Gene expression regulators

A gene expression regulator using mesenchymal stem cell culture supernatant or exosomes addresses the need for new applications by promoting or suppressing specific gene expressions, enhancing skin health and hair growth, and treating atopy.

JP7744665B2Active Publication Date: 2025-09-26BIOMIMETICS SYMPATHIES INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2021063757
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-04-02
Publication Date
2025-09-26
Estimated Expiration
2041-04-02

AI Technical Summary

Technical Problem

Existing uses of mesenchymal stem cell culture supernatants are limited, and new functions and applications are needed for research and pharmaceutical purposes.

Method used

A gene expression regulator is developed using mesenchymal stem cell culture supernatant or its exosomes as an active ingredient, promoting or suppressing the expression of specific genes such as KPRP, Col3A1, Meprin-α, elastin, p16 INK4a, and HAS1, potentially enhanced by hyaluronic acid, for applications like hair growth and atopy treatment.

Benefits of technology

The gene expression regulator effectively regulates gene expression in epidermal cells, promoting desirable gene expression levels for skin health and hair growth, and suppressing undesirable gene expression, demonstrating utility in research and medical treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007744665000001
    Figure 0007744665000001
  • Figure 0007744665000002
    Figure 0007744665000002
  • Figure 0007744665000003
    Figure 0007744665000003
Patent Text Reader

Abstract

To provide new applications for conditioned media of mesenchymal stem cells.SOLUTION: A gene expression control agent contains conditioned media of mesenchymal stem cells or exosomes thereof as active ingredients, the gene expression control agent being at least one selected from KPRP, Col3A1, Meprin-α, Elastin, p16INK4a HAS1.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to a gene expression regulator, and more specifically to a gene expression regulator comprising a culture supernatant of mesenchymal stem cells as an active ingredient. [Background technology]

[0002] Mesenchymal stem cells are one type of stem cell present in adults and have the ability to differentiate into mesodermally derived tissues (e.g., bone, cartilage, blood vessels, cardiomyocytes, etc.) Examples of mesenchymal stem cells include bone marrow-derived mesenchymal stem cells and adipose tissue-derived mesenchymal stem cells.

[0003] Mesenchymal stem cells can be cultured in any medium, and the culture supernatant obtained after culturing mesenchymal stem cells is known to have specific functions.

[0004] For example, Patent Document 1 discloses an eicosanoid production promoter that contains a secretion product of mesenchymal stem cells as an active ingredient and promotes the production of eicosanoids from macrophages. Furthermore, Patent Document 2 discloses a synoviolin expression inhibitor that contains mesenchymal stem cells or a culture supernatant of mesenchymal stem cells as an active ingredient and inhibits the expression of the synoviolin gene or the expression of the synoviolin protein. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] Patent No. 6497827 [Patent Document 2] International Publication No. 2018 / 079753 Summary of the Invention [Problem to be solved by the invention]

[0006] As described above, mesenchymal stem cell culture supernatants are known to have specific functions, and the development of new functions and / or uses is expected in the future. Therefore, an object of the present disclosure is to provide new uses for mesenchymal stem cell culture supernatants. [Means for solving the problem]

[0007] As a result of extensive research, the present inventors have newly discovered that the culture supernatant of mesenchymal stem cells is involved in the regulation of the expression of several genes. Such a function of regulating gene expression is useful not only for research and development purposes but also for pharmaceutical applications.

