Genetically modified microorganism capable of producing isoprenoids and method for producing isoprenoids using the same
Enhanced enzyme activities and optimized MEP pathway genes in genetically modified Escherichia coli strains address productivity issues in bioisoprene production, achieving efficient isoprene synthesis and mass production.
Patent Information
- Application Number
- JP2021052847
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-03-26
- Publication Date
- 2025-09-22
- Estimated Expiration
- 2041-03-26
AI Technical Summary
Current bioisoprene production methods, particularly using the MEP pathway, face challenges in productivity and efficiency, especially in Escherichia coli hosts, due to limitations in enzyme activities and pathways, leading to suboptimal isoprene yields.
Genetically modified Escherichia coli strains with enhanced activities of enzymes such as Dxs, Idi, IspS, Dxr, IspG, IspH, PetF/FldA, and PetH/Fpr, and reduced activities of Pgi and GapA, along with optimized MEP pathway genes from Thermosynechococcus elongatus, to enhance isoprene synthesis.
The modified strains significantly increase bioisoprene production, enabling mass production of isoprene and other isoprenoids, leveraging a sustainable biological pathway.
Smart Images

Figure 0007742602000001 
Figure 0007742602000002 
Figure 0007742602000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to the production of compounds using microorganisms, and in particular to the production of isoprenoid compounds in microorganisms using genetic recombination techniques. [Background technology]
[0002] Isoprene is a member of a group of compounds known as isoprenoids. Industrial uses of isoprene include synthetic rubber, adhesives, elastomers, cosmetic ingredients, and herbal medicines. Currently, over 95% of isoprene is used in the production of synthetic rubber.
[0003] Currently, most of the isoprene used industrially is derived from fossil fuels, with a market of 1 million tons per year and continuing to grow. However, the production of isoprene from fossil fuels using petroleum and organic chemical methods places a heavy burden on the environment, and a shift to biological production is anticipated in order to build a sustainable society in the future.
[0004] There have been many examples of isoprene production using biological methods, particularly those using microorganisms as hosts (hereinafter referred to as bioisoprene production) in the past (see Non-Patent Document 1). Isoprenoids, including isoprene, are important compounds for living organisms, and most organisms possess pathways for their biosynthesis. However, the specific isoprenoid compounds they produce vary depending on the species. With a few exceptions, the biosynthetic pathway for isoprene has currently only been confirmed in plants. This is because the isoprene synthase (isoprene synthase: IspS), which synthesizes isoprene from dimethylallyl diphosphate (DMAPP), the direct precursor of isoprene synthesis, has only been confirmed in plants.
[0005] Biosynthetic pathways for bioisoprene production can be broadly divided into two: the methylerythritol phosphate (MEP) pathway and the mevalonate (MVA) pathway.
[0006] Many bacteria, including E. coli, naturally retain only the MEP pathway, which allows them to produce DMAPP and various downstream isoprenoids. Therefore, if the aforementioned ispS gene can be transferred from plants using genetic engineering and made functional, it will be possible to produce bioisoprene in E. coli and other bacteria.
[0007] Although the MVA pathway is not present in many naturally occurring bacteria, bioisoprene can be produced by transferring and functioning all of the pathway genes from other organisms. Most previous examples of bioisoprene production have used the MVA pathway, likely because the enzymes of the MVA pathway are easier to handle as genetically modified organisms (see Non-Patent Document 1). However, production using the MEP pathway is considered to have a higher maximum theoretical yield and is also superior in terms of intracellular redox balance (see Non-Patent Document 2). Despite this, basic research into the enzymes of the MEP pathway is lagging behind. Furthermore, the pathway involves multiple enzymes containing iron-sulfur clusters, which are delicate to handle in genetically modified organisms. Therefore, there are few examples of its use.
[0008] In an example of bioisoprene production using only the MEP pathway with Escherichia coli as a host, a maximum production amount of 221 mg / L was reported in a batch process (see Non-Patent Document 3). For example, in E. coli overexpressing the E. coli MEP pathway genes 1-deoxy-D-xylulose 5-phosphate synthase gene (Ec_dxs; hereafter, "Ec_" is the prefix used for genes derived from E. coli K12 strains) and isopentyl diphosphate isomerase gene (Ec_idi), as well as the Populus alba ispS gene, gradually increasing the activity of Dxs, which catalyzes the first step of the MEP pathway, resulted in an increase in flux through the MEP pathway. However, this resulted in a large accumulation of the intermediate metabolite MEcPP (2-C-methyl-D-erythritol 2,4-cyclodiphosphate), resulting in little increase in isoprene production (see Non-Patent Document 4). This strongly suggests that the reaction of 1-hydroxy-2-methyl-2-butenyl 4-diphosphate synthase (IspG) is the rate-limiting step in the MEP pathway. It also suggests that overexpression of only the Ec_ispG and 1-hydroxy-2-methyl-2-butenyl 4-bisphosphate reductase genes (Ec_ispH) in E. coli may not improve isoprene productivity.
[0009] In another example, it has been reported that isoprene productivity can be improved by using Escherichia coli overexpressing the Ec_dxs, Ec_dxr (1-deoxy-D-xylulose 5-phosphate reductoisomerase gene), Ec_ispG, and Ec_fldA (flavodoxin) genes; the mvk (mevalonate kinase gene), pmk (phosphomevalonate kinase gene), mvd (diphosphomevalonate decarboxylase gene), and Ec_idi genes derived from heterologous organisms; the plant-derived ispS gene; the Thermosynechococcus elongatus ispG (Te_ispG), the Thermosynechococcus elongatus petF (ferredoxin gene: Te_petF), and the Thermosynechococcus elongatus petH (ferredoxin-NADP reductase: Te_petH) genes; and the Anabaena sp.-derived ispH gene (see Patent Document 1). The above-mentioned mvk, pmk, and mvd genes are MVA pathway genes.
[0010] In another example, it has been reported that isoprene productivity is improved by disrupting the phosphoglucose isomerase (Pgi) gene in Escherichia coli overexpressing the Ec_dxs, Ec_ispG, and Ec_idi genes, and the plant-derived ispS gene, and metabolizing glucose primarily via the Entner-Doudoroff pathway (see Non-Patent Document 3).
[0011] In another example, it is known that the combined use of the MEP pathway and the MVA pathway results in a synergistic effect that increases the productivity of bioisoprene (see Non-Patent Document 5).
[0012] In another example, a group of MVA pathway genes derived from a heterologous organism and the ispS gene (Mb_ispS) or its highly active mutant gene (Mb_ispS*) derived from Mucuna bracteata were transferred into Escherichia coli in which the pgi gene had been disrupted, to produce bioisoprene (see Patent Document 2).
[0013] In another example, the dxs gene (Rr_dxs) derived from Rhizobium radiobacter, which has a high Kcat value (turnover number, molecular activity value), was cloned and artificially overexpressed in the same bacterium, increasing the production of ubiquinone 10 (see Non-Patent Document 6). Note that ubiquinone 10 requires isoprenoid compounds for its biosynthesis.
