexpress at least one protein from a cellulose synthase complex.

[0094] The term "overexpression," as used herein, refers to the expression of a protein of interest in a microorganism or bacterium at a level higher than that expressed in a reference microorganism or bacterium, respectively, optionally in a comparable wild-type microorganism or bacterium, typically of the same strain or species. Overexpression can include, but is not limited to, constitutive or inducible expression. In some embodiments, a microorganism or bacterium does not endogenously express a protein of interest, and any expression level of that protein in a microorganism or bacterial cell is considered "overexpression" of that protein for purposes of the present invention. In the present invention, the term "overexpression of at least one protein involved in cellulose synthesis and / or secretion" or "overexpression of at least one protein from a cellulose synthase complex" means that at least one protein involved in cellulose synthesis is expressed in a microorganism or bacterium at a level higher than that expressed in the corresponding reference microorganism or bacterium, respectively. In some embodiments, the reference microorganism is a wild-type microorganism. In some embodiments, the reference microorganism is of the same species as the modified microorganism. The reference microorganism may be of the same strain as the modified microorganism. In some aspects, the reference microorganism is a wild-type bacterium of the same strain or species as the modified microorganism. In some aspects, the reference bacterium is a wild-type bacterium. In some aspects, the reference bacterium is of the same species as the modified bacterium. The reference bacterium may be of the same strain as the modified bacterium. In some aspects, the reference bacterium is a wild-type bacterium of the same strain or species as the modified bacterium.

[0095] Overexpression can be achieved by any method known to those skilled in the art. Generally, it can be achieved by increasing gene transcription / translation, for example, by increasing the copy number of the gene, or by changing or modifying the regulatory sequences or sites associated with gene expression. For example, overexpression can be achieved by introducing one or more copies of a polynucleotide encoding a gene of interest operably linked to a regulatory sequence (e.g., a promoter). To achieve high expression levels, the gene can be operably linked to a strong constitutive promoter and / or a strong ubiquitous promoter. Such a promoter can be an endogenous promoter or a recombinant promoter. Alternatively, the regulatory sequence can be removed to make expression constitutive. The native promoter of a given gene can be replaced with a heterologous promoter that increases gene expression or directs constitutive expression of the gene. Typically, genome editing methods such as CRISPR, TALEN, and zinc finger nucleases can be used in accordance with the present invention to achieve overexpression of cellulose synthesis and / or secretory proteins. For example, CRISPR genome editing can be used to remove regulatory sequences, resulting in constitutive expression of the gene of interest. Cellulose synthesis and / or secretion proteins (e.g., proteins of the cellulose synthase complex and its associated proteins) can be overexpressed by the host cells by more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, more than 200%, or more than 300% compared to the host cells prior to engineering when cultured under the same conditions.

[0096] In one embodiment, overexpression of cellulose synthesis and secretion genes is achieved by altering or modifying regulatory sites associated with gene expression. In another embodiment, overexpression of cellulose synthesis and secretion genes is achieved by increasing the copy number of the cellulose synthesis and secretion genes. In a further embodiment, the microorganism, bacterium, or root-associated bacterium is modified with an exogenous nucleic acid comprising one or more cellulose synthesis and secretion genes. In some embodiments, the microorganism or bacterium is modified with one or more separate exogenous nucleic acids comprising one or more cellulose synthesis and secretion genes. In some embodiments, the exogenous nucleic acid is incorporated into a self-replicating plasmid within the microorganism or bacterium. In an alternative embodiment, the exogenous nucleic acid is incorporated into the genome of the microorganism or bacterium. In some embodiments, expression of the gene of interest is transient. In some embodiments, expression of the gene of interest is stable.

[0097] Detection of overexpression can be achieved by any method known to those skilled in the art, including, but not limited to, detecting proteins (machinery) for the synthesis of cellulose, such as the cellulose synthase complex, by techniques such as Western blot, qRT-PCR, and flow cytometry, or detecting the amount of cellulose produced by the genetically engineered bacteria by techniques such as determining the dry and / or wet weight of the cellulose biomass.

[0098] In some embodiments, the exogenous nucleic acid is introduced into a microorganism, bacterium, or root-associated bacterium. As used herein, the nucleic acid can be any nucleic acid (DNA or RNA) having a nucleotide sequence with a predetermined degree of sequence identity to the genes of the bcs operon, cmcAx gene, ccpAx gene, bglxA gene, pgm gene, galU gene, cdg operon, and / or dgc gene isolated from K. xylinus, as well as to an RNA transcript of any one of these sequences, to a fragment of any one of the foregoing sequences, or to a complementary sequence of any one of these sequences or fragments. The predetermined degree of sequence identity can be at least 60% to 100% sequence identity. More preferably, the predetermined degree of sequence identity can be one of at least 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. As used herein, "exogenous nucleic acid" refers to a nucleotide sequence that is foreign, e.g., not endogenous to the host cell.

[0099] The term "endogenous," with respect to a polynucleotide or protein, refers to a polynucleotide or protein that is naturally present in a host cell. The term "heterologous," with respect to a polynucleotide or protein, refers to a polynucleotide or protein that does not naturally occur in a host cell. In a preferred embodiment, the exogenous nucleic acid is a heterologous nucleic acid.

[0100] The term "recombinant," when used in reference to a subject cell, nucleic acid, protein, or vector, indicates that the subject has been modified from its native state. Thus, for example, a recombinant cell expresses a gene not found in the native (non-recombinant) form of the cell, or expresses a native gene at a level or under conditions different from those found in nature. A recombinant nucleic acid differs from the native sequence by one or more nucleotides and / or is operably linked to a heterologous sequence, e.g., a heterologous promoter in an expression vector. A recombinant protein may differ from the native sequence by one or more amino acids and / or may be fused to a heterologous sequence. An engineered microorganism or bacterium can be considered a recombinant microorganism or bacterium. In one aspect, a microorganism or bacterial cell is genetically engineered by introducing into the cell an expression cassette or vector containing an exogenous nucleic acid sequence encoding machinery for cellulose synthesis and secretion, e.g., a cellulose synthase complex. The nucleic acid sequence may be operably linked to one or more control sequences that direct expression of the nucleic acid in the microorganism or bacterial cell. The control sequences may include a promoter recognized by the microorganism or bacterial cell. The promoter contains a transcriptional control sequence that mediates the expression of the apparatus for cellulose synthesis. The promoter may be any polynucleotide that exhibits transcriptional activity in microorganisms or bacterial cells, including mutant, truncated, and hybrid promoters. The promoter may be a constitutive or inducible promoter, preferably a constitutive promoter. The control sequence may also include appropriate transcription initiation, termination, and enhancer sequences. In some embodiments, the expression cassette comprises or consists of a nucleic acid sequence encoding the apparatus for cellulose synthesis and secretion, operably linked to a transcriptional promoter and a transcriptional terminator.

[0101] As used herein, a "vector" is an oligonucleotide molecule (DNA or RNA) used as a vehicle for introducing exogenous genetic material into cells. The vector may be an expression vector for expressing exogenous genetic material in cells. Such a vector may include a promoter sequence operably linked to a nucleotide sequence encoding the gene sequence to be expressed. The vector may also include a stop codon and an expression enhancer. Any suitable vector, promoter, enhancer, and stop codon known in the art can be used in the present invention. Suitable vectors include plasmids, binary vectors, viral vectors, and artificial chromosomes (e.g., yeast artificial chromosomes). In some embodiments, the vectors of the present invention are isolated vectors. As used herein, an "expression cassette" is a separate component of vector DNA consisting of a gene and regulatory sequences to be expressed in a host cell. An expression cassette typically contains one or more genes and sequences controlling their expression.

[0102] As used herein, a "constitutive promoter" is a promoter that is active under most conditions and / or at most stages of development. The use of constitutive promoters in expression vectors used in biotechnology has several advantages, including: high-level production of proteins used to select transgenic cells or organisms; high-level expression of reporter proteins or scorable markers that allow for easy detection and quantification; high-level production of transcription factors that are part of a regulated transcription system; production of compounds that require ubiquitous activity in vivo; and production of compounds required at all stages of development. Alternatively, non-constitutive promoters can be used. As used herein, a "non-constitutive promoter" is a promoter that is active under certain conditions. In embodiments, the promoter is an inducible promoter. In some embodiments, the inducible promoter is a sugar-inducible promoter. In some embodiments, the promoter is an arabinose-inducible promoter.

[0103] In a preferred embodiment, the vector is a vector that, when introduced into microorganisms or bacterial cells, is integrated into the genome and replicates together with the chromosome into which it is integrated.In some embodiments, the integration of the gene encoding the apparatus for cellulose synthesis is considered to be integrated into a non-essential chromosomal locus.A non-limiting example of a non-essential chromosomal locus is the locus-6- on the 6.6 Mbp chromosome of SBW25 (Rainey and Bailey, 1996), using the method shown by Bailey et al., 1995 (incorporated by reference).Typically, the insertion of the gene of interest is mediated by site-specific homologous recombination.In some embodiments, the insertion of the gene of interest is mediated by CRISPR genome editing.Typically, CRISPR knock-in is mediated by homology-directed repair (HDR).Without being bound by theory, it is expected that the expression of new gene sequences and the extra metabolic activity due to environmental variability are a safeguard against the uncontrolled growth of genetically modified bacteria in the environment. For example, a microorganism or bacterium that produces increased amounts of cellulose can only survive in an environment that supports its growth, such as growing in and around plant roots. If the genetically modified microorganism or bacterium grows in an unfavorable environment, the extra metabolic burden of producing increased amounts of cellulose could lead to a decrease in the viability of the genetically modified microorganism or bacterium in the broader environment, thereby improving the safety of the genetically modified microorganism or bacterium.