[0008] Based on the above findings, the present disclosure includes, in one aspect, the following invention. (Invention 1) A gene expression regulator that promotes the expression of KPRP genes, comprising mesenchymal stem cell culture supernatant or its exosomes as an active ingredient. (Invention 2) A gene expression regulator that promotes the expression of the Col3A1 gene, comprising mesenchymal stem cell culture supernatant or its exosomes as an active ingredient. (Invention 3) A gene expression regulator that promotes the expression of the Meprin-α gene, comprising mesenchymal stem cell culture supernatant or its exosomes as an active ingredient. (Invention 4) A gene expression regulator that promotes the expression of elastin genes, containing mesenchymal stem cell culture supernatant or its exosomes as an active ingredient. (Invention 5) p16 containing mesenchymal stem cell culture supernatant or its exosomes as an active ingredient INK4a A gene expression regulator that suppresses the expression of a gene. (Invention 6) A gene expression regulator that promotes the expression of the HAS1 gene, comprising mesenchymal stem cell culture supernatant or its exosomes as an active ingredient. (Invention 7) 7. The gene expression regulator according to any one of Inventions 1 to 6, further comprising hyaluronic acid. (Invention 8) 8. The gene expression regulator according to any one of Inventions 1 to 7, which regulates the expression of the gene in epidermal cells. (Invention 9) 9. The gene expression regulator according to any one of Inventions 1 to 8, wherein the culture supernatant is serum-free. (Invention 10) 10. The gene expression controlling agent according to any one of Inventions 1 to 9, which is an agent to be administered to the skin. (Invention 11) A gene expression control agent according to Invention 10, which is administered for the purpose of hair growth and / or hair development. (Invention 12) A gene expression control agent of Invention 10, which is an agent administered for the purpose of treating atopy. [Effects of the Invention]

[0009] In one aspect, the above invention contains a mesenchymal stem cell culture supernatant as an active ingredient and regulates the expression of a specific gene, which is useful in research and development and / or pharmaceutical applications. [Brief explanation of the drawings]

[0010] [Figure 1] This is a graph showing the relative expression levels of each gene determined by quantitative PCR. [Figure 2] This is a graph showing the relative expression levels of each gene determined by quantitative PCR. [Figure 3] This is a graph showing the relative expression levels of each gene determined by quantitative PCR. [Figure 4] This is a graph showing the relative expression levels of each gene determined by quantitative PCR. DETAILED DESCRIPTION OF THE INVENTION

[0011] Specific embodiments for carrying out the present invention will be described below. The following description is intended to facilitate understanding of the present invention and is not intended to limit the scope of the present invention.

[0012] 1. Gene expression regulators In one embodiment, the present disclosure relates to a gene expression regulator. Regulating gene expression means acting on a specific cell to increase or suppress gene expression.

[0013] In one embodiment, the gene expression controlling agent of the present disclosure may be in any dosage form. It may be solid, liquid, or semi-solid (e.g., gel, paste). If it is solid, it may be in any form (e.g., tablet, powder (e.g., for inhalation, for reconstitution with liquid, etc.), capsule). If it is liquid, it may be in a form suitable for use as a drink, injection, spray, etc. If it is semi-solid, it may be in a form suitable for use as an injection, topical application, oral ingestion, etc.

[0014] In one embodiment, the gene expression regulator of the present disclosure comprises, as an active ingredient, a mesenchymal stem cell culture supernatant or exosomes contained in the culture supernatant. Specific examples of the mesenchymal stem cell culture supernatant or exosomes therein will be described in detail below.

[0015] In one embodiment, the gene expression regulator of the present disclosure may contain, as an active ingredient, a component other than the mesenchymal stem cell culture supernatant. For example, to regulate the expression of a target gene, a drug with an equivalent effect may be used in combination. Alternatively, when the expression of multiple genes is regulated by the mesenchymal stem cell culture supernatant, a drug that cancels the effect of expression of genes other than the target gene may be used in combination in order to regulate only the expression of the target gene.

[0016] In a preferred embodiment, hyaluronic acid may be added. Hyaluronic acid may be added to the medium during the culture of mesenchymal stem cells. Alternatively, hyaluronic acid may be added to the culture supernatant or the like after the culture of mesenchymal stem cells is completed.

[0017] The hyaluronic acid to be added to the culture medium is not particularly limited, but low-molecular-weight hyaluronic acid is preferred. More specifically, the weight-average molecular weight is 5,000 or less, preferably 2,000 or less, more preferably 1,500 or less, and most preferably 1,000 or less. The preferred concentration for use is 20 to 1,000 μg / ml. The molecular weight of hyaluronic acid is calculated by a method combining size exclusion chromatography and a light scattering detector (SEC-LS).

