Mammalian artificial chromosome vectors having a human immunoglobulin heavy chain locus containing a modified D region, and cells or non-human animals harboring the vectors
The mammalian artificial chromosome vector with modified human immunoglobulin heavy chain D region enhances antibody diversity and effectiveness against viral antigens by incorporating sequences from other animal species, addressing the limitations of existing human antibody-producing systems.
Patent Information
- Application Number
- JP2023562377
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-11-16
- Filing Date
- 2022-11-16
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2042-11-16
AI Technical Summary
Existing human antibody-producing systems, such as human antibody-producing mice, struggle to generate diverse and effective antibodies against rapidly mutating viral antigens, necessitating lengthy and costly development of new antibodies.
A mammalian artificial chromosome vector is developed with a modified human immunoglobulin heavy chain D region, replacing the human-derived genomic sequence with sequences from bovine, monkey, or other animal species, or modified sequences based on human antibody heavy chain CDR3 sequences, to enhance antibody diversity and length.
The modified vector enables the production of human antibodies with longer CDRH3 regions, expanding antibody diversity and improving immune response effectiveness against viral antigens.
Smart Images

Figure 0007748680000027 
Figure 0007748680000028 
Figure 0007748680000029
Abstract
Description
[Technical Field]
[0001] The present invention relates to a mammalian artificial chromosome vector comprising a human immunoglobulin heavy chain locus and a human immunoglobulin light chain locus in which the human immunoglobulin heavy chain D region has been modified. The present invention also relates to mammalian cells or non-human animals containing the mammalian artificial chromosome vector. The present invention further relates to a method for modifying the D region in the production of the mammalian artificial chromosome vector. [Background technology]
[0002] Human antibodies are not recognized as foreign substances by the human body and are therefore used as therapeutic agents for tumors, autoimmune diseases, and other conditions. Such antibodies can be produced using phage display technology or human antibody-producing mice. Human antibody-producing mice are transchromosomic (TC) mice carrying mouse artificial chromosome vectors containing full-length human immunoglobulin heavy and light chain loci (Patent Document 1, Patent Document 2, Non-Patent Document 1).
[0003] For example, when using human antibodies for passive immunization against infectious diseases caused by viruses such as human immunodeficiency virus (HIV), novel coronavirus (COVID-19), and influenza virus, it is well known that neutralizing antibodies often lack effectiveness due to masking of viral target antigens or rapid mutation of viral target antigens. Mutations necessitate the creation of new protective antibodies, which requires significant time and expense for infectious disease control. Furthermore, masking of target antigens by pathogenic viruses requires measures such as immune system activation and the development of therapeutic agents such as antivirals, making it difficult to rapidly suppress infectious diseases.
[0004] In this situation, the usefulness of human antibody-producing mice is limited for target antigens for which humans are unlikely to produce antibodies. Therefore, there is a need for the development of technologies that will expand the human antibody repertoire and make it easier to obtain antibodies against these target antigens. Furthermore, the construction of a platform for achieving even greater human antibody diversity has been proposed (Non-Patent Document 3). [Prior art documents] [Patent documents]
[0005] [Patent Document 1] Patent No. 4318736 [Patent Document 2] Patent No. 6868250 [Non-patent literature]
[0006] [Non-Patent Document 1] K. Tomizuka et al., Proc. Natl. Acad. Sci. USA, 2000;97(2):922-927 [Non-patent document 2] MAAlfaleh et al.,Front.Immunol.2020;11:Article 1986,https: / / doi.org / 10.3389 / fimmu.2020.01986 [Non-patent document 3] ARRees,MABS 2020,12(1),e1729683 Summary of the Invention [Problem to be solved by the invention]
[0007] An object of the present invention is to provide a means for achieving expansion of human antibody diversity in human antibody-producing non-human animals. In this regard, Y. Di et al. (Immunology August 2021;00:1-14, doi:10.1111 / imm.13407) used genome editing to create B-DH mice by recombining the bovine DH gene region with the DH gene region on the mouse genome, immunized them with antigens (OVA, BSA, EWL, KLH), and examined the production of antibodies containing ultralong CDRH3. However, they reported that ultralong CDRH3 was only observed at a fairly low rate. [Means for solving the problem]
[0008] To solve the above problems, the present inventors have focused on the finding that cattle efficiently produce broadly neutralizing antibodies against HIV (MJBurke et al., Viruses 2020, 12, 473; doi:10.3390 / v12040473), and have discovered a method for expanding the diversity of human antibodies and / or a method for generating human antibodies with longer than normal antibody heavy chain CDR3s.
[0009] That is, the present invention includes the following features. [1] In a mammalian artificial chromosome vector containing human immunoglobulin heavy chain and light chain loci, the human-derived genomic sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region is a mammalian artificial chromosome vector characterized in that it is replaced with a modified sequence of the D region consisting of a combination of the following (1) and (2), or (1) and (3), wherein the modified sequence of the D region is (1) The human-derived genomic sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human-derived genomic sequence between the ORFs excluding D3-9 and D3-10, includes a sequence shortened to a length of 49 bp or more from the end of each VDJ recombination sequence in the inter-ORF region flanked by VDJ recombination sequences; and (2) The ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region is replaced with the ORF sequence from B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequence from 1S5 to 1S6 of the monkey immunoglobulin heavy chain locus D region. 1S39 or the ORF sequence of the immunoglobulin heavy chain locus D region from sheep, horse, rabbit, bird or shark, or (3) In place of the ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, 26 modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region are prepared based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more. The mammalian artificial chromosome vector. [2] The mammalian artificial chromosome vector according to [1], wherein the human-derived genomic sequence between the ORFs of the human animal immunoglobulin heavy chain locus D region of (1) is shortened to a length of 100 to 500 bp. [3] The ORF sequence from B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region comprises the nucleotide sequence of SEQ ID NO: 127 to 149 or a nucleotide sequence having 90% or more identity to the nucleotide sequence, [1] or [2]. The mammalian artificial chromosome vector according to. [4] From 1S5 of the immunoglobulin heavy chain locus D region derived from the monkey 1S39 The mammalian artificial chromosome vector according to [1] or [2], wherein the ORF sequence comprises the nucleotide sequence of SEQ ID NOs: 150 to 175 or a nucleotide sequence having 90% or more identity to the nucleotide sequence. [5] The 26 types of modified ORF sequences of (3) above comprise the nucleotide sequences of SEQ ID NOs: 75 to 100 or 90% or more identical to the nucleotide sequence, [1] or [2]. A mammalian artificial chromosome vector. [6] The modified sequence of the D region comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3, or a nucleotide sequence having 90% or more identity to the nucleotide sequence, [1] to [5] A mammalian artificial chromosome vector according to any one of the above. [7] The mammalian artificial chromosome vector according to any one of [1] to [6], wherein the D region of the human immunoglobulin heavy chain locus further lacks D7-27. [8] The mammalian artificial chromosome vector according to any one of [1] to [7], wherein the vector is a rodent artificial chromosome vector. [9] The mammalian artificial chromosome vector according to [8], wherein the rodent artificial chromosome vector is a mouse artificial chromosome vector.
[10] The mammalian artificial chromosome vector according to any one of [1] to [9], wherein the light chain locus is a κ light chain locus and / or a λ light chain locus.
[11] A mammalian cell comprising the mammalian artificial chromosome vector according to any one of [1] to
[10] .
[12] The mammalian cell according to
[11] , wherein the cell is a rodent cell or a human cell.
[13] The mammalian cell according to
[11] , wherein the cell is a pluripotent stem cell selected from the group consisting of iPS cells and ES cells derived from mammals.
[14] A non-human mammal comprising the mammalian artificial chromosome vector according to any one of [1] to
[10] , and in which the endogenous immunoglobulin heavy chain, κ light chain and λ light chain genes or loci are disrupted.
[15] A non-human animal comprising human immunoglobulin heavy chain and light chain loci, wherein the human-derived genomic sequence from D1-1 to D1-26 in the D region of the human immunoglobulin heavy chain locus is replaced with a modified sequence of the D region consisting of a combination of the following (1) and (2), or (1) and (3), and the modified sequence of the D region is: (1) The human-derived genomic sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human-derived genomic sequence between the ORFs excluding D3-9 and D3-10, includes a sequence shortened to a length of 49 bp or more from the end of each VDJ recombination sequence in the inter-ORF region flanked by VDJ recombination sequences; and (2) The ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region is replaced with the ORF sequence from B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequence from 1S5 to 1S6 of the monkey immunoglobulin heavy chain locus D region. 1S39 or the ORF sequence of the immunoglobulin heavy chain locus D region from sheep, horse, rabbit, bird or shark, or (3) In place of the ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, 26 modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region are prepared based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more. and wherein the endogenous immunoglobulin heavy chain, κ light chain and λ light chain genes or gene loci are disrupted.
[16] The non-human animal according to
[14] or
[15] , wherein the animal is a rodent.
[17] The non-human animal according to
[16] , wherein the rodent is a mouse or a rat.
[18] A method for producing an antibody, comprising immunizing a non-human animal according to any one of
[14] to
[17] with a target antigen and obtaining an antibody that binds to the target antigen from the blood of the non-human animal.
[19] A method for producing an antibody, comprising: immunizing a non-human animal according to any one of
[14] to
[17] with a target antigen; obtaining spleen cells, lymph node cells, or B cells from the non-human animal that produces an antibody that binds to the target antigen; fusing the spleen cells, lymph node cells, or B cells with myeloma cells to form hybridomas; culturing the hybridomas; and obtaining a monoclonal antibody that binds to the target antigen.
[20] A method for producing an antibody, comprising: immunizing a non-human animal according to any one of
[14] to
[17] with a target antigen; obtaining B cells from the non-human animal that produces an antibody that binds to the target antigen; obtaining nucleic acid encoding a protein consisting of an antibody heavy chain and light chain, or a variable region thereof, from the B cells; and using the nucleic acid by DNA recombinant technology or phage display technology to produce an antibody that binds to the target antigen.
[21] In the production of a mammalian artificial chromosome vector according to any one of [1] to
[10] , a method for substituting a human immunoglobulin heavy chain D region with a modified sequence thereof, (1') providing a mammalian artificial chromosome vector containing human immunoglobulin heavy and light chain loci; (2') deleting the human immunoglobulin heavy chain D region from the mammalian artificial chromosome vector of step (1'); (3') inserting a cassette comprising a first site-specific recombinase recognition site, a promoter, and a second site-specific recombinase recognition site into the deletion site of the D region of the vector obtained in step (2'); (4') inserting, using a second site-specific recombinase, a cassette comprising the modified sequence of the human immunoglobulin heavy chain D region, the first site-specific recombinase recognition site, a selection marker, and a second site-specific recombinase recognition site into the second site-specific recombinase recognition site of the cassette inserted in step (3'); and (5') obtaining the artificial chromosome vector in which a cassette including a first site-specific recombinase recognition site, the modified sequence of the human immunoglobulin heavy chain D region, and a second site-specific recombinase recognition site is inserted into the deletion site of the D region by site-specific recombination using a first site-specific recombinase; The method comprising:
[22] The method according to
[21] , wherein the deletion of the human immunoglobulin heavy chain D region is carried out by genome editing.
[23] A mammalian artificial chromosome vector comprising human immunoglobulin heavy and light chain loci, wherein the human immunoglobulin heavy chain loci lack a D region, and the mammalian artificial chromosome vector comprises, in place of the deleted D region, a first site-specific recombinase recognition site, a promoter, and a second site-specific recombinase recognition site.
[24] The mammalian artificial chromosome vector according to
[23] , wherein the deleted D region is the region from D1-1 to D1-26.
[25] The mammalian artificial chromosome vector according to
[23] , wherein the deleted D region is the region from D1-1 to D7-27. This specification includes the disclosure of Japanese Patent Application No. 2021-186124, from which this application claims priority. [Effects of the Invention]
[0010] According to the present invention, by replacing the ORF (gene) sequence of the human-derived genomic sequence of the D region of the human immunoglobulin heavy chain locus or its human-minimized (i.e., shortening of the open reading frame (ORF) inter-region) D region sequence in a human antibody-producing non-human animal (e.g., rodent) with an ORF sequence of the D region derived from an animal such as a cow or a monkey, or a modified ORF sequence of the human D region sequence, it is possible to expand antibody diversity and to produce human antibodies containing a CDRH3 preferably having a length of 15 to 50 or more amino acids. [Brief explanation of the drawings]
[0011] [Figure 1] This figure shows that the D region sequence of the human immunoglobulin heavy chain locus (the region including D1-1 to D1-26) is deleted using a combination of human gRNAs Up3 and Down4. The human immunoglobulin heavy chain locus from which the heavy chain D region has been deleted is called Ig-NAC(ΔDH). This figure relates to Example 1. [Figure 2] Figure 2A shows CHO cells (cell clone TF7-B10) that retain one copy of Ig-NAC(ΔDH) independently of the host mouse chromosome. In Ig-NAC(ΔDH), the arrowheads indicate the human chromosome region (red), and the arrows indicate the artificial chromosome region (green). Figure 2B shows that Ig-NAC(ΔDH) contains a human immunoglobulin (Ig) heavy chain (arrow or green) and a kappa light chain (arrowhead or red). These figures show the results of Example 1. [Figure 3]This figure shows that the Fcy::fur gene was inserted into the AfiIII (NEB) and XbaI (NEB) restriction enzyme sites of the plasmid pRP[Exp]-CAG>mCherry (synthesized by Vector Builder) containing CAGP (a CAG promoter; a combination of the cytomegalovirus enhancer and chicken β-actin promoter) to obtain the CAG-Fcy::fur plasmid. This plasmid was then cleaved with the XbaI restriction enzyme, and a fragment ("B") derived from the HRB plasmid, cleaved at both ends with XbaI, was inserted between the CAGP and Fcy::fur genes to obtain the CAG-ΦC31-HRB-Fcy::fur plasmid. This figure relates to Example 2. [Figure 4] This figure shows that the HDR vector was obtained by cleaving the CAG-ΦC31-HRB-Fcy::fur plasmid with the restriction enzymes NotI (NEB) and SpeI (NEB) and inserting a fragment ("A") derived from the HRA plasmid upstream of CAGP. In the figure, BsdR represents the blasticidin resistance gene, CAGP represents the CAG promoter, R4 attB, Bxb1 attB, and Bxb1 attP represent recombinase recognition sites, AmpR represents the ampicillin resistance gene, and pUCori represents the origin of replication for pUC. This figure relates to Example 2. [Figure 5] This figure relates to Example 2 and shows that the HDR vector was inserted into CHO cells near the DH region deletion site (ΔDH) of Ig-NAC(ΔDH) by genome editing (Cas9 / gRNA). [Figure 6] This figure relates to Example 3, showing that the blasticidin resistance gene is removed from the HDR vector by site-specific recombination reaction by introducing Bxb1 recombinase into cells. [Figure 7] This figure relates to Example 6 and shows that each genomic sequence between ORFs D1-1 to D1-26 of the human immunoglobulin heavy chain gene D region was shortened to a size of about 200 bp to minimize the D region. [Figure 8]This figure shows the procedure for constructing a human minimized IgHD vector from human miniA, human miniB, and human miniC. In the figure, human miniA contains the R4 attP and the D fragment downstream of HRA to 3-10. Human miniB contains the D fragments 3-10 to 3-22. Human miniC contains the D fragment 3-22 to HRB, as well as the ΦC31 attP and blasticidin resistance gene (BSDR). This figure relates to Example 6. [Figure 9] This figure relates to Example 6 and shows the construction of an HDR vector into which human minimized IgHD has been inserted by site-specific recombination between ΦC31 attB of the HDR vector from which the blasticidin resistance gene shown in Figure 6 has been deleted and ΦC31 attP on the human minimized IgHD vector. [Figure 10] This figure shows that unnecessary sequences such as the CAG promoter and blasticidin resistance gene are removed from the HDR vector into which the human minimized IgHD prepared in Figure 9 has been inserted by introducing R4 recombinase into cells. This figure relates to Example 6. [Figure 11] This figure shows the construction of a vector in which the human minimized IgHD (23 fragments in total, D2-2 to D5-24 in the figure) in a vector containing the human minimized immunoglobulin heavy chain locus D region (Figure 8) was replaced with bovine human IgHD (23 fragments in total, B1-1 to B9-4 in the figure). Because the number of bovine D fragments (23 fragments) is fewer than that of humans (26 fragments), the three human D fragments (D1-1, D6-25, and D1-26) that were not replaced were deleted along with 100 bp before and after. This figure relates to Example 9. [Figure 12] This figure shows the procedure for preparing a bovine human IgHD vector carrying bovine miniA, B, and C. In the figure, bovine human IgHD was divided into three parts as in Example 5, and the three divided plasmid DNAs, bovine miniA, bovine miniB, and bovine miniC, were chemically synthesized (synthesis was outsourced to Eurofins Genomics). This figure relates to Example 9. [Figure 13]This figure shows the frequency of D region usage in Igμ-cDNA in spleen cells of chimeric mice carrying a mammalian artificial chromosome vector containing a human immunoglobulin (Ig) heavy chain locus in which the human heavy chain D region has been replaced with a human minimized D region. ● indicates the D region used. The figure shows n=27 (total number of ●) for the human minimal type, while n=15 (total number of ●) for the wild type. This figure shows the results of Example 14. [Figure 14] This figure shows the results of ELISA performed on antisera diluted 1 / 1,000 to 1 / 1,000,000 times as indicated using a 96-well plate immobilized with antigen (the receptor binding site (RBD) of the SARS-CoV2 spike protein S1) and an anti-human IgG Fc antibody to evaluate the antigen-specific IgG titer in plasma from TC mice carrying a modified Ig-NAC containing a human immunoglobulin heavy chain locus modified with bovine human IgHD. Successive booster immunizations induced an immune response, and the antibody titer against RBD (vertical axis, OD at 450 nm) increased. In the figure, b1 to b5 represent boosters 1 to 5. This figure shows the results of Example 18. [Figure 15] This figure relates to Example 19 and shows the structure of the monkey-modified human IgHD region obtained by replacing the human minimized IgHD region (approximately 43 kb) with the cynomolgus monkey D fragment (approximately 44 kb). [Figure 16] This figure shows 26 modified long DH sequences for replacing D segments 1-1 to 1-26 of the human long minimized IgHD region. DETAILED DESCRIPTION OF THE INVENTION
[0012] The present invention will now be described in further detail. 1. Mammalian Artificial Chromosome Vectors In a first aspect, the present invention provides a mammalian artificial chromosome vector comprising a human immunoglobulin heavy chain and light chain locus, wherein the human-derived genomic sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region is a mammalian artificial chromosome vector characterized in that it is replaced with a modified sequence of the D region consisting of a combination of the following (1) and (2), or (1) and (3), wherein the modified sequence of the D region is (1) The human-derived genomic sequence between ORFs D1-1 to D1-26 in the human immunoglobulin heavy chain locus D region, or the human-derived genomic sequence between the ORFs excluding D3-9 and D3-10, contains a sequence shortened to a length of 49 bp or more from the end of each VDJ recombination sequence in the inter-ORF region adjacent to the VDJ recombination sequence; and (2) The ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region is replaced with the ORF sequence from B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequence from 1S5 to 1S6 of the monkey immunoglobulin heavy chain locus D region. 1S39 or the ORF sequence of the immunoglobulin heavy chain locus D region from sheep, horse, rabbit, bird or shark, or (3) In place of the ORF sequences from D1-1 to D1-26 in the human immunoglobulin heavy chain locus D region, 26 modified ORF sequences from D1-1 to D1-26 in the human immunoglobulin heavy chain locus D region are prepared based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more. The mammalian artificial chromosome vector is provided.
[0013] As used herein, the term "human immunoglobulin heavy chain locus D region" refers to the entire region, including all ORFs (also referred to as "genes" (or regions encoding polypeptides) or "D fragments"), VDJ recombination sequences, and all inter-ORF (i.e., between genes) regions.
[0014] As used herein, the term "VDJ recombination sequence" refers to a sequence adjacent to the upstream and downstream of the V, D, and J regions of human immunoglobulin heavy and light chain loci, and comprises a conserved sequence consisting of 7, 23, 9, and / or 12 bases, arranged differently depending on the heavy chain, light chain κ, and light chain λ loci. In the case of the D region of a human immunoglobulin heavy chain locus, the recombination sequence comprises 28 bp (i.e., 9 bp, 12 bp (spacer), 7 bp) of bases.
[0015] Mammalian artificial chromosome vectors are artificial chromosome vectors created from the chromosomes of mammals such as, but not limited to, humans and rodents (e.g., mice, rats, hamsters, guinea pigs, etc.), and more specifically, they are artificially created chromosome vectors that contain centromeres and telomeres derived from the animal, and that contain a human immunoglobulin heavy chain locus containing a modified antibody heavy chain D region and, optionally, a human immunoglobulin light chain locus in the genomic sequence derived from the long arm and (if any) short arm from which, for example, 99.5% to 100%, preferably 100%, of the genes have been removed.
[0016] As used herein, "telomere" refers to a homologous or heterologous natural telomere, or an artificial telomere. Here, "homologous" refers to an animal of the same species as the mammal from which the chromosomal fragment of the artificial chromosome vector is derived, while "heterologous" refers to a mammal other than the animal (including humans). The sequence of an artificial telomere refers to an artificially created sequence with telomere function, such as the (TTAGGG)n sequence (n represents repeats). Introduction of a telomere sequence into an artificial chromosome can be performed, for example, by a method involving telomere truncation (cutting is performed by artificially inserting a telomere sequence), as described in International Publication WO 00 / 10383. Telomere truncation can be used to shorten chromosomes in the construction of the artificial chromosomes of the present invention.
[0017] [Modification of the D region of the human immunoglobulin heavy chain locus] The following describes modified sequences that are a combination of (1) above and (2) or (3) above. The human immunoglobulin (also referred to simply as "human antibody") heavy chain locus contained in the artificial chromosome vector of the present invention has been modified in the V, D, J, and C regions, with only the genomic sequence of the D region being modified. Here, modification of the human-derived genomic sequence of the D region includes modification of the ORF (or gene) sequence of the human D region or shortening of the inter-ORF region (also referred to as "minimalization"). Furthermore, the ORF sequence in the human-derived genomic sequence of the human D region or the minimized sequence of the human D region is replaced with a D region ORF sequence from another animal species, or 26 modified ORF sequences, D1-1 to D1-26, of the human immunoglobulin heavy chain locus D region, created based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more.
[0018] Generally, a human antibody heavy chain variable region consists of, from the N-terminus, framework (FR) 1, CDRH1, FR2, CDRH2, FR3, CDRH3, FR4, and a portion of the constant region. FR1, CDRH1, FR2, CDRH2, and FR3 are encoded primarily by the V region nucleotide sequence of a VDJ sequence formed by recombination (or rearrangement) of a human immunoglobulin heavy chain locus. Furthermore, CDRH3 and FR4 are encoded primarily by the D region nucleotide sequence and J region nucleotide sequence of the VDJ sequence, respectively. In the present invention, the D region is modified to produce human antibodies comprising an antibody heavy chain CDR3 having a length of 18 or more amino acids.