[0104] A counter-selectable marker may be used in the expression system. An example of a selectable marker is a sucrose sensitivity system in which the vector encodes sacB. Examples of suitable vectors include, but are not limited to, recombinant integrative or non-integrative vectors. Examples of vectors include pGEX series vectors, pET series vectors, and pEX series vectors. In some embodiments, a pEX18Ap vector is used. In some embodiments, a mini CTX1 vector is used. In some embodiments, a pFLP2 vector is used. pFLP2 is a removal vector that can be used to remove undesired sequences. In some embodiments, the insertion site in the host microorganism is attb, defined by SEQ ID NO: 1: TGAGTTCGAATCTCACCGCCTCCGCCATAT.

[0105] As used herein, the term "operably linked" can include situations in which a selected nucleotide sequence and a regulatory nucleotide sequence are covalently linked in such a way that expression of the nucleotide coding sequence is under the influence or control of the regulatory sequence. Thus, a regulatory sequence is operably linked to a selected nucleotide sequence if the regulatory sequence is capable of causing transcription of the nucleotide coding sequence that forms part or all of the selected nucleotide sequence. If necessary, the resulting transcript can be translated into a desired protein or polypeptide.

[0106] In some embodiments, a microorganism according to the invention is modified with a cmcAx gene having the nucleic acid sequence defined by SEQ ID NO:2. In some embodiments, the microorganism is modified with a cmcAx gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:2.

[0107] In some embodiments, a microorganism according to the invention is modified with a ccpAx gene having the nucleic acid sequence defined by SEQ ID NO:3. In some embodiments, the microorganism is modified with a ccpAx gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:3.

[0108] In some embodiments, a microorganism according to the invention is modified with a bcs operon comprising the bcsA, bcsB, bcsC and bcsD genes, having the nucleic acid sequence defined by SEQ ID NO:4.

[0109] In some embodiments, the microorganism is modified with a bcs operon having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:4.

[0110] In some embodiments, the microorganism according to the invention is modified with a gfp gene having the nucleic acid sequence defined by SEQ ID NO:5. In some embodiments, the microorganism is modified with a gfp gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:5.

[0111] In some embodiments, a microorganism according to the invention is modified with a bglAx gene having the nucleic acid sequence defined by SEQ ID NO:6. In some embodiments, the microorganism is modified with a bglAx gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:6.

[0112] In some embodiments, the microorganism is modified with a cmcAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO:2, a ccpAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO:3, a bcs operon having at least 65% nucleic acid sequence identity to SEQ ID NO:4, a gfp gene having at least 65% nucleic acid sequence identity to SEQ ID NO:5, and / or a bglAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO:6.

[0113] In some embodiments, the microorganism according to the invention is modified with a PhlZ quorum sensing promoter having the nucleic acid sequence defined by SEQ ID NO:7. In some embodiments, the microorganism is modified with a PhlZ quorum sensing promoter having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:7.

[0114] In some embodiments, the microorganism according to the invention is modified with a Rox quorum sensing promoter having the nucleic acid sequence defined by SEQ ID NO:8. In some embodiments, the microorganism is modified with a Rox quorum sensing promoter having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:8.

[0115] In some embodiments, a microorganism according to the invention is modified with an AfmR quorum sensing promoter having the nucleic acid sequence defined by SEQ ID NO:9. In some embodiments, the microorganism is modified with an AfmR quorum sensing promoter having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:9.

[0116] In some embodiments, a microorganism according to the invention is modified with a cmcAx gene having a nucleic acid sequence defined by SEQ ID NO:10. In some embodiments, the microorganism is modified with a cmcAx gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:10.

[0117] In some embodiments, a microorganism according to the invention is modified with a ccpAx gene having the nucleic acid sequence defined by SEQ ID NO:11. In some embodiments, the microorganism is modified with a ccpAx gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:11.

[0118] In some embodiments, a microorganism according to the invention is modified with a bcsA gene having the nucleic acid sequence defined by SEQ ID NO:12. In some embodiments, the microorganism is modified with a bcsA gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:12.

[0119] In some embodiments, a microorganism according to the invention is modified with a bcsB gene having the nucleic acid sequence defined by SEQ ID NO:13. In some embodiments, the microorganism is modified with a bcsB gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:13.

[0120] In some embodiments, a microorganism according to the invention is modified with a bcsC gene having the nucleic acid sequence defined by SEQ ID NO:14. In some embodiments, the microorganism is modified with a bcsC gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:14.

[0121] In some embodiments, a microorganism according to the invention is modified with a bcsD gene having the nucleic acid sequence defined by SEQ ID NO:15. In some embodiments, the microorganism is modified with a bcsD gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:15.

[0122] In some embodiments, the microorganism according to the invention is modified with a gfp gene having the nucleic acid sequence defined by SEQ ID NO:16. In some embodiments, the microorganism is modified with a gfp gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:16.

[0123] In some embodiments, a microorganism according to the invention is modified with a bglAx gene having the nucleic acid sequence defined by SEQ ID NO:17. In some embodiments, the microorganism is modified with a bglAx gene having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:17.

[0124] In some embodiments, the microorganism is modified with a cmcAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO:10, a ccpAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO:11, a bcsA gene having at least 65% nucleic acid sequence identity to SEQ ID NO:12, a bcsB gene having at least 65% nucleic acid sequence identity to SEQ ID NO:13, a bcsC gene having at least 65% nucleic acid sequence identity to SEQ ID NO:14, a bcsD gene having at least 65% nucleic acid sequence identity to SEQ ID NO:15, a gfp gene having at least 65% nucleic acid sequence identity to SEQ ID NO:16, and / or a bglAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO:17. In a further aspect, a promoter having at least 65% nucleic acid sequence identity to SEQ ID NO:7, SEQ ID NO:8 or SEQ ID NO:9 is operably linked to a cmcAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO:10, a ccpAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO:11, a bcsA gene having at least 65% nucleic acid sequence identity to SEQ ID NO:12, a bcsB gene having at least 65% nucleic acid sequence identity to SEQ ID NO:13, a bcsC gene having at least 65% nucleic acid sequence identity to SEQ ID NO:14, a bcsD gene having at least 65% nucleic acid sequence identity to SEQ ID NO:15, a gfp gene having at least 65% nucleic acid sequence identity to SEQ ID NO:16, and / or a bglAx gene having at least 65% nucleic acid sequence identity to SEQ ID NO:17.

[0125] In some embodiments, the microorganism according to the invention is modified with SEQ ID NO:18. In some embodiments, the microorganism is modified with a nucleic acid having at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity to SEQ ID NO:18. The above sequences can be used in any order and combination.

[0126] Quorum sensing system In some embodiments, the expression of cellulose synthesis genes is regulated by a cell density quorum sensing promoter. In further embodiments, the expression of cellulose synthesis genes is regulated by a cell density quorum sensing system. In further embodiments, the quorum sensing system is under the control of a constitutive promoter. In further embodiments, the quorum sensing system regulates the promoter that controls the expression of the genes disclosed herein. Without being bound by theory, it is expected that the use of the quorum sensing system controls the expression of cellulose synthesis genes, and when bacteria colonize the rhizosphere and reach a concentration threshold, the promoter is switched on and cellulose synthesis begins.

[0127] Quorum sensing (QS) is defined as the ability to detect and respond to cell population density through gene regulation. For example, bacteria can use quorum sensing to regulate phenotypic expression, such as biofilm formation, virulence factor expression, motility, bioluminescence, nitrogen fixation, and sporulation, which regulate their behavior. This function is based on the local density of the bacterial population in its immediate environment. In some embodiments, a quorum sensing operon is inserted into a host cell.

[0128] In some examples, Gram-positive bacteria use autoinducer peptide (AIP) as a signaling molecule. When high concentrations of AIP are detected in the local environment, AIP binds to a receptor and activates a kinase. The kinase then phosphorylates a transcription factor, which then regulates gene transcription. This is known as a two-component system. Therefore, in some embodiments, a two-component system is used. In some embodiments, the two-component system includes a sensor kinase (detecting signaling molecules) and a response regulator (regulating gene expression).

[0129] In another example, Gram-negative bacteria produce N-acylhomoserine lactones (AHLs) as signaling molecules. Typically, these AHLs directly bind to transcription factors to regulate gene expression. In some embodiments, a one-step process is used. Some Gram-negative bacteria are also known to utilize two-component systems.

[0130] In some embodiments, the genes disclosed herein are regulated by cell density-dependent autoinducible promoters.In some embodiments, the cellulose synthesis and / or secretion genes disclosed herein are under the control of cell density quorum-sensing promoters.When bacteria settle in the rhizosphere and reach a threshold density, it is expected that cellulose synthesis genes will be switched on.