[0018] In addition to the above ingredients, other ingredients may be added as needed. For example, other ingredients include excipients, antibiotics, pH buffers, etc. Furthermore, other ingredients include additional ingredients for promoting and / or improving the health of the skin (e.g., antioxidants, fragrances, whitening ingredients, moisturizing ingredients, whitening ingredients, etc.).

[0019] 2. Mesenchymal stem cell culture supernatant 2-1. Types of mesenchymal stem cells Mesenchymal stem cells are not limited to those derived from a specific tissue, and may be derived from any tissue. For example, mesenchymal stem cells derived from bone marrow, umbilical cord blood, placenta, adipose tissue, etc. Typically, mesenchymal stem cells derived from bone marrow and / or adipose tissue can be used.

[0020] 2-2. Culture medium The medium is not particularly limited, and media known in the art (e.g., DMEM, F12, RPMI, etc.) can be used. Examples of media include mesenchymal stem cell basal medium manufactured by Invitrogen, mesenchymal stem cell basal medium manufactured by Sanko Junyaku, MF medium manufactured by Toyobo, sf-DOT (registered trademark) manufactured by BioMimetics Sympathies, medium manufactured by Nipro / Cell Science Institute (e.g., product numbers A2G00P05C+A2G20P1CC), and medium manufactured by Kohjin Bio (e.g., product number KBM ADSC-4).

[0021] Although serum may be added to the medium, a serum-free medium is preferred, which can avoid the influence of serum components when the gene expression regulator containing the culture supernatant is allowed to act on other cells, for example.

[0022] 2-3.Culture conditions The culture conditions are not particularly limited and may be any conditions known in the art. For example, the temperature may be 35°C to 40°C, typically 37°C. The incubator may be appropriately controlled to maintain a CO2 concentration of 5%. The culture period is not particularly limited, but it is preferable to culture for at least 24 hours, preferably 48 hours or more. The upper limit is not particularly limited, but it is 168 hours or less.

[0023] 2-4. Culture supernatant or its exosomes In one embodiment, a culture supernatant can be obtained by culturing the cells described in "2-1. Types of mesenchymal stem cells" above using the medium described in "2-2. Medium" under the conditions described in "2-3. Culture conditions." After culturing, miscellaneous components may be removed by centrifugation and / or filtering, etc. Alternatively, a specific fraction (e.g., exosomes) may be obtained by separate centrifugation. Alternatively, the cells may be lyophilized or otherwise made into a powder. Alternatively, a gelling agent or the like may be added to form a gel.

[0024] Therefore, the term "culture supernatant" as used herein includes not only the medium components immediately after cell culture, but also those that have been subjected to some kind of processing.

[0025] 3. Genes to be regulated In one embodiment, the gene targeted by the gene expression regulator of the present disclosure is one or more genes selected from the following: The description in parentheses indicates the direction (enhancement or suppression) of change in gene expression by the gene expression regulator. KPRP (enhanced expression) Col3A1 (increased expression) Meprin-α (enhanced expression) Elastin (enhanced expression) p16 INK4a(expression suppression) HAS1 (increased expression) Each gene will be explained below.

[0026] 3-1.KPRP Keratinocyte proline-rich protein (KPRP) is involved in the skin's barrier function. It has been reported that KPRP expression is low in atopic patients, and it may be involved in the treatment of atopic dermatitis.

[0027] 3-2.Col3A1 Col3A1, also known as type III collagen alpha 1, is a component of the triple helix of collagen fibers and is a histologically essential protein in skin. It is known that a decrease in this protein contributes to signs of skin aging. Furthermore, Col3A1 may also be involved in wound healing (including surgical wound healing) and hair growth promotion.

[0028] Meprin-α Meprin-α is a subunit of Zn protease and functions to cleave the propeptide of type III collagen. It is known that the ratio of type III collagen to type I collagen decreases with age, and Meprin-α also decreases with age. Furthermore, it has been reported that preventing the age-related decrease in Meprin-α can suppress the decrease in the ratio of type III collagen to type I collagen (https: / / www.jstage.jst.go.jp / article / sccj / 47 / 4 / 47_278 / _article / -char / ja / ).