[0014] In another example, using Bacillus sp. N16-5, an exceptional bacterium that naturally produces isoprene, as a host, the amount of isoprene produced was successfully increased by adjusting the sequence and expression level of ispH derived from this bacterial strain (see Non-Patent Document 7). This is thought to be because the ispH gene product of this strain exceptionally retains the activity to synthesize isoprene directly from HMBPP ((E)-4-hydroxy-3-methyl-2-butenyl diphosphate) without the intervention of DMAPP.
[0015] In another example, it has been reported that when producing protoilludene, a type of isoprenoid, in Escherichia coli, overexpression of Ec_dxr, Ec_ispDEFGH, Ec_idi, Ec_fldA, and Ec_fpr (flavodoxin-NADP reductase gene) in addition to the protoilludene synthesis pathway genes maximizes production (see non-patent document 8).
[0016] In another example, it has been reported that isoprene productivity via the MVA pathway can be improved by artificially reducing the expression of Ec_gltA (citrate synthase gene), which competes with the first reaction step of the MVA pathway (see Patent Document 3). [Prior art documents] [Patent documents]
[0017] [Patent Document 1] International Publication No. 2012-088462 [Patent Document 2] International Publication No. 2015-076392 [Patent Document 3] U.S. Patent Publication No. 8,975,051 [Non-patent literature]
[0018] [Non-Patent Document 1] "Engineering microbes for isoprene production", Metabolic Engineering, Volume 38, November 2016, Pages 125-138 [Non-patent document 2] "Handbook of Hydrocarbon and Lipid Microbiology", Springer-Verlag Berlin Heidelberg 2010 HYPERLINK [Non-patent document 3] "Combination of Entner-Doudoroff Pathway with MEP Increases Isoprene Production in Engineered Escherichia coli", PLoS One, 2013, 8:e83290 [Non-Patent Document 4] "Investigation of the methylerythritol 4-phosphate pathway for microbial terpenoid production through metabolic control analysis", Microbial Cell Factories, 2019, 18:192 [Non-Patent Document 5] "Synergy between methylerythritol phosphate pathway and mevalonate pathway for isoprene production in Escherichia coli", Metabolic Engineering, Volume 37, September 2016, Pages 79-91, [Non-Patent Document 6] "Cloning and characterization of the dxs gene, encoding 1-deoxy-d-xylulose 5-phosphate synthase from Agrobacterium tumefaciens, and its overexpression in Agrobacterium tumefaciens", Journal of Biotechnology, Volume 128, Issue 3, 20 February 2007, Pages 555-566 [Non-Patent Document 7] "Two unexpected promiscuous activities of the iron-sulfur protein IspH in production of isoprene and isoamylene", Microbial Cell Factories, 2016, 15:79 [Non-patent document 8] "Enhanced performance of the methylerythritol phosphate pathway by manipulation of redox reactions relevant to IspC, IspG, and IspH", Journal of Biotechnology, Volume 248, 20 April 2017, Pages 1-8 Summary of the Invention [Problem to be solved by the invention]
[0019] The present invention aims to provide a technology for producing bioisoprene using a microorganism as a host. In particular, the technology uses Escherichia coli, which is the easiest microorganism to handle, as a host, and produces bioisoprene by manipulating the MEP pathway and its downstream biosynthetic pathway. There is still room for improvement in productivity in bioisoprene production for practical use. As mentioned above, there is particularly significant room for improvement in production methods using the MEP pathway. [Means for solving the problem]
[0020] In order to solve the above problems, the present invention provides the following [1]-
[13] . [1] Reduced phosphoglucose isomerase (Pgi) activity compared to an unmodified form; The modified strain has enhanced 1-deoxy-D-xylulose 5-phosphate synthase (Dxs) activity, isopentyl diphosphate isomerase (Idi) activity, and isoprene synthase (IspS) activity compared to an unmodified strain, and further The strain has enhanced 1-deoxy-D-xylulose 5-phosphate reductoisomerase (Dxr) activity, 1-hydroxy-2-methyl-2-butenyl 4-diphosphate synthase (IspG) activity and / or 1-hydroxy-2-methyl-2-butenyl 4-diphosphate reductase (IspH) activity, ferredoxin / flavodoxin (PetF / FldA) activity, and ferredoxin / flavodoxin-NADP reductase (PetH / Fpr) activity compared to an unmodified strain. A genetically modified microorganism capable of producing isoprenoids. [2] A genetically modified microorganism according to [1], which has reduced glyceraldehyde-3-phosphate dehydrogenase (GapA) activity compared to an unmodified microorganism. [3] The genetically modified microorganism of [2], which has reduced citrate synthase (GltA) activity compared to an unmodified microorganism. [4] A genetically modified microorganism selected from any of [1]-[3] that expresses the 1-hydroxy-2-methyl-2-butenyl 4-diphosphate synthase (IspG) gene and / or the 1-hydroxy-2-methyl-2-butenyl 4-diphosphate reductase (IspH) gene, the ferredoxin / flavodoxin (PetF / FldA) gene, and the ferredoxin / flavodoxin-NADP reductase (PetH / Fpr) gene derived from Thermosynechococcus elongatus. [5] A genetically modified microorganism that is Escherichia coli, any of [1]-[4]. [6] The genetically modified microorganism according to any one of [1] to [5], wherein the isoprenoid is isoprene.
[0021] [7] A method for producing isoprenoids, comprising a step of contacting a genetically modified microorganism capable of producing isoprenoids with an organic raw material in an aqueous medium, The genetically modified microorganism Reduced phosphoglucose isomerase (Pgi) activity compared to the unmodified form; The modified strain has enhanced 1-deoxy-D-xylulose 5-phosphate synthase (Dxs) activity, isopentyl diphosphate isomerase (Idi) activity, and isoprene synthase (IspS) activity compared to an unmodified strain, and further The strain has enhanced 1-deoxy-D-xylulose 5-phosphate reductoisomerase (Dxr) activity, 1-hydroxy-2-methyl-2-butenyl 4-diphosphate synthase (IspG) activity and / or 1-hydroxy-2-methyl-2-butenyl 4-diphosphate reductase (IspH) activity, ferredoxin / flavodoxin (PetF / FldA) activity, and ferredoxin / flavodoxin-NADP reductase (PetH / Fpr) activity compared to an unmodified strain. Manufacturing method. [8] The method according to [7], wherein the genetically modified microorganism has reduced glyceraldehyde-3-phosphate dehydrogenase (GapA) activity compared to an unmodified microorganism. [9] The method according to [8], wherein the genetically modified microorganism has reduced citrate synthase (GltA) activity compared to an unmodified microorganism.
[10] A production method according to any of [7]-[9], wherein the genetically modified microorganism expresses the 1-hydroxy-2-methyl-2-butenyl 4-diphosphate synthase (IspG) gene and / or the 1-hydroxy-2-methyl-2-butenyl 4-diphosphate reductase (IspH) gene, the ferredoxin / flavodoxin (PetF / FldA) gene, and the ferredoxin / flavodoxin-NADP reductase (PetH / Fpr) gene derived from Thermosynechococcus elongatus.