[0131] In some embodiments, the quorum sensing system comprises a gene encoding a sensor kinase and a gene encoding a response regulator. In further embodiments, the quorum sensing system further comprises a promoter regulated by quorum sensing. In some embodiments, the nucleic acid comprising the gene encoding the sensor kinase and the gene encoding the response regulator is operably linked to a constitutive promoter. In further embodiments, a RoxS / RoxR quorum sensing system is used. In some embodiments, the RoxS / RoxR operon is inserted into the host cell. In alternative embodiments, the quorum sensing system comprises a gene encoding a signaling molecule (autoinducer) and a gene encoding a transcription / response regulator. In further embodiments, the quorum sensing system further comprises a promoter regulated by quorum sensing. In some embodiments, the nucleic acid comprising the gene encoding the signaling molecule and the gene encoding the transcription / response regulator is operably linked to a constitutive promoter. In further embodiments, a PhzR / PhzI quorum sensing system is used. In some embodiments, the PhzR / PhzI operon is inserted into the host cell.

[0132] In some aspects, the quorum sensing system activates a target gene promoter, hi further aspects, the response regulator binds to the target gene promoter. QS-based autoinducible promoter systems, particularly the bacterial RoxS / RoxR quorum sensing (QS) system, are described in Meyers A et al., 2019. The RoxS / RoxR quorum sensing system is a two-component system formed by a sensor histidine kinase (RoxS) and a response regulator (RoxR). RoxS phosphorylates RoxR, and this phosphorylated RoxR is then expected to regulate the expression of the cellulose synthesis and secretion genes disclosed herein by binding to putative RoxR recognition elements. In some embodiments, the RoxS / RoxR quorum sensing system is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, a quorum sensing-dependent RoxS / RoxR promoter is used to control the expression of the cellulose synthesis and secretion genes. In some embodiments, a promoter regulated by rox quorum sensing is used to control the expression of the genes described herein. In some embodiments, a quorum sensing-dependent RoxS / RosR promoter is operably linked to a nucleic acid encoding a gene disclosed herein. In some embodiments, the promoter comprises a RoxR recognition element.

[0133] The PhzR / PhzI quorum sensing system is also described. This system includes the transcriptional regulator PhzR and the AHL synthase PhzI. In some embodiments, the PhzR / PhzI quorum sensing system is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, a quorum sensing-dependent PhzR / PhzI promoter is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, a promoter regulated by phz quorum sensing is used to control the expression of the genes described herein. In some embodiments, the quorum sensing-dependent PhzR / PhzI promoter is operably linked to a nucleic acid encoding the gene disclosed herein.

[0134] In a further embodiment, the quorum sensing system is under the control of a constitutive promoter, which can be seen in Figures 4 and 5. In some embodiments, the RhlR / RhlI quorum sensing system is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, the RhlR / RhlI operon is inserted into host cells. In the RhlI / R system, rhlI directs the synthesis of N-(butanoyl)-homoserine lactone (C4-HSL), which then interacts with cognate RhlR to affect the transcription of target genes. In some embodiments, a quorum sensing-dependent RhlR / RhlI promoter is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, a promoter regulated by rhl quorum sensing is used to control the expression of the genes described herein. In some embodiments, the quorum sensing-dependent RhlR / RhlI promoter is operably linked to a nucleic acid encoding the genes disclosed herein.

[0135] In some embodiments, the LuxI / LuxR quorum sensing system is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, the LuxI / LuxR operon is inserted into a host cell. In some embodiments, the Lux / LuxR quorum sensing system is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, a quorum sensing-dependent LuxI / LuxR promoter is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, a promoter regulated by lux quorum sensing is used to control the expression of the genes described herein. In some embodiments, the quorum sensing-dependent LuxI / LuxR promoter is operably linked to a nucleic acid encoding a gene disclosed herein.

[0136] In some embodiments, the AfmI / AfmR quorum sensing system is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, the AfmI / AfmR operon is inserted into a host cell. In some embodiments, the AfmI / AfmR quorum sensing system is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, a quorum sensing-dependent AfmI / AfmR promoter is used to control the expression of cellulose synthesis and secretion genes. In some embodiments, a promoter regulated by afm quorum sensing is used to control the expression of the genes described herein. In some embodiments, the quorum sensing-dependent AfmI / AfmR promoter is operably linked to a nucleic acid encoding a gene disclosed herein.

[0137] Without wishing to be bound by theory, the quorum sensing system acts as a biosafety element. The genetically engineered microorganisms of the present invention are expected to colonize the rhizosphere environment of the target plant because the plant and bacteria live in a beneficial symbiotic relationship. In this biosafety system, cellulose expression is achieved only when the bacterial concentration is high. Therefore, when the genetically engineered microorganisms of the present invention are not present in their optimal rhizosphere environment, the cellulose gene is not expressed, and the genetically engineered microorganisms will act as wild-type strains.

[0138] In some embodiments, the heterologous cellulose synthesis and / or secretion gene is regulated by a quorum sensing system. In some embodiments, the heterologous cellulose synthesis and / or secretion gene is regulated by a quorum sensing-regulated promoter.

[0139] In some embodiments, a promoter regulated by a quorum sensing system is operably linked to a nucleic acid encoding one or more of the exogenous genes of the present invention, and the expression of the gene is regulated by the quorum sensing system. In some embodiments, the exogenous genes include the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the cmc gene, the ccp gene, the bgl gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. In further embodiments, the gene is heterologous.

[0140] composition In some embodiments, the genetically modified microorganisms of the present invention are delivered to plants as an inoculant that can be added directly to the soil. In some embodiments, the genetically modified bacteria of the present invention are delivered to plants as a bacterial inoculant that can be added directly to the soil. In other embodiments, the genetically modified microorganisms or bacteria of the present invention are delivered to plants as a liquid formulation that can be added directly to the soil. In some embodiments, the microbial or bacterial inoculant is a peat-based formulation. In further embodiments, the peat-based formulation is used to coat seeds or pellets for planting in furrows. In some embodiments, the genetically modified microorganisms or bacteria of the present invention are delivered to plants in microbeads. In further embodiments, the microbeads are alginate microbeads. It is expected that these alginate microbeads will encapsulate the microorganisms or bacteria, protecting them from environmental stresses and gradually releasing them into the soil as soil microorganisms degrade the polymer.

[0141] Typically, the genetically modified microorganisms or bacteria of the present invention can be applied in combination with biofertilizers. As used herein, a "biofertilizer" is a substance containing live microorganisms that promote plant growth by increasing the availability of primary nutrients to the host plant. Biofertilizers add nutrients to plants by nitrogen fixation, phosphorus solubilization, and promoting plant growth through the synthesis of growth-promoting substances. Biofertilizers do not contain chemicals that are harmful to the growing soil. Examples include Rhizobium, Azotobacter, Azospirium, and blue-green algae (BGA). Other examples include strains such as Pantoea agglomerans strain P5 or Pseudomonas putida strain P13, which are known in the art to solubilize phosphate from organic or inorganic phosphate sources. It is expected that the genetically modified microorganisms or bacteria of the present invention can be used in combination with such biofertilizers. In some embodiments, the genetically modified microorganisms or bacteria of the present invention can be administered to soil in combination with a biofertilizer in a single composition. In some embodiments, the genetically modified microorganisms or bacteria of the present invention can be administered to soil in combination with multiple biofertilizers in a single composition. In other aspects, the genetically modified microorganisms or bacteria of the present invention are administered separately from one or more biofertilizers.

[0142] In some embodiments, the genetically modified microorganisms or bacteria of the present invention are delivered to plants in combination with a fertilizer in a single composition. In some embodiments, the genetically modified microorganisms or bacteria of the present invention are delivered to plants in combination with multiple fertilizers in a single composition. In other embodiments, the genetically modified microorganisms or bacteria of the present invention are administered separately from one or more fertilizers. As used herein, a "fertilizer" is any material of natural or synthetic origin used to improve plant growth and yield.

[0143] In some embodiments, the compositions of the present invention are delivered to plants in microbeads. In a further embodiment, the microbeads are alginate microbeads. Typically, alginate is the most common polymeric material for encapsulating microorganisms for various industrial microbiological purposes, although other algal polysaccharides may be used (Bashan, Y et al., 2002). The main advantages associated with alginate preparations are their non-toxicity (reduced local environmental burden), degradability in soil, slow release of bacteria into the soil, and nearly unlimited shelf life (Bashan Y et al., 2002). In some embodiments, the microbeads are applied as wet microbeads. In some embodiments, the microbeads are applied as dry microbeads. In some embodiments, the microbeads have a diameter of 100 μm to 500 μm. In a preferred embodiment, the microbeads have a diameter of 100 μm to 200 μm. Microbeads with a diameter between 100 μm and 500 μm are used in 10 6 CFU beads -1 It is expected that the composition of the present invention can maintain a temperature above 100°C, which is sufficient to inoculate the seeds. In some embodiments, the compositions of the present invention are delivered to plants as macrobeads. In further embodiments, the macrobeads are alginate macrobeads. It is expected that the alginate macrobeads will behave similarly to microbeads. In some embodiments, the macrobeads are 1 mm to 5 mm in diameter. In further embodiments, the macrobeads are 1 mm to 3 mm in diameter.