[0029] 3-4.Elastin Elastin is a fiber that supports collagen fibers. Elastin decreases with age, which causes wrinkles. It is also known to be used as an ingredient in cosmetics and / or supplements. In addition, elastin can also be involved in wound healing (including healing of surgical wounds). Furthermore, elastin components are sometimes included in hair growth and / or hair restoration agents, and elastin can be involved in hair growth.

[0030] 3-5.p16 INK4a p16 INK4a is known to have the function of inhibiting the cell cycle, and furthermore, it is known that an increase in the expression level of this protein promotes aging.

[0031] 3-6.HAS1 HAS1, also known as hyaluronan synthase 1, is an enzyme that synthesizes hyaluronic acid. It is known that the expression levels of HAS1 and hyaluronic acid are reduced in the skin of atopic patients. This hyaluronic acid is also known to be incorporated as an ingredient in cosmetics and / or supplements. Furthermore, HAS1 can also be involved in wound healing (including surgical wound healing) via the synthesized hyaluronic acid. Furthermore, HAS1 can also be involved in hair growth and / or hair development via the synthesized hyaluronic acid.

[0032] 4. Cells targeted by gene expression control In one embodiment, the gene expression control agent of the present disclosure can act on cells in any form to control gene expression. Target cells include, but are not limited to, epidermal cells. Histologically, skin comprises, from the surface, the epidermis, dermis, and adipose tissue, and the term "epidermal cells" used herein includes cells of any of the epidermis, dermis, and adipose tissue. Examples of "epidermal cells" include epidermal keratinocytes and dermal fibroblasts.

[0033] 5.Applications In one embodiment, the gene expression regulator of the present disclosure may have various uses. For example, it may be used to regulate cellular gene expression in research and development (e.g., in vivo or in vitro). In one embodiment, the gene expression regulator of the present disclosure may be administered to the human body, particularly to the skin.

[0034] Examples of purposes for administration to the skin include hair growth and / or hair care, and the treatment of atopy. [Example]

[0035] 6. Working Example 6-1. Example 1 (Primary culture of mesenchymal stem cells) First, adipose tissue-derived mesenchymal stem cells were prepared. Specifically, subcutaneous adipose tissue was isolated from patients who were scheduled to undergo regenerative medicine using adipose tissue-derived mesenchymal stem cells. This subcutaneous adipose tissue served as the raw material for preparing cells for administration. The remaining subcutaneous adipose tissue was subjected to primary culture. In addition, consent for research use was obtained from the patient in advance.

[0036] Subcutaneous adipose tissue was centrifuged (400 × g for 5 minutes) to separate into three layers. Specifically, the three layers were separated from the top down: lipid fraction, adipose tissue fraction, and aqueous fraction. The middle adipose tissue fraction was retained, and the top and bottom layers were discarded. A 0.15% collagenase enzyme solution was added to the remaining adipose tissue fraction at a volume four times the tissue weight. The adipose tissue was permeated at 37°C for 1 hour for enzyme treatment. After the adipose tissue was dispersed by enzyme treatment, the adipose tissue was centrifuged (400 × g for 5 minutes). The precipitated fraction was suspended in 30 mL of PBS(-) solution to obtain the stromal vascular cell fraction containing mesenchymal stem cells. The suspension was then passed through a cell strainer (mesh size 70 μm), and any tissue debris captured by the cell strainer was discarded. The flow-through fraction was then centrifuged again (400 × g for 5 minutes), and the precipitated fraction was suspended in 6 mL of serum-free culture medium sf-DOT (Biomimetics Sympathies, Inc.). The entire cell suspension was seeded into a T25 flask (CellBIND; Corning, 3289) and placed in an incubator (37°C, 5% CO2) to initiate primary culture.