[11] The method of any one of [7] to
[10] , wherein the genetically modified microorganism is Escherichia coli.
[12] The method according to any one of [7] to
[11] , wherein the isoprenoid is isoprene.
[13] The method of any one of [7] to
[12] , wherein the organic raw material comprises xylose, arabinose, mannose, galactose, fructose, glucose, lactose, maltose, trehanose, cellobiose, sucrose, starch, dextrin, cellulose, hemicellulose, glycerol, and / or mannitol. [Effects of the Invention]
[0022] The present invention makes it possible to mass-produce bioisoprene using a microorganism as a host. [Brief explanation of the drawings]
[0023] [Figure 1] The results of an isoprene production experiment are shown. The structure of the plasmid used is illustrated at the top. [Figure 2] The results of an isoprene production experiment are shown. The structure of the plasmid used is illustrated at the top. [Figure 3] The results of an isoprene production experiment are shown. The structure of the plasmid used is illustrated at the top. [Figure 4] The results of an isoprene production experiment are shown. The structure of the plasmid used is illustrated at the top. DETAILED DESCRIPTION OF THE INVENTION
[0024] Preferred embodiments for carrying out the present invention will be described below. Note that the embodiment described below is an example of a typical embodiment of the present invention, and the scope of the present invention should not be construed as being narrow.
[0025] [Genetically modified microorganisms] The genetically modified microorganism according to the present disclosure has the following characteristics: (1) It has reduced phosphoglucose isomerase (Pgi) activity compared to the unmodified form. (2) It has enhanced 1-deoxy-D-xylulose 5-phosphate synthase (Dxs) activity compared to the unmodified strain. (3) It has enhanced isopentyl diphosphate isomerase (Idi) activity compared to the unmodified strain. (4) It has enhanced isoprene synthase (IspS) activity compared to the unmodified strain. (5) It has enhanced 1-deoxy-D-xylulose 5-phosphate reductoisomerase (Dxr) activity compared to the unmodified strain. (6) It has enhanced 1-hydroxy-2-methyl-2-butenyl 4-diphosphate synthase (IspG) activity and / or 1-hydroxy-2-methyl-2-butenyl 4-diphosphate reductase (IspH) activity compared to an unmodified strain. (7) It has enhanced ferredoxin / flavodoxin (PetF / FldA) activity compared to the unmodified strain. (8) It has enhanced ferredoxin / flavodoxin-NADP reductase (PetH / Fpr) activity compared to the unmodified strain. (9) Ability to produce isoprenoids. Furthermore, it is preferable that the genetically modified microorganism according to the present disclosure has the following characteristics: (10) It has reduced glyceraldehyde-3-phosphate dehydrogenase (GapA) activity compared to the unmodified variant. (11) It has reduced citrate synthase (GltA) activity compared to the unmodified strain.
[0026] The genetically modified microorganism according to the present disclosure may be Escherichia coli, coryneform bacteria, Bacillus bacteria, Pantoea bacteria, Enterobacter bacteria, Pseudomonas bacteria, and the like. Furthermore, the genetically modified microorganism according to the present disclosure may be a yeast of the genus Saccharomyces, Candida, Shizosaccharomyces, or Pichia, or a filamentous fungus of the genus Aspergillus. The genetically modified microorganisms disclosed herein are not limited as long as they have the characteristics (1) to (9) above, but Escherichia coli is particularly preferred because it is simple to use and there are a wide variety of genetic modification tools available.
[0027] Genetically modified microorganisms can be produced using conventionally known genetic engineering techniques. Genetically modified microorganisms that have reduced activity of a target enzyme compared to unmodified microorganisms can be produced by, for example, disrupting the nucleic acid encoding the enzyme on the chromosome of the microorganism, replacing the nucleic acid encoding the enzyme with a weaker promoter, modifying the promoter of the nucleic acid encoding the enzyme or expression regulatory sequences such as the Shine-Dalgarno (SD) sequence to reduce expression levels, suppressing translation by expressing antisense RNA to inhibit ribosome binding to the target mRNA, suppressing transcription by CRISPR interference, or reducing the activity per enzyme molecule by introducing a mutation into the nucleic acid encoding the enzyme. Genetically modified microorganisms that have enhanced activity of a target enzyme compared to unmodified microorganisms can be produced by, for example, introducing a nucleic acid encoding the enzyme into a vector and transforming the microorganism with the vector system, introducing an expression cassette containing the nucleic acid encoding the enzyme into the chromosome of the microorganism, replacing the nucleic acid encoding the enzyme with a stronger promoter, modifying the promoter of the nucleic acid encoding the enzyme or an expression regulatory sequence such as a Shine-Dalgarno (SD) sequence to increase the expression level, or introducing a mutation into the nucleic acid encoding the enzyme to increase the activity per molecule of the enzyme.
[0028] [Methylerythritol phosphate (MEP) pathway / mevalonate (MVA) pathway] The MEP pathway is a biosynthetic pathway for isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). The MEP pathway involves the following genes in order from upstream to downstream: 1-Deoxy-D-xylulose 5-phosphate synthase (Dxs) 1-Deoxy-D-xylulose 5-phosphate reductoisomerase (Dxr) 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (IspD) 4-Diphosphocytidyl-2-C-methyl-D-erythritol kinase (IspE) 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (IspF) 1-hydroxy-2-methyl-2-butenyl 4-diphosphate synthase (IspG) 1-hydroxy-2-methyl-2-butenyl 4-bisphosphate reductase (IspH) Isopentyl diphosphate isomerase (Idi)
[0029] The MVA pathway is a biosynthetic pathway for isopentenyl diphosphate (IPP). The MVA pathway involves the following genes in order from upstream to downstream: Acetyl-CoA acetyltransferase (MvaE) 3-hydroxy-3-methylglutaryl-CoA synthase (MvaS) 3-hydroxy-3-methylglutaryl-CoA reductase (MvaE) Mevalonate kinase (MVK) Phosphomevalonate kinase (PMK) activity Diphosphomevalonate decarboxylase (MVD) activity MvaE has both acetyl-CoA acetyltransferase activity and 3-hydroxy-3-methylglutaryl-CoA reductase activity. Hereinafter, the term "MvaE activity" refers to both enzyme activities.