[0144] In some aspects, the microbial or bacterial composition is applied to the plant after planting but before harvesting the plant. In some aspects, the microbial or bacterial composition is applied to the soil before planting the plant. In some aspects, the plant is a crop plant. In some aspects, the composition is used to coat seeds or pellets for planting in furrows.

[0145] Without being bound by theory, it is expected that genetically engineered microorganisms, bacteria, or root-associated bacteria according to the present invention will colonize plant roots following seed inoculation, resulting in enhanced plant growth. The following steps outline the colonization process: a) seed inoculation, b) proliferation in the spermosphere (the area surrounding the seed) in response to seed exudates, c) attachment to the root surface, and d) colonization of the developing root system.

[0146] In some embodiments, the microorganisms or bacteria are stored as a dry formulation and delivered to the soil as a liquid broth. method In one aspect of the present invention, a method for increasing water retention around plant roots is provided. The method comprises applying a genetically engineered microorganism, bacterium, or root-associated bacterium of the present invention to soil surrounding a plant. In some embodiments, water retention around the plant roots is increased compared to the same plant under the same conditions without the microorganism of the present invention. In some embodiments, the increase in water retention can be measured by an increase in soil water content. Soil water content can be calculated on a weight or volume basis. For example, gravimetric water content (θg) is the mass of dry soil, and is expressed as the mass of a soil sample (m wet ) was weighed, and the sample was dried to remove the moisture. dry ) and using the following formula:

[0147]

number

[0148] Alternatively, soil moisture content can be measured by volumetric water content (θv), which is the liquid water content per volume of soil. Volume is the ratio of mass to density (ρ) and can be calculated using the following formula:

[0149]

number

[0150] In some embodiments, the soil moisture content is increased by at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, etc. Another aspect of the present invention provides a method for reducing water consumption in agriculture, comprising applying a genetically engineered microorganism, bacterium, or root-associated bacterium of the present invention to the soil surrounding a plant. In some embodiments, the reduction in water consumption in agriculture is compared to the same plant under the same conditions without the microorganism of the present invention. In some embodiments, the amount of water used in agriculture is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, etc.

[0151] plant The genetically modified microorganisms or bacteria of the present invention are expected to increase the amount of water retained around a plant's root system, thereby increasing the viability and yield of crops in climates with reduced rainfall and / or drought, relative to the same plant under the same conditions (e.g., soil) without the bacteria of the present invention.

[0152] In some aspects of the invention, the plant is a cereal plant, corn, rice, wheat, soybean, sugarcane, maize, potato, tomato, tobacco, and cassava. In further aspects, the plant is a cereal plant, corn, rice, wheat, or soybean.

[0153] One aspect of the present invention provides plants comprising the genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention. In some embodiments, the plants comprise the isolated genetically engineered root-associated bacteria of the present invention, the population of genetically engineered root-associated bacteria of the present invention, or the bacterial composition of the present invention. In some embodiments, the genetically engineered root-associated bacteria, the isolated genetically engineered root-associated bacteria, or the population of genetically engineered root-associated bacteria is associated with the plant root. In some embodiments, the genetically engineered root-associated bacteria grows on the plant root. In some embodiments, the genetically engineered microorganisms, bacteria, or root-associated bacteria grows in the soil surrounding the plant root.

[0154] Carbon Capture The present invention provides a method for capturing carbon, comprising applying genetically engineered microorganisms to soil surrounding plant roots, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, and wherein the carbon is converted into cellulose by the microorganisms.

[0155] In some aspects, the genetically engineered microorganism is a microorganism according to the invention, an isolated genetically engineered microorganism of the invention, a population of genetically engineered microorganisms of the invention, or a composition of the invention.

[0156] In some aspects, carbon is absorbed as carbohydrates secreted by the plant, which are converted by microorganisms into cellulose, and in some aspects, the production of cellulose increases water retention around the plant roots.

[0157] In some aspects, the genetically engineered microorganism is selected from a bacterial cell, a fungal cell, or an algal cell. In some aspects, the genetically engineered microorganism is a bacterium. In further aspects, the genetically engineered microorganism is a root-associated bacterium.

[0158] The genetically engineered microorganisms, bacteria, or root-associated bacteria of the present invention excrete carbon-rich cellulose around plant roots, which not only stores large volumes of water but also sequester significant amounts of carbon, as described below.

[0159] During the synthesis process, glucose chains produced within the microorganism or bacteria are extruded through small holes in the cell membrane. The glucose chains form microfibrils, which then aggregate to form cellulose ribbons. These ribbons create a web-like network structure with numerous gaps between the fibers. The well-separated nanofibers of bacterial cellulose create an enhanced surface area and a highly porous matrix. The basic fibrous structure consists of β-1→4 glucan chains, with the molecular formula (C6H10O5)n. These chains are held together by hydrogen bonds. Bacterial cellulose microfibrils are approximately 100 times smaller than plant fibers. The fibrous network of bacterial cellulose consists of well-arranged three-dimensional nanofibers, resulting in the formation of a hydrogel film with a large surface area and high porosity. Unlike plant cellulose, bacterial cellulose is purer because it is not bound to lignin or hemicellulose. Furthermore, the three-dimensional nanofiber network has high water absorption capacity and tensile strength.

[0160] During photosynthesis, plants absorb carbon dioxide from the atmosphere and convert it into carbohydrates. These carbohydrates are then excreted in root exudates. These carbohydrates include many sugars, including glucose, fructose, and arabinose. These carbohydrates are essential as carbon sources for microbial habitats in the soil and are thought to promote cell proliferation and growth. Approximately 30% of the sugars produced in plants are thought to be secreted into the surrounding soil and supplied to the plant's microbiome.

[0161] The naturally occurring bacteria found in the soil around plants do not provide a substantial sequestering event to slow / reduce climate change. The inventors have surprisingly found that genetically engineered microorganisms, bacteria, and / or root-associated bacteria according to the present invention not only grow using this excreted glucose, but also advantageously metabolize and excrete these sugars as bacterial cellulose. Cellulose is composed of glucose molecules structurally formed by β-1,4-glycosidic bonds and intramolecular hydrogen bonds. This carbon captured in the soil surrounding plant roots directly improves plant health (e.g., by retaining water around plant roots). As a result, plants are able to absorb more carbon dioxide, thus continuing the cycle. Because bacterial cellulose can be decomposed over several months, carbon sequestration can be used by plants and microorganisms to grow stronger and maintain carbon in the soil. This is thought to form a cyclical event that never leaves the soil.

[0162] In some aspects, increased cellulose production leads to increased plant viability, which is expected to result in increased capture of atmospheric carbon by the plant and production of sugars that are converted to cellulose and sequester carbon in the soil.

[0163] In some embodiments, the production of cellulose by microorganisms or bacteria results in increased carbon sequestration in the surrounding soil. In some embodiments, the carbon captured is increased by at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, etc. The increase in carbon captured is compared to the same plant under the same conditions without the microorganism of the present invention. In some embodiments, the carbon is atmospheric carbon.

[0164] In some embodiments, the carbohydrate secreted by the plant is a sugar, hi further embodiments, the sugar is glucose, fructose, and / or arabinose.

[0165] use In some aspects, the present invention provides agricultural uses of genetically modified microorganisms, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose.

[0166] In another aspect, the present invention provides the use of a genetically modified microorganism to increase water retention around plant roots, wherein the microorganism has been genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion.

[0167] In another aspect, the present invention provides the use of genetically modified microorganisms in carbon capture, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, and carbon is converted to cellulose by the microorganisms.

[0168] In some aspects, the genetically engineered microorganism is a microorganism according to the invention, an isolated genetically engineered microorganism of the invention, a population of genetically engineered microorganisms of the invention, or a composition of the invention.

[0169] In some aspects, the genetically engineered microorganism is selected from a bacterial cell, a fungal cell, or an algal cell. In some aspects, the genetically engineered microorganism is a bacterium. In further aspects, the genetically engineered microorganism is a root-associated bacterium.

[0170] In some embodiments, a microorganism is genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, wherein the genetically modified bacterium is modified with an exogenous nucleic acid comprising the bcs operon, the bcs operon comprising the bcsA, bcsB, bcsC, and bcsD genes. In further embodiments, the exogenous nucleic acid further comprises the ccpAx gene. In some embodiments, the exogenous nucleic acid further comprises the cmcAx, ccpAx, and bglAx genes. In further embodiments, the genes are heterologous.

[0171] In some embodiments, the microorganism is genetically modified with one or more heterologous genes, wherein the genes are selected from the following: the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the cmcAx gene, the ccpAx gene, and the bglAx gene. In some embodiments, each of the genes is isolated from K. xylinus. In some embodiments, the genetically engineered microorganism is a bacterium, optionally a root-associated bacterium. In some embodiments, the genetically engineered microorganism is a plant growth-promoting rhizobacterium.

[0172] The features disclosed in the foregoing description, or in the following numbered embodiments or claims, or in the accompanying drawings, are appropriately expressed in their specific form, or in terms of means for performing a disclosed function, or a method or process for obtaining a disclosed result, but they can be utilized separately, or in any combination of such features, to realize the invention in various of its forms.