[0019] On the other hand, the human antibody light chain variable region consists of FR1, CDRL1, FR2, CDRL2, FR3, CDRL3, FR4, and a portion of the constant region, with FR1, CDRL1, FR2, CDRL2, FR3, and CDRL3 (partially) being encoded mainly by the V region nucleotide sequence of a VJ sequence formed by recombination (or rearrangement) of a human immunoglobulin light chain locus, and CDRH3 (partially) and FR4 being encoded mainly by the J region nucleotide sequence of the above-mentioned VJ sequence.
[0020] Furthermore, since it is generally known that the antibody region to which a target antigen specifically binds is the CDRH3 domain of the antibody heavy chain hypervariable region, in the present invention, the D region genomic sequence of the above-mentioned human antibody heavy chain locus is modified to expand the diversity of human antibodies and preferably to obtain antibodies containing a CDRH3 with a longer amino acid length than normal in human antibodies (e.g., 18 or more amino acids).
[0021] The modified sequences of the human D region are described below. An example of a modified sequence is a modified D region genomic sequence in which the genomic sequence of the inter-ORF (also referred to as "intergenic") region of the D region of the above-mentioned human immunoglobulin heavy chain locus includes a sequence shortened by 49 bp or more from the end of each VDJ recombination sequence in the inter-ORF region adjacent to the VDJ recombination sequence, for example, a sequence shortened to a length of about 100 to about 500 bp, about 150 bp to about 300 bp, or about 200 bp to about 250 bp.
[0022] The D region of the human immunoglobulin heavy chain locus (also referred to as the "IgHD" region) is located on human chromosome 14 (14q32.33) and consists of, in 5' to 3' order, e.g., D1-1 (positions 23599-35048; accession number X97051), D2-2 (positions 35049-37615; accession number J00232), D3-3 (positions 37616-39425; accession number X13972), D4-4 (positions 39426-40474; accession number X13972), D5-5 (positions 40475-41880; accession number X13972), and D6-6 (positions 41880-420475; accession number X13972). Accession number X13972), D6-6 (locations 41881-43056; accession number X13972), D1-7 (locations 43057-44649; accession number X13972), D2-8 (locations 44650-47262; accession number X13972), D3-9 (locations 47263-48619; accession number X13972), D3-10 (locations 48620-49158; accession number X13972), D4-11 (locations 49159-50078; accession number X13972), D5-12 (locations 50079 -51316; accession number X13972), D6-13 (locations 51317-52324; accession number X13972), D1-14 (locations 52325-53909; accession number X13972), D2-15 (locations 53910-56408; accession number J00234), D3-16 (locations 5640-58143; accession number X97051), D4-17 (locations 58144-59187; accession number X97051), D5-18 (locations 59188-60591; accession number X9705 1), D6-19 (locations 60592-61769; accession number X97051), IGHD1-20 (location 61770; accession number X97051), D2-21 (locations 61770-65916; accession number X97051), D3-22 (locations 65917-67762; accession number X93616), D4-23 (locations 67763-68826; accession number X97051), D5-24 (locations 68827-70492; accession number X97051), D6-25 (locations 70493-71926;The sequence of the human native IgHD region is also disclosed in NG_001019.6 (nucleotide numbers (positions): 960181 to 1000622 (40442 bp)).
[0023] The ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain (IgH) D region are, for example, the nucleotide sequences of SEQ ID NOs: 101 to 126. Examples of the size between ORFs after shortening are shown between each sequence. SEQ ID NO: 101 (IGHD1-1): ggtacaactggaacgac (Size between D1-1 and D2-2 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 102 (IGHD2-2): aggatattgtagtagtaccagctgctatgcc (Size between D2-2 and D3-3 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 103 (IGHD3-3): gtattacgatttttggagtggttattatacc (Size between D3-3 and D4-4 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 104 (IGHD4-4): tgactacagtaactac (Size between D4-4 and D5-5 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 105 (IGHD5-5): gtggatacagctatggttac (Size between D5-5 and D6-6 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 106 (IGHD6-6): gagtatagcagctcgtcc (Size between D6-6 and D1-7 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 107 (IGHD1-7): ggtataactggaactac (Size between D1-7 and D2-8 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 108 (IGHD2-8): aggatattgtactaatggtgtatgctatacc (Size between D2-8 and D3-9 ORFs + VDJ recombination sequence (28bp x 2): 255bp) SEQ ID NO: 109 (IGHD3-9): gtattacgatattttgactggttattataac (Size between D3-9 and D3-10 ORFs + VDJ recombination sequence (28bp x 2): 153bp) SEQ ID NO: 110 (IGHD3-10): gtattactatggttcggggagttattataac (Size between ORFs D3-10 and D4-11 + VDJ recombination sequence (28bp x 2): 316bp) SEQ ID NO: 111 (IGHD4-11): tgactacagtaactac (Size between ORFs D4-11 and D5-12 + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 112 (IGHD5-12): gtggatatagtggctacgattac (Size between ORFs D5-12 and D6-13 + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 113 (IGHD6-13): gggtatagcagcagctggtac (Size between ORFs D6-13 and D1-14 + VDJ recombination sequence (28bp x 2): 259bp) SEQ ID NO: 114 (IGHD1-14): ggtataaccggaaccac (Size between ORFs D1-14 and D2-15 + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 115 (IGHD2-15): aggatattgtagtggtggtagctgctactcc (Size between D2-15 and D3-16 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 116 (IGHD3-16): gtattatgattacgtttgggggagttatgcttatacc (Size between ORFs D3-16 and D4-17 + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 117 (IGHD4-17): tgactacggtgactac (Size between D4-17 and D5-18 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 118 (IGHD5-18): gtggatacagctatggttac (Size between ORFs D5-18 and D6-19 + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 119 (IGHD6-19): gggtatagcagtggctggtac (Size between D6-19 and D1-20 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 120 (IGHD1-20): ggtataactggaacgac (Size between ORFs D1-20 and D2-21 + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 121 (IGHD2-21): agcatattgtggtggtgattgctattcc (Size between ORFs D2-21 and D3-22 + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 122 (IGHD3-22): gtattactatgatagtagtggttattactac (Size between D3-22 and D4-23 ORFs + VDJ recombination sequence (28bp x 2): 316bp) SEQ ID NO: 123 (IGHD4-23): tgactacggtggtaactcc (Size between D4-23 and D5-24 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 124 (IGHD5-24): gtagagatggctacaattac (Size between D5-24 and D6-25 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 125 (IGHD6-25): gggtatagcagcggctac (Size between D6-25 and D1-26 ORFs + VDJ recombination sequence (28bp x 2): 256bp) SEQ ID NO: 126 (IGHD1-26): ggtatagtgggagctactac
[0024] The modified sequence includes the modified ORF of the human IgHD region, and involves shortening (or minimizing) each human-derived genomic sequence in the inter-ORF region (i.e., intergenic region) to a length of 49 bp or more, e.g., about 100 bp to about 500 bp, about 150 bp to about 300 bp, or about 200 bp to about 250 bp, from the end of each VDJ recombination sequence in the inter-ORF region flanked by the VDJ recombination sequences. The length of the modified human IgHD region after minimization is preferably about 10 kb or less so that it can be inserted into a (standard) plasmid vector. For example, when shortening to about 200 bp, the length is minimized to about 8 kb.
[0025] The shortening (or minimization) method is not particularly limited, but may involve, for example, leaving at least 49 bp from the end of the VDJ recombination sequence adjacent to each ORF in the inter-ORF region and deleting evenly from the center of the inter-ORF region. Minimization can also be performed by dividing the human D region (D1-1 to D1-26) into several (e.g., 3 to 5) segments, minimizing each segment, and then linking the resulting minimized segments in order from the 5' end to produce the desired human minimized D region (Figure 8). The nucleotide sequence of the D region, including the ORF sequences from D1-1 to D1-26 of the human minimized D region, the VDJ recombination sequence (28 bp x 2) and the minimized inter-ORF sequence, has, for example, the nucleotide sequence of SEQ ID NO: 1 below, or a nucleotide sequence that is 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more identical to said sequence, or that contains a deletion, substitution, or addition of one or several nucleotides (or bases) in said nucleotide sequence.
[0026] SEQ ID NO:1: [ka] TIFF0007748680000002.tif242132TIFF0007748680000003.tif242134TIFF0007748680000004.tif122136
[0027] As used herein, the term "several" refers to an integer of 2 to 10.
[0028] A human minimized D region sequence such as SEQ ID NO: 1 can be used to replace the human IgHD region ORF with a heterologous ORF.
[0029] By minimizing the human D region according to the present invention, for example, the frequency of human minimized D fragment usage in chimeric mouse spleen Igμ-cDNA increases to n=27 (n=15 for the wild type) ( FIG. 13 ), indicating that shortening the inter-ORF region of the human immunoglobulin heavy chain D region does not affect antibody diversity.
[0030] Another modified sequence includes a genomic sequence of the immunoglobulin heavy chain locus D region derived from a non-human animal capable of producing an antibody in which the antibody heavy chain CDR3 has a length of 18 or more amino acids, or a modified sequence thereof.
[0031] Examples of such non-human animals include cattle, monkeys (e.g., cynomolgus monkeys), sheep, horses, rabbits, birds, and sharks (e.g., bull sharks, remora, and nurse sharks). For example, by searching information from the international ImMunoGeneTics information system (IMGT), it can be confirmed that at least the above-mentioned animal species have D fragments longer than the longest D fragment (37 base pairs) in humans. While cattle and monkeys will be specifically described below, a similar technique can be used to replace the ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region with an ORF sequence from another animal species.
[0032] The bovine immunoglobulin heavy chain locus D region (21q24) includes, in 5' to 3' order, the nucleotide sequences of, for example, IGHD B1-1, B2-1, B3-1, B4-1, B9-1, B1-2, B2-2, B5-2, B8-2, B6-2, B1-3, B2-3, B3-3, B7-3, B5-3, B6-3, B1-4, B2-4, B3-4, B7-4, B5-4, B6-4, and B9-4.
[0033] The ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region can be substituted with the ORF sequence from B1-1 to B9-4 of bovine-derived immunoglobulin heavy chain locus D region. The nucleotide sequence of the bovine-modified human minimized D region obtained in this manner includes, for example, the nucleotide sequence of SEQ ID NO: 2 below, or a nucleotide sequence having 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more identity to said sequence, or a nucleotide sequence containing a deletion, substitution, or addition of one or several nucleotides (or bases) in said nucleotide sequence.
[0034] SEQ ID NO:2: [ka] TIFF0007748680000006.tif243133TIFF0007748680000007.tif242132TIFF0007748680000008.tif99133
[0035] The ORF sequences from B1-1 to B9-4 of the bovine IgHD region are, for example, the nucleotide sequences of SEQ ID NOs: 127 to 149 below. SEQ ID NO: 127 (B1-1): agaataccgtgatgatggttactgctacacc SEQ ID NO: 128 (B1-2): agaatatcgtgatgatggttactgctacacc SEQ ID NO: 129 (B1-3): agactatcgtgatgatggttactgctacacccacagtgactcaggccctgacataaagtctgacccgcacacaggtgtggagctggccaatgcatccccaggggcactgggctcccaag SEQ ID NO: 130 (B1-4): agaatatcgtgatgatggttactgctacacc SEQ ID NO: 131 (B2-1): ttactatagtgaccac SEQ ID NO: 132 (B2-2): ttactatagtgaccac SEQ ID NO: 133 (B2-3): ttactatagtgaccac SEQ ID NO: 134 (B2-4): ttactatagtgaccac SEQ ID NO: 135 (B3-1): gtattgtggtagctattgtggtagttattatggtac SEQ ID NO: 136 (B3-3): gtattgtggtagctattgtggtagttattatggtac SEQ ID NO: 137 (B3-4): gtattgtggtagctattgtggtagttattatggtac SEQ ID NO: 138 (B4-1): gtagttatagtggttatggttatggttatagttatggttatac SEQ ID NO: 139 (B5-2): atgatacgataggtgtggttgtagttattgtagtgttgctac SEQ ID NO: 140 (B5-3): atgatacgataggtgtggttttagttattgtagtgttgctac SEQ ID NO: 141 (B5-4): atgatacgataggtgtggttttagttattgtagtgttgctac SEQ ID NO: 142 (B6-2): gtagttgttatagtggttatggttatggttgtggttatggttatggttatgattatac SEQ ID NO: 143 (B6-3): gtagttgttatagtggttatggttatggttatggttgtggttatggttatggttatac SEQ ID NO: 144 (B6-4): gtagttgttatagtggttatggttatggttatggttgtggttatggttatggttatac SEQ ID NO: 145 (B7-3): gtagttatggtggttatggttatggtggttatggttgttatggttatggttatggttatggttatac SEQ ID NO: 146 (B7-4): gtagttatggtggttatggttatggtggttatggttgttatggttatggttatggttatggttatggttatac SEQ ID NO: 147 (B8-2): gtagttgtcctgatggttatagttatggttatggttgtggttatggttatggttgtagtggttatgattgttatggttatggtggttatggtggttatggtggttatggttatagtagttatagttatagttatacttacgaatatac SEQ ID NO: 148 (B9-1): gaactcggtggggc SEQ ID NO: 149 (B9-4): gaactcggtggggc
[0036] The cynomolgus monkey immunoglobulin heavy chain locus D region (Chr7q; G.-Y. Yu et al., Immunogenetics 2016;68:417-428) contains, in 5'→3' order, approximately 44 kb of nucleotide sequence, for example, 1S5, 2S11, 3S6, 4S24, 5S8, 6S4, 1S10, 2S17, 3S18, 2S34, 5S14, 5S31, 6S3, 1S27, 2S22, 4S36, 4S30, 5S37, 6S20, 1S33, 2S28, 6S32, 3S12, 6S38, 6S26, and 1S39 of IGHD (Figure 15). Instead of the ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, 1S39 The ORF sequence is replaced to include the sequence up to .
[0037] From 1S5 of the cynomolgus monkey D region 1S39 The ORF sequence is, for example, the nucleotide sequence of SEQ ID NOs: 150 to 175 below. SEQ ID NO: 150 (1S5): ggtataactggaactac SEQ ID NO: 151 (2S11): agaatattgtagtagtacttactgctcctcc SEQ ID NO: 152 (3S6): gtattacgaggatgattacggttactattacacccacagcgt SEQ ID NO: 153 (4S24): tgactacggtagcagctac SEQ ID NO: 154 (5S8): gtggatacagctacagttac SEQ ID NO: 155 (6S4): gggtatagcagcggctggtac SEQ ID NO: 156 (1S10): ggtatagctggaacgac SEQ ID NO: 157 (2S17): agaatactgtactggtagtggttgctatgcc SEQ ID NO: 158 (3S18): gtactggggtgattattatgac SEQ ID NO: 159 (2S34): agcatattgtagtggtggtgtctgctacacc SEQ ID NO: 160 (5S14): gtggatacagctacagttaccacagttttgccacc SEQ ID NO: 161 (5S31): gtggatatagctacggttac SEQ ID NO: 162 (6S9): gggtatagcagctggtcc SEQ ID NO: 163 (1S27): ggtataactggaatgac SEQ ID NO: 164 (2S22): agaatattgtagtggtatttactgctatgcc SEQ ID NO: 165 (4S36): tgaatacagtaactac SEQ ID NO: 166 (4S30): tgactacggtaactac SEQ ID NO: 167 (5S37): ggggatacagtgggtacagttac SEQ ID NO: 168 (6S20): gggtatagcggcagctggaac SEQ ID NO: 169 (1S33): ggaacacctggaacgac SEQ ID NO: 170 (2S28): agcacactgtagtgatagtggctgctcctcc SEQ ID NO: 171 (6S32): gggtatagcggtggctggtcc SEQ ID NO: 172 (3S12): gtattactatagtggtagttattactaccacagtgt SEQ ID NO: 173 (6S38): gggtatagcagcagcta SEQ ID NO: 174 (6S26): gggtatagcagcggctggtcc SEQ ID NO: 175 (1S39): ggtatagtgggaactacaac
[0038] Alternatively, another modified sequence includes 26 modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, which are created based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more, in place of the ORFs from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region described above.
[0039] Although the frequency is low, long CDRH3 sequences are known to exist in human antibodies (L. Yu and Y. Guan, Frontiers in Immunology, 2014, 24, doi:10.3389 / fimmu.2014.00250).
[0040] Such modified D region ORFs include, for example, the nucleotide sequences set forth in SEQ ID NOS: 75 to 100 shown in Figure 16, or nucleotide sequences having 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more identity to said nucleotide sequences, or nucleotide sequences having one or several nucleotide (or base) deletions, substitutions, or additions in said nucleotide sequences. ORFs D1-1 to D1-26 in the human IgHD region can be replaced with the corresponding 26 types of modified ORF sequences described above. The nucleotide sequence of the human minimized D region thus replaced includes, for example, the nucleotide sequence of SEQ ID NOS: 3, or a nucleotide sequence having 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more identity to said nucleotide sequence, or a nucleotide sequence having one or several nucleotide (or base) deletions, substitutions, or additions in said nucleotide sequences.
[0041] SEQ ID NO:3: [ka] TIFF0007748680000010.tif243132TIFF0007748680000011.tif243133TIFF0007748680000012.tif199133
[0042] The method for determining a modified ORF sequence based on a human antibody heavy chain CDR3 sequence can include, for example, the steps shown below. In this example, CDR3 is defined as the region following the C-terminal sequence "CAR" / "CAK" of the VH heavy chain amino acid sequence of a human antibody and upstream of the N-terminal sequence "WG" of VH (M. Chiu et al., Antibodies 2019;8(4):55;doi.org / 10.3390 / antib8040055). In the first step, known sequences with CDR3 of 18 amino acids or more are searched for. In the second step, the base sequence of CDR3 is extracted. In the third step, synonymous substitution mutations (which do not change the amino acid) are introduced into somatic mutation hotspot sequences to the extent possible.
[0043] "Identity" herein can be determined using a protein or gene search system such as BLAST or FASTA, with or without introducing gaps (Zheng Zhang et al., J. Comput. Biol. 2000; 7:203-214; Altschul, S. F. et al., Journal of Molecular Biology 1990; 215:403-410; Pearson, W. R. et al., Proc. Natl. Acad. Sci. USA, 1988; 85:2444-2448).
[0044] [Method for modifying the D region of the human immunoglobulin heavy chain locus] The D region of the human immunoglobulin heavy chain locus can be modified, for example, by a method comprising the following steps.
[0045] <1st process> A mammalian artificial chromosome vector ([Ig-NAC]) containing human immunoglobulin heavy and light chain loci is prepared.
[0046] Ig-NAC has a structure that includes a human immunoglobulin heavy chain gene locus and a human immunoglobulin light chain κ (or λ) gene locus from the telomere side to the centromeric side (for example, Japanese Patent No. 6868250).
[0047] Ig-NAC can be stably replicated and distributed as a chromosome independent of the native chromosome of the cell into which it is introduced. An example of this vector is a rodent artificial chromosome vector (e.g., a mouse or rat artificial chromosome vector). The construction of rodent artificial chromosome vectors is described, for example, in Japanese Patent Publication No. 6775224 and Japanese Patent Publication No. 6868250 filed by the present applicant.
[0048] The specific manufacturing method is as follows. Mammalian artificial chromosome vectors may be prepared, for example, by telomere truncation of a mammalian chromosome, and include the animal's centromere, a long-arm fragment near the centromere, and, if present in the animal, a short-arm fragment, and a telomere. For example, a mouse-derived chromosome fragment is a fragment of any of mouse chromosomes 1 to 19, X, and Y, preferably any of chromosomes 1 to 19 (a long-arm fragment in which at least 99.5%, preferably nearly 100%, of the total number of endogenous genes in the long arm has been deleted), including a long-arm fragment in which the distal portion of the long arm has been deleted from the site of the mouse chromosome long arm near the centromere. Sequence information for mouse chromosomes is available from Chromosome Databases such as DDBJ / EMBL / GenBank and Santa Cruz Biotechnology, Inc. More specifically, for example, in the case of an artificial chromosome vector derived from a mouse chromosome 15 fragment, the long-arm fragment may be, but is not limited to, a long-arm fragment in which the region distal to the position of AC121307, AC161799, etc. has been deleted. Alternatively, in the case of an artificial chromosome vector derived from a mouse chromosome 16 fragment, the long arm fragment may be, for example, a long arm fragment from which the region distal to Gm35974 has been deleted. Alternatively, the long arm fragment may be a long arm fragment from mouse chromosome 10 from which the distal long arm region has been deleted from the gene Gm8155, which is the chromosomal site of the long arm of mouse chromosome 10.
[0049] Examples of mouse artificial chromosome vectors include the mouse artificial chromosome contained in the deposited cell line DT40 (10MAC) T5-26 (international deposit number NITE BP-02656) or the mouse artificial chromosome contained in the deposited cell line DT40 (16MAC) T1-14 (international deposit number NITE BP-02657).
[0050] The mammalian artificial chromosome vector of the present invention can be prepared, for example, by the following steps (a) to (c): (a) obtaining cells harboring mammalian chromosomes; (b) deleting the distal long arm of the mouse chromosome so as to not contain the majority (99.5% to 100%, preferably 100%) of the endogenous genes; and (c) inserting one or more DNA sequence insertion sites into the proximal long arm The order of steps (b) and (c) may be reversed.
[0051] Each step will be described below. <Process (1a)> To prepare the mammalian artificial chromosome vector of the present invention, first, cells carrying mammalian chromosomes are prepared. For example, mammalian fibroblasts carrying mammalian chromosomes labeled with a drug resistance gene (e.g., blasticidin S resistance gene (BSr)) are fused with mouse A9 cells (ATCC VA20110-2209) into which the neo gene, a G418 resistance gene, has been introduced. The vector can be prepared by transferring the chromosome from the mouse A9 hybrid cells carrying mammalian chromosomes labeled with the drug resistance gene into cells with a high rate of homologous recombination. Mammalian fibroblasts can be obtained based on methods described in the literature; for example, mouse fibroblasts can be established from C57B6 strain mice available from CLEA Japan. For example, chicken DT40 cells (Dieken et al., Nature Genetics, 12:174-182, 1996) can be used as cells with a high rate of homologous recombination. Furthermore, the above transfer can be carried out by known chromosome transfer methods, for example, microcell fusion (Koi et al., Jpn. J. Cancer Res., 80:413-418, 1973).