[0030] [Pgi gene] The genetically modified microorganisms of the present disclosure have reduced Pgi activity compared to unmodified microorganisms. Pgi is an enzyme that converts glucose-6-phosphate to fructose-6-phosphate. In the present disclosure, an "unmodified organism" refers to a naturally occurring microorganism, but may also be a microorganism having other genetic modifications as long as it has not been subjected to the genetic modifications disclosed herein. "Activity reduced compared to the unmodified form" means that the amount of product per unit time of a reaction catalyzed by a genetically modified microorganism or an enzyme expressed by the genetically modified microorganism is less than that of the unmodified form or the enzyme expressed by the genetically modified microorganism, for example, 10% or more, 20% or more, preferably 30% or more, 40% or more, more preferably 50% or more, 60% or more, even more preferably 70% or more, 80% or more, most preferably 90% or more, 95% or more, and particularly preferably 99% or more, 99.5% or more. "Activity reduced compared to the unmodified form" also includes cases where enzyme activity is zero due to gene deletion. Enzyme activity can be measured by using the target enzyme and a reaction substrate for the reaction catalyzed by the enzyme, conducting the reaction under conditions that allow the reaction to proceed, and measuring the amount of reaction product produced from the reaction substrate.
[0031] [MEP pathway genes] The genetically modified microorganisms of the present disclosure have enhanced Dxs activity, Idi activity, IspS activity, Dxr activity, IspG activity, or IspH activity in the MEP pathway compared to unmodified microorganisms. More preferably, the genetically modified microorganisms of the present disclosure have enhanced Dxs activity, Idi activity, IspS activity, Dxr activity, IspH activity, and IspG activity compared to unmodified microorganisms. "Enhanced activity compared to an unmodified organism" means that the amount of product per unit time of a reaction catalyzed by a unit amount of a genetically modified microorganism or an enzyme expressed by it is greater than that of an unmodified organism or an enzyme expressed by it, for example, 50% or more, 60% or more, preferably 70% or more, 80% or more, more preferably 80% or more, 90% or more, even more preferably 100% or more, 150% or more, most preferably 200% or more, 300% or more, and particularly preferably 400% or more, 500% or more.
[0032] When the dxs gene is introduced, the gene derived from Rhizobium radiobacter (Rr_dxs) is preferably used. When the ispG gene and the ispH gene are introduced, the genes derived from Thermosynechococcus elongatus (Te_ispGH) are preferably used. When the ispS gene is introduced, the gene (Mb_ispS) derived from Mucuna bracteata or its highly active mutant gene (Mb_ispS*) is preferably used.
[0033] [Genes involved in electron transfer in the IspG and IspH reactions] The genetically modified microorganisms of the present disclosure have enhanced PetF / FldA activity and PetH / Fpr activity compared to unmodified microorganisms. IspG and IspH in the MEP pathway are enzymes containing iron-sulfur clusters, and their reduction reactions proceed via electron transfer via ferredoxin or flavodoxin, respectively. Modification of PetF / FldA activity can efficiently enhance IspG and / or IspH activity, which is expected to improve isoprenoid production. Ferredoxin / Flavodoxin-NADP + The reductase can convert ferredoxin and / or flavodoxin, which have been converted from reduced to oxidized forms as the enzymatic reactions of IspG and / or IspH proceed, back to the reduced forms. By modifying PetH / Fpr activity, IspG activity and / or IspH activity can be efficiently enhanced, which is expected to lead to improved production of isoprenoids.
[0034] When the petF / fldA gene and petH / fpr gene are introduced, the genes preferably used are those derived from Thermosynechococcus elongatus (Te_petF, T_petH).
[0035] The genetically modified microorganisms of the present disclosure preferably have reduced glyceraldehyde-3-phosphate dehydrogenase (GapA) activity compared to unmodified microorganisms. GapA is a glyceraldehyde-3-phosphate dehydrogenase that catalyzes the conversion of glyceraldehyde-3-phosphate to glycerate 1,3-bisphosphate.
[0036] [gltA gene] The genetically modified microorganisms of the present disclosure preferably have reduced GltA activity compared to unmodified microorganisms. GltA is a citrate synthase that catalyzes the synthesis of citrate from acetyl-CoA and oxaloacetate.
[0037] [Method of producing isoprenoids] The genetically modified microorganisms disclosed herein have a significant ability to produce isoprenoids, and can therefore be used to produce isoprenoids by contacting them with organic raw materials in an aqueous medium.
[0038] In the method for producing isoprenoids according to the present disclosure, the isoprenoids may be isoprene, artemisinin, farnesene, farnesol, taxol, amorphadiene, astaxanthin, zeaxanthin, taxadiene, lycopene, levopimaradiene, prenol, isoprenol, geraniol, limonene, menthol, alpha-tocopherol, and the like, and is particularly isoprene.
[0039] In the method for producing isoprenoids according to the present disclosure, the organic raw material can be biomass, which is a renewable resource, and may be, but is not limited to, xylose, arabinose, mannose, galactose, fructose, glucose, lactose, maltose, trehanose, cellobiose, sucrose, starch, dextrin, cellulose, hemicellulose, glycerol, mannitol, etc. Among these, glucose and / or sucrose are preferred.
[0040] The culture medium of the genetically modified microorganism may be used as is, or bacterial cells obtained from the culture medium by a cell collection procedure such as centrifugation, or a processed product thereof, etc. Examples of processed bacterial cells include immobilized bacterial cells obtained by immobilizing microbial cells with acrylamide, carrageenan, etc., disrupted bacterial cells, the supernatant obtained by centrifugation thereof, or a cell-free extract obtained by partially purifying the supernatant, as well as crude enzymes or purified enzymes obtained by extracting enzymes from these.
[0041] The step of contacting the genetically modified microorganism with the organic raw material may be carried out in an appropriate aqueous medium. The aqueous medium may be, for example, a culture medium for culturing the microorganism or a buffer solution such as a phosphate buffer. The aqueous medium is preferably an aqueous solution containing a nitrogen source, an inorganic salt, and the like. Examples of the nitrogen source include various organic and inorganic nitrogen compounds such as ammonium salts, nitrates, urea, soybean hydrolysates, casein hydrolysates, peptone, yeast extract, meat extract, and corn steep liquor. Examples of inorganic salts include various phosphates, sulfates, and metal salts such as magnesium, potassium, manganese, iron, and zinc. Furthermore, factors that promote microbial growth, such as vitamins such as biotin, thiamine, pantothenic acid, inositol, and nicotinic acid, nucleotides, and amino acids, may be added as needed. Furthermore, to suppress foaming during the reaction, it is preferable to add an appropriate amount of a commercially available antifoaming agent to the reaction solution.