[0173] While the present invention has been described in conjunction with the exemplary embodiments above, many equivalent modifications and variations will become apparent to those skilled in the art given this disclosure. Accordingly, the exemplary embodiments of the present invention set forth above are considered to be illustrative and not limiting. Various changes can be made to the described embodiments without departing from the spirit and scope of the invention.

[0174] For the avoidance of doubt, the theoretical explanations provided herein are provided for the purpose of enhancing the understanding of the reader, and the inventors do not wish to be bound by any of these theoretical explanations.

[0175] Any section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. Throughout this specification, including the claims which follow, unless the context requires otherwise, the words "comprise" and "include," as well as variations such as "comprises," "comprising," and "including," are understood to imply the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of other integers or steps or groups of integers or steps.

[0176] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Ranges can be expressed herein as from "about" one particular value and / or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values ​​are expressed as approximations, it will be understood that the particular value forms another embodiment by use of the antecedent "about." With respect to numerical values, the term "about" is optional and means, for example, + / - 10%.

[0177] Numbered Aspects 1. Genetically engineered microorganisms for the production of cellulose, wherein the microorganisms are genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. 2. The genetically engineered microorganism of embodiment 1, wherein the cellulose is bacterial cellulose. 3. The genetically engineered microorganism of embodiment 1 or embodiment 2, wherein cellulose production is increased in the genetically modified microorganism compared to the reference microorganism. 4. The genetically engineered microorganism of any one of the preceding aspects, wherein the genetically modified microorganism is modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. 5. The genetically engineered microorganism of any one of the previous embodiments, wherein the exogenous nucleic acid comprises the bcs operon. 6. The exogenous nucleic acid is selected from the group consisting of: a) cmcAx gene; b) the ccpAx gene; c) bglAx gene; d) pgm gene; e) galU gene; f) the cdg operon; and / or g) dgc gene or at least one of an operon. 7. The genetically engineered microorganism of embodiment 5, wherein the exogenous nucleic acid further comprises a cmcAx gene, a ccpAx gene, and a bglAx gene. 8. The genetically engineered microorganism of any one of aspects 5 to 7, wherein the bcs operon, cmcAx gene, ccpAx gene, bglAx gene, pgm gene, galU gene, cdg operon, and / or dgc gene are isolated from K. xylinus. 9. The genetically engineered microorganism of any one of the previous aspects, wherein the microorganism is a bacterium, and optionally is Pseudomonas fluorescens. 10. The genetically engineered microorganism of any one of the previous embodiments, wherein the cellulose is secreted extracellularly. 11. The genetically engineered microorganism of embodiment 10, wherein the secreted cellulose forms an extracellular network. 12. The genetically engineered microorganism of embodiment 11, wherein the secreted cellulose network increases water retention around plant roots. 13. The genetically engineered microorganism of aspect 12, wherein the plant is a cereal plant, corn, rice, wheat, or soybean. 14. A method for increasing cellulose production in a microorganism compared to a reference microorganism, the method comprising modifying the microorganism to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. 15. The method for increasing cellulose production according to aspect 14, wherein the microorganism is modified with an exogenous nucleic acid encoding at least one protein from a cellulose synthase complex. 16. A vector comprising an exogenous nucleic acid comprising the bcs operon and at least one of the cmcAx gene, the ccpAx gene, the bglAx gene, the pgm gene, the galU gene, the cdg operon, and the dgc gene. 17. A method for producing a genetically engineered microorganism for producing cellulose, comprising the steps of: a) isolating the microorganism; and b) introducing into the microorganism a vector containing an exogenous nucleic acid comprising at least one gene selected from the group consisting of the bcsA gene; the bcsB gene; the bcsC gene; the bcsD gene; the cmcAx gene; the ccpAx gene; the bglAx gene; the pgm gene; the galU gene; the cdg operon; and the dgc gene. 10. A method comprising modifying a microorganism to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, comprising: 18. A genetically engineered microorganism obtainable by the method of embodiment 17. 19. The isolated genetically engineered microorganism of any one of aspects 1 to 13 or aspect 18. 20. A population comprising a genetically engineered microorganism according to any one of embodiments 1 to 13 or embodiment 18. 21. A composition comprising the genetically engineered population of embodiment 20. 22. The composition of aspect 21, wherein the composition further comprises a fertilizer and / or a biofertilizer. 23. A method for increasing water retention around plant roots, comprising applying genetically engineered microorganisms to soil surrounding the plant roots, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. 24. The method according to aspect 23, wherein the microorganism is selected from a genetically engineered microorganism according to any one of aspects 1 to 13 or aspect 18, an isolated genetically engineered microorganism according to aspect 19, a population of genetically engineered microorganisms according to aspect 20, or a composition according to aspect 21 or 22. 25. A method for reducing water consumption in agriculture, comprising applying genetically engineered microorganisms to soil surrounding plant roots, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. 26. The method according to aspect 25, wherein the microorganism is selected from a genetically engineered microorganism according to any one of aspects 1 to 13 or aspect 18, an isolated genetically engineered microorganism according to aspect 19, a population of genetically engineered microorganisms according to aspect 20, or a composition according to aspect 21 or 22. 27. A plant comprising a genetically engineered microorganism according to any one of aspects 1 to 13 or aspect 18, an isolated genetically engineered microorganism according to aspect 19, a population of genetically engineered microorganisms according to aspect 20, or a composition according to aspect 21 or 22, wherein the genetically engineered microorganism, isolated genetically engineered microorganism, or population of genetically engineered microorganisms is associated with a plant root. 28. A method for capturing carbon, comprising applying genetically engineered microorganisms to soil surrounding plant roots, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, and wherein the carbon is converted to cellulose by the microorganisms. 29. The method according to aspect 28, wherein the genetically engineered microorganism is a microorganism according to any one of aspects 1 to 13 or aspect 18, an isolated genetically engineered microorganism according to aspect 19, a population of genetically engineered microorganisms according to aspect 20, or a composition according to aspect 21 or 22. 30. The method of embodiment 28 or embodiment 29, wherein the carbon is absorbed as carbohydrates secreted by the plant, and the carbohydrates are converted to cellulose by microorganisms. 31. The method of any one of aspects 28-30, wherein the production of cellulose results in increased water retention around the plant roots. 32. Use in agriculture of genetically modified microorganisms, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. 33. Use of a genetically modified microorganism to increase water retention around plant roots, wherein the microorganism has been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. 34. Use of genetically modified microorganisms in carbon capture, wherein the microorganisms are genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, and carbon is converted into cellulose by the microorganisms. [Example]

[0178] Example 1 Manipulation of root-associated bacteria 1. Bacterial Strains and Plasmids Komagataibacter xylinus DSM 2325 is obtained from DSMZ (Braunschweig, Germany). Exemplary bacterial strains and plasmids are listed in Table 1.

[0179] K. xylinus is a member of the acetobacteria, a group of Gram-negative aerobic bacteria that produce acetic acid during fermentation. K. xylinus is unusual within this group in that it also produces cellulose.

[0180] 2. Genetic manipulation For genetic manipulation purposes, Escherichia coli (E. coli) TOP10 cells are used. E. coli cells are grown in Luria-Bertani (LB) medium (Invitrogen, Carlsbad, CA) at 37°C with orbital shaking at 225 rpm. Antibiotics (50 μg / ml ampicillin) are added to LB when necessary for plasmid maintenance. All DNA manipulations are performed according to standard protocols (Sambrook, J., 2001).

[0181] Pseudomonas fluorescens strain SBW25 (Rainey and Bailey, 1996) was used as a host for the insertion of the bacterial biosynthetic cellulose machinery. The nonessential locus -6- on the 6.6 Mbp chromosome of SBW25 was selected, as previously described (Rainey and Bailey, 1996) and described by Bailey et al., 1995. Two fragments (approximately 200 bp) flanking the -6- locus were amplified by PCR using P. fluorescens genomic DNA; genomic DNA was prepared using a genomic DNA extraction kit from Promega (Madison, WI). The upstream and downstream flanking fragments were amplified by PCR. The upstream and downstream regions of the -6-locus, bcs operon, pgm (phosphoglucomutase), galU (UTP-glucose-1-phosphate), cdg operon, and dgc independent gene (Table 2) from K. xylinus (Jang et al., 2019) were ligated into the EcoRI restriction enzyme site of the pEX18Ap vector using the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA) to obtain the pEX-bcs vector. This plasmid was transformed into E. coli TOP10 cells for amplification and identification of the modified pEX-bcs plasmid. The purified plasmid was then introduced into the -6-locus chromosomal site in P. fluorescens by electroporation for expression of the bcs bacterial biosynthetic cellulose machinery.

[0182] 3. Growth Conditions of Engineered Strains The following conditions are used to visually confirm successful expression of the bacterial biosynthetic cellulose machinery in P. fluorescens. This is followed by greenhouse and field trials for optimization of cellulose production in the model system. Nutrient broth medium is used for all cellulose synthesis experiments, using flasks containing 3.0 g / L meat extract, 10.0 g / L peptone (an enzymatic digest of casein), 5.0 g / L sodium chloride, pH 7. Cells are incubated at 30°C under static conditions for 5 days. Various carbohydrates are added to the medium for optimization. Routine experimental optimization of this protocol allows for adjustment of specific parameters to achieve best results according to specific field conditions.