[0037] 6-2. Example 2 (Subculture, P0 ⇒ P1 ⇒ P2) The medium was completely replaced every three days. The supernatant was discarded, and cells growing on the flask bottom were selectively expanded. After cells reached semi-confluence in a T-25 flask, 2 mL of enzyme solution (TrypLE Express; Thermo Fisher Scientific, 12604021) was added to detach the cells from the flask bottom (37°C, 5 minutes). The cells were diluted with PBS(-) and centrifuged (400 × g, 5 minutes). The precipitated cells were suspended in sf-DOT culture medium, and an aliquot was taken and counted using trypan blue staining. The cells suspended in sf-DOT were seeded into a new T75 flask (CellBIND; Corning, 3290) and placed in an incubator (37°C, 5% CO2) for subculture (P0 → P1). Subsequent subcultures were repeated in the same manner to obtain the required cell numbers (P1 → P2).

[0038] 6-3. Example 3 (Preparation of culture supernatant) First, adipose tissue-derived mesenchymal stem cells were cultured in sf-DOT as described above. Adipose tissue-derived mesenchymal stem cells were cultured in the same medium at 3000 cells / cm per T75 flask. 2 On the third day, when the cells reached semi-confluence, they were washed once with PBS(-). Then, the following two media (both serum-free) were prepared for the culture supernatant. (i) Basic medium (DMEM / F12; SIGMA, D8900), (ii) Basic medium (DMEM / F12; SIGMA, D8900) + low molecular weight hyaluronic acid HA4 (100 μg / ml added)

[0039] The cells were further cultured in these media (i) and (ii) for 3 days, and the supernatants were collected. The collected culture supernatants were filtered through a 0.2 μm PES syringe filter (25 mm GD / X syringe filter (PES 0.2 μm sterilized); 6896-2502; GE Healthcare Japan). The filtered culture supernatants were stored frozen at -28°C until use in analysis.

[0040] The culture supernatant obtained above was used to prepare the following three types of culture supernatant. CM1: Culture supernatant from (i) above H-CM: culture supernatant derived from (ii) above CM2: Culture supernatant from (i) above, to which low molecular weight hyaluronic acid HA4 (100 μg / ml) was added

[0041] 6-4. Example 4 (Treatment of skin fibroblasts with culture supernatant) Normal human dermal fibroblasts (NHDF; Takara, C-12302) were prepared. The cells were passaged and maintained in Fibroblast medium (Sciencell, 2301). NHDF were plated at 3000 cells / cm in each well of a 12-well plate (Corning, 3336). 2 and cultured overnight.

[0042] 6-5. Example 5 (Treatment of epidermal keratinocytes with culture supernatant) Normal human epidermal keratinocytes (NHEK; Takara, C-12006) were prepared. The cells were passaged and maintained in Keratinocyte-SFM (ThermoFisher Scientific, 17005042). NHEK were plated at 10,000 cells / cm in each well of a 12-well plate (Corning, 3336). 2 and cultured overnight.

[0043] The following day (16–24 h after seeding), the medium for the above skin fibroblasts and epidermal keratinocytes was replaced with various supernatants (CM1, CM2, H-CM) and cultured for an additional 3 days (approximately 72 h). After culture, total RNA was extracted from NHDF and NHEK using the ReliaPrep RNA Miniprep system (Promega, Z6012). After extraction, 500 ng of RNA was used for cDNA synthesis (PrimeScript RT Master Mix; Takara, RR036A), followed by quantitative PCR (Thunderbird Sybr qPCR Mix; TOYOBO, QPS-201X5).

[0044] A mixture for cDNA synthesis was prepared according to the following composition. 5xPrimeScript RT Master Mix 2μl (final concentration 1x) Total RNA 500ng RNase-free H2O, adjust to a total of 10 μl

[0045] The mixture was treated using a Veriti 96-well Thermal Cycler manufactured by Applied Biosystems under the following conditions. 37℃ 15 minutes ↓ 85℃ 5 seconds ↓ 4℃∞

[0046] The synthesized cDNA (10 μl) was diluted 10-fold with 90 μl of TE (10 mM Tris-HCl pH 8.0 + 1 mM EDTA pH 8.0), and the diluted product was subjected to quantitative PCR.