[0042] The process time, temperature, pH, and amounts of genetically modified microorganisms and organic raw materials added are not particularly limited and can be adjusted as appropriate. The temperature is preferably adjusted to a range that allows the activity of the microorganism to be most effectively exhibited depending on the type of microorganism used. Specifically, when E. coli is used, the temperature is usually in the range of 20-45°C, preferably 25-37°C. When yeast is used, the temperature is usually in the range of 20-45°C, preferably 27-40°C. The time is usually 1 to 168 hours, preferably 3 to 120 hours, and more preferably 6 to 72 hours. The pH condition is also preferably adjusted depending on the type of microorganism used so that its activity is most effectively exhibited. Specifically, when Escherichia coli is used, the pH is usually in the range of 4.5 to 9.0, preferably 5.5 to 8.0. When yeast is used, the pH is usually in the range of 2.5 to 8.5, preferably 3.5 to 7.5. The amount of genetically modified microorganisms to be added is usually 1 to 700 g / L, preferably 10 to 500 g / L, and more preferably 20 to 400 g / L in terms of wet cell weight. The concentration of the organic raw material used is typically 0.1-10% (W / V), preferably 0.2-5% (W / V), of the carbohydrates contained therein relative to the aqueous medium. Additional organic raw material may be added as the amount of organic raw material decreases with the progress of isoprene production. [Example]
[0043] Example 1: Preparation of plasmid DNA and E. coli strain The cultivation of E. coli, genetic recombination manipulation, etc. were carried out based on the inventors' papers and patents (Nakashima and Tamura, 2004 Biotechnol Bioeng 86:136-, Nakashima and Tamura, 2004 Appl Environ Microbiol 70:5557-, Nakashima et al., 2006 Nucleic Acids Res 34:e138, Nakashima and Tamura, 2009 Nucleic Acids Res 37:e103, Japanese Patent No. 3793812, Japanese Patent No. 3944577). The DNA fragments were digested using restriction enzymes from New England Biolabs or Nippon Gene, and after digestion, the fragments were separated by agarose gel electrophoresis to recover only the required DNA fragments. DNA fragments were recovered from the gel using Promega's Wizard SV Gel and PCR Clean-Up System, and the ligation reaction during subcloning was performed using Takara Bio's DNA Ligation Kit.<Mighty Mix> was used. After ligation, transformation was performed using ECOS competent E. coli DH5α (Nippon Gene Co., Ltd.) according to the method recommended by the manufacturer. PCR reactions were carried out using KOD FX neo polymerase or KOD ONE polymerase manufactured by Toyobo Co., Ltd. The synthesis of synthetic oligonucleotides was outsourced to Hokkaido System Science Co., Ltd. The artificial synthesis of the genes was outsourced to Eurofins or genscript. E. coli was cultured at 37°C in LB medium (10 g / L Difco Bacto Tryptone, 5 g / L Difco Yeast Extract, 5 g / L sodium chloride) unless otherwise noted. For agar cultures, the agar concentration was 18 g / L and the plates were placed in 90 mm round plastic Petri dishes. M9 medium consisted of 17 g / L NaHPO-12H2O, 3 g / L KH2PO4, 0.5 g / L NaCl, 1 g / L NH4Cl, 0.49 g / L MgSO4-7H2O, 0.015 g / L CaCl2-2H2O, 0.0083 g / L FeSO4-7H2O, 0.01 g / L thiamine hydrochloride, 0.01 g / L pyridoxine hydrochloride, and 10 g / L glucose. M9Y medium was prepared by adding 2 g / L Difco Yeast Extract to M9 medium. When culturing E. coli carrying a plasmid, the corresponding antibiotics were added. The final concentrations of the antibiotics were 50 mg / L ampicillin, 50 mg / L carbenicillin, 34 mg / L chloramphenicol (the stock solution was prepared at a concentration of 34 g / L in 99.5% ethanol), and 50 mg / L kanamycin. Ampicillin was used for cultures in LB and M9Y medium, while carbenicillin was used for cultures in M9 medium. When glucose was added to the culture medium, a 300 g / L aqueous solution was prepared and sterilized using a Sartorius Minisart filter 0.22 μM (product code 16534K), and then diluted appropriately.
[0044] The genomic DNA used as a template for PCR reaction was obtained from wild-type E. coli K12-MG1655 strain (F - lambda - ilvG - The genomic DNA was derived from the rfb-50 and rph-1 strains. The method for preparing the genomic DNA is described below. The strain was cultured in 5 mL of culture medium and suspended in 500 μL of SET buffer (75 mM sodium chloride, 25 mM EDTA (pH 8.0), 20 mM Tris-HCl (pH 7.5)). 5 μL of lysozyme solution (100 g / L) was added and incubated at 37°C for 30 minutes. 14 μL of protease K solution (20 g / L) and 60 μL of sodium dodecyl sulfate solution (100 g / L) were then added, mixed thoroughly, and incubated at 55°C for 2 hours. 200 μL of sodium chloride solution (5 M) and 500 μL of phenol / chloroform / isoamyl alcohol (25:24:1) solution (Nippon Gene Co., Ltd.) were then added and rotated at room temperature for 20 minutes. The sample was centrifuged, and 700 μL of the supernatant was collected. This was then ethanol precipitated, air-dried, and dissolved in 50 μL of water.
[0045] [Plasmid pHN4272] To construct pHN4272, a plasmid that expresses Rr_dxs, Ec_idi, and Mb_ispS* under the control of the trc promoter (Ptrc) in an IPTG (Isopropyl β-D-1-thiogalactopyranoside)-inducible manner, the following procedures were carried out. The pTrc99a plasmid (Amersham Biosciences) was digested with NsiI and NcoI, and the purified DNA fragment (trc promoter sequence and lacI q The fragment containing the trc promoter sequence was subcloned into the PstI-NcoI site of the pHN540u plasmid (Nakashima et al., Nucleic Acids Res. 2006 34:e138). This plasmid was named pHN1238. pHN1238 contains the trc promoter sequence and lacI qThe gene sequence allows for IPTG-inducible expression of genes downstream of the trc promoter. The transformation marker of this plasmid is chloramphenicol, and the origin of autonomous replication (ori) of the plasmid is derived from pACYC184 (Nippon Gene Co., Ltd.). Next, to obtain a DNA fragment containing the Rr_dxs gene sequence, two oligonucleotide primers, sSN8221 (aaatcatgaccggaatgccacagaccccattg: SEQ ID NO: 1) and sSN1671 (ccctatagtgagtcgtattaatttc: SEQ ID NO: 2), were prepared and PCR was performed using the pYS067 plasmid (SEQ ID NO: 3) as a template. Note that pYS067 was created by subcloning an artificially synthesized DNA fragment into pCOLADuet-1 (Novagen). The ends of the resulting DNA fragment were digested with BspHI and HindIII and purified. This fragment was subcloned into the NcoI-HindIII site of pHN1238. This plasmid containing the Rr_dxs gene sequence downstream of the trc promoter was designated pHN4213. To obtain a DNA fragment containing the Ec_idi gene sequence, two oligonucleotide primers, sSN8335 (aaagaattcagaattacatgtgagaaattatgcaaacgg: SEQ ID NO: 4) and sSN8336 (aaatctagacctaggtctcgagttatttaagctgggtaaatgcagataatcgttttc: SEQ ID NO: 5), were designed and PCR was performed using MG1655 genomic DNA as a template. The resulting DNA fragment was digested at its termini with EcoRI and XbaI and purified. This fragment was subcloned into the EcoRI-SpeI site of pHN4213. The resulting plasmid, containing the Rr_dxs and Ec_idi sequences consecutively (as an artificial operon) downstream of the trc promoter, was designated pHN4214. To obtain a DNA fragment containing the Mb_ispS* gene sequence, two oligonucleotide primers, sSN8343 (aaagtcgactaaaagaggagaaatcattaatgtcc: SEQ ID NO: 6) and sSN8255 (agaggccccaaggggttatgctag: SEQ ID NO: 7), were designed and PCR was performed using pYS067 as a template. The ends of the resulting DNA fragment were digested with SalI and AvrII and purified. This fragment was subcloned into the XhoI-AvrII sites of pHN4214. The resulting plasmid, which contains the Rr_dxs, Ec_idi, and Mb_ispS* sequences consecutively (as an artificial operon) downstream of the trc promoter, was designated pHN4233. To construct an expression plasmid, pTrc99a was cloned from lacI q The DNA fragment containing the trc promoter sequence was excised with NsiI and NcoI, and the fragment was subcloned into the NsiI-NcoI site of pHN1257 (Nakashima and Tamura, Nucleic Acids Res 2009 37:e103). The completed plasmid was named pHN1387. This plasmid was lacI. q In addition to the trc promoter sequence, the kanamycin resistance gene and pSC101 H It has the sequence of ori (Nakashima and Tamura, Nucleic Acids Res. 2009 37:e103). pHN4233 to trc promoter, Rr_dxs, Ec_idi, Mb_ispS*, and lacI q A DNA fragment containing a partial sequence of was excised with ApaI and AvrII, and the fragment was subcloned into the ApaI-SpeI site of pHN1387. The completed plasmid was designated pHN4272.