[0183] [Table 1]

[0184] [Table 2]

[0185] Example 2 Applications of genetically modified bacteria The genetically modified bacteria will be delivered in biodegradable microbeads (microballs) containing nutrients that are added to currently commercially available biofertilizers.

[0186] This example describes a method for inoculating plants (or seeds) with genetically modified bacteria of the present invention using alginate microbeads. These alginate microbeads encapsulate the bacteria, protecting them from environmental stresses and gradually releasing them into the soil as soil microorganisms degrade the polymer. The raw material, Macrocystis pyrifera, is a renewable marine resource highly abundant in the Pacific Ocean.

[0187] 1. Microbead formation Microbeads can be produced using a device such as that described in Bashan et al. (2002) or any other suitable device. Typically, the microbeads produced are approximately 100 to 200 μm in diameter. The bacteria of the present invention are cultured as described above, and the bacterial suspension is then mixed with 2% sodium alginate (CICIMAR, La Paz, Mexico). Optionally, calcium-free skim milk may also be added to the alginate-bacteria suspension to produce more biodegradable beads. This suspension is then pressurized to 10-15 psi using a commercially available air compressor. The bacterial suspension is then forced through a 222 μm diameter capillary outlet, generating a fine spray of microdroplets. This mist is then collected using a stainless steel flask containing 0.1 M CaCl2 and rotating at 40 rpm to solidify the microbeads. The microbeads are then cured in the CaCl2 solution for 30 minutes. The wet microbeads are then extracted from the CaCl solution and then rinsed four times in 500 ml of saline (0.85% (w / v) NaCl) under sterile conditions. Optionally, the microbeads can be transferred to bacterial culture medium (under growth conditions) to allow bacterial growth. The microbeads are then separated from the suspension by filtration using Whatman filter paper and rinsed three times with 500 ml of saline.

[0188] 2. Drying Procedure Optionally, the microbeads can be dried before being applied to soil, plant roots, and / or seeds. In this drying method, 10 g of microbeads are placed in a thin layer on filter paper in a Petri dish and dried at 38±1°C for 48 hours. The dried microbeads can then be collected in a sealed container with silica gel until use. Alternatively, the dried microbeads can be prepared by standard freeze-drying. Wet and / or dry microbeads containing the genetically modified root-associated bacteria are then applied to the soil, plant roots, and / or seeds.

[0189] Example 3 Manipulation of root-associated bacteria 1. Bacterial Strains and Plasmids This method uses the Komagataibacter xylinus CGMCC 2955 strain and the Mini CTX1 vector, as well as the pFLP2 removal vector to remove undesired sequences.

[0190] 2. Genetic manipulation As before, E. coli TOP10 cells are used for genetic manipulation. E. coli cells are grown in Luria-Bertani (LB) medium (Invitrogen, Carlsbad, CA) at 37°C with orbital shaking at 225 rpm. Antibiotics (50 μg / ml ampicillin) are added to LB when necessary for plasmid maintenance. All DNA manipulations are performed according to standard protocols (Sambrook, J., 2001).

[0191] Pseudomonas strains CHA0, F113, FW300 N2E2, and Pf-5 are used as hosts for the insertion of bacterial biosynthetic cellulose machinery. The target insertion site in the genome of these strains is the attB site (SEQ ID NO: 1: TGAGTTCGAATCTCACCGCCTCCGCCATAT). The cellulose synthesis genes (cmcAX, ccpAX, BcsA, BcsA, BcsC, BcsD, BglAX) are inserted using the Mini CTX1 vector and the pFLP2 (Flp recombinase) vector. In this example, GFP is also inserted as a reporter gene, which can be seen in Figure 3. A quorum-sensing operon can also be added to the Pseudomonas strain to regulate the promoter controlling cellulose synthase gene expression (see Figure 4). The quorum-sensing operon, e.g., the PhzI / PhzR operon, is under the control of a constitutive promoter.

[0192] 3. Method Conjugation The recipient Pseudomonas strain and the E. coli donor and helper strains were grown in 3 ml of LB (with antibiotics as appropriate) for approximately 8 hours with rotation at 37°C. One milliliter of each culture was centrifuged in a microfuge at 8,000 x g for 2 minutes. The culture supernatant was aspirated, the cell pellet was resuspended in 1 ml of LB, and the cell suspension was centrifuged. The aspiration, resuspension, and centrifugation were repeated. The supernatant was aspirated, and the cell pellet was resuspended in 35 μl of LB. The cell suspension was spotted on LB agar and incubated overnight at 37°C. Cells were scraped and resuspended in LB, and serial 10-fold dilutions were made. 100 μl of each dilution was spread onto Vogel-Bonner minimal medium (VBMM; 10 mM tribasic sodium citrate, 9.5 mM citric acid, 57 mM dibasic potassium phosphate, 17 mM sodium ammonium phosphate, 1 mM magnesium sulfate, 0.1 mM calcium chloride, pH 7.0) agar plates containing antibiotics (gentamicin or tetracycline) and incubated overnight at 37°C. Chromosomal integration of miniTn7 was confirmed by PCR using oligonucleotide primers.

[0193] Electroporation The recipient Pseudomonas strain was grown in duplicate in 3 ml of LB for approximately 8 hours with rotation at 37°C. The two 3 ml cultures were then pooled and distributed into four microcentrifuge tubes. The cultures were centrifuged at 8,000 x g for 2 minutes, and each cell pellet was then resuspended in 1 ml of 300 mM sucrose and centrifuged twice. The four cell pellets were then resuspended and pooled for a total of 300 μl of 300 mM sucrose. 100 microliters of each suspension was transferred to an electroporation cuvette with a 1 mm gap width. 100 nanograms of pFLP2 plasmid was added to each suspension. The cells were electroporated at 1,800 V in an Eppendorf Electroporator 2510. 900 microliters of LB was added to each electroporation. The recovery cultures were then incubated with rotation at 37°C for 1 hour. Cultures can be serially diluted 10-fold, spread onto LB agar plates containing antibiotics (carbenicillin), and incubated overnight at 37°C.

[0194] Removal of antibiotic resistance cassette by Flp-FRT recombination A recipient Pseudomonas strain containing a chromosomal gentamicin resistance cassette flanked by FRT recombination sites was electroporated with the pFLP2 plasmid. To screen for removal of the gentamicin resistance cassette by Flp recombination, transformants were streaked on LB medium containing carbenicillin and LB medium containing gentamicin. Gentamicin-sensitive transformants were streaked on LB medium containing carbenicillin to LB medium containing 5% sucrose. Strains harboring the pFLP2 plasmid are sucrose-sensitive, while strains that have lost the plasmid are sucrose-resistant. To confirm removal of the gentamicin resistance cassette and loss of the pFLP2 plasmid, sucrose-resistant colonies were streaked on LB medium, LB medium containing gentamicin, and LB medium containing carbenicillin.

[0195] Example 4 Protocol for Testing of Genetically Modified Pseudomonas fluorescens 1. Experimental Design Corn (cultivar Pioneer P7892) was grown in 24-cell module trays using seeds and then grown at the 3- to 4-leaf stage in a commercial sandy loam soil containing the same weight of soil packed to the same bulk density. about Plants of similar size are transplanted into 10 L pots. The pots are inoculated with one of nine inoculation treatments (Table 3). Control inoculations consisted of mock inoculations using the same volume of growth medium or other medium without bacteria.

[0196] Five pot replicates are used for each inoculation treatment. These are arranged in a randomized block design in greenhouse beds in five blocks (each of the nine treatments is represented in a block), allowing data analysis by analysis of variance (ANOVA). Environmental data are captured in the greenhouse control system (temperature, relative humidity, radiation, setpoint).

[0197] The pots are hand-watered daily according to the following two treatments and fed twice weekly with Hoagland's solution from the time the plants reach 8-10 leaves or when the available nutrients in the pots are clearly depleted. The feeding solution replaces the irrigation treatment until field capacity is reached; the feeding rate is the same for all treatments, and water is replenished until field capacity is reached. Pests and diseases can be controlled with appropriate fungicides and insecticides.

[0198] To determine whether the predicted increase in soil water storage translates into increased plant growth, studies are conducted under limited water supply conditions in an artificial rainfall environment. Because increased water-holding capacity is not expected to affect plant growth unless water is limited, a "well-watered" control treatment is compared to a water-limited treatment.

[0199] 1. Water thoroughly daily. Plants should be watered daily or every other day to field capacity to ensure water is not growth-limiting. If water is not limiting, an inoculant effect through increased soil water retention is not expected. Effects through other mechanisms may be observed.

[0200] 2. Cycling between field capacity and growth-limiting soil moisture deficiency. After plants are fully established and show growth of two to three more leaves after transplanting, they are watered to field capacity and then allowed to dry out through transpirational water loss until control plants show signs of water deficiency (wilting, leaf curl, reduced stomatal conductance compared to well-watered plants). They are then watered again to field capacity, and the cycle is repeated. Pots with higher water-holding capacity will maintain growth longer before available water is depleted, so a longer period of unrestricted growth is expected. (Note that increased growth rate also increases transpiration, so increased growth eventually balances increased water-holding capacity.)