[0052] <Process (1b)> In cells containing a single mammalian chromosome, the distal long arm and, if present in the animal, the distal short arm of the mammalian chromosome are deleted. The key here is to delete (or remove or delete) most of the endogenous genes present on the long and short arms and construct an artificial chromosome that retains the mammalian centromere. This involves determining the cut sites so that at least 99.5%, preferably at least 99.7%, more preferably at least 99.8%, most preferably 99.9-100%, and even more preferably 100% of the total endogenous genes present on the long and short arms are deleted (or removed or deleted). This ensures stable and high retention in cells, tissues, or individuals derived from mammals, preferably rodents such as mice and rats, into which the artificial chromosome has been introduced. The deletion of the endogenous genes can be achieved, for example, by telomere truncation. Specifically, a targeting vector carrying a telomere sequence is constructed in cells carrying a mammalian chromosome, and a clone is obtained in which an artificial or natural telomere sequence is inserted at a desired position on the chromosome by homologous recombination. This allows for the generation of a deletion mutant by telomere truncation. For example, the desired position (or site) is the cleavage site at the distal end of the long arm to be deleted, and a telomere sequence is substituted and inserted at this position by homologous recombination to delete the distal end of the long arm. This position can be appropriately determined by designing the target sequence when constructing the targeting vector. For example, a target sequence is designed based on the DNA sequence of the long arm of a mammalian chromosome, and telomere truncation is set to occur on the telomere side of the target sequence. This results in a mammalian chromosome fragment in which most of the endogenous genes have been deleted. Telomere truncation can be performed in the same manner for other chromosomes. The same applies to cleavage of the distal end of the short arm.
[0053] <Process (1c)> As the DNA sequence insertion site, preferably the recognition site of a site-specific recombinase can be inserted. That is, it is known that certain enzymes recognize specific recognition sites and specifically cause DNA recombination at those recognition sites, and in the mammalian artificial chromosome vector of the present invention, utilizing a system consisting of such an enzyme and its enzyme recognition site, the sequence of the desired human immunoglobulin heavy chain or locus, and / or human immunoglobulin light chain gene or locus can be inserted and mounted. Examples of such systems include a system using the Cre enzyme derived from bacteriophage P1 and its recognition site, the loxP sequence (Cre / loxP system; B. Sauer in Methods of Enzymology; 1993, 225:890-900), a system using the Flp enzyme derived from budding yeast and its recognition site, the FRT (Flp Recombination Target) sequence (Flp / FRT system), a system using the φC31 integrase derived from Streptomyces phage and its recognition site, the φC31attB / attP sequence, a system using the R4 integrase and its recognition site, the R4attB / attP sequence, a system using the TP901-1 integrase and its recognition site, the TP901-1attB / attP sequence, and a system using the Bxb1 integrase and its recognition site, the Bxb1attB / attP sequence. However, the system is not limited to the above, as long as it can function as an insertion site for a DNA sequence.
[0054] To insert such recognition sites for site-specific recombinase, known methods, such as homologous recombination, can be used, and the insertion positions and number can be appropriately set within the proximal long and short arms.
[0055] A mammalian artificial chromosome vector can be inserted with one type of recognition site or different types of recognition sites. By setting the recognition site, the insertion position of the target gene or locus, i.e., human immunoglobulin heavy chain gene or locus, human immunoglobulin light chain κ gene or locus, or human immunoglobulin light chain λ gene or locus, can be specified, so the insertion position is constant and there is no unexpected position effect.
[0056] In addition to the sequence of the gene or locus of interest, a reporter gene may be inserted into the mammalian artificial chromosome vector. Examples of reporter genes include, but are not limited to, fluorescent protein (e.g., green fluorescent protein (GFP) or EGFP), yellow fluorescent protein (YFP), etc.) genes, tag protein-encoding DNA, β-galactosidase genes, and luciferase genes.
[0057] The mammalian artificial chromosome vector may further contain a selection marker gene. The selection marker is effective in selecting cells transformed with the vector. Examples of the selection marker gene include a positive selection marker gene and / or a negative selection marker gene. Positive selection marker genes include drug resistance genes, such as neomycin resistance genes, ampicillin resistance genes, blasticidin S (BS) resistance genes, puromycin resistance genes, geneticin (G418) resistance genes, and hygromycin resistance genes. Negative selection marker genes include, for example, herpes simplex thymidine kinase (HSV-TK) genes and diphtheria toxin A fragment (DT-A) genes. Generally, HSV-TK is used in combination with ganciclovir or acyclovir.
[0058] As used herein, unless otherwise specified, "human immunoglobulin gene or locus" refers to a human immunoglobulin heavy chain gene or locus derived from human chromosome 14, a human immunoglobulin light chain κ gene or locus derived from human chromosome 2, and / or a human immunoglobulin light chain λ gene or locus derived from human chromosome 22. Specifically, human immunoglobulin genes or loci include, for example, the immunoglobulin heavy locus (human) NC_000014.9 ((nucleotide numbers 105586437..106879844) or (nucleotide numbers 105264221..107043718)) on human chromosome 14, the immunoglobulin kappa locus (human) NC_000002.12 ((nucleotide numbers 88857361..90235368) or (nucleotide numbers 88560086..90265666)) on human chromosome 2, and the immunoglobulin lambda locus (human) NC_000002.12 ((nucleotide numbers 88857361..90235368) or (nucleotide numbers 88560086..90265666)) on human chromosome 22. The human immunoglobulin heavy chain gene or locus is represented by the nucleotide sequence set forth in locus(human)NC_000022.11 ((nucleotide numbers 22026076..22922913) or (nucleotide numbers 21620362..23823654)). The human immunoglobulin heavy chain gene or locus is approximately 1.3 Mb in length, the human immunoglobulin light chain κ gene or locus is approximately 1.4 Mb in length, and the human immunoglobulin light chain λ gene or locus is approximately 0.9 Mb in length.
[0059] Incidentally, a mouse antibody heavy chain gene or locus is located on mouse chromosome 12, a mouse antibody light chain κ gene or locus is located on mouse chromosome 6, and a mouse antibody light chain λ gene or locus is located on mouse chromosome 16. Specifically, a mouse antibody heavy chain gene or locus is represented by the nucleotide sequence described in, for example, Chromosome 12, NC_000078.6 (113258768..116009954, complement), a mouse antibody light chain κ gene or locus is represented by the nucleotide sequence described in Chromosome 6, NC_000072.6 (67555636..70726754), and a mouse antibody light chain λ gene or locus is represented by the nucleotide sequence described in Chromosome 16, NC_000082.6 (19026858..19260844, complement).
[0060] Furthermore, rat antibody heavy chain genes or loci are located on rat chromosome 6, rat antibody light chain κ genes or loci are located on rat chromosome 4, and rat antibody light chain λ genes or loci are located on rat chromosome 11. Similarly, the nucleotide sequences of these genes or loci are available from the US NCBI (GenBank, etc.), publicly known literature, etc.
[0061] <Second process> In the mammalian artificial chromosome vector (Ig-NAC) containing the human immunoglobulin (heavy chain and / or light chain) locus prepared in the first step above, the D region present between the V region and J region of the human heavy chain locus is deleted from the human immunoglobulin heavy chain locus by methods such as genome editing (JM Hylinski et al., Science 2012;337:816-821) or site-specific recombination technology (e.g., the use of site-specific recombinase) to prepare "Ig-NAC(ΔDH)".
[0062] "Genome editing" as used herein refers to a technique for editing genomic DNA or modifying genes using, for example, artificial cleavage enzymes such as TALEN (TALE nuclease), the CRISPR-Cas system, etc. In the method of the present invention, any genome editing technique can be used, but the CRISPR-Cas system is preferred.
[0063] The CRISPR / Cas9 system, discovered from the adaptive immune system of bacteria and archaea against viruses and plasmids, is relatively easy to construct vectors for and can simultaneously modify multiple genes (Jinek et al., Science, 17, 337(6096):816-821, 2012; Sander et al., Nature biotechnology, 32(4):347-355, 2014). This system involves the Cas9 protein and a guide RNA (gRNA) with a target sequence of approximately 20 base pairs. When co-expressed in cells, the gRNA recognizes the PAM sequence near the target sequence and binds specifically to the target genomic DNA, allowing the Cas9 protein to induce a double-strand break 5' upstream of the PAM sequence. The most commonly used Cas9 protein is the SpCas9 type, which has a PAM sequence of NGG (N = C, G, A, or T), thereby limiting the location of mutations. In the present invention, the site of the human immunoglobulin heavy chain locus targeted by the guide RNA is, for example, but not limited to, the 5' upstream site of the human D1-1 fragment, and the target sequence of the guide RNA is, for example, 5'-AGATCCTCCATGCGTGCTGTGGG-3' (SEQ ID NO: 4).
[0064] As used herein, "site-specific recombinase" refers to an enzyme that specifically recombines with a target DNA sequence at its recognition site. Site-specific recombination can be achieved by using such a recombinase and its recognition site. Examples of site-specific recombinases include Cre integrase (also called Cre recombinase), Flp recombinase, φC31 integrase, R4 integrase, TP901-1 integrase, and Bxb1 integrase. Furthermore, examples of the enzyme recognition sites include loxP (Cre recombinase recognition site), FRT (Flp recombinase recognition site), φC31attB and φC31attP (φC31 recombinase recognition sites), R4attB and R4attP (R4 recombinase recognition sites), TP901-1attB and TP901-1attP (TP901-1 recombinase recognition sites), or Bxb1attB and Bxb1attP (Bxb1 recombinase recognition sites).
[0065] An acceptor site for introducing a synthetic D region polynucleotide is inserted into the site where the D region of the human immunoglobulin heavy chain locus has been deleted. An example of an acceptor site is a cassette containing a recognition site for a site-specific recombinase. An example of a method for inserting the acceptor site is described in <Step 3> below.
[0066] Here, examples of the site-specific recombinase and its recognition site include the above-mentioned Cre recombinase and loxP system, Flp recombinase and FRT system, φC31 recombinase and φC31attB and φC31attP system, etc. The site-specific recombinase (e.g., Cre) can catalyze a site-specific recombination reaction between recognition site sequences (e.g., between loxP sites).
[0067] <3rd process> The synthetic D region polynucleotide is inserted into the acceptor site by a method such as site-specific recombination or genome editing.
[0068] The synthetic D region polynucleotide is a modified D region in which the human-derived genomic sequence of D1-1 to D1-26 of the D region of the human immunoglobulin heavy chain locus, as described in Section 1 above, is replaced with a modified D region sequence consisting of a combination of the following (1) and (2), or (1) and (3), wherein the modified sequence is: (1) The human-derived genomic sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human-derived genomic sequence between the ORFs excluding D3-9 and D3-10, includes a sequence shortened to a length of 49 bp or more from the end of each VDJ recombination sequence in the inter-ORF region flanked by VDJ recombination sequences; and (2) The ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region is replaced with the ORF sequence from B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequence from 1S5 to 1S6 of the monkey immunoglobulin heavy chain locus D region. 1S39 or an ORF sequence of an immunoglobulin heavy chain locus D region from a vertebrate such as a sheep, horse, rabbit, bird or shark, or (3) In place of the ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, 26 modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region are prepared based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more. The sequence is modified as follows:
[0069] In one embodiment, the method for replacing the human immunoglobulin heavy chain D region with its modified sequence (synthetic D region polynucleotide) in the production of the mammalian artificial chromosome vector described above can include the following steps. (1') providing a mammalian artificial chromosome vector containing human immunoglobulin heavy and light chain loci; (2') deleting the human immunoglobulin heavy chain D region from the mammalian artificial chromosome vector of step (1'); (3') inserting a cassette comprising a first site-specific recombinase recognition site, a promoter, and a second site-specific recombinase recognition site into the deletion site of the D region of the vector obtained in step (2'); (4') inserting, using a second site-specific recombinase, a cassette comprising the modified sequence of the human immunoglobulin heavy chain D region, the first site-specific recombinase recognition site, a selection marker, and a second site-specific recombinase recognition site into the second site-specific recombinase recognition site of the cassette inserted in step (3'); and (5') By site-specific recombination using a first site-specific recombinase, the artificial chromosome vector is obtained in which a cassette containing a first site-specific recombinase recognition site, the modified sequence of the human immunoglobulin heavy chain D region, and a second site-specific recombinase recognition site is inserted into the deletion site of the D region.
[0070] In the above steps, the modified sequence of the human immunoglobulin heavy chain D region, the first site-specific recombinase recognition site, the second site-specific recombinase recognition site, the first site-specific recombinase, and the second site-specific recombinase can be, for example, those described above, without any limitation. The promoter can also be, for example, the CAG promoter.
[0071] In step (2'), the human immunoglobulin heavy chain D region can be deleted from the mammalian artificial chromosome vector of step (1') using techniques such as the above-mentioned genome editing and site-specific recombination.
[0072] Specifically, in order to insert the synthetic D region polynucleotide into the human heavy chain D region cleavage site of the Ig-NAC(ΔDH), a vector is prepared containing the polynucleotide and a cassette containing a site-specific recombinase recognition site at its 5' end (e.g., the φC31-BsdR-oriC-R4 sequence), and a site-specific recombination reaction is performed between the vector and the Ig-NAC(ΔDH) to insert the synthetic D region polynucleotide into the human heavy chain D region cleavage site of the Ig-NAC(ΔDH) (Figures 5, 6, 9 and 10).
[0073] Alternatively, to insert a synthetic D region polynucleotide into the human heavy chain D region cleavage site of Ig-NAC(ΔDH), a vector containing a site-specific recombinase recognition site between a partial sequence of the human immunoglobulin heavy chain V region and a partial sequence of the human immunoglobulin heavy chain J region (and, if necessary, the C region) is created, and genome editing (Cas9 / gRNA) is performed between this vector and Ig-NAC(ΔDH) to insert the site-specific recombinase recognition site into the human heavy chain D region cleavage site of Ig-NAC(ΔDH), and another site-specific recombinase is then applied to create an Ig-NAC containing a site-specific recombinase recognition site at the human heavy chain D region cleavage site of the Ig-NAC(ΔDH). Furthermore, in order to insert the above-mentioned synthetic D region polynucleotide into this Ig-NAC, a vector containing the polynucleotide and a site-specific recombinase recognition site at its 5' end is prepared, and a site-specific recombinase (e.g., φC31 recombinase) is applied, followed by the application of another site-specific recombinase (e.g., Bxb1 recombinase or R4 recombinase) to produce the desired modified Ig-NAC containing the synthetic D region polynucleotide at the human heavy chain D region cleavage site of the above-mentioned Ig-NAC(ΔDH) (Figure 10).
[0074] In another aspect, the present invention further provides a mammalian artificial chromosome vector comprising human immunoglobulin heavy chain and light chain loci, wherein the human immunoglobulin heavy chain loci lack a D region, and the mammalian artificial chromosome vector comprises, in place of the deleted D region, a first site-specific recombinase recognition site, a promoter, and a second site-specific recombinase recognition site.
[0075] The vector may further comprise a third site-specific recombinase recognition site.
[0076] An example of the mammalian artificial chromosome vector is the vector prepared in step (3') above (eg, Figure 9).
[0077] The deleted D region is the region from D1-1 to D1-26, or the region from D1-1 to D7-27.
[0078] In the above vector, the first site-specific recombinase recognition site and the second site-specific recombinase recognition site are not limited, and for example, those described above can be used.Furthermore, the promoter is also not limited, and for example, the CAG promoter can be used.
[0079] 2. Mammalian cells In a second aspect, the present invention provides a mammalian cell comprising the mammalian artificial chromosome vector described in Section 1 above.
[0080] By introducing a human immunoglobulin locus with a modified antibody heavy chain D region ("modified Ig-NAC" in Section 1) into mammalian-derived cells via the mammalian artificial chromosome vector of the present invention, mammalian cells capable of producing human antibodies can be produced.
[0081] The mammalian artificial chromosome vector of the present invention can be transferred or introduced into any mammalian cell. Techniques for this purpose include, for example, micronuclear cell fusion, lipofection, calcium phosphate method, microinjection, electroporation, etc., but the preferred technique is micronuclear cell fusion.
[0082] The micronucleus cell fusion method is a method of transferring the vector to other cells by micronucleus fusion between cells (e.g., mouse A9 cells) that have the ability to form micronuclei containing the mammalian artificial chromosome vector of the present invention and other cells of interest. Cells with the ability to form micronuclei are treated with polyploidy inducers (e.g., colcemid, colchicine, etc.) to form micronucleus polynuclear cells, and then treated with cytochalasin to form micronuclei, after which cell fusion with the desired cells can be performed.
[0083] The cells into which the vectors can be introduced are mammalian cells such as rodent cells and human cells, and include, for example, germline cells such as oocytes and spermatids, stem cells such as embryonic stem (ES) cells, spermatogonial stem (GS) cells, and somatic stem cells, somatic cells, fetal cells, adult cells, normal cells, primary cultured cells, passaged cells, and established cell lines. Stem cells include somatic stem cells such as embryonic stem (ES) cells, embryonic germ (EG) cells, and mesenchymal stem cells, induced pluripotent stem (iPS) cells, and nuclear transfer cloned embryo-derived embryonic stem (ntES) cells. Preferred cells are selected from the group consisting of somatic cells, stem cells, progenitor cells, and non-human germline cells derived from mammals, such as rodents (e.g., mice, rats, hamsters (e.g., Chinese hamsters), and guinea pigs), primates (e.g., humans, monkeys, and chimpanzees), and ungulates (e.g., cows, pigs, sheep, goats, horses, and camels). When the cells are derived from a rodent, the vector of the present invention is more stably maintained in the cells or tissues of the rodent into which it has been introduced.
[0084] Examples of somatic cells include, but are not limited to, liver cells, intestinal cells, kidney cells, splenocytes, lung cells, heart cells, skeletal muscle cells, brain cells, skin cells, bone marrow cells, fibroblasts, and the like.
[0085] ES cells are stem cells that possess pluripotency and the ability to proliferate semipermanently and are established from the inner cell mass of blastocysts of mammalian fertilized eggs (M. J. Evans and M. H. Kaufman (1981) Nature 292:154-156; J. A. Thomson et al. (1999) Science 282:1145-1147; J. A. Thomson et al. (1995) Proc. Natl. Acad. Sci. USA 92:7844-7848; J. A. Thomson et al. (1996) Biol. Reprod. 55:254-259; J. A. Thomson and V. S. Marshall (1998) Curr. Top. Dev. Biol. 38:133-165).
[0086] Similar to mouse ES cells (M.J. Evans and M.H. Kaufman, Nature 1981;292(5819):154-156), rat ES cells are pluripotent and self-renewing cell lines established from the inner cell mass of rat blastocysts or 8-cell embryos. For example, rat blastocysts, from which the zona pellucida has been dissolved, are cultured on mouse embryonic fibroblast (MEFF) feeders using a medium containing leukemia inhibitory factor (LIF). After 7 to 10 days, outgrowths formed from the blastocysts are dispersed and transferred to MEF feeders for culture. After approximately 7 days, ES cells emerge. The generation of rat ES cells is described, for example, in K. Kawaharada et al., World J Stem Cells 2015;7(7):1054-1063.
[0087] iPS cells can be produced by introducing specific reprogramming factors (DNA or proteins) into somatic cells (including somatic stem cells), culturing them in an appropriate medium, and then subculturing them to form colonies in approximately 3 to 5 weeks. Known reprogramming factors include, for example, a combination of Oct3 / 4, Sox2, Klf4, and c-Myc; a combination of Oct3 / 4, Sox2, and Klf4; a combination of Oct4, Sox2, Nanog, and Lin28; or a combination of Oct3 / 4, Sox2, Klf4, c-Myc, Nanog, and Lin28 (K. Takahashi and S. Yamanaka, Cell 126:663-676 (2006); WO2007 / 069666; M. Nakagawa et al., Nat. Biotechnol. 26:101-106 (2008); K. Takahashi et al., Cell 131:861-872 (2007); J. Yu et al., Science 318:1917-1920 (2007); J. Liao et al. al., Cell Res. 18, 600-603 (2008)). In one example, a mouse embryonic fibroblast cell line (e.g., STO) treated with mitomycin C is used as a feeder cell, and vector-introduced somatic cells (e.g., approximately 10 4 ~10 5 cells / cm 2 ) at a temperature of about 37°C. Feeder cells are not necessarily required (Takahashi, K. et al., Cell 131:861-872 (2007)). Examples of basal media include Dulbecco's modified Eagle's medium (DMEM), Ham's F-12 medium, and mixtures thereof. Examples of ES cell media that can be used include mouse ES cell media and primate ES cell media (ReproCell).
[0088] 3. Non-human animals In a third aspect, the present invention provides a non-human animal comprising human immunoglobulin heavy chain and light chain loci, wherein a human-derived genomic sequence from D1-1 to D1-26 in the D region of the human immunoglobulin heavy chain locus has been replaced with a modified sequence of the D region consisting of a combination of the following (1) and (2), or (1) and (3), wherein the modified sequence of the D region is: (1) The human-derived genomic sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human-derived genomic sequence between the ORFs excluding D3-9 and D3-10, includes a sequence shortened to a length of 49 bp or more from the end of each VDJ recombination sequence in the inter-ORF region adjacent to the VDJ recombination sequence; and (2) The ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region is replaced with the ORF sequence from B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequence from 1S5 to 1S6 of the monkey immunoglobulin heavy chain locus D region. 1S39 or an ORF sequence of an immunoglobulin heavy chain locus D region from a vertebrate such as a sheep, horse, rabbit, bird or shark, or (3) In place of the ORF sequences from D1-1 to D1-26 in the human immunoglobulin heavy chain locus D region, 26 modified ORF sequences from D1-1 to D1-26 in the human immunoglobulin heavy chain locus D region are prepared based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more. and wherein the endogenous immunoglobulin heavy chain, κ light chain and λ light chain genes or loci are disrupted.
[0089] In another aspect of the non-human animals, the present invention provides non-human animals comprising the mammalian artificial chromosome vectors described in Section 1 above, and in which the endogenous immunoglobulin heavy chain, κ light chain, and λ light chain genes or loci have been disrupted.
[0090] As used herein, the term "non-human animals" includes, but is not limited to, mammals other than humans, such as primates, such as monkeys and chimpanzees, rodents, such as mice, rats, hamsters and guinea pigs, and ungulates, such as cows, pigs, sheep, goats, horses and camelids.
[0091] [Creation of non-human animals] For example, by using techniques such as mammalian artificial chromosome vector-mediated technology, gene targeting technology, genome editing technology, and / or microinjection technology, a human immunoglobulin locus with a modified human immunoglobulin heavy chain D region ("modified Ig-NAC") can be introduced into pluripotent cells such as the above-mentioned ES cells and iPS cells, or into totipotent cells such as germ cells, oocytes, and spermatogonia, thereby creating a non-human animal capable of producing human immunoglobulins.
[0092] In such non-human animals, endogenous loci corresponding to the human immunoglobulin heavy chain and light chain κ and λ loci are disrupted (or knocked out), and, if necessary, foreign DNA corresponding to a human immunoglobulin heavy chain locus with an altered human immunoglobulin heavy chain D region derived from human chromosome 14, a human immunoglobulin light chain κ locus derived from human chromosome 2, and a human immunoglobulin light chain λ locus derived from human chromosome 22 can be inserted (or knocked in) into the disrupted endogenous loci on the genome of the non-human animal. Techniques such as gene targeting and genome editing can be used for disruption methods.