[0046] [Plasmid pHN4312] To construct a plasmid (pHN4312) in which the Ec_dxr gene sequence was added downstream of Rr_dxs, Ec_idi, and Mb_ispS* of pHN4272, the following manipulations were performed. To obtain a DNA fragment containing the Ec_dxr gene sequence, two oligonucleotide primers, sSN8339 (aaactcgagaaaagaggagaaatactagatgaagcaactcaccattctgggctcgaccg: SEQ ID NO: 8) and sSN8228 (aaaactagtcagcttgcgagacgcatcacctcttttc: SEQ ID NO: 9), were constructed and PCR was performed using MG1655 genomic DNA as a template. The ends of the resulting DNA fragment were digested with XhoI and SpeI and purified. This fragment was subcloned into the XhoI-AvrII sites of pHN4233. The resulting plasmid was designated pHN4239. To obtain a DNA fragment containing the Ec_dxr gene sequence, two oligonucleotide primers, sSN8341 (catacatgtccgccgtttcaagccagttc) and sSN8352 (aaagtcgactcagcttgcgagacgcatcacctcttttc), were designed and PCR was performed using pHN4239 as the template. The ends of the resulting DNA fragment were digested with BsrGI and SalI and purified. This fragment was subcloned into the BsrGI-XhoI sites of pHN4272. The resulting plasmid was designated pHN4312.
[0047] [Plasmid pHN4231] The following procedure was carried out to introduce into pHN4312 an IPTG-inducible T5lac promoter (PT5lac) and Te_ispG, Te_ispH, Te_petF, and Te_petH downstream of the promoter as an artificial operon. First, an artificially synthesized fragment containing the T5lac promoter sequence and other components was subcloned into the XbaI site of pHN4239. The resulting plasmid was designated pHN4239T5only. Its full sequence is shown in SEQ ID NO:10. To obtain a DNA fragment containing the T5lac promoter sequence, two oligonucleotide primers, sSN1002 (tttgtacagatcaattcgcgctaactcacattaattg: SEQ ID NO: 11) and sSN8401R (aaactgcaggcttctcaaatgcctgaggtttcagc: SEQ ID NO: 12), were designed and PCR was performed using pHN4239T5 only as a template. The resulting DNA fragment was digested with ApaI and PstI, and the fragment containing the T5lac promoter sequence was purified. This fragment was subcloned into the ApaI-NsiI sites of pHN4312. The resulting plasmid was designated pHN4315. An artificially synthesized DNA fragment containing the sequences Te_ispG, Te_ispH, Te_petF, and Te_petH was subcloned into the NcoI-BamHI site of the pHN1238 plasmid. This was designated pHN1238Tesyn. The full sequence is shown in SEQ ID NO: 13. A DNA fragment containing the sequences of Te_ispG, Te_ispH, Te_petF, and Te_petH was excised from pHN1238Tesyn with NcoI and SpeI, and the fragment was subcloned into the BspHI-AvrII site of pHN4315. The completed plasmid was named pHN4319. This plasmid was inserted into the lacI q , trc promoter, Rr_dxs, Ec_idi, Mb_ispS*, Ec_dxr, T5lac promoter, Te_ispG, Te_ispH, Te_petF, Te_petH, kanamycin resistance gene, pSC101 H It has an ori sequence. The following procedure was performed to construct pHN4231. To obtain a DNA fragment containing the on sequence required for autonomous replication of the plasmid and the chloramphenicol resistance marker sequence, two oligonucleotide primers, sSN8116 (ggtctgtttcctgtgtgaaattg: SEQ ID NO: 14) and sSN1020 (ctactagttttggcggatgagagaagattt: SEQ ID NO: 15), were prepared, and PCR was performed using the pHN1238 plasmid as a template. One end of the resulting DNA fragment was digested with SpeI and purified. This fragment was designated fragment A. Separately, to obtain a DNA fragment containing the sequences Ec_ispG and Ec_ispH, two oligonucleotide primers, sSN8250 (atgcataaccaggctccaattcaac: SEQ ID NO: 16) and sSN8255 (agaggccccaaggggttatgctag: SEQ ID NO: 17), were prepared, and PCR was performed using the pYS089 plasmid (SEQ ID NO: 18) as a template. pYS089 was created by subcloning an artificially synthesized DNA fragment into the pCDFDuet-1 plasmid (Novagen). Prior to PCR, the 5' end of sSN8250 was phosphorylated with T4 DNA kinase. One end of the resulting DNA fragment was treated with AvrII and purified. This was designated fragment B. Fragments A and B were ligated using a DNA Ligation Kit.<Mighty Mix> The plasmid pHN4231 was obtained by ligating the fragments with the pACYC184-derived ori, chloramphenicol resistance gene, trc promoter, Ec_ispG, Ec_ispH, and lacI. q It has an array of .
[0048] [Plasmid pHN4317] To generate pHN4317, the following procedure was performed. A DNA fragment containing the Ec_fldA and Ec_fpr sequences was excised from pYS078 (SEQ ID NO: 19) with XhoI and subcloned into the XhoI site of pHN4231. pYS078 was created by subcloning an artificially synthesized DNA fragment into the pCDFDuet-1 plasmid (Novagen). Furthermore, during this subcloning, a plasmid was selected in which Ec_ispG, Ec_ispH, Ec_fldA, and Ec_fpr were located in the 3' direction from the trc promoter. This completed plasmid was designated pHN4317.