[0047] 6-6. Example 6 (Analysis of gene expression in skin fibroblasts and epidermal keratinocytes) More specifically, the dilutions were mixed under the following conditions: 2×THUNDERBIRD Probe qPCR Mix 10μl 5mM Forward Primer 0.4μl 5mM Reverse Primer 0.4μl H2O 8.2 μl cDNA (10x diluted) 1 μl

[0048] The mixture was used to amplify the cDNA using Bio-Rad's CFX-Connect. The PCR cycle conditions were as follows: 1. 95℃ 1 minute (initial denaturation) 2.95℃ 15 seconds (denaturation) 3.60℃ 30 seconds (extension) (Steps 2 and 3 were repeated 40 times, and a fluorescent signal was detected each time step 3 was completed.) 4. Increase the temperature from 65℃ to 95℃ in 0.5℃ increments, hold the temperature for 5 seconds, and then detect the fluorescent signal.

[0049] Using the above cycles, PCR products were detected, and the uniformity of the PCR products was confirmed by a melting curve.

[0050] As an internal control (a housekeeping gene with equal expression in all cells and conditions), GAPDH ( G lycer a ldehyde 3- p phosphate d e h hydroxylase) was used. The primer sequences for detecting each gene were as follows: GAPDH Forward primer: 5’ - agccacatcgctcagacac - 3’ GAPDH Reverse primer: 5’ - gcctaatacgaccaaatcc - 3’ Col3A1 Forward primer: 5’ - ctggaccccagggtcttc - 3’ Col3A1 Reverse primer: 5’ - gaccatctgatccagggtttc - 3’ Meprin-α Forward primer: 5’ - gcaccacaactcacactctttt - 3’ Meprin-α Reverse primer: 5’ - ttccacagatgtttgccttc - 3’ Elastin Forward primer: 5’ - ggaggtgttcccggagtc - 3’ Elastin Reverse primer: 5’ - ggtccccactccgtacttg - 3’ p16 INK4a Forward primer: 5’ - gtggacctggctgaggag - 3’ p16 INK4a Reverse primer: 5’ - ctttcaatcggggatgtctg - 3’ HAS1 Forward Primer: 5’ - acgtgcggatccttaaccc - 3’ HAS1 Reverse Primer: 3’ - aggcctagaggaccgctgat - 3’

[0051] All primers were purchased from FASMAC Co., Ltd. (reverse-phase column purification grade). The expression level of each gene is shown as the normalized expression level obtained by quantitative PCR divided by the expression level of GAPDH. Furthermore, the expression level under control conditions (no supernatant treatment) was normalized to "1." The melting curve confirmed that all PCR products amplified using the above primers were unique (i.e., multiple sequences were not amplified with the same primers).

[0052] The results are shown in Figures 1 and 2. When treated with culture supernatant (CM1, CM2, H-CM), it was confirmed that the expression levels of the examined genes in skin fibroblasts were favorably changed. That is, the expression levels of genes that are considered desirable to increase (Col3A1, Meprin-α, Elastin) increased. On the other hand, the expression levels of genes that are considered desirable to decrease (p16 INK4a ) expression levels were decreased. Furthermore, it was confirmed that the expression levels of the examined genes (specifically, HAS1 expression levels) were also changed in a favorable direction in epidermal keratinocytes treated with H-CM. Furthermore, it was confirmed that the expression of some genes was further changed in a favorable direction when hyaluronic acid was added (CM2, H-CM).

[0053] Notably, the changes in gene expression levels resulting from H-CM treatment were more pronounced than those resulting from CM2 treatment. As mentioned above, in CM2, HA4 was added to the medium after adipose tissue-derived mesenchymal stem cells were treated with the medium. On the other hand, in H-CM, HA4 was added to the medium before adipose tissue-derived mesenchymal stem cells were treated with the medium.