[0093] In the gene targeting method, a targeting vector is constructed to disrupt the endogenous gene locus or to further replace / insert (or knock-in) the foreign DNA in place of the endogenous gene locus. Vectors for disrupting the endogenous gene locus and inserting foreign DNA contain a 5' upstream sequence (approximately 2.5 kb or more) and a 3' downstream sequence (approximately 2.5 kb or more) of the endogenous gene locus, and these sequences can contain, for example, an exogenous drug resistance gene sequence or the exogenous DNA sequence for replacing the endogenous gene locus to be disrupted. Examples of drug resistance genes include the neomycin resistance gene and the ampicillin resistance gene.
[0094] As described above, genome editing, for example, in the CRISPR / Cas9 system, involves co-expressing the Cas9 protein and a guide RNA (gRNA) with a target sequence of approximately 20 base pairs in cells. The gRNA recognizes a PAM sequence near the target sequence and specifically binds to the target genomic DNA, allowing the Cas9 protein to induce a double-strand break 5' upstream of the PAM sequence. This technology can be used to cleave and remove antibody heavy and light chain loci in non-human animals. Alternatively, foreign DNA can be inserted (or knocked in) into the cleavage site using vectors containing foreign DNA corresponding to a human immunoglobulin heavy chain locus with an altered human immunoglobulin heavy chain D region derived from human chromosome 14, a human immunoglobulin light chain κ locus derived from human chromosome 2, and a human immunoglobulin light chain λ locus derived from human chromosome 22.
[0095] A vector containing the foreign DNA of interest can be introduced into ES cells or iPS cells derived from a non-human animal, disrupting the endogenous gene locus derived from the animal and inserting the DNA sequence of interest into the genome. Insertion of the foreign DNA of interest can be confirmed by identifying an amplified product by PCR using forward and reverse primers designed based on the inserted sequence. ES cells or iPS cells into which the foreign DNA sequence has been inserted can be microinjected into the early embryo of a foster non-human animal to produce a chimeric non-human animal.
[0096] The non-human animal in which the endogenous gene locus has been disrupted can be produced, for example, by mating a chimeric non-human animal containing the human immunoglobulin locus in which the human immunoglobulin heavy chain D region has been modified, or a progeny thereof, with a chimeric animal or progeny thereof in which the corresponding endogenous gene has been deleted as a cluster, and then further mating the resulting animals in which the endogenous genes have been heterologously deleted.
[0097] Examples of non-human animals of the present invention include non-human animals comprising a human immunoglobulin heavy chain locus and a human immunoglobulin light chain κ locus derived from human chromosome 2 in which the human immunoglobulin heavy chain D region has been modified, or a non-human animal comprising the artificial chromosome vector, a non-human animal comprising a human immunoglobulin heavy chain locus and a human immunoglobulin light chain λ locus derived from human chromosome 22 in which the human immunoglobulin heavy chain D region has been modified, or a non-human animal comprising a human immunoglobulin heavy chain locus derived from human chromosome 14, a human immunoglobulin light chain κ locus derived from human chromosome 2, and a non-human animal comprising ... non-human animal comprising a non-human animal comprising the artificial chromosome vector.
[0098] The non-human animal is preferably a rodent such as a mouse or rat, which contains the mouse artificial chromosome vector.
[0099] An example of producing a non-human animal using a mouse artificial chromosome (MAC) vector will be described below. Site-specific recombinase recognition sites (e.g., loxP or FRT) have been introduced to modify the human immunoglobulin light chain κ locus derived from human chromosome 2. Animal cells (e.g., chicken B cell line DT40) containing the human immunoglobulin light chain κ locus derived from human chromosome 22, and site-specific recombinase recognition sites (e.g., loxP or FRT) have been introduced to modify the human immunoglobulin light chain λ locus derived from human chromosome 22. Each of these animal cells (e.g., DT40) is transferred into rodent cells (e.g., Chinese hamster ovary cells (CHO)) containing a mouse artificial chromosome (MAC) vector by cell fusion, and then, by the action of site-specific recombinase (e.g., Cre or Flp) or induction of expression of the enzyme, rodent cells containing a MAC vector containing the human immunoglobulin light chain κ locus, as well as rodent cells containing a MAC vector containing the human immunoglobulin light chain λ locus can be produced.
[0100] On the other hand, a recognition site for a site-specific recombinase (e.g., loxP or FRT) can be introduced near the human immunoglobulin heavy chain locus on human chromosome 14 carried in an animal cell (e.g., DT40), and then the animal cell containing the human immunoglobulin heavy chain locus with a modified human immunoglobulin heavy chain D region can be fused with a rodent cell (e.g., CHO) containing a MAC vector by cell fusion to produce a rodent cell containing a MAC vector containing a human immunoglobulin heavy chain locus with a modified human immunoglobulin heavy chain D region (the above-mentioned "modified Ig-NAC").
[0101] The rodent cells containing the MAC vector comprising the human immunoglobulin heavy chain locus with a modified human immunoglobulin heavy chain D region and the human immunoglobulin light chain κ locus, and the rodent cells containing the MAC vector comprising the human immunoglobulin heavy chain locus with a modified human immunoglobulin heavy chain D region and the human immunoglobulin light chain λ gene or locus derived from human chromosome 22, are each fused with a non-human animal (e.g., mouse or rat) pluripotent stem cell (e.g., ES cell or iPS cell) by microcell fusion to produce a human 1 It is possible to produce pluripotent stem cells of non-human animals (e.g., mice or rats) containing a MAC vector comprising a human immunoglobulin heavy chain locus with a modified human immunoglobulin heavy chain D region derived from chromosome 4 and a human immunoglobulin light chain κ locus derived from human chromosome 2, as well as pluripotent stem cells of non-human animals (e.g., mice or rats) containing a MAC vector comprising a human immunoglobulin heavy chain locus with a modified human immunoglobulin heavy chain D region derived from human chromosome 14 and a human immunoglobulin light chain λ locus derived from human chromosome 22.
[0102] Non-human animal (e.g., mouse or rat) pluripotent stem cells containing the MAC vector comprising a human immunoglobulin heavy chain locus with a modified human immunoglobulin heavy chain D region derived from human chromosome 14 and a human immunoglobulin light chain κ locus derived from human chromosome 2, and non-human animal (e.g., mouse or rat) pluripotent stem cells containing a MAC vector comprising a human immunoglobulin heavy chain locus with a modified human immunoglobulin heavy chain D region derived from human chromosome 14 and a human immunoglobulin light chain λ locus derived from human chromosome 22, are transplanted into early embryos (e.g., 8-cell embryos or blastocyst embryos) of non-human animals that are B cell deficient or non-deficient to produce chimeric animals containing the MAC vectors. If the chimeric animals retain endogenous B cells, the chimeric animals are further mated with the same species of non-human animal (e.g., mouse or rat) that is deficient in mouse antibody heavy chain, light chain κ, and light chain λ loci (or that is B cell deficient). Thereafter, by selecting the non-human animal of interest, it is possible to produce a non-human animal comprising either a MAC vector comprising a human immunoglobulin heavy chain locus in which the human immunoglobulin heavy chain D region derived from human chromosome 14 has been modified and a human immunoglobulin light chain κ locus derived from human chromosome 2, or the MAC vector comprising a human immunoglobulin heavy chain locus in which the human immunoglobulin heavy chain D region derived from human chromosome 14 has been modified and a human immunoglobulin light chain λ locus derived from human chromosome 22.
[0103] Alternatively, a non-human animal (e.g., a mouse or rat) containing a MAC vector comprising a human immunoglobulin heavy chain locus with an altered human immunoglobulin heavy chain D region, a human immunoglobulin light chain κ locus, and a human immunoglobulin light chain λ locus can be produced by mating the two different offspring animals.
[0104] In non-human animals produced by the above-described methods, it is preferable that all endogenous antibody genes or loci corresponding to human immunoglobulin heavy chain genes or loci, and human immunoglobulin light chain κ and λ genes or loci, are disrupted or knocked out, thereby enabling the non-human animals to produce only human antibodies.
[0105] 4. Methods for producing human antibodies The invention further provides a method for producing a human antibody, comprising producing a human antibody using a non-human animal described in Section 3 that contains a mammalian artificial chromosome vector containing human immunoglobulin heavy and light chain loci, and recovering the human antibody.
[0106] As used herein, a "human antibody" may be any class and subclass of human immunoglobulin (Ig). Such classes include IgG, IgA, IgM, IgD, and IgE, and subclasses include IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. These classes and subclasses can be divided by differences in heavy chains. IgG chains are called γ chains, and γ1, γ2, γ3, and γ4 chains corresponding to IgG1 to IgG4, while IgA, IgM, IgD, and IgE are called α chains (α1 and α2), μ chains, δ chains, and ε chains, respectively. The light chains of all antibodies include κ chains and λ chains, and it is known that if κ chain gene rearrangement is unsuccessful during the immunoglobulin gene rearrangement process, λ chain gene rearrangement occurs.
[0107] Furthermore, the human immunoglobulin heavy chain locus comprises, from 5' to 3', V (variable) region genes including VH1, VH2...VHm (where m is, for example, 38 to 46), D (diversity) region genes including DH1, DH2...DHn (where n is 23), J (joining) region genes including JH1, JH2...JHr (where r is 6), and C (constant) region genes including Cμ, Cδ, Cγ3, Cγ1, Cα1, Cγ2, Cγ4, Cε, and Cα2. However, in the present invention, the D region genes of the human immunoglobulin heavy chain locus include substitutions with synthetic D region nucleotide sequences described as modified sequences consisting of a combination of (1) and (2) or (1) and (3) in Section 1 above.
[0108] In the non-human animals, antibodies produced through the rearrangement of the human immunoglobulin genes can be produced, including human antibodies containing ultralong CDRH3s with, for example, 18 to 50 or more amino acids, which have been difficult to consistently produce with conventional human antibodies. Human antibodies containing such ultralong CDRH3s are difficult to produce using conventional monoclonal antibody production methods because of their low frequency in humans.
[0109] A human antibody molecule consists of two human antibody heavy chains and two human antibody light chains, each of which is bound by two disulfide bonds, and the two heavy chains are bound by two disulfide bonds in their constant (C) regions. The variable (V) regions of the heavy and light chains of an antibody molecule each contain three highly variable regions (hypervariable regions), called complementarity determining regions (CDRs). The hypervariable regions of the heavy chain variable region are designated CDRH1, CDRH2, and CDRH3 from the N-terminus, while the hypervariable regions of the light chain variable region are designated CDRL1, CDRL2, and CDRL3 from the N-terminus. Differences in the sequences of these CDR regions affect the antigen-binding properties of antibodies. The present invention expands the diversity of human antibodies by rearrangement of human immunoglobulin genes. The human antibodies containing ultralong CDRH3 produced by the non-human animals of the present invention have a structure consisting of a long (β-ribbon) stalk and knob, which contains a loop and multiple disulfide bonds (J. Dong et al., Frontiers in Immunology, 2019;10:Article 558; JK Haakenson et al., Frontiers in Immunology 2018;9:Article 1 262).
[0110] The antibodies obtainable by the methods of the present invention are human antibodies containing an ultralong CDRH3, such as an antibody heavy chain CDR3 with a length of 18 or more, 20 or more, 25 or more, 30 or more, 40 or more, or 50 or more amino acids, and are therefore considered to be effective against diseases including infectious diseases caused by pathogenic viruses such as human immunodeficiency virus (HIV), influenza virus, coronaviruses (e.g., SARS-CoV and MERS-CoV), and respiratory syncytial virus (RS) virus, as well as other pathogens (e.g., malaria parasites and trypanosomatid parasites).These human antibodies are therapeutically useful because the protruding CDRH3 region enables "key"-type interactions that bind to the receptor recesses of the viruses and pathogens.
[0111] The antibodies of the present invention can also be used as a cocktail of multiple antibodies, and can be used to enhance not only therapeutic but also preventive effects.
[0112] Specific methods for producing antibodies include the following.
[0113] For example, polyclonal antibodies that specifically bind to a target antigen such as an HIV envelope protein can be produced by immunizing the above-mentioned human antibody-producing non-human animal of the present invention (eg, mouse or rat) with the target antigen.
[0114] Alternatively, the above-mentioned animals can be immunized with a target antigen, and B lymphocytes from the animals with elevated antigen-specific antibody titers can be fused with myeloma cells to produce hybridomas (immortalized B cells). Human monoclonal antibodies in the hybridoma supernatant can then be selected by ELISA analysis to assess antigen binding ability and, if necessary, by evaluation of infection with HIV or other pathogens, to select broadly neutralizing human monoclonal antibodies.
[0115] That is, in a fourth aspect, the present invention provides a method for producing an antibody, which comprises immunizing the non-human animal described in Section 3 above with a target antigen and obtaining an antibody that binds to the target antigen from the blood of the non-human animal.
[0116] Alternatively, in another aspect, the present invention further provides a method for producing an antibody, comprising immunizing the non-human animal described in Section 3 above with a target antigen, obtaining spleen cells or lymph node cells from the non-human animal that produces an antibody that binds to the target antigen, fusing the spleen cells or lymph node cells with myeloma cells to form hybridomas, and culturing the hybridomas to obtain a monoclonal antibody that binds to the target antigen.
[0117] Alternatively, in yet another aspect, the present invention further provides a method for producing an antibody, comprising immunizing the non-human animal described in Section 3 above with a target antigen, obtaining B cells from the non-human animal that produces an antibody that binds to the target antigen, obtaining nucleic acid encoding a protein consisting of an antibody heavy chain and light chain, or the variable regions thereof, from the B cells, and using the nucleic acid to produce an antibody that binds to the target antigen (e.g., a recombinant antibody, a monoclonal antibody, a single-chain antibody (scFv), etc.) by DNA recombinant technology or phage display technology.
[0118] The nucleic acid includes DNA (including cDNA) or RNA (including mRNA).
[0119] The scFv is a recombinant antibody fragment produced by linking an antibody heavy chain variable region polypeptide and an antibody light chain variable region polypeptide via a linker.
[0120] In phage display, the variable regions of human antibodies are expressed on the surface of phages, for example as single-chain fragments (scFv) or Fab, and phages that bind to the antigen are selected (Nature Biotechnology, 2005; 23(9): 1105-1116). By analyzing the genes of phages selected by their antigen binding, the DNA sequences encoding the variable regions of human antibodies that bind to the antigen can be determined. Once the DNA sequence of an antigen-binding scFv has been elucidated, an expression vector containing that sequence can be constructed and introduced into an appropriate host for expression to obtain a human antibody (WO92 / 01047, WO92 / 20791, WO93 / 06213, WO93 / 11236, WO93 / 19172, WO95 / 01438, WO95 / 15388, Annu. Rev. Immunol, 1994; 12: 433-455, Nature Biotechnology, 2005; 23(9): 1105-1116).
[0121] Antibodies produced by the above-mentioned methods can be recovered and purified by techniques such as affinity chromatography, which involves applying blood (antiserum) or cell supernatant containing the antibody to a column filled with a carrier bound to an antigenic substance or an immunoglobulin G-binding carrier (e.g., agarose gel, silica gel, etc.), and then eluting the human antibody bound to the carrier from the carrier. [Example]
[0122] The present invention will be described in more detail with reference to the following examples, but the technical scope of the present invention is not limited to these examples.
[0123] [Example 1] Construction of Ig-NAC(ΔDH) with deleted human IgHD region To construct Ig-NAC(ΔDH) with the human IgHD region deleted, we designed, evaluated, and selected CRISPR / Cas9 gRNAs at two locations (upstream and downstream) on either side of the DH region, and removed the DH region by cleaving the two locations in CHO cells carrying Ig-NAC. We then obtained Ig-NAC(ΔDH)-carrying CHO cells through screening.
[0124] 1. Construction of gRNA expression vectors and selection by activity evaluation Plasmids expressing candidate gRNAs were constructed based on the all-in-one vector eSpCas9(1.1) (Addgene Plasmid #71814), which expresses Cas9 and gRNA. The all-in-one vector was transfected into CHO cells carrying Ig-NAC using Lipofectamine LTX (Invitrogen) according to the manufacturer's protocol. DNA was extracted from the transfected cells using a PureGene kit (Qiagen), and cleavage activity was confirmed using a Cel-1 assay kit (IDT). The vectors with the following gRNA sequences, which showed the highest activity, were selected. gRNA Up3: 5'-AGATCCTCCATGCGTGCTGT (GGG)-3' (SEQ ID NO: 4) (Here, the gRNA sequence is a 20-base sequence excluding the PAM sequence (GGG).) gRNA Down4: 5'-CTGCGGCATGAACCCAATGC (AGG)-3' (SEQ ID NO: 5) (Here, the gRNA sequence is a 20-base sequence excluding the PAM sequence (AGG).)
[0125] 2. Obtaining clones with deleted DH region The DH region was deleted using each combination of gRNA Up3 (referred to as "5'guide3" in the figure) and Down4 (referred to as "5'guide4" in the figure) (Figure 1). The all-in-one vector for each gRNA and the CMV-tdTomato expression vector were introduced into Ig-NAC-containing CHO cells (Japanese Patent Publication No. 6868250) using Lipofectamine LTX (Invitrogen) according to the manufacturer's protocol. Three days later, EGFP / tdTomato co-positive cells were obtained by sorting. The EGFP signal indicates the presence of Ig-NAC, and the tdTomato signal indicates lipofection. The co-positive cells were further cultured, and 8 days after the first sorting, EGFP-positive, tdTomato-negative cells were collected into 384-well plates by single-cell sorting. The expanded clones were further scaled up and screened as described below.
[0126] 3. Screening of clones with deleted DH region The cells obtained above were subjected to PCR screening using DNA extracted using a PureGene kit (Qiagen) as a template and the following primers for confirming junction and DH region deletion. Junction primer F1: 5'-TCCCACGGCCCAAGGAAGACAAGACACA-3' (SEQ ID NO: 6) Junction primer R1: 5'-TCGAACACGCTCCTAGCATTGCACAGCC-3' (SEQ ID NO: 7) Deletion confirmation primer F1: 5'-ACACCTGTCTCCGGGTTGTG-3' (SEQ ID NO: 8) Deletion confirmation primer R1: 5'-AAGAAACGCAGGACGGTGGA-3' (SEQ ID NO: 9) Deletion confirmation primer F2: 5'-CAGCAGCCACTCTGATCCCA-3' (SEQ ID NO: 10) Deletion confirmation primer R2: 5'-CTGGTGGACTCTACGGCGAA-3' (SEQ ID NO: 11) Deletion confirmation primer F3: 5'-GGGACCCTCAAGGTGTGAAC-3' (SEQ ID NO: 12) Deletion confirmation primer R3: 5'-AGGGTGCTTGGGTCCTGTTA-3' (SEQ ID NO: 13) Deletion confirmation primer F4: 5'-ACAAGCCAGGGAGCTGTTTC-3' (SEQ ID NO: 14) Deletion confirmation primer R4: 5'-TCAAGAAATCCGAGGCGACA-3' (SEQ ID NO: 15)
[0127] The enzyme used was KOD FX (TOYOBO), and the reaction conditions were 98°C for 15 seconds, 60°C for 30 seconds, and 68°C for 90 seconds, with 35 cycles. Of the 381 clones obtained from all combinations, removal of the D region was confirmed in 35 clones. PCR was then performed to confirm the presence of antibody gene regions other than DH on the Ig-NAC using the method described in Japanese Patent No. 6868250, and candidate Ig-NAC(ΔDH) clones were selected.
[0128] 4. Confirmation of the structure of Ig-NAC(ΔDH) To confirm that Ig-NAC(ΔDH) was maintained independently without being integrated into the host chromosome and that it maintained the expected structure, we performed FISH analysis using the method described in Patent No. 6868250. As a result, we confirmed that we had obtained CHO cells that maintained one copy of Ig-NAC(ΔDH) independently of the host chromosome (Figure 2), and named this cell clone TF7-B10.
[0129] [Example 2] Insertion of an acceptor site to introduce a synthetic D region into Ig-NAC(ΔDH) A chemically synthesized DH region can be introduced by inserting an acceptor site into the deleted DH region of Ig-NAC(ΔDH) prepared in Example 1 using genome editing and homologous recombination. To this end, an HDR vector was prepared using the following procedure: sequences before and after the deleted DH region of Ig-NAC(ΔDH) (V region side: HRA, J fragment side: HRB), Bxb1 attB, Bxb1 attP, ΦC31 attB, and R4 attB (Japanese Patent No. 6868250) (each sequence is shown below), a CAG promoter (pRP[Exp]-CAG>mCherry, synthesized by Vector Builder), a blasticidin resistance gene (Fujifilm Wako Pure Chemical Industries), and an Fcy::fur gene (pSELECT-zeo-Fcy::fur, Invivogen) arranged as shown in Figure 4.