[0201] The pots are arranged in two rows, 30 cm apart, in a 1 m wide growing bed. The glasshouse is heated to 25 / 20°C day / night and supplemented with high-pressure sodium lamps on a 16 / 8 hour day / night cycle. The optimum growth temperature for corn is 25°C (with a range optimum of 21-27°C).

[0202] Five replicate pots are used for all treatments except for the "no Pseudomonas" treatment, which has 10 replicates (to compare all lines to this baseline). There are two irrigation treatments.

[0203] Total number of pots = [(5 replicates x 8 inoculations) + (10 replicates x 1 inoculation)] x 2 treatments = 100 Cultivation floor area = 1 x 6m 2 and 1 x 9 m 2 (Two rows of 30cm x 100cm, 1m wide beds divided into beds containing two or three "blocks"). To reduce edge effects, guard plants (8 plants total) are placed at the ends of each row.

[0204] [Table 3]

[0205] 2. Measurement Water retention capacity: Water-holding capacity is measured using the funnel method, in which soil and roots removed from a pot are soaked to mix the soil and roots, a sample is taken to estimate the gravimetric water content (weight before and after drying), and then packed into a funnel. Water is added to the top of the funnel, and the amount of water retained is recorded based on the mass of water applied and the mass of water flowing through the funnel. This is a rapid method that allows for the calculation of the total water-holding capacity between field capacity (water retained after free drainage) and oven-dried soil. This method includes water between the permanent wilting point and oven-drying that is considered too tightly bound to the soil and therefore unavailable to the plant. Alternatively, soil water potential (in megapascals, MPa) can be calculated as the gravimetric water content (gg -1 ) can also be used to calculate water release curves plotted against the soil water potential. The latter method allows calculation of the gravimetric water retained between the field water capacity (-0.01 MPa) and the permanent wilting point (-1.4 MPa soil water potential), i.e., only the water available to the plant. One measurement per pot = 100.

[0206] The funnel method was verified to be sensitive to soil cellulose content by using soil mixed with various amounts of cellulose powder purchased from Fisher Scientific. Approximately 20 measurements were performed.

[0207] Microbial colonization of the rhizosphere: Water holding capacity experiments of submerged soil / roots about 10 g of sample (one sample per pot at harvest) is mixed with water or buffer and then filtered. Serial dilutions are plated onto appropriate selective media and then incubated at 25°C for 48 hours. Colony forming units (cfus) are counted and cfuml -1 The positive control consisted of inoculum applied to a sample of non-inoculated soil immediately prior to extraction (performed at the time of pot inoculation).

[0208] Three replicates and three serial dilutions per treatment + control = (3 replicates x 9 inoculations x 2 irrigation treatments x 3 dilutions) + (8 control inoculations x 3 replicates x 3 dilutions) = 162 + 72 = 234 plates.

[0209] Soil carbon content: From the rhizosphere at harvest about A 20 g soil sample was collected (before soil / root maceration for the water-holding experiment) and sieved at 2 mm to remove root fragments. Total organic carbon (TOC) was measured by elemental analyzer after treatment with hydrochloric acid to remove carbonates.

[0210] One sample per pot = 100 samples. A positive control analysis was also performed on soil mixed with cellulose (obtained in the water holding capacity experiment) = 20 samples.

[0211] Plant Health: a) During plant growth, plant height and leaf number are measured weekly using methods defined by agronomic practices.

[0212] Briefly, height is defined as "from the soil surface to the highest point of the arch of the topmost leaf with its tip pointing downwards." Leaf counts are recorded using three rapid methods: 1. The number of leaf tips arising from a whorl.

[0213] 2. The number of leaves, starting from the lowest leaf and ending with the last arching leaf (the tip of the leaf points downward). 3. Number of leaves with visible necks (i.e., leaves arising from whorls).

[0214] b) Leaf chlorophyll content is measured using a leaf chlorophyll meter (CCM-200) on standard leaves (e.g., top arched leaves, two readings per leaf) at weekly intervals and verified using a standard curve (acetone extraction and spectrophotometer). 3 weeks x 200 measurements = 600.

[0215] c) At the time of harvesting the plants, all above ground material is chopped up, bagged and dried at 80°C until completely dry. The dry weight per plant is recorded (100 measurements). The mineral content of plants may be measured using standard methods. The present invention includes, but is not limited to, the following aspects. [Aspect 1] A genetically engineered microorganism for producing cellulose, wherein the microorganism is genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, and the microorganism is modified by exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, and the ccpAx gene. [Aspect 2] 2. The genetically engineered microorganism of embodiment 1, wherein the microorganism is further modified by an exogenous cmcAx gene and / or an exogenous bglAx gene. [Aspect 3] 2. The genetically engineered microorganism of embodiment 1, wherein the microorganism is modified by an exogenous nucleic acid comprising a bcsA gene, a bcsB gene, a bcsC gene, a bcsD gene, and at least a ccpAx gene. [Aspect 4] 20. The genetically engineered microorganism of any one of the preceding aspects, wherein the gene is heterologous. [Aspect 5] 20. The genetically engineered microorganism of any one of the preceding aspects, wherein each of the genes is isolated from K. xylinus. [Aspect 6] 6. The genetically engineered microorganism of any one of embodiments 1 to 5, wherein the microorganism is a root-associated bacterium. [Aspect 7] 6. The genetically engineered microorganism of any one of embodiments 1 to 5, wherein the microorganism is a plant growth-promoting rhizobacterium. [Aspect 8] 8. The genetically engineered microorganism of embodiment 6 or 7, wherein the microorganism is a Pseudomonas bacterium. [Aspect 9] 9. The genetically engineered microorganism of any one of embodiments 1 to 8, wherein expression of the gene is regulated by a cell density quorum sensing system. [Aspect 10] A method for increasing cellulose production in a microorganism compared to a reference microorganism, comprising modifying the microorganism to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, wherein the microorganism is modified with exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, and the ccpAx gene. [Aspect 11] 11. The method for increasing cellulose production according to embodiment 10, wherein the microorganism is further modified by an exogenous cmcAx gene and / or an exogenous bglAx gene. [Aspect 12] 12. The method for increasing cellulose production according to aspect 10 or 11, wherein the microorganism is a root-associated bacterium. [Aspect 13] 12. The method for increasing cellulose production according to aspect 10 or 11, wherein the microorganism is a plant growth-promoting rhizobacterium. [Aspect 14] A vector comprising an exogenous nucleic acid comprising a bcs operon and at least one of a cmcAx gene, a ccpAx gene, a bglAx gene, a pgm gene, a galU gene, a cdg operon, and a dgc gene, optionally wherein the bcs operon comprises a bcsA gene, a bcsB gene, a bcsC gene, and a bcsD gene. [Aspect 15] 1. A method of producing a genetically engineered microorganism for producing cellulose, comprising the steps of: a) isolating the microorganism; and b) introducing into the microorganism a vector containing an exogenous nucleic acid comprising at least one gene selected from the group consisting of the bcsA gene; the bcsB gene; the bcsC gene; the bcsD gene; the cmcAx gene; the ccpAx gene; the bglAx gene; the pgm gene; the galU gene; the cdg operon; and the dgc gene. The method comprises modifying the microorganism to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, comprising: [Aspect 16] A genetically engineered microorganism obtainable by the method according to embodiment 15. [Aspect 17] 17. The isolated genetically engineered microorganism of any one of embodiments 1 to 9 or embodiment 16. [Aspect 18] 17. A population comprising the genetically engineered microorganism of any one of embodiments 1 to 9 or embodiment 16. [Aspect 19] 20. A composition comprising the genetically engineered population of embodiment 18. [Aspect 20] 20. The composition of embodiment 19, wherein the composition further comprises a fertilizer and / or a biofertilizer. [Aspect 21] 1. A method for increasing water retention around plant roots, comprising the step of applying genetically engineered microorganisms to soil surrounding plant roots, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. [Aspect 22] 1. A method for reducing water consumption in agriculture, comprising the step of applying genetically engineered microorganisms to soil surrounding plant roots, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. [Aspect 23] 1. A method for capturing carbon, comprising applying genetically engineered microorganisms to soil surrounding plant roots, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and wherein the carbon is converted to cellulose by the microorganisms. [Aspect 24] 24. The method of embodiment 21, 22, or 23, wherein the microorganism is genetically modified with an exogenous bcs operon, the bcs operon comprising the bcsA, bcsB, bcsC, and bcsD genes. [Aspect 25] 1. The use of genetically modified microorganisms in agriculture, wherein said microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. [Aspect 26] 1. Use of a genetically modified microorganism to increase water retention around plant roots, wherein the microorganism has been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose. [Aspect 27] Use of genetically modified microorganisms in carbon capture, wherein the microorganisms have been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, and the carbon is converted into cellulose by the microorganisms.