[0054] Therefore, it is thought that adipose tissue-derived mesenchymal stem cells secrete some useful substance extracellularly in response to stimulation by HA4, and the presence of this useful substance favorably alters the gene expression levels in skin fibroblasts and epidermal keratinocytes.

[0055] Dermal fibroblasts and epidermal keratinocytes are cells present in skin tissue, and therefore, changes in the expression levels of these genes are thought to have a positive effect on the health of the skin.

[0056] Furthermore, considering the differences in conditions and results between H-CM and CM2, it is expected that similar effects will be obtained even if cells treated with H-CM are co-cultured with, for example, either skin fibroblasts or epidermal keratinocytes.

[0057] 6-7. Example 7 (Expression of KPRP gene in epidermal keratinocytes) The adipose tissue-derived mesenchymal stem cells prepared in Examples 1 and 2 were prepared.

[0058] Specifically, adipose tissue-derived mesenchymal stem cells were cultured in sf-DOT as described above until P1. They were then cryopreserved in STEM CELL BANKER (TAKARA; CB045). The cryopreserved adipose tissue-derived mesenchymal stem cells were thawed and cultured in the following two media, and the culture supernatant was collected at P4. (A)Nipro / Cell Science Institute (product number A2G00P05C+A2G20P1CC) (B) Kohjin Bio Co., Ltd. (Product No. KBM ADSC-4)

[0059] At P4, cells were cultured in these media (A) and (B) at a density of 3000 / cm. 2 The cells were cultured at 4°C for 3 days, and the supernatants were collected. The collected culture supernatants were filtered through a 0.2 μm PES syringe filter (25 mm GD / X syringe filter (PES 0.2 μm sterilized); 6896-2502; GE Healthcare Japan). The filtered culture supernatants were stored frozen at -28°C until use in analysis.

[0060] Next, epidermal keratinocytes were treated with the culture supernatant under the same conditions as in Example 5, RNA was extracted, and expression analysis was performed under the same conditions as in Example 6. However, the culture supernatants used were those derived from (A) and (B) above. As a control, epidermal keratinocytes were treated with fresh media (A) and (B) above that had not been cultured with mesenchymal stem cells. Furthermore, the gene to be analyzed for expression was KPRP, and the following primers were used for amplification. KPRP Forward Primer: 5' - cttgcctgtgaggagggtca - 3' KPRP Reverse Primer: 3' - aagggggattgagaggagca - 3'

[0061] The results are shown in Figure 3. Compared with the controls (Nipro(AF) and KBM), the culture supernatants (Nipro(AF)-CM and KBM-CM) significantly promoted the expression of KPRP.

[0062] 6-8. Example 8 (Expression of KPRP gene in epidermal keratinocytes) The experiment was carried out using the same procedure as in Example 7. However, in addition to adipose tissue-derived mesenchymal stem cells (AD), umbilical cord blood-derived mesenchymal stem cells (UC) were also prepared. Furthermore, to investigate which components of the culture supernatant were important, a kit for crude purification of exosome fractions (ExoQuickTC (System Bioscience, LCC, EXOTC10A-1)) was used. The culture supernatant was prepared as described above using sf-DOT.

[0063] Umbilical cord blood-derived mesenchymal stem cells were prepared as follows. Umbilical cord tissue obtained with informed consent from women undergoing normal delivery was subjected to primary culture the day after collection. After removing umbilical cord blood from approximately 10 cm of umbilical cord tissue, the tissue was shredded with a scalpel and immersed in 0.15% collagenase solution for 16 hours at 37°C with gentle agitation on a shaker. After visually confirming the tissue was dispersed, the tissue was diluted 10-fold with PBS(-) and centrifuged at 1,000 × g for 5 minutes. The upper layer was discarded, leaving only the precipitate. The precipitate was then suspended in PBS(-) and passed through a 70 μm filter. The flow-through fraction was divided equally between two conical tubes and centrifuged at 400 × g for 5 minutes. The precipitate containing the cells was suspended in 24 mL of serum-free culture medium (Procul AD; Rohto Pharmaceutical). The entire amount was then seeded into one T-150 flask (CellBIND (registered trademark); Corning) and placed in an incubator (37°C, 5% CO2) to initiate primary culture. Subculture was then performed using the same procedure as in Example 2.