[0130] HRA: (SEQ ID NO: 16) GACCTGAGAGCCGCTCCCTGAAGTGTCCCCATTGGGAAGGATGGGGCCTGTGTCTCCAGGCTCTGGGAGGACAGAATCCTGACCTCAACAGTGGCCGGCACGGACACAACTGGCCCCATCCCGGGGACGCTGACCAGCGCTGGGCAACTTTTCCCTTCCCCGACGACTGAGCCCCGAGCACCCTCCCTGCTCCCCTACCACCTCCCTTTACAAGGCTGTGGCCTCTGCACAGATGATAATGGAGCTTGGCTCATTCCCCTAGAGTCGGTAGGGAGTTAAGGACAAAACTCAGTTTCCTCCACCTGAACTCAAGTCTGCCTATGTTTACCTAATCACACCTGGTGGACAGTTTGGACAAACTTGCACACTCAGAGACACAGACACTTCTAGAAATCATTATCTCCCTGCCCCGGGGACCCCACTCCAGCAGAAGTCTGCTAGGCACTGGCCTGGGCCCTCCTGCTGTCCTAGGAGGCTGCTGACCTCCTGCCTGGCTCCTGTCCCCAGGTCCAGAGTCAGAGCAGACTCCAGGGACGCTGCAGGCTAGGAAGCCGCCCCCTCCAGGCGAGGGTCTAGTGCAGGTGCCCAGGACAAGAAAGATTGTGAATGCAGGAATGACTGGGCCACACCCCTCCCGTGCACGCCCCCTCCTGCCCTGCACCCCACAGCCCAGCCCCCCGTGCTGGATGCCCCCCCACAGCAGAGGTGCTGTTCTGTGATCCCCTGGGAAAGACGCCCTCAACCTCCACCCTGTCCCACGGCCCAAGGAAGACAAGACACAGGCCCTCTCCTCACAGTCTCCCCACCTGGCTCCTGCTGGGACCCTCAAGGTGTGAACAGGGAGGATGGTTGTCTGGGTGGCCCCTAGGAGCCCAGATCTTCACTCCACAGACCCCAACCCAAGCACCCCCTTCTGCAGGGCCCAGCTCATCCCCCTCCTCCTCCCTCTGCTCTCCTCT
[0131] HRB: (SEQ ID NO: 17) CTCACTGAAGGCAGCCTCAGGGTGCCCAGGGGCAGGCAGGGTGGGGGTGAGGCTTCCAGCTCCAACCGCTCCACTAGCCGAGACTAAGGAAGTGAGAGGCAGCCAGAAATCCAGACCATTCCATAGCAAATGGATTTCATTAAAGTTACCAGACTTCAGTGTAAGTAACATGAGCCCCATGCACAACAATCCCTTATGAAGGGGAAGTCAGTGTCGCCTCGGATTTCTTGAAAAACACAAAAACTTATCAATGCCTGTAAAAGTCTGTTGGAAAGAAAATATGATTCAAGAATGTTATGCCCAACAAAGCTGGCATATTTTCTACCCGGACACACTCAGGGAATGTGGTCCCTTGAGTGCTTCTCTCACTGCGTAAATCCTACGTGGTGTTTAAGCATATTCATAAATGTGTATGTCTATTTTTATGTGTAAGATGGTTCATTTTTATTTTATTTATTCAATATGTACAATAAAGAATATTGACAAATAGGCTGGACATGGTGGCTCCCACCTGTAATCCCAGCCCTTTGGGAGGCCGAGGCGGGCAGATCACCTGAGGTCTGGAGTTCGAGACCAGCCTGGCCAACATGATGAAAACCCATCTCTACTAAAAATACAAAGATTAGCCAGGCATGGTGGTGCATGCCTGTAATCCCAGCCACTCAGGAGGCTGAGACAGGAGAAATGCGTGAACCCGGAAGGCGGAGGTTGCAGTGAGCCGAGATCACACCACTGCACTCCAGCCTGGCGACAGAGCAAGATTCCATCTCAAAAAAAAAAAGACAAAGAAATTTGTTTTTTTGAATAAAGACAAATTTCATCACACGAAGATAAAGATGCAAAGCTCCAGACAGGAAGGCACGGACAGCACAGTGAAGCCCGGAGCGGGCGCTGGGGGGCCAGGGGCATGGCGGGGGTGCCAGCGTCTCTCGGTGCCTACCATGGCCACTCCAGCCTGTGTTCTCACGAGGATGGCTGTGT
[0132] Bxb1 attB: (SEQ ID NO: 18) TGGCCGTGGCCGTGCTCGTCCTCGTCGGCCGGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATCCGGGCCAC
[0133] Bxb1 attP: (SEQ ID NO: 19) TATGGCCGTGATGACCTGTGTCTTCGTGGTTTGTCTGGTCAACCACCGCGGTCTCAGTGGTGTACGGTACAAACCCA
[0134] ΦC31 attB: (SEQ ID NO: 20) GATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATCTGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAAC GCGCGGCGCACCGGGAAGCCCTCGCCCTCGAACCGCTGGGCGCGGTGGTCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGGGGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCAT
[0135] R4 attB: (SEQ ID NO: 21) GCGCCCAAGTTGCCCATGACCATGCCGAAGCAGTGGTAGAAGGGCACCGGCAGACAC
[0136] 1. Insertion of the Fcy::fur gene into a CAG promoter-containing vector When the HDR vector was inserted into Ig-NAC(ΔDH)-harboring CHO cells, the Fcy::fur gene, a negative selection marker, was inserted to selectively kill cells in which random integration occurred rather than the intended homologous recombination. The Fcy::fur gene was amplified by PCR from pSelect-zeo-Fcy::fur plasmid (Invivogen) DNA using the following primers and conditions. Fcy-fur-F1: 5'-CATGAATCTAGAAGTGCAGGTGCCAGAACATT-3' (SEQ ID NO: 22) fur-BspH1-R1: 5'-CATGAATCATGACCCCCTGAACCTGAAACATA-3' (SEQ ID NO: 23)
[0137] PCR was performed using 100 ng / μL pSelect-zeo-Fcy::fur plasmid DNA (0.1 μL) as a template, KODone (TOYOBO) Taq DNA polymerase, and 35 cycles of PCR under the following reaction conditions: 98°C, 10 seconds; 60°C, 5 seconds; 68°C, 13 seconds.
[0138] After PCR, the Fcy::fur gene was purified by agarose gel electrophoresis and then digested at both ends with the restriction enzymes BspHI (NEB) and XbaI (NEB). The Fcy::fur gene was inserted into the AfiIII (NEB) and XbaI (NEB) sites of the CAG promoter-containing plasmid DNA pRP[Exp]-CAG>mCherry (synthesized by Vector Builder) to obtain the CAG-Fcy::fur plasmid (Figure 3).
[0139] 2. Construction of vector plasmid CAG-ΦC31-HRB-Fcy::fur, in which ΦC31attB and HRB are inserted between the CAG promoter and the Fcy::fur gene The plasmid DNA pHRB containing ΦC31 attB and HRB was synthesized by Eurofins Genomics, Inc. and used to introduce the chemically synthesized DNA into the plasmid CAG-Fcy::fur prepared in 1 above. This plasmid was cleaved with the restriction enzyme XbaI. The plasmid CAG-Fcy::fur was then cleaved with the restriction enzyme XbaI, and a pHRB-derived fragment cleaved at both ends with XbaI was inserted between the CAG promoter and the Fcy::fur gene to obtain the plasmid CAG-ΦC31-HRB-Fcy::fur (Figure 3).
[0140] 3. Preparation of HDR Vector Plasmid The plasmid DNA pHRA used to introduce HRA, the site-specific recombinase enzyme sites R4 attB, Bxb1 attB, and Bxb1 attP, and the blasticidin resistance gene into the CAG-ΦC31-HRB-Fcy::fur plasmid prepared in step 2 above, was synthesized by Eurofins Genomics. This plasmid was digested with the restriction enzymes NotI and SpeI. The CAG-ΦC31-HRB-Fcy::fur plasmid was then digested with the restriction enzymes NotI and SpeI, and a 2437-bp fragment from the HRA plasmid was inserted upstream of the CAG site to obtain the HDR vector (Figure 4).
[0141] 4. CRISPR / Cas9-mediated cleavage of Ig-NAC(ΔDH) CRISPR / Cas9 induces two double-stranded DNA breaks at the target site, enabling efficient homologous recombination. We designed guide RNAs, gRNA-A1 and gRNA-B1, at two sites (targets) near the DH region deletion site on Ig-NAC(ΔDH). gRNA-A1:GGGCCCAGGCGCCGTTTAAT AGG (SEQ ID NO: 24) (Here, the gRNA sequence is a 20-base sequence excluding the PAM sequence (AGG).) gRNA-B1: TGCCGCAGAGTGCCAGGTGC AGG (SEQ ID NO: 25) (Here, the gRNA sequence is a 20-base sequence excluding the PAM sequence (AGG).)
[0142] The NGG sequence recognized by Cas9 was removed from these gRNAs, and oligo DNAs containing the BbsI restriction enzyme recognition sequence were synthesized (Eurofins Genomics). These oligo DNAs were then annealed, and the resulting plasmid DNA was digested with the BbsI restriction enzyme (NEB). The resulting plasmid DNA was then cloned into a Cas9 expression vector (px330, addgene Plasmid #42230) that had also been digested with the BbsI restriction enzyme. The resulting E. coli colonies were subjected to PCR using the following primers and conditions to confirm the presence or absence of oligo DNA insertion. U6F was used as the forward primer. gRNA-A1R and gRNA-B1R were used as reverse primers to confirm gRNA-A1 and gRNA-B1, respectively. U6F:GAGGGCCTATTTCCCATGATTCC (SEQ ID NO: 26) gRNA-A1F:CACCGGGGCCCAGGCGCCGTTTAAT (SEQ ID NO: 27) gRNA-A1R:AAACATTAAACGGCGCCTGGGCCCC (SEQ ID NO: 28) gRNA-B1F:CACCGTGCCGCAGAGTGCCAGGTGC (SEQ ID NO: 29) gRNA-B1R:AAACGCACCTGGCACTCTGCGGCAC (SEQ ID NO: 30)
[0143] Taq DNA polymerase (EmeraldAmp PCR Master Mix, Takara Bio) was used, and PCR was performed under the following reaction conditions: 98°C, 2 minutes, once, followed by 98°C, 10 seconds, 60°C, 1 second, and 68°C, 13 seconds, for a total of 35 cycles.
[0144] After PCR, colonies that showed the desired band around 330 bp by 2% agarose gel electrophoresis were cultured in liquid LB medium and ampicillin at 100 μL / mL, and plasmid DNA (Cas9-gRNA expression vectors A1 and B1) was obtained using Nucleospin Plasmid Transfection-grade (Takara Bio).
[0145] 5. HDR vector insertion into Ig-NAC(ΔDH) The HDR vector was inserted into CHO cells near the DH region deletion site of Ig-NAC(ΔDH) using genome editing with Cas9 / gRNA (Figure 5). The HDR vector and Cas9-gRNA expression vectors A1 and B1 were introduced by electroporation into the CHO cell clone TF7B10 carrying Ig-NAC(ΔDH) prepared in Example 1. The CHO cells TF7B10 were trypsinized and 1 × 10 7 Cells were suspended in OptiMEM (Thermo Fisher Scientific) to a concentration of 100 cells / mL and electroporated with NEPA21 (Nepa Gene) at 150 V for 7.5 ms in the presence of 5 μg of HDR vector, 2.5 μg of gRNA-A1, and 2.5 μg of gRNA-B1. After electroporation, the cells were seeded into three 96-well plates. After 48–72 hours, they were cultured in F12 medium containing 800 μg / mL G418 (Fujifilm Wako Pure Chemical Industries), 1600 μg / mL blasticidin (Fujifilm Wako Pure Chemical Industries), and 10% FBS (Sigma). After 84–96 hours, the medium was replaced with F12 medium containing 1600 μg / mL blasticidin, 200 μM 5FC (Tokyo Chemical Industry Co., Ltd.), and 10% FBS. Drug-resistant clones were isolated.
[0146] 6. PCR analysis The isolated drug-resistant clones were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). Using this genomic DNA as a template, PCR analysis was performed using three homologous recombination-specific primers (see below) and 12 Ig-NAC-specific primers (Japanese Patent No. 6868250) to select one strain (TF7B10-74) that yielded a homologous recombination-specific band. Approximately 0.1 μg of genomic DNA was used for PCR amplification. Taq polymerase (KODone, Toyobo) was used. After one cycle of 98°C for 2 minutes, denaturation was performed at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 5 seconds if the amplified fragment was 500 bp or less, and 100 seconds / kb if it was 500 bp or longer. PCR amplification was performed for 35 cycles. HRAprimerF1: 5'-GAACTGACCGTCTGCTCCA-3' (SEQ ID NO: 31) Bxb1attBF1: 5'-TGCCGAAGCAGTGGTAGAAG-3' (SEQ ID NO: 32) ΦC31F1: 5'-GGGCAACGTGCTGGTTATTG-3' (SEQ ID NO: 33) HRAprimerR1: 5'-GTGCCCTTCTACCACTGCTTC-3' (SEQ ID NO: 34) Bxb1attPR1: 5'-AGAGTGAAGCAGAACGTGGG-3' (SEQ ID NO: 35) HRBR1: 5'-TGCTTTTTCGCAACCATGGG-3' (SEQ ID NO: 36)
[0147] In Table 1, the horizontal rows show the clone names, and the vertical columns show the primers and extension times used in PCR. ○ indicates a positive result.
[0148] [Table 1]
[0149] [Example 3] Removal of the blasticidin resistance gene by site-specific recombination using Bxb1 recombinase When chemically synthesized DNA is introduced into Ig-NAC(ΔDH), the presence or absence of blasticidin resistance can be determined to determine whether the DNA has been introduced into the target site. Therefore, the inserted blasticidin resistance gene must be removed by homologous recombination. As shown in the HDR vector, the blasticidin resistance gene is located between Bxb1 attB and Bxb1 attP. By introducing Bxb1 recombinase into cells, site-specific recombination occurs between Bxb1 attB and attP, allowing the blasticidin resistance gene to be removed (Figure 6).
[0150] 1. Removal of the blasticidin resistance gene by introducing the Bxb1 recombinase gene The Bxb1 recombinase gene expression vector (Japanese Patent No. 6868250) was introduced by electroporation into CHO cells TF7B10-74 carrying the acceptor site-inserted Ig-NAC(ΔDH) obtained in Example 2. TF7B10-74 cells were treated with trypsin and 2 × 10 6 The cells were suspended in OptiMEM at a concentration of 100 cells / mL, and 10 μg of Bxb1 recombinase gene expression vector was added. Electroporation was performed using NEPA21 (Nepa Gene) at 150 V for 7.5 ms. After electroporation, the cells were seeded onto a 10 cm dish. Five days later, the cells were trypsinized and seeded onto a 384-well plate at 150 cells per plate. After seeding onto the 384-well plate, the cells were cultured for 9 days in F12 medium containing 800 μg / mL G418 and 10% FBS, and single clones were selected.
[0151] 2. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). PCR analysis was performed using this genomic DNA as a template with two primers specific for Bxb1 site-specific recombination and 12 primers specific for Ig-NAC (Japanese Patent No. 6868250). Of the two primers specific for Bxb1 site-specific recombination, primer HRAF1-Bxb1attPR2 shifted the band from approximately 2800 bp to approximately 1500 bp after site-specific recombination. Two strains (clones D1 and J23) that yielded bands specific for Bxb1 site-specific recombination were selected. Approximately 0.1 μg of genomic DNA was used for PCR amplification. Taq polymerase was KODone (TOYOBO), and the following cycle was performed: 1 cycle at 98°C for 2 minutes, followed by denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C.The cycle was repeated for 5 seconds if the amplified fragment was 500 bp or less, and 100 seconds / kb if it was 500 bp or more. HRAprimerF1: 5'-GAACTGACCGTCTGCTCCA-3' (SEQ ID NO: 31) Bxb1attPR2: 5'-GGGGCGTACTTGGCATATGA-3' (SEQ ID NO: 37)
[0152] 3. Blasticidin resistance confirmation Two clones (clone D1 and J23) that yielded specific bands after Bxb1 site-specific recombination were cultured in F12 medium containing 800 μg / mL L418, 1600 μg / mL blasticidin, and 10% FBS to confirm the presence or absence of blasticidin resistance. One of the two clones (clone D1: TF7B10-74-D1) died in the presence of blasticidin.
[0153] 4. Fluorescence in situ hybridization (FISH) FISH analysis was performed according to the method described in Japanese Patent No. 6868250 using the human gene-specific probe human cot1 (Invitrogen) and the mouse gene-specific probe mouse cot1 (Invitrogen).
[0154] The results of the PCR analysis, blasticidin resistance confirmation, and FISH analysis described above are shown in Table 2. In Table 2, the horizontal rows show the clone names, and the vertical columns show the primers and extension times used in PCR. ○ indicates positive for Bxb1 recombination, and × indicates negative for Bxb1 recombination.
[0155] [Table 2]
[0156] [Example 4] Ig-NAC (ΔDH / Bsr-) transfection into HPRT(-) CHO cell line by micronucleation cytogenetic testing (MMCT) In Example 3, the TF7B10-74-D1 clone harboring Ig-NAC(ΔDH / Bsr-), in which removal of the blasticidin resistance gene by Bxb1 recombinase was confirmed, was found to be tetraploid while independently maintaining Ig-NAC by FISH analysis (Table 2). Because these cells are important as platform cells for introducing chemically synthesized DNA, Ig-NAC(ΔDH / Bsr-) was transferred into a normal diploid CHO cell strain, HPRT(-), by MMCT.
[0157] 1. Transfer of Ig-NAC (ΔDH / Bsr-) into HPRT(-) CHO cells by MMCT 400 nM paclitaxel and 500 nM reversine at approximately 2 x 10 8 Micronuclei were prepared from TF7B10-74-D1 cells. The obtained micronuclei were suspended in 4 mL of 1× phytohemagglutinin (PHA)-P (Fujifilm Wako Pure Chemical Industries). Approximately 2 × 10 7 After trypsinization, recipient CHO cells (HPRT(-) strain) were washed three times with DMEM and replaced with the micronuclei / pHAP suspension. The cells were then incubated at 37°C for 15 minutes. The supernatant was removed, and 2 mL of PEG solution (2.5 g PEG1000 (Fujifilm Wako Pure Chemicals), 3 mL DMEM (Fujifilm Wako Pure Chemicals), 0.5 mL DMSO (Fujifilm Wako Pure Chemicals)) was added. The cells were then incubated at room temperature for 1 minute and 30 seconds, after which 10 mL of DMEM was slowly added. The cells were then washed three times with DMEM, suspended in 10 mL of F12 medium containing 10% FBS prewarmed at 37°C, and cultured in 10 cm dishes. After 24 hours, the cells were passaged. After 48 hours, the medium was replaced with F12 medium containing 800 μg / mL L418 and 10% FBS and cultured in 48 96-well plates. Approximately two weeks later, 24 drug-resistant colonies emerged and were picked.
[0158] 2. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). PCR was performed using this genomic DNA as a template with the same primers as in the PCR analysis performed in Example 2. The target band was confirmed in 14 of the 24 cell clones picked.
[0159] 3.FISH analysis Six of the 14 cell clones in which the desired band was confirmed by PCR analysis were randomly selected and subjected to FISH analysis. FISH analysis was performed according to the method described in Japanese Patent No. 6868250 using the mouse gene-specific probe mouse cot1 (Invitrogen). The results of PCR and FISH analysis for the six cell clones subjected to FISH analysis are shown in Table 3. In Table 3, the horizontal rows indicate the clone names, and the vertical columns indicate the primers and extension times used in PCR. ○ indicates positive for Bxb1 recombination. In the table, Ig-NACx1 indicates that one copy of Ig-NAC was detected per cell, and Ig-NACx2 indicates that two copies of Ig-NAC were detected per cell.
[0160] [Table 3]
[0161] [Example 5] Insertion of chemically synthesized DNA containing human minimized IgHD by site-specific recombination using ΦC31 recombinase The human IgHD region is large, approximately 40.2 kb, but most of this is non-antibody coding sequence. For example, there is approximately 2500 bp of non-antibody coding region between the first and second D fragments. On the other hand, the region between the ninth and tenth D fragments is short, approximately 100 bp. In the human minimized IgHD designed here, only the 100 bp of non-antibody coding region around D fragments 1-1 to 6-26 was retained, significantly reducing the DNA size to approximately 7.8 kb. However, no deletions or additions were made when the distance between fragments was shorter than 100 bp. Furthermore, to modify only the D region, synthetic DNA was designed so that the D region would be seamlessly connected to the deletion site of the D region deleted in Example 1 without any base duplication or deletion (Figure 7). In other words, the sequences downstream of HRA to D fragment 1-1 and from D fragment 6-26 to HRB were retained without minimization. Furthermore, by preparing a chemically synthesized DNA carrying ΦC31 attP, it is possible to cause site-specific recombination between the DNA and ΦC31 attB at the acceptor site introduced in Example 2.
[0162] The following describes the construction of vectors containing the chemically synthesized DNA recombination sites ΦC31 attP and R4 attP, a blasticidin resistance gene for vector integration, and human minimized IgHD. First, the vector sequence was divided into three separate plasmid DNA fragments: human miniA, human miniB, and human miniC (Eurofins Genomics). Human miniA contains R4 attP and the D fragment downstream of HRA to D fragment 3-10; human miniB contains D fragments 4-11 to 3-22; and human miniC contains D fragment 4-23 to HRB, as well as ΦC31 attP and the blasticidin resistance gene. The human minimized IgHD vectors containing human miniA, B, and C were constructed using the following steps 1 and 2 (Figure 8).
[0163] 1. Insertion of human miniA fragment into human miniB Human miniA was cleaved with restriction enzymes XhoI and NotI. Similarly, miniA was inserted into human miniB cleaved with restriction enzymes XhoI and NotI to obtain R4 attP-HRA / 1-1_3-22.
[0164] 2.R4 Insertion of human miniC fragment into attP-HRA / 1-1_3-22 Human miniC was cleaved with the restriction enzymes EcoRI and SalI. Similarly, the human miniC fragment was inserted into R4 attP-HRA / 1-1_3-22 cleaved with the restriction enzymes EcoRI and SalI to construct a human minimized IgHD vector.
[0165] 3. Introduction of the human minimized IgHD vector using ΦC31 recombinase Site-specific recombination can occur between ΦC31 attB in the chemically synthesized DNA transfer platform cells constructed in Example 4 and ΦC31 attP on the human minimized IgHD vector (Figure 9). The ΦC31 recombinase gene expression vector (Japanese Patent No. 6868250) and the human minimized IgHD vector were introduced by electroporation into Ig-NAC-carrying CHO cells 1-10 (Example 4) equipped with the chemically synthesized DNA transfer platform. 1-10 cells were trypsinized and 3 x 10 6 The cells were suspended in OptiMEM at a concentration of 1 / mL, and 1 μg of the ΦC31 recombinase gene expression vector ΦC31pEF1 (Japanese Patent No. 6868250) and 3 μg of human minimized IgHD vector were added. Electroporation was performed using NEPA21 (Nepa Gene) at 150 V for 7.5 ms. After pulsing, the cells were seeded onto two 384-well plates. After 48–72 hours, the medium was replaced with F12 medium containing 800 μg / mL G418, 800 μg / mL blasticidin, and 10% FBS. After 11 days, 24 clones that were resistant to blasticidin were selected.
[0166] 4. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). PCR analysis was performed using this genomic DNA as a template, with one primer specific for ΦC31 site-specific recombination, two primers engineered within the human minimized IgHD, and 12 primers specific for Ig-NAC engineered within the Ig-NAC. Approximately 0.1 μg of genomic DNA was used for PCR amplification. Taq polymerase was used (KODone, Toyobo). After one cycle of 98°C for 2 minutes, denaturation was performed at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 5 seconds for amplified fragments less than 500 bp, and 100 seconds / kb for fragments greater than 500 bp. For PCR fragments longer than 500 bp, 35 cycles were performed. BsdR1: 5'-ATGCAGATCGAGAAGCACCT-3' (SEQ ID NO: 38) 2-8to3-9F: 5'- AACGCACCAGACCAGCAGAC-3' (SEQ ID NO: 39) 4-11 to 5-12R: 5'-GACGTGGGGCCTAGAGGCT-3' (SEQ ID NO: 40) 3-22 to 4-23F: 5'-CAGGCGGGGAAGATTCAGAA-3' (SEQ ID NO: 41) 4-23 to 5-24R: 5'-TAGAGAGCCTGGGCCTAGAG-3' (SEQ ID NO: 42)
[0167] 5.FISH analysis FISH analysis was performed on the three clones for which the desired bands were confirmed by PCR analysis. FISH analysis was performed according to the method described in Japanese Patent No. 6868250 using the mouse gene-specific probe mouse cot1 (Invitrogen). The results of PCR analysis and FISH analysis for the three cell clones subjected to FISH analysis are shown in Table 4.