[0049] [Plasmids pHN1238Tesyn, pHN1238-Zm1syn, pHN1238-Zm2syn, pHN1238-Sasyn] Gene sequences encoding IspG, IspH, fdx or fldA, and fpr from various species were artificially synthesized and subcloned into the NcoI-BamHI site of pHN1238. The gene clusters derived from Zymomonas mobilis were either a set of Zm_ispG, Zm_ispH, Zm_fld, and Zm_fpr, or a set of Zm_ispG, Zm_ispH, Zm_fdx, and Zm_fpr. Two sets were created because the enzymes that supply electrons to Zm_ispGH were unknown. A search for candidate sequences for these enzymes in the Z. mobilis ZM4 genome revealed Zm_fld and Zm_fdx, making it necessary to test both sets simultaneously. The plasmids were designated pHN1238-Zm1syn and pHN1238-Zm2syn, and their DNA sequences are shown in SEQ ID NOs: 20 and 21, respectively. The gene cluster derived from Salipaludibacillus agaradhaerens is Sa_ispG, Sa_ispH, Sa_fdx, and Sa_fpr, and the DNA sequence of the plasmid (pHN1238-Sasyn) is shown in SEQ ID NO:22. Since the detailed sequence of the gene group derived from S. agaradhaerens in Bacillus sp. N16-5 strain (mentioned above) was unknown except for ispH, a biological species with the ispH gene most homologous to the ispH of Bacillus sp. N16-5 strain was identified by a BLAST search and used. For T. elongatus, the above-mentioned pHN1238Tesyn is a plasmid carrying the gene cluster.
[0050] [MG1655_Dpgi strain] A strain (MG1655_Dpgi) in which the Ec_pgi gene has been disrupted in the genome of the MG1655 strain is described in Japanese Patent Application Laid-Open No. 2014-209872.
[0051] [MG1655_Dpgi_tetgapA strain] To control the expression of Ec_gapA on the E. coli genome, the following manipulation was carried out. A sequence containing the upstream sequence of Ec_gapA (including part of Ec_yeaC and all of Ec_msrB), the tetR gene (JP 2014-209872), the hom promoter (JP 2014-209872), the tetracycline / doxycycline-inducible promoter (Ptet, JP 2014-209872), and part of the coding sequence of Ec_gapA was artificially synthesized and subcloned into the PstI-NcoI site of pHN1234 (Nakashima and Tamura, J Biosci Bioeng 2012 114:38-). The DNA sequence of the plasmid, pHN4314, is shown in SEQ ID NO: 23. pHN4314 also contains the temperature-sensitive pSC101-derived on, the chloramphenicol resistance gene, and the Bacillus subtilis-derived sacB gene, allowing the Ec_gapA promoter sequence in the MG1655 genome to be replaced with a tetracycline / doxycycline-inducible promoter sequence. The specific method is as described in Nakashima et al. (Nakashima and Miyazaki, Int J Mol Sci 2014 15:2773-). This resulted in the construction of a strain (MG1655_Dpgi_tetgapA) in which the Ec_gapA promoter was replaced in the MG1655_Dpgi genome. Ec_gapA is a gene essential for the growth of E. coli, and its complete removal from the genome is known to be difficult (Nakashima et al., Appl Environ Microbiol 2014 80:564-). As an alternative, we constructed a strain whose expression can be artificially regulated by tetracycline / doxycycline, as described above.
[0052] [Plasmids pHN2066, pHN4325] pHN666 (Nakashima et al., 2006 Nucleic Acids Res 34:e138) is a base plasmid for constitutive expression of antisense RNA. The constitutive promoter incorporated is the con promoter (Pcon). To introduce DNA sequences for expressing antisense RNA against Ec_aceE and Ec_gltA mRNAs into this plasmid, the following procedure was performed. To obtain a DNA fragment containing a partial sequence of the Ec_aceE gene, two oligonucleotide primers, sSN1218 (ggctcgagaaaactcaacgttattagatag: SEQ ID NO: 24) and sS1219 (tcccatggagccagtcgcgagtttcgat: SEQ ID NO: 25), were designed and PCR was performed using MG1655 genomic DNA as a template. The ends of the resulting DNA fragment were digested with NcoI and XhoI and purified. This fragment was subcloned into the NcoI-XhoI site of pHN666. This plasmid, which contains an antisense sequence of aceE downstream of the constitutive promoter, was designated pHN2066. To obtain a DNA fragment containing a partial sequence of the Ec_gltA gene, two oligonucleotide primers, sSN1267 (gtctcgaggcaaatttaagttccggcagtc: SEQ ID NO: 26) and sS1268 (acccatggttcaacagctgtatccccgttg: SEQ ID NO: 27), were designed and PCR was performed using MG1655 genomic DNA as a template. The ends of the resulting DNA fragment were digested with NcoI and XhoI and purified. This fragment was subcloned into the NcoI-XhoI site of pHN666. This plasmid, which contains the antisense sequence of Ec_gltA downstream of the constitutive promoter, was designated pHN4325.
[0053] [Example 2: Isoprene production experiment] E. coli MG1655_Dpgi transformed with each plasmid was inoculated from a colony on agar medium into a 15 mL plastic centrifuge tube containing 1 mL of medium. After overnight incubation at 30°C with shaking, a 20 μL aliquot was taken and mixed with 10 mL of M9Y medium in a 50 mL baffled Erlenmeyer flask. After overnight incubation at 30°C with shaking, the optical density at 600 nm (OD600) of the culture was measured using a spectrophotometer. The culture was diluted with M9Y medium to an OD600 of 0.6, and 10 mL of the diluted culture was placed in a new 50 mL baffled Erlenmeyer flask. A 1 M IPTG solution was added to the flask to a final IPTG concentration of 0.5 mM, followed by incubation with shaking at 30°C for 4 hours. The E. coli cells were then pelleted in a centrifuge at 5000 g for 5 minutes using an angle rotor. The supernatant culture medium was discarded, and the pellet was suspended in 1 mL of M9 medium. A 1 M IPTG solution was added to the suspension to a final concentration of 0.5 mM. The entire suspension was then transferred to a headspace crimp vial (Shimadzu GLC, product number 20-09-0297-1, rounded bottom, 20 mL) and sealed to prevent isoprene loss. The vial was sealed using a rubber stopper (Nichiden Rika Glass, product number 0717041211, large type B for lyophilization), an aluminum vial cap (Shimadzu GLC, product number 20-ACB, for headspace sampler HS-20 vials), and a 20 mm electronic crimper (Shimadzu GLC, model number GLC-20AC). However, when culturing the MG1655_Dpgi_tetgapA strain using the above culture method, doxycycline was always added at 20 μg / L (stock solution 20 mg / L, solvent 99.5% ethanol) until just before the first IPTG addition. This was because Ec_gapA is an essential gene for growth. After sealing, the vial was shaken at 30°C for 20 hours. Next, to achieve gas-liquid equilibrium for the isoprene in the vial, the vial was left to stand at 50°C for 20 minutes, after which 25 μL of the gas phase was aspirated using a gas-tight syringe (Hamilton, product number 1702NPT5, 22 s gauge, 25 μL capacity). The entire gas phase was injected into a gas chromatography mass spectrometer (Shimadzu, GCMS-TQ8040 NX), and the amount of isoprene was quantified. A GL Sciences TC-70 column (inner diameter 0.25 mm, length 30 m) was used in the gas chromatography section. Helium was used as the carrier gas. The gas chromatography mass spectrometer settings were: sample inlet temperature 220°C, column oven temperature 80°C (constant), splitless injection, pressure 100 kPa, linear velocity 44.5 cm / s (constant control), mass spectrometer interface temperature 80°C, ion source temperature 200°C, scan measurement mode, mass range (m / z) 60 to 70, and analysis time 3 minutes. Quantitation was performed using the isoprene peak appearing approximately between 1.175 and 1.180 minutes. Wako Pure Chemical Industries, Ltd.'s Wako First-Class Isoprene was used as the isoprene standard solution. An appropriate amount was mixed with M9 medium and then fed to the gas chromatography mass spectrometer to create a calibration curve.