[0064] Culture supernatants of adipose tissue-derived mesenchymal stem cells and cord blood-derived mesenchymal stem cells were prepared as described above and mixed with ExoQuickTC (System Bioscience, LCC, EXOTC10A-1) at a 5:1 ratio and left to stand overnight (approximately 16 hours) at 4°C. The mixture was then centrifuged at 10,000 × g for 30 minutes at 4°C, and the precipitated fraction was collected as the exosome fraction. These were designated ExoAD and ExoUC, respectively.

[0065] The results are shown in Figure 4. Using only the exosome fraction from the culture supernatant of adipose-derived mesenchymal stem cells significantly promoted KPRP expression. While this result does not rule out the possibility that other secretory components may also be important, it demonstrates that the exosome fraction is sufficient. Furthermore, a similar effect was observed with the exosome fraction from the culture supernatant of umbilical cord-derived mesenchymal stem cells, demonstrating that exosomes derived from mesenchymal stem cells of any tissue origin can induce similar gene expression regulation effects.

[0066] The results shown above demonstrate that the expression of desired genes can be controlled by incorporating mesenchymal stem cell conditioned media as an active ingredient. It has also been confirmed that exosomes in conditioned media can control the expression of other genes. This ability to control gene expression is useful in research and development, as well as in medical treatment.

[0067] Specific embodiments have been described above. The above embodiments are merely illustrative examples, and the present invention is not limited to these embodiments. For example, technical features disclosed in one of the above embodiments may be applied to other embodiments. Furthermore, unless otherwise specified, for a particular method, the order of some steps may be interchanged, and additional steps may be added between two specific steps. The scope of the present invention is defined by the claims.

Claims

1. A gene expression regulator that promotes the expression of the KPRP gene, comprising a culture supernatant of mesenchymal stem cells or exosomes thereof as an active ingredient, and further containing hyaluronic acid.

2. The gene expression control agent of claim 1, which contains a culture supernatant of mesenchymal stem cells or exosomes thereof as an active ingredient and further contains hyaluronic acid, and promotes expression of the Col3A1 gene.

3. The gene expression control agent according to claim 1, which contains a culture supernatant of mesenchymal stem cells or exosomes thereof as an active ingredient and further contains hyaluronic acid, and promotes expression of the Meprin-α gene.

4. The gene expression control agent of claim 1, which contains a culture supernatant of mesenchymal stem cells or exosomes thereof as an active ingredient and further contains hyaluronic acid, and promotes the expression of the elastin gene.

5. A composition comprising a culture supernatant of mesenchymal stem cells or exosomes thereof as an active ingredient, and further comprising hyaluronic acid, p16 INK4a The gene expression control agent according to claim 1, which suppresses the expression of the gene.

6. The gene expression control agent of claim 1, which contains a culture supernatant of mesenchymal stem cells or exosomes thereof as an active ingredient and further contains hyaluronic acid, and promotes expression of the HAS1 gene.

7. The gene expression regulator according to any one of claims 1 to 6, which regulates the expression of the gene in epidermal cells.

8. The gene expression regulator according to any one of claims 1 to 7, wherein the culture supernatant is serum-free.

9. The gene expression controlling agent according to any one of claims 1 to 8, which is an agent to be administered to the skin.

10. The gene expression control agent of claim 9, which is administered for the purpose of hair growth and / or hair development.

11. The gene expression controlling agent of claim 9, which is administered for the purpose of treating atopy.

Citation Information

Patent Citations

  • Semiconductor diffusion-type stress sensor

    JP1989097827A

  • Mesenchymal stem cell originated from human adipose tissue and aimed at treatment of alzheimer's disease

    JP2012157263A

  • Synoviolin expression inhibitor containing mesenchymal stem cell or culture supernatant thereof

    WO2018079753A1