[0168] In Table 4, the horizontal rows show the clone names, and the vertical columns show the primers and extension times used in PCR. ○ indicates a positive result. In the table, Ig-NACx1 indicates that one copy of Ig-NAC was detected per cell, and Ig-NACx2 indicates that two copies of Ig-NAC were detected per cell.
[0169] [Table 4]
[0170] [Example 6] Removal of a partial sequence by site-specific recombination using R4 recombinase Among the sequences introduced into Ig-NAC(ΔDH), the CAG promoter and blasticidin resistance gene are sequences that are not required for antibody gene expression. These sequences are flanked by the R4 attB and attP regions, and can be removed by introducing R4 recombinase into cells, which causes site-specific recombination between the R4 attB and attP regions (Figure 10).
[0171] 1. Introduction of R4 recombinase gene expression vector The R4 recombinase gene expression vector (Japanese Patent No. 6868250) was introduced by electroporation into CHO cells 1-10 pEFI-8 (Example 5), which had been confirmed to contain a human minimized IgHD vector and had a high rate of retaining a single Ig-NAC. 1-10 pEFI-8 cells were trypsinized and 3 × 10 6 The cells were suspended in OptiMEM at a concentration of 100 cells / mL, and 10 μg of R4 recombinase gene expression vector was added. Electroporation was performed using NEPA21 (Nepa Gene) at 150 V for 7.5 ms. After pulsing, the cells were seeded onto a 10 cm dish. 24-48 hours later, the cells were trypsinized and seeded onto a 384-well plate at 150 cells per dish. After seeding onto the 384-well plate, the cells were cultured for 2 weeks in F12 medium containing 800 μg / mL L418 and 10% FBS, and 24 single clones were picked.
[0172] 2. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). PCR analysis was performed using this genomic DNA as a template, with one primer specific for R4 site-specific recombination, two primers engineered within the human minimized IgHD, and 12 primers specific for Ig-NAC engineered within the Ig-NAC. PCR using the primers specific for R4 site-specific recombination yielded bands specific for R4 site-specific recombination. Six strains were selected for PCR amplification. Approximately 0.1 μg of genomic DNA was used. Taq polymerase (KODone, Toyobo) was used. After one cycle of 98°C for 2 minutes, denaturation was performed at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 5 seconds for amplified fragments less than 500 bp, and 100 seconds / kb for fragments greater than 500 bp. The PCR amplification cycle consisted of 35 cycles. R4attLF2: 5'-CCCTCAAGGTGTGAACAGGG-3' (SEQ ID NO: 43) R4attLR2: 5'-CTGGAGGGAGGCATGTTCTG-3' (SEQ ID NO: 44)
[0173] 3.FISH analysis FISH analysis was performed on six cell clones for which the desired bands were confirmed by PCR analysis. FISH analysis was performed according to the method described in Japanese Patent No. 6868250 using the mouse gene-specific probe mouse cot1 (Invitrogen). The results of PCR analysis and FISH analysis for the six cell clones subjected to FISH analysis are shown in Table 5.
[0174] In Table 5, the horizontal rows show the clone names, and the vertical columns show the primers and extension times used in PCR. ○ indicates a positive result. In the table, Ig-NACx1 indicates that one copy of Ig-NAC was detected per cell.
[0175] [Table 5]
[0176] [Example 7] Introduction of human minimized IgHD-loaded Ig-NAC into mouse ES cell lines by micronucleation therapy (MMCT) Two clones, K5 (1-10 pEF1-K5) and M24 (1-10 pEF1-M24), were randomly selected from the six clones in Example 6 in which R4 site-specific recombination was confirmed by PCR and FISH analysis. These clones were used as chromosome donor cells, and Ig-NAC carrying human minimized IgHD was transferred into mouse ES cells using the MMCT method.
[0177] 1. Transfer of Ig-NAC carrying human minimized IgHD into mouse ES cells using the MMCT method The chromosome recipient cells used were the mouse ES cell line HKD31 6TG-9 (XO) (Patent No. 4082740), in which both alleles of the endogenous immunoglobulin heavy chain and κ chain loci have been disrupted. The HKD31 6TG-9 line was cultured on a layer of feeder cells treated with mitomycin C (mouse embryonic fibroblasts). The cells were cultured on this feeder cell layer at 37°C in Dulbecco's modified Eagle's medium (DMEM) containing 15% FBS, 1% nucleosides, penicillin-streptomycin, non-essential amino acids, L-glutamine solution, 2-mercaptoethanol, and LIF. First, 400 nM paclitaxel and 500 nM reversine were added to approximately 4 × 10 7 1-10 pEF1-K5 and 1-10 pEF1-M24 were added to prepare micronuclei. The total amount of micronuclei obtained was suspended in 5 mL of DMEM and precipitated by centrifugation. 6 ~4×10 6Mouse ES cells (HKD31 6TG-9 strain) were dispersed with trypsin, washed three times with DMEM, suspended in 5 mL of DMEM, and added to the micronuclei precipitate. The mixture was centrifuged at 1200 rpm for 5 minutes, and the supernatant was removed. The precipitate was thoroughly loosened by tapping, and 0.5 mL of PEG solution (2.5 g PEG1000 (Fujifilm Wako Pure Chemicals), 3 mL of DMEM (Fujifilm Wako Pure Chemicals), 0.5 mL of DMSO (Fujifilm Wako Pure Chemicals)) was added and shaken in a 37°C water bath. After 90 seconds, 13 mL of DMEM was slowly added, centrifuged at 1200 rpm for 5 minutes, and the supernatant was removed. The precipitate was suspended in 30 mL of ES cell medium and seeded onto three 10 cm dishes previously seeded with feeder cells. After 48 hours, the medium was replaced with ES cell medium supplemented with 350 μg / mL of G418, and thereafter, the medium was replaced with the same composition every two days. After 1 week to 10 days, 14 drug-resistant colonies appeared and were picked.
[0178] 2. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). PCR was performed using this genomic DNA as a template and the same primers as in the PCR analysis performed in Example 5. The target band was confirmed in 5 of the 14 cells picked.
[0179] 3.Karyotype analysis PCR-positive clones cultured in 6 wells were treated with trypsin after adding 0.05 μg / mL MAS (Funakoshi) for 1 hour and 30 minutes. After centrifugation at 1500 rpm for 5 minutes, the clones were suspended in 5 mL of 0.074 M potassium chloride and allowed to stand for 20 minutes. After Carnoy treatment, specimens were prepared. 50 μL of mounting medium (Slowfade) was added to the specimens. TM The mice were stained with DAPI (gold antifade with DAPI). The presence of karyotype abnormalities in the mouse chromosomes was then confirmed. The results of this PCR analysis and karyotype analysis are shown in Table 6. The results of PCR and karyotype analysis for each clone are shown in Table 6. The horizontal rows show the clone names, and the vertical columns show the primers and extension times used in PCR. ○ indicates a positive result.
[0180] [Table 6]
[0181] [Example 8] Generation of chimeric mice from mouse ES cell lines harboring human minimized IgHD-containing Ig-NAC To confirm human antibody production, chimeric mice were generated from Ig-NAC mouse ES cells containing human minimized IgHD.
[0182] Using mouse ES cells carrying the human minimized IgHD-containing Ig-NAC obtained in Example 7, chimeric mice were produced according to the Gene Targeting, Experimental Medicine, 1995, technique. Morulae and 8-cell embryos obtained by mating male and female MCH (ICR) mice (white, purchased from CLEA Japan) or HKLD mice exhibiting antibody gene deficiency (Igh / Igκ KO) or low expression (Igl1 low) were used as hosts. The injected embryos were transferred into surrogate mothers, and the resulting offspring were identified as chimeric by their coat color. By transferring the embryos into surrogate mothers, chimeric mice (with dark brown areas in their coat color) were obtained.
[0183] Four mouse ES cell line clones carrying human minimalized Ig-NAC were injected into 211 ICR embryos and transplanted into six foster mothers. As a result, a total of five GFP-positive chimeric mice were obtained. Chimerism was assessed by coat color, and the chimerism was 10-40% for the five chimeric mice. Two mouse ES cell line clones were injected into 465 HKLD embryos and transplanted into 27 foster mothers, resulting in 14 GFP-positive individuals. Chimerism was assessed by coat color, and the chimerism was 5-50% for the 14 chimeric mice.
[0184] [Example 9] Insertion of chemically synthesized DNA containing bovine human IgHD by site-specific recombination using ΦC31 recombinase In bovine antibodies, antibodies with extremely long CDRH3s, ranging from 40 to 70 amino acids in length, are observed at a frequency of approximately 10% (Wang et al., Cell, 153:1379-93, 2013). Long CDRH3s protrude from the surface of the antibody molecule, allowing them to bind to sites difficult for conventional antibodies to bind to, such as epitopes hidden by protein folding. To incorporate this feature into human antibodies, we replaced the human D fragment sequences (coding regions of the antibody) in human minimized IgHD with bovine D fragment sequences. In this case, bovine D fragments 8-2 were substituted for human D fragments 3-10. However, the order of the bovine D fragments was not changed. Because the number of D fragments in bovine IgHD is smaller than in humans, the three remaining human D fragments were deleted along with the 100 bp before and after. In this way, we designed bovine IgHD, as shown in Figure 11.
[0185] This bovine human IgHD was divided into three parts as in Example 5, and the following three plasmid DNA fragments were chemically synthesized (Eurofins Genomics): bovine miniA (containing HRA and bovine D fragments B1-1 to B8-2 corresponding to the human D fragments 1-1 to 3-10), bovine miniB (containing bovine D fragments B6-2 to B5-4 corresponding to the human D fragments 4-11 to 3-22), and bovine miniC (containing bovine D fragments B6-4 to B9-4 corresponding to the human D fragments 4-23 to 1-26, HRB, ΦC31 attP, and a blasticidin resistance gene). The bovine human minimized IgHD vectors containing these bovine miniA, B, and C fragments were constructed as follows (Figure 12).
[0186] 1. Insertion of bovine miniA fragment into bovine miniB Bovine miniA was digested with the restriction enzymes XhoI and NotI. Similarly, bovine miniB was digested with the restriction enzymes XhoI and NotI and inserted into miniA to obtain R4 attP-HRA / 1-1_3-22 (containing HRA and bovine D fragments B1-1 to B5-4).
[0187] 2.R4 Insertion of bovine miniC fragment into attP-HRA / 1-1_3-22 Human miniC was cleaved with the restriction enzymes EcoRI and SalI. Similarly, the human miniC fragment was inserted into R4 attP-HRA / 1-1_3-22 cleaved with the restriction enzymes EcoRI and SalI to construct a bovine human IgHD vector.
[0188] 3. Introduction of bovine human IgHD vector using ΦC31 recombinase The procedure was carried out in the same manner as in Example 5. 1-10 cells (Example 4) were trypsinized and 3 × 10 6 The cells were suspended in OptiMEM at a concentration of 1 / mL, and 1 μg of the ΦC31 recombinase gene expression vector ΦC31pEF1 (Japanese Patent No. 6868250) and 3 μg of bovine human IgHD vector were added. Electroporation was performed using NEPA21 (Nepa Gene) at 150 V for 7.5 ms. After pulsing, the cells were seeded onto two 384-well plates. After 48–72 hours, the medium was replaced with F12 medium containing 800 μg / mL G418, 800 μg / mL blasticidin, and 10% FBS. After 13 days, 16 blasticidin-resistant cells were picked.
[0189] 4. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). PCR analysis was carried out using this genomic DNA as a template and the same primers as in Example 5.
[0190] 5.FISH analysis Four randomly selected clones from the 16 cell clones for which the desired band was confirmed by PCR analysis were subjected to FISH analysis using the mouse gene-specific probe mouse cot1 (Invitrogen) according to the method described in Japanese Patent No. 6868250.
[0191] Table 7 shows the results of PCR analysis and FISH analysis for the four cell clones that were subjected to FISH analysis. In Table 7, the horizontal rows show the clone names, and the vertical columns show the primers and extension times used in PCR. ○ indicates a positive result. In the table, Ig-NACx1 indicates that one copy of Ig-NAC was detected per cell, and Ig-NACx2 indicates that two copies of Ig-NAC were detected per cell.
[0192] [Table 7]
[0193] [Example 10] Removal of a partial sequence by site-specific recombination using R4 recombinase 1. Introduction of R4 recombinase gene expression vector The procedure was the same as in Example 6. 1-10 C4 cells (Example 9) in which the introduction of the bovine human IgHD vector had been confirmed were treated with trypsin and then cultured in 3 × 10 6 The cells were suspended in OptiMEM at a concentration of 100 cells / mL, and 10 μg of an R4 recombinase gene expression vector was added. Electroporation was performed using NEPA21 (Nepa Gene) at 150 V for 7.5 ms. After pulsing, the cells were seeded onto a 10 cm dish. 24–48 hours later, the cells were trypsinized and seeded onto a 384-well plate at 150 cells per dish. After seeding onto the 384-well plate, the cells were cultured for 17 days in F12 medium containing 800 μg / mL G418 and 10% FBS, and 22 single clones were picked.
[0194] 2. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). Using this genomic DNA as a template, PCR analysis was performed using one primer specific to R4 site-specific recombination as in Example 6, two primers engineered within human minimized IgHD, and 12 primers specific to Ig-NAC engineered on Ig-NAC. PCR was performed using primers specific to R4 site-specific recombination, and three clones that gave bands specific to R4 site-specific recombination were selected.
[0195] 3.FISH analysis FISH analysis was performed on the three clones in which the desired band was confirmed by PCR analysis. FISH analysis was performed according to the method described in Japanese Patent No. 6868250, using the mouse gene-specific probe mouse cot1 (Invitrogen). The results of PCR and FISH analysis for the three cell clones subjected to FISH analysis are shown in Table 8. In Table 8, the horizontal rows show the clone names, and the vertical columns show the primers and extension times used in PCR. ○ indicates a positive result. In the table, Ig-NACx1 indicates that one copy of Ig-NAC was detected per cell.
[0196] [Table 8]
[0197] [Example 11] Introduction of Ig-NAC containing bovine minimized IgHD (bovine human minimized IgHD) into mouse ES cell lines by micronucleation (MMCT) 1. Transfer of Ig-NAC carrying bovine minimalized IgHD into mouse ES cells using the MMCT method Two clones, G11 (1-10 C4-G11) and L2 (1-10 C4-L2), randomly selected from the three clones confirmed to have undergone R4 site-specific recombination by PCR and FISH analysis in Example 10 were used as chromosome donor cells. Mouse ES cell line HKD31 6TG-9 (XO) (Japanese Patent No. 4082740), in which both alleles of the endogenous immunoglobulin heavy chain and κ chain loci were disrupted, was used as chromosome recipient cells. Micronuclei were formed in the same manner as in Example 7, fused with mouse ES cell line HKD31 6TG-9 (XO), and the cells were seeded onto three 10 cm dishes. After 48 hours, the medium was replaced with ES cell medium supplemented with 350 μg / mL G418, and thereafter, the medium was replaced with the same composition every two days. Twenty-three drug-resistant colonies that emerged after 1 week to 10 days were picked.
[0198] 2. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). PCR was performed using this genomic DNA as a template and the same primers as in the PCR analysis performed in Example 6. The target band was confirmed in 14 of the 23 cells picked.
[0199] 3.Karyotype analysis Using the same method as in Example 7, mouse chromosome karyotype abnormalities were confirmed. The results of this PCR analysis and karyotype analysis are shown in Table 9. Of the clones that underwent karyotype analysis, 9 clones were obtained that contained 39 mouse chromosomes, had a high rate of Ig-NACx1 retention, and were free of translocations. Table 9 shows the results of PCR and karyotype analysis for each clone. The horizontal rows show the clone names, and the vertical columns show the primers and extension times used in PCR. ○ indicates a positive result. In the table, "trans" indicates that a Robertsonian translocation was observed. In the table, Ig-NACx1 indicates that one copy of Ig-NAC was detected per cell.
[0200] [Table 9]
[0201] [Example 12] Generation of chimeric mice from mouse ES cell lines carrying bovine minimized IgHD-containing Ig-NAC To confirm human antibody production, chimeric mice were generated from mouse ES cells carrying Ig-NAC containing bovine minimized IgHD.
[0202] Using mouse ES cells carrying the resulting bovine minimized IgHD-containing Ig-NAC, chimeric mice were produced according to the Gene Targeting, Experimental Medicine, 1995, method. Morulae and 8-cell embryos obtained by mating male and female MCH (ICR) (white, purchased from CLEA Japan) or HKLD mice exhibiting antibody gene deficiency (Igh / Igκ KO) or low expression (Igl1 low) were used as hosts. The injected embryos were transferred into surrogate mothers, and the resulting offspring were identified as chimeric by their coat color. By transferring the embryos into surrogate mothers, chimeric mice (with dark brown areas in their coat color) were obtained.
[0203] Eight mouse ES cell clones carrying bovine minimized IgHD-containing Ig-NAC were injected into 591 ICR embryos and transplanted into 32 foster mothers. 18 GFP-positive individuals were obtained. Chimerism was assessed by coat color, resulting in a chimerism of 5-60% for the 18 chimeric mice. Five clones were also injected into 380 HKLD embryos and transplanted into 21 foster mothers. Thirteen GFP-positive individuals were obtained. Chimerism was assessed by coat color, resulting in a chimerism of 5-80% for the 13 chimeric mice.
[0204] [Example 13] Analysis of human-minimized chimeric mice (B cell analysis, ELISA, cDNA preparation) To evaluate whether human antibodies are being produced by human-minimized chimeric mice, B cell differentiation analysis, ELISA analysis to measure plasma antibody concentrations, and gene sequence analysis using cDNA recovered from the spleen can be performed.
[0205] 1.B cell differentiation analysis Detecting cells positive for both EGFP and the B cell marker B220 indicates B cell differentiation contributing to antibody production and serves as an indirect assessment of antibody functional expression. Flow cytometry analysis of B220 using peripheral blood samples obtained from chimeric mice, as described in Patent Publication No. 6868250, confirmed not only a GFP-positive cell population but also a GFP- and B220-copositive population, indicating the expression of functional antibodies. The highest GFP-positive rate per individual was 28.12%, and the highest GFP- and B220-copositive rate per individual was 2.30%.
[0206] 2. Antibody expression analysis by ELISA Using plasma obtained from chimeric mice, the plasma concentrations of mouse antibodies (mγ, mμ, mκ, mλ) and human antibodies (hγ, hμ, hκ, hλ, hγ1, hγ2, hγ3, hγ4, hα, hε, hδ) are measured using the method described in Japanese Patent No. 6868250, including confirmation of the presence or absence of mouse antibody expression.
[0207] 3. Expression analysis and sequence identification of human antibodies cDNA was synthesized from RNA derived from the spleens of human antibody-producing mice, and human antibody gene variable region cloning and nucleotide sequencing were performed. Analysis and evaluation were performed as described in Patent No. 6868250. After harvesting, the spleens were stored overnight at 4°C in RNAlater (Ambion), then removed from the solution and stored at -80°C. 1 mL of ISOGEN (Nippon Gene) was added to a pressure-resistant tube containing zirconia beads, followed by the addition of 50 mg of tissue. After homogenizing the tissue using an apparatus (approximately 30-45 seconds), and confirming that the tissue was homogenized, the tissue was spun down, and 1 mL of the supernatant was removed. 200 μL of chloroform was added, and RNA was extracted using the RNeasy Mini kit according to the manufacturer's protocol.
[0208] [Example 14] Analysis of bovine minimal chimeric mice (B cell analysis, ELISA, cDNA preparation) To evaluate whether human antibodies are produced by bovine-minimal chimeric mice, B cell differentiation analysis, ELISA analysis to measure plasma antibody concentrations, and gene sequence analysis using cDNA recovered from the spleen can be performed.
[0209] 1.B cell differentiation analysis Detecting cells positive for both EGFP and the B cell marker B220 indicates B cell differentiation contributing to antibody production and serves as an indirect assessment of antibody functional expression. Flow cytometry analysis of B220 using peripheral blood samples obtained from chimeric mice, as described in Patent Publication No. 6868250, confirmed not only a GFP-positive cell population but also a GFP- and B220-copositive population, indicating the expression of functional antibodies. The highest GFP-positive rate per individual was 40.38%, and the highest GFP- and B220-copositive rate per individual was 3.23%.
[0210] 2. Antibody expression analysis by ELISA Using plasma obtained from chimeric mice, the plasma concentrations of mouse antibodies (mγ, mμ, mκ, mλ) and human antibodies (hγ, hμ, hκ, hλ, hγ1, hγ2, hγ3, hγ4, hα, hε, hδ) are measured using the method described in Japanese Patent No. 6868250, including confirmation of the presence or absence of mouse antibody expression.
[0211] 3. Expression analysis and sequence identification of human antibodies cDNA was synthesized from RNA derived from the spleens of human antibody-producing mice, and human antibody gene variable region cloning and nucleotide sequencing were performed. Analysis and evaluation were performed as described in Patent No. 6868250. After harvesting, the spleens were stored overnight at 4°C in RNAlater (Ambion), then removed from the solution and stored at -80°C. 1 mL of ISOGEN (Nippon Gene) was added to a pressure-resistant tube containing zirconia beads, followed by the addition of 50 mg of tissue. After homogenizing the tissue using an apparatus (approximately 30-45 seconds), and confirming that the tissue was homogenized, the tissue was spun down, and 1 mL of the supernatant was removed. 200 μL of chloroform was added, and RNA was extracted using the RNeasy Mini kit according to the manufacturer's protocol.
[0212] [Example 15] Repertoire analysis of human-minimized (ΔIgH / ΔIgκ-ES) chimeric mice 1. Cloning and sequencing of the heavy chain region of a human antibody gene from cDNA derived from the spleen of a human-minimized (ΔIgH / ΔIgκ-ES) chimeric mouse PCR was performed using the following primers on cDNA derived from the spleen of a chimeric mouse carrying human minimized IgHD to amplify the heavy chain variable region of the human antibody gene. As a negative control, cDNA derived from the spleen of a non-chimeric mouse ICR was used. For the constant region: HIGMEX1-2: 5'-CCAAGCTTCAGGAGAAAGTGATGGAGTC-3' (SEQ ID NO: 45) For variable regions: VH1 / 5BACK: 5'-CAGGTGCAGCTGCAGCAGTCTGG-3' (SEQ ID NO: 46) VH4BACK: 5'-CAGGTGCAGCTGCAGGAGTCGGG-3' (SEQ ID NO: 47) VH3BACK: 5'-GAGGTGCAGCTGCAGGAGTCTGG-3' (SEQ ID NO: 48)
[0213] PCR was performed using three combinations of constant region and variable region primers, with 35 cycles of 98°C for 10 seconds, 59°C for 5 seconds, and 68°C for 5 seconds. All amplification products were electrophoresed on a 1.5% agarose gel and detected by ethidium bromide staining. Amplified products were detected at the expected position of approximately 470 bp in all combinations. In contrast, no specific amplification product was detected at the same position in the negative control. These amplification products were extracted from the agarose gel and digested with HindIII and PstI restriction enzymes. The resulting products were cloned into the HindIII and PstI sites of the pUC119 (TAKARA) vector. The VH1 family-derived clones, VH4 family-derived clones, and VH3 family-derived clones were sequenced to determine the nucleotide sequences of the amplified products.