[0216] References A number of publications have been cited above in order to more fully describe and disclose the present invention and the state of the art to which it pertains. Full citations for these references are provided below. Each of these references is incorporated herein in its entirety. BAILEY, MJ et al. (1995) 'Site directed chromosomal marking of a fluorescent pseudomonad isolated from the phytosphere of sugar beet; stability and potential for marker gene transfer.', Molecular Ecology, 4(6), pp. 755-764. doi: 10.1111 / j.1365-294X.1995.tb00276.x. Bashan, Y., et al. (2002) ‘Alginate microbeads as inoculant carriers for plant growth-promoting bacteria’. Biol Fertil Soils, 35, 359-368. Baynham, P. J. et al. (2006) ‘The Pseudomonas aeruginosa ribbon-helix-helix DNA-binding protein AlgZ (AmrZ) controls twitching motility and biogenesis of type IV pili’, Journal of Bacteriology, 188(1), pp. 132-140. doi: 10.1128 / JB.188.1.132-140.2006. Brautaset, T. et al. (1994) ‘Nucleotide sequence and expression analysis of the Acetobacter xylinum phosphoglucomutase gene’, Microbiology, 140(5), pp. 1183-1188. doi: 10.1099 / 13500872-140-5-1183. Buldum, G. et al. (2018). ‘Recombinant biosynthesis of bacterial cellulose in genetically modified Escherichia coli’. Bioprocess Biosyst Eng; 41(2): 265-279. doi: 0.1007 / s00449-017-1864-1. Florea, M. et al. (2016). ‘Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose producing strain’. PNAS; 113(24): E3431-40. Jang, W. D. et al. (2019) ‘Genomic and metabolic analysis of Komagataeibacter xylinus DSM 2325 producing bacterial cellulose nanofiber ’, Biotechnology and Bioengineering, (July), pp. 1-10. doi: 10.1002 / bit.27150. Jozala, A. F., et al. (2014) ‘Bacterial cellulose production by Gluconacetobacter xylinus by employing alternative culture media’. Appl Microbiol Biotechnol; 99(3): 1181-90. Doi: 1007 / s00253-014-6232-3. Kawano, S., et al. (2008). ‘Regulation of endoglucanase gene (cmcax) expression in Acetobacter xylinum’. J. Biosci. Bioeng. 106, 88-94. doi: 10.1263 / jbb.106.88 Klemm, D. et al. (2001) ‘Bacterial synthesized cellulose - artificial blood vessels for microsurgery’, Progress in Polymer Science, 26(9), pp. 1561-1603. doi: 10.1016 / S0079-6700(01)00021-1. Koo, H. M. et al. (2000) ‘Cloning, sequencing, and expression of UDP-glucose pyrophosphorylase gene from acetobacter xylinum BRC5’, Bioscience, Biotechnology and Biochemistry, 64(3), pp. 523-529. doi: 10.1271 / bbb.64.523. Meyers A, Furtmann C, Gesing K, Tozakidis IEP, Jose J. 2019. Cell density-dependent auto-inducible promoters for expression of recombinant proteins in Pseudomonas putida. Microb Biotechnol 12:1003-1013 Rainey, P. B. and Bailey, M. J. (1996) ‘Physical and genetic map of the Pseudomonas fluorescens SBW25 chromosome’, Molecular Microbiology, 19(3), pp. 521-533. doi: 10.1046 / j.1365-2958.1996.391926.x. Ryngajllo, M. et al. (2019) ‘Comparative genomics of the Komagataeibacter strains-Efficient bionanocellulose producers’, MicrobiologyOpen, 8(5), pp. 1-25. doi: 10.1002 / mbo3.731. Sambrook, J., & R. (2001) ‘Molecular cloning: a laboratory manual’, Cold Spring Harbor Laboratory Press. Standal, R., et al. (1994). ‘A new gene required for cellulose production and a gene encoding cellulolytic activity in Acetobacter xylinum are colocalized with the bcs operon’. J. Bacteriol. 176, 665-672. Tajima, K., et al. (2001). ‘Cloning and sequencing of the beta-glucosidase gene from Acetobacter xylinum ATCC 23769’. DNA Res. 8, 263-269. doi: 10.1093 / dnares / 8.6.263. Vandamme, E.J., et al. (1998). ‘Improved production of bacterial cellulose and its application potential’. Polymer Degradation and Stability. 59 (1-3): 93-99. doi:10.1016 / S0141-3910(97)00185-7. Walz, A. et al. (2002) 'A gene encoding a protein modified by the phytohormone indoleacetic acid', Proceedings of the National Academy of Sciences of the United States of America, 99(3), pp. 1718-1723. doi: 10.1073 / pnas.032450399. Wong, HC et al. (1990) 'Genetic organization of the cellulose synthase operon in Acetobacter xylinum', Proceedings of the National Academy of Sciences of the United States of America, 87(20), pp. 8130-8134. doi: 10.1073 / pnas.87.20.8130. For standard molecular biology techniques, see Sambrook, J., Russell, D.W. Molecular Cloning, A Laboratory Manual. 3rd ed. 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.

Claims

1. A genetically engineered Pseudomonas bacterium for producing cellulose, wherein the Pseudomonas bacterium is modified with exogenous genes including bcsA gene, bcsB gene, bcsC gene, bcsD gene, ccpAx gene, cmcAx gene, and bglAx gene, and is genetically engineered to overexpress at least one protein involved in the synthesis and / or secretion of cellulose.

2. 2. The genetically engineered Pseudomonas bacterium of claim 1, wherein the bacterium is modified with exogenous nucleic acids comprising the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the ccpAx gene, the cmcAx gene, and the bglAx gene.

3. 3. The genetically engineered Pseudomonas bacterium of claim 1 or 2, wherein each of the genes is isolated from K. xylinus.

4. The genetically engineered Pseudomonas bacterium according to any one of claims 1 to 3, which is a plant growth-promoting rhizobacterium.

5. The genetically engineered Pseudomonas bacterium according to any one of claims 1 to 4, wherein gene expression is regulated by a cell density quorum sensing system.

6. A method for increasing cellulose production in a Pseudomonas bacterium compared to a reference Pseudomonas bacterium, wherein the reference Pseudomonas bacterium is a wild-type Pseudomonas bacterium, the method comprising the step of modifying the Pseudomonas bacterium to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, wherein the Pseudomonas bacterium is modified by exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the ccpAx gene, the cmcAx gene, and the bglAx gene.

7. A method for increasing cellulose production as described in claim 6, wherein the Pseudomonas bacterium is a plant growth-promoting rhizobacterium.

8. 1. A method for producing a genetically engineered Pseudomonas bacterium for producing cellulose, comprising the steps of: a) isolating Pseudomonas bacteria; and b) introducing a vector containing exogenous nucleic acids including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the ccpAx gene, the cmcAx gene, and the bglAx gene into the root-associated bacterium; The method comprises modifying a Pseudomonas bacterium to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, comprising:

9. A composition comprising a population, said population comprising the genetically engineered Pseudomonas bacterium of any one of claims 1 to 5.

10. 10. The composition of claim 9, wherein the composition further comprises a fertilizer and / or a biofertilizer.

11. A method for increasing water retention around plant roots, comprising the step of applying a genetically engineered Pseudomonas bacterium to soil surrounding the plant roots, wherein the Pseudomonas bacterium has been genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and the Pseudomonas bacterium has been modified with exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the ccpAx gene, the cmcAx gene, and the bglAx gene.

12. 1. A method for reducing water consumption in agriculture, comprising the step of applying a genetically engineered Pseudomonas bacterium to soil surrounding plant roots, wherein the Pseudomonas bacterium has been genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and the Pseudomonas bacterium has been modified with exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the ccpAx gene, the cmcAx gene, and the bglAx gene.

13. 1. A method for capturing carbon, comprising the step of applying genetically engineered Pseudomonas bacteria to soil surrounding plant roots, wherein the Pseudomonas bacteria have been genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and the carbon is converted to cellulose by the Pseudomonas bacteria, wherein the Pseudomonas bacteria have been modified with exogenous genes including bcsA, bcsB, bcsC, bcsD, ccpAx, cmcAx, and bglAx.

14. 1. The agricultural use of a genetically modified Pseudomonas bacterium, wherein the Pseudomonas bacterium has been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, and the Pseudomonas bacterium has been modified with exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the ccpAx gene, the cmcAx gene, and the bglAx gene.

15. Use of a genetically modified Pseudomonas bacterium to increase water retention around plant roots, wherein the Pseudomonas bacterium has been genetically modified to overexpress at least one protein involved in cellulose synthesis and / or secretion, and the Pseudomonas bacterium has been modified with exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the ccpAx gene, the cmcAx gene, and the bglAx gene.

16. Use of a genetically modified Pseudomonas bacterium in carbon capture, wherein the Pseudomonas bacterium has been genetically modified to overexpress at least one protein involved in the synthesis and / or secretion of cellulose, and the carbon is converted into cellulose by the Pseudomonas bacterium, and the Pseudomonas bacterium has been modified with exogenous genes including the bcsA gene, the bcsB gene, the bcsC gene, the bcsD gene, the ccpAx gene, the cmcAx gene, and the bglAx gene.

Citation Information

Patent Citations

  • Expression vector for cellulose production, transformant, and cellulose production method

    WO2014104310A1

  • Methods and compositions for improving engineered microbes that fix nitrogen

    WO2019084059A2

  • Gene targets for nitrogen fixation targeting for improving plant traits

    WO2019084342A1