[0054] The measurement results of isoprene production are shown in Figure 1-4. Although overexpression of Ec_dxr sometimes reduced isoprene production (Fig. 1), when it was coexpressed with Ec_ispGH, Ec_fldA, and Ec_fpr, productivity was high (Fig. 2).
[0055] In addition, when various ispGH, ferredoxin / flavodoxin genes, and ferredoxin / flavodoxin-NADPH reductase genes were overexpressed, it was found that Te_ispGH, Te_petF, and Te_petH were the most productive (Fig. 2).
[0056] Furthermore, productivity was higher when Ec_gapA expression was suppressed using the MG1655_Dpgi_tetgapA strain than when it was suppressed using the MG1655_Dpgi strain (Fig. 3). In addition to suppressing Ec_gapA expression, constitutive expression of an antisense RNA that binds to Ec_gltA mRNA and inhibits (silences) its function further increased productivity (Fig. 4). [Sequence List Free Text]
[0057] SEQ ID NO: 1: Nucleotide sequence of primer sSN8221 SEQ ID NO: 2: Nucleotide sequence of primer sSN1671 SEQ ID NO: 3: Nucleotide sequence of plasmid pYS067 SEQ ID NO: 4: Nucleotide sequence of primer sSN8335 SEQ ID NO: 5: Nucleotide sequence of primer sSN8336 SEQ ID NO: 6: Nucleotide sequence of primer sSN8343 SEQ ID NO: 7: Nucleotide sequence of primer sSN8255 SEQ ID NO: 8: Nucleotide sequence of primer sSN8339 SEQ ID NO: 9: Nucleotide sequence of primer sSN8228 SEQ ID NO: 10: Nucleotide sequence of plasmid pHN4239T5 only SEQ ID NO: 11: Nucleotide sequence of primer sSN1002 SEQ ID NO: 12: Nucleotide sequence of primer sSN8401R SEQ ID NO: 13: Nucleotide sequence of plasmid pHN1238Tesyn SEQ ID NO: 14: Nucleotide sequence of primer sSN8116 SEQ ID NO: 15: Nucleotide sequence of primer SN1020 SEQ ID NO: 16: Nucleotide sequence of primer sSN8250 SEQ ID NO: 17: Nucleotide sequence of primer sSN8255 SEQ ID NO: 18: Nucleotide sequence of plasmid pYS089 SEQ ID NO: 19: Nucleotide sequence of plasmid pYS078 SEQ ID NO: 20: Nucleotide sequence of plasmid pHN1238-Zm1syn SEQ ID NO: 21: Nucleotide sequence of plasmid pHN1238-Zm2syn SEQ ID NO: 22: Nucleotide sequence of plasmid pHN1238-Sasyn SEQ ID NO: 23: Nucleotide sequence of plasmid pHN4314 SEQ ID NO: 24: Nucleotide sequence of primer sSN1218 SEQ ID NO: 25: Nucleotide sequence of primer sS1219 SEQ ID NO: 26: Nucleotide sequence of primer sSN1267 SEQ ID NO: 27: Nucleotide sequence of primer sS1268
Claims
1. Reduced phosphoglucose isomerase (Pgi) activity compared to the unmodified form; The modified strain has enhanced 1-deoxy-D-xylulose 5-phosphate synthase (Dxs) activity, isopentyl diphosphate isomerase (Idi) activity, and isoprene synthase (IspS) activity compared to an unmodified strain, and further reduced glyceraldehyde-3-phosphate dehydrogenase (GapA) activity compared to the unmodified variant; Reduced citrate synthase (GltA) activity compared to the unmodified form, and the strain has enhanced 1-deoxy-D-xylulose 5-phosphate reductoisomerase (Dxr) activity, 1-hydroxy-2-methyl-2-butenyl 4-diphosphate synthase (IspG) activity and / or 1-hydroxy-2-methyl-2-butenyl 4-diphosphate reductase (IspH) activity, ferredoxin / flavodoxin (PetF / FldA) activity, and ferredoxin / flavodoxin-NADP reductase (PetH / Fpr) activity compared to an unmodified strain; A genetically modified microorganism capable of producing isoprenoids.
2. 2. The genetically modified microorganism according to claim 1, which expresses the 1-hydroxy-2-methyl-2-butenyl 4-diphosphate synthase (IspG) gene and / or the 1-hydroxy-2-methyl-2-butenyl 4-diphosphate reductase (IspH) gene, the ferredoxin / flavodoxin (PetF / FldA) gene, and the ferredoxin / flavodoxin-NADP reductase (PetH / Fpr) gene derived from Thermosynechococcus elongatus.
3. The genetically modified microorganism according to claim 1 or 2, which is Escherichia coli.
4. The genetically modified microorganism according to any one of claims 1 to 3, wherein the isoprenoid is isoprene.
5. A method for producing isoprenoids, comprising a step of contacting a genetically modified microorganism capable of producing isoprenoids with an organic raw material in an aqueous medium, The method for producing the genetically modified microorganism, wherein the genetically modified microorganism is a genetically modified microorganism described in any one of claims 1 to 3.
6. 6. The method of claim 5, wherein the organic raw material comprises xylose, arabinose, mannose, galactose, fructose, glucose, lactose, maltose, trehanose, cellobiose, sucrose, starch, dextrin, cellulose, hemicellulose, glycerol, and / or mannitol.
7. The method according to claim 5 or 6, wherein the isoprenoid is isoprene.
Citation Information
Patent Citations
Metabolic engineering for microbial production of terpenoid products
JP2020505930A
Escherichia coli strain FMIS2 for producing isoprene and use thereof
KR101582259B1
Enhanced production of isoprene using host cells having decreased ispA activity
US8975051B2
Improved isoprene production using the DXP and MVA pathway
WO2010148150A1
Compositions and methods for improved isoprene production using two types of ISPG enzymes
WO2012088462A1