[0214] 2. Analysis of the heavy chain variable region sequence of human antibody genes derived from cDNA derived from the spleen of human-minimized (ΔIgH / ΔIgκ-ES) chimeric mice For the base sequences determined in 1 above, the known germline V gene (referred to as "V fragment"), D gene (referred to as "D fragment"), and J gene (referred to as "J fragment") used in each clone were identified. Table 10 shows the results for 27 clones from which the D fragment was identified. Table 11 shows the results for 15 clones for which a similar analysis was performed using spleen-derived cDNA obtained from a human antibody-producing mouse harboring wild-type Ig-NAC (Japanese Patent No. 6868250).
[0215] As a result, the use of D fragments in chimeric mouse spleen Igμ-cDNA was observed to be biased, with 13 types of D fragments used in 27 human minimal-type clones and 6 types used in 15 wild-type human antibody-producing mouse clones, with 7 clones using D fragments 3-10 (Figure 13).
[0216] [Table 10]
[0217] [Table 11]
[0218] [Example 16] Repertoire analysis of bovine minimalized (ΔIgH / ΔIgκ-ES) chimeric mice PCR was performed using bovine minimized (ΔIgH / ΔIgκ-ES) chimeric mouse spleen-derived cDNA to amplify the heavy chain variable region of a human antibody gene, as described in Example 15. Spleen-derived cDNA obtained from a non-chimeric mouse ICR was used as a negative control. The results demonstrate the use of bovine D fragment in chimeric mouse spleen Igμ-cDNA.
[0219] To confirm the use of bovine D fragment, the following primers specific to bovine D fragment were designed and used. As a negative control, cDNA derived from the spleen of a non-chimeric mouse ICR was used. cowF1: 5'-ATTATCTGCAGAAGTCTGACCCGCACACAGG-3' (SEQ ID NO: 49) cowF2: 5'-ATTATCTGCAGTGTGGAGCTGGCCAATGCAT-3' (SEQ ID NO: 50) cowF3: 5'-ATTATCTGCAGATGGTTATGGTTATGGTTATGG-3' (SEQ ID NO: 51) cowR1: 5'-GTCGGAAGCTTATAACCACAACCATAACCAT-3' (SEQ ID NO: 52)
[0220] The amplification was performed using a combination of forward primers (cowF1, cowF2, cowF3) engineered within the fragment and HIGMEX1-2 (primer for the constant region) used in Example 15, and a reverse primer (cowR1) engineered within the fragment and primers for the variable region (VH1 / 5BACK, VH4BACK, VH3BACK) used in Example 15, under the conditions of 98°C for 10 seconds, 59°C for 5 seconds, and 68°C for 5 seconds, for 35 cycles. All amplification products were detected by ethidium bromide staining after 1.5% agarose gel electrophoresis. As a result, amplification products of the expected lengths (for the forward primer engineered within the fragment and HIGMEX1-2: approximately 250 bp, for the reverse primer engineered within the fragment and primer for the variable region used in Example 15: approximately 400 bp) were detected. On the other hand, no specific amplification products were detected at the same position in the negative control. These amplification products were extracted from the agarose gel and then subjected to restriction enzyme digestion with HindIII and PstI. This was cloned into the HindIII and PstI sites of the pUC119 (TAKARA) vector. The plasmid into which the amplified product had been inserted was sequenced to determine the nucleotide sequence.
[0221] The nucleotide sequences determined above were used to identify the known germline D fragment, V fragment, or J fragment used in each clone. The nucleotide sequences of four clones from which the bovine D fragment was identified are shown below.
[0222] Clone 1 D fragment (bovine D1-3): TGTGGAGCTGGCCA (SEQ ID NO: 53) J fragment (human J3): ATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG (SEQ ID NO: 54) Clone 2 D fragment (bovine 6-3 or 6-4): ATGGTTATGGTTATGGTTATGGTTGTGGTTATGGTTATGGTTATGGTTATAC (SEQ ID NO: 55) J fragment (human J1): CTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAG (SEQ ID NO: 56) Clone 3 V fragment (human V3-23): GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGT GGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGA (SEQ ID NO: 57) D fragment (bovine 6-3 or 6-4): TAGTTGTTATAGTGGTTATGGTTATGGTTATGGTTATGGTTGTGGTTAT (SEQ ID NO: 58) Clone 4 V fragment (human V2-5): AGGAGTCTGGTCCTACGCTGGTGAAACCACACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCATTCATTT ATTGGGATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACACAG (SEQ ID NO: 59) D fragment (bovine 6-3 or 6-4): TTGTTATAGTGGTTATGGTTATGGTTATGGTTATGGTTGTGGTTAT (SEQ ID NO: 60)
[0223] As a result of the above, cDNA in which a bovine D fragment and a human V fragment or J fragment were linked was detected in the spleen of the chimeric mouse. For example, the amino acid sequence deduced from the cDNA sequence of clone 2 is the following sequence: As shown in TIFF0007748680000024.tif9101, it was confirmed that the CDRH3 was a long CDR3 with a length of 18 amino acids or more (the number of amino acids is underlined).
[0224] [Example 17] Immune response of human-minimized (ΔIgH / ΔIgκ-ES) chimeric mice An antigen protein can be administered to human-minimized chimeric mice, and the serum or plasma samples collected after administration can be used to perform an enzyme-linked immunosorbent assay (ELISA) to evaluate whether an immune response and antigen-specific antibodies are induced.
[0225] 1. Administration of antigen A 1 mg / mg antigen protein solution was prepared in PBS containing 0.4 M arginine, and Freund's Complete adjuvant (Sigma F5881) was used for the primary immunization, and Sigma Adjuvant System (Sigma) was used for the booster immunization. TM (SAS TM The antigen administration solution is prepared by mixing 1:1 with Sigma S6322. Six-week-old chimeric mice are administered 200 μL (100 μg antigen, intraperitoneally) for the first immunization, 100 μL (50 μg antigen, intraperitoneally, every 2 weeks) for booster immunizations, and 100 μL (50 μg antigen, 1 mg / mg antigen protein solution, intravenously) for the final immunization.
[0226] 2. Antiserum ELISA Plasma is prepared from peripheral blood three days after each immunization. To evaluate the titer of antigen-specific IgG in the plasma, antiserum ELISA is performed using an antigen-immobilized 96-well plate and an anti-human IgG Fc antibody.
[0227] [Example 18] Immune response of bovine minimalized (ΔIgH / ΔIgκ-ES) chimeric mice The receptor binding domain (RBD) of the SARS-CoV2 spike protein S1 was administered as an antigen to bovine-minimized chimeric mice, and ELISA was performed using serum or plasma samples collected after administration to evaluate whether an immune response and antigen-specific antibodies were induced.
[0228] 1. Administration of antigen A 1 mg / mg antigen protein solution was prepared in PBS containing 0.4 M arginine, and Freund's Complete adjuvant (Sigma F5881) was used for the primary immunization, and Sigma Adjuvant System (Sigma) was used for the booster immunization. TM (SAS TM The antigen administration solution was prepared by mixing 1:1 with Sigma S6322. Six-week-old chimeric mice were given 200 μL (100 μg antigen, intraperitoneal) for the primary immunization and 100 μL (50 μg antigen, intraperitoneal, five times every two weeks) for the booster immunization.
[0229] 2. Antiserum ELISA Plasma was prepared from peripheral blood 3 days after each immunization. To evaluate the antigen-specific IgG titer in the plasma, antiserum ELISA was performed using an antigen-coated 96-well plate and an anti-human IgG Fc antibody. The results confirmed that repeated booster immunizations stimulated an immune response, resulting in increased antibody titers against the RBD (Figure 14).
[0230] [Example 19] Insertion of chemically synthesized DNA (Synplogen) containing simian IgHD by site-specific recombination using ΦC31 recombinase We designed a 40-kbp monkey-like human IgHD by replacing a human D fragment with a cynomolgus monkey D fragment, which is evolutionarily closely related to humans and whose antibody gene sequence has been elucidated (the base sequence of each D fragment is listed at http: / / www.imgt.org / ), while maintaining the human antibody D region gene sequence for all regions other than the D fragment (Figure 15).
[0231] 1. Preparation of synthetic DNA containing simian IgHD Because there are 26 human D fragments to be replaced, while there are 40 cynomolgus D fragments, sequences similar to each other among the cynomolgus D fragments were excluded, and sequences showing significant changes compared to human IgHD were prioritized, narrowing the list down to the 26 types shown in Table 12. In addition, mutations in the VDJ recombination sequences present before and after four human D fragments (D4-11, D1-14, D4-23, and D5-24) were converted to normal types.
[0232] [Table 12]
[0233] In addition to the monkey-modified IgHD carrying these 26 types of cynomolgus monkey D fragments, a vector carrying the chemically synthesized DNA recombination sites ΦC31 attP and R4 attP, and a blasticidin resistance gene to confirm whether or not the vector was introduced, was chemically synthesized using the OGAB (Ordered Gene Assembly in Bacillus subtilis) method using Bacillus subtilis from Synplogen Co., Ltd.
[0234] 2. Introduction of the monkey-modified IgHD vector using ΦC31 recombinase The procedure was carried out in the same manner as in Example 5. 1-10 cells were trypsinized and 3 × 10 6 The cells were suspended in OptiMEM at a concentration of 1 / mL, and 1 μg of the ΦC31 recombinase gene expression vector ΦC31pEF1 (Japanese Patent No. 6868250) and 3 μg of simianized IgHD vector were added. Electroporation was performed using NEPA21 (Nepa Gene) at 150 V for 7.5 ms. After pulsing, the cells were seeded onto two 384-well plates. After 48 hours, the medium was replaced with F12 medium containing 800 μg / mL G418, 800 μg / mL blasticidin, and 10% FBS, and the cells were cultured. After 12 days, 17 blasticidin-resistant cells were picked.
[0235] 3. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). PCR analysis was performed using this genomic DNA as a template, with one primer specific to the ΦC31 site-specific recombination fragment (as in Example 5), 12 primers specific to Ig-NAC prepared on Ig-NAC, and one primer specific to the simianized IgHD fragment shown below. Approximately 0.1 μg of genomic DNA was used for PCR amplification. Taq polymerase was used (KODone (TOYOBO)). After one cycle of 98°C for 2 minutes, denaturation was performed at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 5 seconds if the amplified fragment was 500 bp or less, and 100 seconds / kb if it was 500 bp or longer. For PCR amplifications of approximately 35 cycles, the following cycles were performed: 1. The PCR amplification was performed using Taq polymerase (KODone) for 2 minutes at 98°C, 2. The PCR amplification cycle consisted of 35 cycles of denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 5 seconds / kb if the amplified fragment was 500 bp or less, and 100 seconds / kb if the amplified fragment was 500 bp or longer. 3-10monkeyF: 5'-CACCCACAGTGTCACAGAGT-3' (SEQ ID NO: 62) 4-11monkeyR: 5'-TCACTGTGGGTGGCAAAACT- 3' (SEQ ID NO: 63)
[0236] Furthermore, to confirm whether the entire simian IgHD was retained in the clone, the following five primers were prepared and long-range PCR was performed. Approximately 0.1 μg of genomic DNA was used for PCR amplification. Taq polymerase was PrimeSTAR TM PCR was performed using GXL Premix Fast (Takara Bio Inc.) by the step-down method as follows.
[0237] Thirty cycles of the following were performed: 1 cycle of 98°C for 2 minutes, followed by denaturation at 98°C for 10 seconds, annealing and extension at 72°C, with 5 seconds per kb if the amplified fragment length was 10 kbp or less, and 10 seconds per kb if it was longer than 10 kb; 5 cycles of denaturation at 98°C for 10 seconds, annealing and extension at 70°C, with 5 seconds per kb if the amplified fragment length was 10 kbp or less, and 10 seconds per kb if it was longer than 10 kb; 5 cycles of denaturation at 98°C for 10 seconds, annealing and extension at 68°C, with 5 seconds per kb if the amplified fragment length was 10 kbp or less, and 10 seconds per kb if it was longer than 10 kb. PACF1: 5'- CGGTGTGCGGTTGTATGCCTGCTGT - 3' (SEQ ID NO: 64) 3-3to4-4R: 5'-GGCCAGGCAGGATGATGGACTCCCA-3' (SEQ ID NO: 65) 3-3F: 5'- CGGTTACTATTACACCCACAGCGTC - 3' (SEQ ID NO: 66) 3-10F2: 5'- TTGTAGTGGTGGTGTCTGCTACACC - 3' (SEQ ID NO: 67) 3-16R: 5'- GTAGTTACTGTATTCACACAGTGAC - 3' (SEQ ID NO: 68) F37: 5'- CTGCAGGCCCTGTCCTCTTC - 3' (SEQ ID NO: 69) 4-23R: 5'- ATAGTAATACCACTGTGGGAGGGCC - 3' (SEQ ID NO: 70)
[0238] 4.FISH analysis FISH analysis was performed on one cell clone in which the desired band was confirmed by PCR analysis using the mouse gene-specific probe mouse cot1 (Invitrogen) according to the method described in Japanese Patent No. 6868250.
[0239] The results of PCR analysis and FISH analysis for one cell clone that underwent FISH analysis are shown in Table X. In Table 13, the horizontal rows show the clone names, and the vertical columns show the primers and extension times used in PCR. ○ indicates a positive result. In the table, Ig-NACx1 indicates that one copy of Ig-NAC was detected per cell.
[0240] [Table 13]
[0241] [Example 20] Removal of a partial sequence by site-specific recombination using R4 recombinase (simianization) 1. Introduction of R4 recombinase gene expression vector The procedure was the same as in Example 6. The cell clone (Example 19) in which the introduction of the monkey-modified human IgHD vector was confirmed was treated with trypsin, and 3 × 10 6 The cells were suspended in OptiMEM at a concentration of 100 cells / mL, and 10 μg of an R4 recombinase gene expression vector was added. Electroporation was performed using NEPA21 (Nepa Gene) at 150 V for 7.5 ms. After pulsing, the cells were seeded onto a 10 cm dish. 24-48 hours later, the cells were trypsinized and seeded onto a 384-well plate at 150 cells per plate. 17 days after seeding onto the 384-well plate, the medium was replaced with F12 medium containing 800 μg / mL L418 and 10% FBS, and the cells were cultured. Single clones were then picked.
[0242] 2. PCR analysis The isolated cells were cultured, and genomic DNA was extracted from the cells using Cellysis (Qiagen). PCR analysis was performed using this genomic DNA as a template, with one primer specific to R4 site-specific recombination as in Example 6, two primers engineered within the simianized IgHD, and 12 primers specific to Ig-NAC engineered on Ig-NAC. PCR was performed using primers specific to R4 site-specific recombination, and a clone (1-10 M9-I9) that gave a band specific to R4 site-specific recombination was selected.
[0243] 3.FISH analysis The clone (1-10 M9-I9) that had been confirmed to produce the desired band by PCR analysis was subjected to FISH analysis using the mouse gene-specific probe mouse cot1 (Invitrogen) according to the method described in Japanese Patent No. 6868250.
[0244] [Example 21] Introduction of monkey-like IgHD-loaded Ig-NAC into mouse ES cell lines by micronucleation cytogenetic testing (MMCT) 1. Transfer of Ig-NAC carrying monkey-specific IgHD into mouse ES cells using the MMCT method Clones in which R4 site-specific recombination was confirmed by PCR and FISH analysis in Example 10 were used as chromosome donor cells. Mouse ES cell line HKD31 6TG-9 (XO) (Japanese Patent No. 4082740), in which both alleles of the endogenous immunoglobulin heavy chain and κ chain loci were disrupted, were used as chromosome recipient cells. Micronuclei were formed using the same method as in Example 7, fused with mouse ES cell line HKD31 6TG-9 (XO), and plated onto three 10 cm dishes. After 48 hours, the medium was replaced with ES cell medium supplemented with 350 μg / mL G418, and thereafter, the medium was replaced with the same composition every two days. Drug-resistant colonies that appeared after 1 week to 10 days were picked.
[0245] 2. PCR analysis The isolated cells are cultured, and genomic DNA is extracted from the cells using Cellysis (Qiagen). Using this genomic DNA as a template, PCR is carried out using the same primers as in the PCR analysis performed in Example 6.
[0246] 3.Karyotype analysis The presence of karyotype abnormalities in mouse chromosomes is confirmed using the same method as in Example 7. From those that underwent karyotype analysis, clones with 39 mouse chromosomes, a high retention rate of Ig-NACx1, and no translocations are selected.
[0247] [Example 22] Preparation of chimeric mice from mouse ES cell lines harboring Ig-NAC containing simian IgHD To confirm human antibody production, chimeric mice were generated from mouse ES cell lines carrying the simian IgHD-containing Ig-NAC. Using the resulting mouse ES cells carrying the simian IgHD-containing Ig-NAC, chimeric mice were generated according to the gene targeting method described in Experimental Medicine (1995). Morulae and 8-cell embryos obtained by mating male and female MCH (ICR) mice (white, purchased from CLEA Japan) or HKLD mice exhibiting antibody gene deficiency (Igh / Igκ KO) or low expression (Igl1 low) were used as hosts. The injected embryos were transferred into surrogate mothers, and the resulting offspring were identified as chimeric by coat color. Chimeric mice (with dark brown coats) were obtained by transferring the embryos into surrogate mothers.
[0248] [Example 23] Analysis of monkey-like IgHD chimeric mice (B cell analysis, ELISA, cDNA preparation) To evaluate whether simian-IgHD chimeric mice are producing simian-IgHD human antibodies, B cell differentiation analysis, ELISA analysis measuring plasma antibody concentrations, and gene sequence analysis using cDNA extracted from the spleen can be performed.
[0249] 1.B cell differentiation analysis If cells positive for both EGFP and the B cell marker B220 can be detected, this indicates B cell differentiation contributing to antibody production, and serves as an indirect evaluation of the functional expression of antibodies. If the results of flow cytometry analysis of B220 using peripheral blood samples obtained from chimeric mice as described in Patent No. 6868250 reveal not only a GFP-positive cell population but also a population positive for both GFP and B220, this indicates the expression of functional antibodies.
[0250] 2. Antibody expression analysis by ELISA Using plasma obtained from chimeric mice, the plasma concentrations of mouse antibodies (mγ, mμ, mκ, mλ) and human antibodies (hγ, hμ, hκ, hλ, hγ1, hγ2, hγ3, hγ4, hα, hε, hδ) are measured using the method described in Japanese Patent No. 6868250, including confirmation of the presence or absence of mouse antibody expression.
[0251] 3. Expression analysis and sequence identification of human antibodies cDNA was synthesized from RNA derived from the spleens of human antibody-producing mice, and human antibody gene variable region cloning and base sequencing were performed. Analysis and evaluation were performed as described in Patent No. 6868250. After harvesting, the spleens were stored overnight at 4°C in RNAlater (Ambion), then removed from the solution and stored at -80°C. 1 mL of ISOGEN (Nippon Gene) was added to a pressure-resistant tube containing zirconia beads, followed by the addition of 50 mg of tissue. After homogenizing the tissue (approximately 30-45 seconds), the tissue was spun down. 1 mL of the supernatant was removed, 200 μL of chloroform was added, and RNA was extracted using the RNeasy Mini kit according to the manufacturer's protocol.
[0252] [Example 24] Repertoire analysis of monkey-like (ΔIgH / ΔIgκ-ES) chimeric mice 1. Cloning and sequencing of the heavy chain region of a human antibody gene from the spleen cDNA of a chimeric mouse (ΔIgH / ΔIgκ-ES) PCR was performed using the following primers on cDNA derived from the spleen of a chimeric mouse carrying monkey-like IgHD to amplify the heavy chain variable region of the human antibody gene. As a negative control, cDNA derived from the spleen of a non-chimeric mouse ICR was used. Constant region: HIGMEX1-2: 5'-CCAAGCTTCAGGAGAAAGTGATGGAGTC-3' (SEQ ID NO: 71) For variable regions: VH1 / 5BACK: 5'-CAGGTGCAGCTGCAGCAGTCTGG-3' (SEQ ID NO: 72) VH4BACK: 5'-CAGGTGCAGCTGCAGGAGTCGGG-3' (SEQ ID NO: 73) VH3BACK: 5'-GAGGTGCAGCTGCAGGAGTCTGG-3' (SEQ ID NO: 74)
[0253] PCR was performed using a combination of constant region and variable region (3 types) under the conditions of 98°C for 10 seconds, 59°C for 5 seconds, and 68°C for 5 seconds for 35 cycles. All amplified products were detected by ethidium bromide staining after 1.5% agarose gel electrophoresis. The amplified products were extracted from the agarose gel and then subjected to restriction enzyme digestion using HindIII and PstI. This was then cloned into the HindIII and PstI sites of the pUC119 (TAKARA) vector. The plasmid into which the amplified product had been inserted was sequenced to determine the base sequence of the amplified product.
[0254] 2. Analysis of the heavy chain variable region base sequence of a human antibody gene derived from the spleen cDNA of monkey-like (ΔIgH / ΔIgκ-ES) chimeric mouse The nucleotide sequences determined in step 1 are used to identify the known germline V gene fragments, D fragments, and J fragments used in each clone. As a result, the presence of human antibody heavy chain variable region cDNA containing a monkey DH sequence due to VDJ recombination is confirmed.
[0255] [Example 25] Immune response of monkey-like (ΔIgH / ΔIgκ-ES) chimeric mice Antigen protein is administered to monkey-like (ΔIgH / ΔIgκ-ES) chimeric mice, and serum or plasma samples are used to perform enzyme-linked immunosorbent assay (ELISA) to evaluate whether an immune response and antigen-specific antibodies are induced.
[0256] 1. Administration of antigen A 1 mg / mg antigen protein solution was prepared in PBS containing 0.4 M arginine, and Freund's Complete adjuvant (Sigma F5881) was used for the primary immunization, and Sigma Adjuvant System (Sigma F5881) was used for the booster immunization. TM (SAS TM The antigen administration solution is prepared by mixing 1:1 with Sigma S6322. Six-week-old chimeric mice are administered 200 μL (100 μg antigen, intraperitoneally) for the first immunization, 100 μL (50 μg antigen, intraperitoneally, every 2 weeks) for booster immunizations, and 100 μL (50 μg antigen, 1 mg / mg antigen protein solution, intravenously) for the final immunization.
[0257] 2. Antiserum ELISA Plasma is prepared from peripheral blood three days after each immunization. To evaluate the titer of antigen-specific IgG in the plasma, antiserum ELISA is performed using an antigen-immobilized 96-well plate and an anti-human IgG Fc antibody.
[0258] [Example 26] Establishment of a mouse strain carrying human minimized IgHD-loaded Ig-NAC and with disrupted endogenous immunoglobulin heavy chain and κ chain gene loci A mouse strain carrying human minimized IgHD-equipped Ig-NAC and with disrupted endogenous immunoglobulin heavy chain and κ chain loci was established by crossing the chimeric mice produced as described in Example 8 using mouse ES cells carrying human minimized IgHD-equipped Ig-NAC, which were produced using mouse ES cells TT2F(XO) as recipient cells in Example 7, with a mouse strain in which endogenous immunoglobulin heavy chain and κ chain loci had been disrupted. The resulting mouse individual (#200) carrying human minimized IgHD-equipped Ig-NAC and with disrupted endogenous immunoglobulin heavy chain and κ chain loci was subjected to flow cytometry analysis as described in Example 13. As a result, the GFP positivity rate of peripheral blood mononuclear cells was 96.97%, and the GFP and B220 co-positivity rate of peripheral blood mononuclear cells was 18.78%, which was equivalent to that of mice that retained wild-type Ig-NAC instead of human minimized IgHD and had their endogenous immunoglobulin heavy chain and κ chain loci disrupted (Patent Publication No. 6868250).
[0259] [Example 27] Establishment of a mouse strain carrying bovine minimized IgHD-loaded Ig-NAC and with disrupted endogenous immunoglobulin heavy chain and κ chain loci Using mouse ES cells carrying bovine minimized IgHD-loaded Ig-NACs generated in Example 11 using mouse ES cells TT2F(XO) as recipient cells, chimeric mice generated as described in Example 12 were crossed with wild-type mice or mouse strains in which endogenous immunoglobulin heavy chains and κ chains had been disrupted, thereby establishing mouse strains carrying bovine minimized IgHD-loaded Ig-NACs and in which endogenous immunoglobulin heavy chain and κ chain loci had been disrupted. The resulting mouse individual (#241) carrying bovine minimized IgHD-loaded Ig-NACs and in which endogenous immunoglobulin heavy chain and κ chain loci had been disrupted was subjected to flow cytometry analysis as described in Example 13. As a result, the GFP positivity rate of peripheral blood mononuclear cells was 99.09%, and the GFP and B220 co-positivity rate of peripheral blood mononuclear cells was 6.26%, which was equivalent to that of mice that retained wild-type Ig-NAC instead of bovine minimized IgHD and had their endogenous immunoglobulin heavy chain and κ chain loci disrupted (Patent Publication No. 6868250).
[0260] [Example 28] Establishment of a mouse strain carrying monkey-like IgHD-loaded Ig-NAC and with disrupted endogenous immunoglobulin heavy chain and κ chain gene loci By crossing the chimeric mouse produced in Example 22, or the chimeric mouse produced in Example 21 using mouse ES cells TT2F(XO) as the recipient cell as described in Example 22, with a wild-type mouse or a mouse strain in which the endogenous immunoglobulin heavy chain and κ chain have been disrupted, a mouse strain can be established that retains Ig-NAC carrying simian IgHD and in which the endogenous immunoglobulin heavy chain and κ chain gene loci have been disrupted.
[0261] [Example 29] Insertion of chemically synthesized DNA containing human long-chain minimized IgHD by site-specific recombination using ΦC31 recombinase Human long-chain minimized IgHD vectors were prepared in the same manner as in Example 5, by replacing D fragments 1-1 to 1-26 of the human minimized IgHD designed in Example 5 with the 26 types of modified long-chain DH sequences shown in Figure 16, using the following procedures 1 and 2. Human long-chain DH sequences were designed based on long (18 amino acids or more) CDR3 sequences found in human antibody cDNA sequences registered with NCBI. Human long-chain miniA, human long-chain miniB, and human long-chain miniC vectors were synthesized by Eurofins Genomics, as in Example 5.
[0262] 1. Insertion of human long miniA fragment into human long miniB Human long miniA was digested with restriction enzymes XhoI and NotI. Human long miniA / B vector was constructed by inserting long miniA into human long miniB which had been similarly digested with restriction enzymes XhoI and NotI.
[0263] 2. Insertion of the human long miniC fragment into the human long miniA / B vector Human long miniC was digested with the restriction enzymes EcoRI and SalI. Similarly, the human long miniC fragment was inserted into the human long miniA / B vector digested with the restriction enzymes EcoRI and SalI to construct a human long minimized IgHD vector.
[0264] 3. Introduction of human long-chain minimized IgHD vectors using ΦC31 recombinase In the same manner as in Example 5, the ΦC31 recombinase gene expression vector (Japanese Patent No. 6868250) and the human long-chain minimized IgHD vector were introduced by electroporation into Ig-NAC-carrying CHO cells 1-10 (Example 4) equipped with a chemically synthesized DNA introduction platform. The 1-10 cells were trypsinized and 3 × 10 6The cells were suspended in OptiMEM at a concentration of 1 / mL, and then 1 μg of the ΦC31 recombinase gene expression vector ΦC31pEF1 (Japanese Patent No. 6868250) and 3 μg of human long-chain minimized IgHD vector were added. Electroporation was performed using NEPA21 (Nepa Gene) at 150 V for 7.5 ms. After pulsing, the cells were seeded onto two 384-well plates. After 48–72 hours, the medium was replaced with F12 medium containing 800 μg / mL G418, 800 μg / mL blasticidin, and 10% FBS. After 11 days, clones that were resistant to blasticidin were selected.
[0265] 4. PCR analysis PCR analysis of the clones obtained in 3. was performed using a method similar to that used in Example 5, with one primer specific to ΦC31 site-specific recombination, two primers engineered within human long-chain minimized IgHD, and 12 primers specific to Ig-NAC engineered within Ig-NAC. Approximately 0.1 μg of genomic DNA was used for PCR amplification. Taq polymerase was used (TOYOBO). After one cycle of 98°C for 2 minutes, denaturation was performed at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 5 seconds if the amplified fragment was 500 bp or less, and 100 seconds per length (bp) if it was 500 bp or longer. 35 cycles were performed.
[0266] 5.FISH analysis The clone (1-10 HL15) for which the desired band was confirmed by PCR analysis was subjected to FISH analysis using the mouse gene-specific probe mouse cot1 (Invitrogen) according to the method described in Japanese Patent No. 6868250.
[0267] [Example 30] Removal of a partial sequence by site-specific recombination using R4 recombinase Among the sequences introduced into Ig-NAC(ΔDH), the CAG promoter and blasticidin resistance gene are sequences that are not required for antibody gene expression. These sequences are flanked by R4 attB and R4 attP, and can be removed by introducing R4 recombinase into cells, which causes site-specific recombination between R4 attB and R4 attP.
[0268] 1. Introduction of R4 recombinase gene expression vector As in Example 6, the R4 recombinase gene expression vector (Japanese Patent No. 6868250) was electroporated into a CHO cell clone (1-10 HL15) that had been confirmed to contain a human long-chain minimized IgHD vector and had a high retention rate of a single Ig-NAC. The resulting G418-resistant clones were selected.
[0269] 2. PCR analysis As in Example 6, PCR analysis was performed using the genomic DNA of the G418-resistant clones obtained in 1 as a template, and clones (1-10 HL15-28, 1-10 HL15-43) that gave specific bands after R4 site-specific recombination were selected.
[0270] 3.FISH analysis FISH analysis was performed on cell clones (1-10 HL15-28 and 1-10 HL15-43) for which the desired bands were confirmed by PCR analysis. FISH analysis was performed using the mouse gene-specific probe mouse cot1 (Invitrogen) according to the method described in Japanese Patent No. 6868250.
[0271] [Example 31] Introduction of human long-chain minimized IgHD-loaded Ig-NAC into mouse ES cell lines by micronucleation therapy (MMCT) Clones in which R4 site-specific recombination was confirmed by PCR and FISH analysis in Example 30 were used as chromosome donor cells, and human long-chain minimized IgHD-containing Ig-NAC was transferred into mouse ES cells using the MMCT method.
[0272] 1.Transfection of Ig-NAC containing human long-chain minimized IgHD into mouse ES cells using the MMCT method As in Example 7, mouse ES cells HKD31 6TG-9 (XO) strain (Japanese Patent No. 4082740), in which both alleles of the endogenous immunoglobulin heavy chain and κ chain loci have been disrupted, were used as chromosome recipient cells. Human long-chain minimized IgHD-containing Ig-NAC was introduced by micronucleus formation (MMCT), and drug-resistant colonies that emerged were selected.
[0273] 2. PCR analysis The isolated cells are cultured and genomic DNA is extracted from the cells using Celllysis (Qiagen) in the same manner as in Example 7. PCR is performed using this genomic DNA as a template, and clones in which the target band is detected are selected.
[0274] 3.Karyotype analysis A chromosome specimen was prepared in the same manner as in Example 7. This specimen was stained with DAPI, and clones with no karyotype abnormalities in mouse chromosomes were selected.
[0275] [Example 32] Preparation of chimeric mice from mouse ES cell lines harboring human long-chain minimized IgHD-containing Ig-NAC As in Example 8, chimeric mice are generated from the human minimized IgHD-containing Ig-NAC mouse ES cells obtained in Example 31 to confirm human antibody production. Mouse ES cell line clones carrying human long-chain minimized HD-containing Ig-NAC are injected into ICR embryos and transplanted into foster mothers, resulting in GFP-positive chimeric mice. The resulting chimeric mice are analyzed by the methods described in Examples 13, 14, 15, etc. The results demonstrate the use of the long human D fragment in the chimeric mouse splenic Igμ-cDNA.
[0276] [Example 33] Construction of synthetic D domain-introduced acceptor-bearing Ig-NAC from human IgHD7-27 In Ig-NAC(ΔDH) with the human IgHD region deleted, a total of 26 human D fragments, 1-1 to 1-26, were deleted, while 7-27, located away from the D region and close to the J region, was not deleted. To eliminate the impact of the remaining D fragment 7-27, CRISPR / Cas9 gRNAs were designed, evaluated, and selected at two locations before and after D fragment 7-27. Then, Ig-NAC-carrying CHO cells 1-10 (Example 4) equipped with a chemically synthesized DNA introduction platform were cut at two locations by genome editing using the above gRNA and Cas9 to obtain an Ig-NAC carrying a synthetic D region-introduced acceptor with human IgHD7-27 deleted. [Industrial Applicability]
[0277] The present invention expands the diversity of human antibodies, making it possible to produce human antibodies that contain CDRH3s with preferably 18 to 50 or more amino acids. [Sequence List Free Text]
[0278] SEQ ID NO: 1: Nucleotide sequence of human minimized D region SEQ ID NO: 2: Nucleotide sequence of the human minimized D region replaced with the bovine ORF 737..767 B1-1 replacing D2-2 1024..1039 B2-1 replacing D3-3 1296..1331 B3-1 replacing D4-4 1588..1630 B4-1 replaces D5-5 1887..1900 B9-1 replaces D6-6 2157..2187 B1-2 replacing D1-7 2444..2459 B2-2 replacing D2-8 2715..2756 B5-2 replacing D3-9 2910..3057 B8-2 replacing D3-10 3374..3431 B6-2 replacing D4-11 3688..3806 B1-3 replacing D5-12 4063..4078 B2-3 replacing D6-13 4338..4373 B3-3 replacing D1-14 4630..4696 B7-3 replacing D2-15 4953..4994 B5-3 replacing D3-16 5251..5308 B6-3 replacing D4-17 5565..5595 B1-4 replacing D5-18 5852..5867 B2-4 replacing D6-19 6124..6159 B3-4 replacing D1-20 6416..6488 B7-4 replacing D1-21 6745..6785 B5-4 replacing D3-22 7103..7160 B6-4 replacing D4-23 7417..7430 B9-4 replacing D5-24 SEQ ID NO: 3: Nucleotide sequence of the human minimized D region replaced with the modified ORF 647..690 Modification D1-1 947..990 Modified D2-2 1247..1290 Modified D3-3 1547..1590 Modified D4-4 1847..1890 Modified D5-5 2147..2190 Modified D6-6 2447..2508 Modification D1-7 2765..2808 Modified DL2-8 3064..3149 Modified D3-9 3303..3385 Modified D3-10 3702..3760 Modified D4-11 4017..4078 Modified D5-12 4335..4384 Modification D6-13 4644..4711 Modification D1-14 4968..5035 Modification D2-15 5292..5365 Modification D3-16 5622..5695 Modification D4-17 5952..6016 Modified D5-18 6273..6334 Modified D6-19 6591..6652 Modification D1-20 6909..6961 Modification D2-21 7218..7264 Modified D3-22 7581..7642 Modification D4-23 7899..7960 Modified D5-24 8217..8263 Modified D6-25 8520..8578 Modification D1-26 SEQ ID NO: 4: Target nucleotide sequence of guide RNA gRNA Up3 21..23: PAM array SEQ ID NO: 5: Target nucleotide sequence of guide RNA gRNA Down4 21..23: PAM array SEQ ID NOs: 6 to 15: Primers SEQ ID NO: 18: Nucleotide sequence of Bxb1 attB SEQ ID NO: 19: Nucleotide sequence of Bxb1 attP SEQ ID NO: 20: Nucleotide sequence of ΦC31 attB SEQ ID NO: 21: Nucleotide sequence of R4 attB SEQ ID NOs: 22 to 23: Primers SEQ ID NO: 24: Target nucleotide sequence of guide RNA gRNA-A1 21..23: PAM array SEQ ID NO: 25: Target nucleotide sequence of guide RNA gRNA-B1 21..23: PAM array SEQ ID NOs: 26 to 52: Primers SEQ ID NO: 61: Amino acid sequence of a peptide containing long CDRH3 SEQ ID NOs: 62 to 74: Primers SEQ ID NO: 75: Modified long DH sequence substituted for the nucleotide sequence of human DH number 1-1 SEQ ID NO: 76: Modified long DH sequence substituted for the nucleotide sequence of human DH number 2-2 SEQ ID NO: 77: Modified long DH sequence substituted for the nucleotide sequence of human DH number 3-3 SEQ ID NO: 78: Modified long DH sequence substituted for the nucleotide sequence of human DH number 4-4 SEQ ID NO: 79: Modified long DH sequence substituted for the nucleotide sequence of human DH number 5-5 SEQ ID NO: 80: Modified long DH sequence substituted for the nucleotide sequence of human DH number 6-6 SEQ ID NO: 81: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 1-7 SEQ ID NO: 82: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 2-8 SEQ ID NO: 83: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 3-9 SEQ ID NO: 84: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 3-10 SEQ ID NO: 85: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 4-11 SEQ ID NO: 86: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 5-12 SEQ ID NO: 87: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 6-13 SEQ ID NO: 88: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 1-14 SEQ ID NO: 89: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 2-15 SEQ ID NO: 90: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 3-16 SEQ ID NO: 91: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 4-17 SEQ ID NO: 92: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 5-18 SEQ ID NO: 93: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 6-19 SEQ ID NO: 94: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 1-20 SEQ ID NO: 95: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 2-21 SEQ ID NO: 96: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 3-22 SEQ ID NO: 97: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 4-23 SEQ ID NO: 98: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 5-24 SEQ ID NO: 99: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 6-25 SEQ ID NO: 100: Modified long DH sequence substituted for the nucleotide sequence of human DH numbers 1-26 All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.
Claims
1. In a mammalian artificial chromosome vector containing human immunoglobulin heavy chain and light chain loci, the human-derived genomic sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region is a mammalian artificial chromosome vector characterized in that it is replaced with a modified sequence of the D region consisting of a combination of the following (1) and (2), or (1) and (3), wherein the modified sequence of the D region is (1) The human-derived genomic sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human-derived genomic sequence between the ORFs excluding the sequence between D3-9 and D3-10, includes a sequence shortened to a length of 100 to 500 bp from the end of each VDJ recombination sequence in the inter-ORF region flanked by VDJ recombination sequences; and (2) Instead of the ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, the ORF sequence from B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequence from 1S5 to 1S39 of the monkey immunoglobulin heavy chain locus D region, or the ORF sequence of the sheep, horse, rabbit, bird, or shark immunoglobulin heavy chain locus D region, or (3) Instead of the ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, 26 types of modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region are prepared based on a human antibody heavy chain CDR3 sequence of 18 to 50 amino acids. The mammalian artificial chromosome vector.
2. A mammalian artificial chromosome vector as described in claim 1, wherein the length of the modified sequence in the D region is 10 kb or less.
3. The ORF sequence from B1-1 to B9-4 of the bovine-derived immunoglobulin heavy chain locus D region comprises a nucleotide sequence of SEQ ID NOs: 127 to 149 or a nucleotide sequence having 90% or more identity with the nucleotide sequence, the mammalian artificial chromosome vector according to claim 1.
4. The ORF sequence from 1S5 to 1S39 of the monkey-derived immunoglobulin heavy chain locus D region comprises a nucleotide sequence of SEQ ID NOs: 150 to 175 or a nucleotide sequence having 90% or more identity to the nucleotide sequence, the mammalian artificial chromosome vector according to claim 1.
5. The 26 types of modified ORF sequences of (3) comprise the nucleotide sequences of SEQ ID NOs: 75 to 100 or 90% or more identical to the nucleotide sequence, mammalian artificial chromosome vector according to claim 1.
6. The modified sequence of the D region comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3, or a nucleotide sequence having 90% or more identity to the nucleotide sequence, mammalian artificial chromosome vector according to claim 1.
7. The mammalian artificial chromosome vector of claim 1, wherein the D region of the human immunoglobulin heavy chain locus further lacks D7-27.
8. 2. The mammalian artificial chromosome vector of claim 1, wherein the vector is a rodent artificial chromosome vector.
9. 9. The mammalian artificial chromosome vector of claim 8, wherein the rodent artificial chromosome vector is a mouse artificial chromosome vector.
10. 2. The mammalian artificial chromosome vector of claim 1, wherein the light chain locus is a kappa light chain locus and / or a lambda light chain locus.
11. A mammalian cell comprising the mammalian artificial chromosome vector according to any one of claims 1 to 10.
12. The mammalian cell of claim 11 , wherein the cell is a rodent cell or a human cell.
13. The mammalian cell according to claim 11, wherein the cell is a pluripotent stem cell selected from the group consisting of iPS cells and ES cells derived from a mammal.
14. A non-human mammal comprising the mammalian artificial chromosome vector of claim 1, wherein endogenous immunoglobulin heavy chain, kappa light chain and lambda light chain genes or loci are disrupted.
15. A non-human animal comprising human immunoglobulin heavy chain and light chain loci, wherein a human-derived genomic sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region is replaced with a modified sequence of the D region consisting of a combination of the following (1) and (2), or (1) and (3), wherein the modified sequence of the D region is: (1) The human-derived genomic sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human-derived genomic sequence between the ORFs excluding the sequence between D3-9 and D3-10, includes a sequence shortened to a length of 100 to 500 bp from the end of each VDJ recombination sequence in the inter-ORF region flanked by VDJ recombination sequences; and (2) Instead of the ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, the ORF sequence from B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequence from 1S5 to 1S39 of the monkey immunoglobulin heavy chain locus D region, or the ORF sequence of the sheep, horse, rabbit, bird, or shark immunoglobulin heavy chain locus D region, or (3) Instead of the ORF sequence from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, 26 types of modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region are prepared based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more. and wherein the endogenous immunoglobulin heavy chain, κ light chain and λ light chain genes or gene loci are disrupted.
16. The non-human animal of claim 14 or 15, wherein the animal is a rodent.
17. The non-human animal of claim 16, wherein the rodent is a mouse or a rat.
18. A method for producing an antibody, comprising immunizing the non-human animal according to claim 14 or 15 with a target antigen and obtaining an antibody that binds to the target antigen from the blood of the non-human animal.
19. A method for producing an antibody, comprising: immunizing the non-human animal according to claim 14 or 15 with a target antigen; obtaining spleen cells, lymph node cells, or B cells from the non-human animal that produces an antibody that binds to the target antigen; fusing the spleen cells, lymph node cells, or B cells with myeloma cells to form hybridomas; and culturing the hybridomas to obtain monoclonal antibodies that bind to the target antigen.
20. A method for producing an antibody, comprising: immunizing the non-human animal according to claim 14 or 15 with a target antigen; obtaining B cells from the non-human animal that produces an antibody that binds to the target antigen; obtaining nucleic acid encoding a protein consisting of an antibody heavy chain and light chain, or a variable region thereof, from the B cells; and using the nucleic acid to produce an antibody that binds to the target antigen by DNA recombinant technology or phage display technology.
21. In the production of the mammalian artificial chromosome vector according to any one of claims 1 to 10, a method for substituting a human immunoglobulin heavy chain D region with a modified sequence thereof, (1') providing a mammalian artificial chromosome vector containing human immunoglobulin heavy and light chain loci; (2') deleting the human immunoglobulin heavy chain D region from the mammalian artificial chromosome vector of step (1'); (3') inserting a cassette comprising a first site-specific recombinase recognition site, a promoter, and a second site-specific recombinase recognition site into the deletion site of the D region of the vector obtained in step (2'); (4') inserting, into the second site-specific recombinase recognition site of the cassette inserted in step (3'), a cassette comprising the modified sequence of the human immunoglobulin heavy chain D region, the first site-specific recombinase recognition site, a selection marker, and a second site-specific recombinase recognition site, using a second site-specific recombinase; and (5') By site-specific recombination using a first site-specific recombinase, a cassette containing a first site-specific recombinase recognition site, a modified sequence of the human immunoglobulin heavy chain D region, and a second site-specific recombinase recognition site is inserted into the deletion site of the D region to obtain the artificial chromosome vector. The method comprising:
22. 22. The method of claim 21, wherein the deletion of the human immunoglobulin heavy chain D region is performed by genome editing.
23. A mammalian artificial chromosome vector for use in producing the mammalian artificial chromosome vector of any one of claims 1 to 10, comprising human immunoglobulin heavy chain and light chain loci, wherein the human immunoglobulin heavy chain loci lack a D region, and the mammalian artificial chromosome vector comprises, in place of the deleted D region, a first site-specific recombinase recognition site, a promoter, and a second site-specific recombinase recognition site.
24. The mammalian artificial chromosome vector according to claim 23, wherein the deleted D region is the region from D1-1 to D1-26.
25. The mammalian artificial chromosome vector according to claim 23, wherein the deleted D region is the region from D1-1 to D7-27.
Citation Information
Patent Citations
HCO32 and HCO27, and related examples
JP2010535510A
Transgenic animals and methods of use
JP2013535202A
Antibodies, variable domains, and chains designed for human use.
JP2014529998A
Non-human animals expressing human antibody genes and their use
JP4318736B2
Human antibody-producing non-human animal and method for producing human antibodies using the same
JP6868250B2