Skin tissue
Isolated skin tissue with an epidermis and dermis, produced by administering donor cells to a host embryo, addresses immune rejection and dermal layer construction issues, providing effective skin transplantation for wounds and burns with enhanced tolerance.
Patent Information
- Application Number
- JP2023558075
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-11-05
- Filing Date
- 2022-11-04
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2042-11-04
AI Technical Summary
Existing skin transplantation methods face challenges such as immune rejection, difficulty in constructing a functional dermal layer, and scarring at the donor site, especially in cases of widespread skin damage or burns, where autografting is difficult or undesirable.
The development of isolated skin tissue comprising an epidermis, basement membrane, and dermis, where the epidermis is attached to one side of the basement membrane and the dermis to the other, with the epidermis containing cells capable of differentiating into mature epidermal cells and the dermis lacking this ability, produced by administering donor cells to a host embryo and growing it in a pseudopregnant foster mammal to obtain skin tissue.
This approach enables the creation of functional skin tissue with improved engraftment and reduced immune rejection, suitable for transplantation to repair wounds and burns, utilizing cells with enhanced tolerance to immune rejection through genetic modifications.
Smart Images

Figure 0007748738000002 
Figure 0007748738000003 
Figure 0007748738000004
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to skin tissue, including, by way of non-limiting example, isolated skin tissue comprising an epidermis, a basement membrane, and a dermis, wherein the epidermis is attached to one side of the basement membrane and the dermis is attached to the other side of the basement membrane, and the epidermis comprises first cells and the dermis comprises second cells, the second cells lacking the ability to differentiate into mature epidermal cells. [Background technology]
[0002] Wounds or burns can cause skin damage down to the dermis. Such damage cannot be repaired autonomously, necessitating skin tissue transplantation. Skin transplantation involves autografting, in which skin taken from another body surface is grafted onto the skin defect. While this method has an extremely high survival rate, there are cases in which autografting is difficult due to widespread skin damage. Even when autografting is possible, there is a desire to avoid autografting because scars remain at the site where the skin was harvested.
[0003] In methods involving allogeneic or xenogeneic skin transplantation, permanent engraftment is often not possible due to factors such as immune rejection. Attempts have been made to create cultured skin cell sheets from cells collected from the patient themselves (Non-Patent Documents 1-6). However, the sheets obtained by these methods generally lack a basement membrane or dermis and contain only epidermal cells (i.e., cultured epidermal sheets). Even if such cultured epidermal sheets are transplanted onto the body surface, they are not easily engrafted onto the body surface due to the lack of dermis. Furthermore, attempts have been made to create artificial skin substitutes in vitro, but have not yet succeeded in constructing a functionally thick dermal layer. [Prior art documents] [Non-patent literature]
[0004] [Non-Patent Document 1] Rheinwald JG, Green H. Cell. 1975;6:331-343. [Non-patent document 2] Matsumura H et al. Burns. 2016;42:769-76. [Non-patent document 3] Hefton JM et al. Lancet. 1983;2:428-430. [Non-patent document 4] KatzAB, Taichman LB. J Invest Dermatol. 1994;102:55-60. [Non-Patent Document 5] Sakamoto M et al. Ann Plast Surg. 2017;78(6):651-658. [Non-patent document 6] Sakamoto M et al. PLoS One. 2020;15(8):e0237985. Summary of the Invention
[0005] The present disclosure provides a skin tissue. As a non-limiting example, the present disclosure may provide an isolated skin tissue comprising an epidermis, a basement membrane, and a dermis, wherein the epidermis is attached to one side of the basement membrane and the dermis is attached to the other side of the basement membrane, and the epidermis comprises first cells and the dermis comprises second cells, the second cells lacking the ability to differentiate into mature epidermal cells.
[0006] According to the present disclosure, by administering donor cells capable of differentiating into mature epidermal cells to a host embryo that does not have the ability to differentiate into mature epidermal cells, skin tissue comprising the epidermis, basement membrane, and dermis, in which the epidermis is derived from the donor cells and the dermis is derived from the donor cells and the host cells, is obtained. The present disclosure is based on this finding.
[0007] According to the present disclosure, the following inventions are provided. [1] An isolated skin tissue comprising an epidermis, a basement membrane (or basal lamina), and a dermis, wherein the epidermis is attached to one side of the basement membrane (or basal lamina), and the dermis is attached to the other side of the basement membrane (or basal lamina), and the epidermis comprises the first cells, or preferably consists of the first cells, and the dermis comprises the second cells, and the dermis may further comprise the first cells; The second cell is a skin tissue that has reduced or no differentiation potential into mature epidermal cells. [2] The skin tissue described in [1] above, wherein the cells of the second individual are cells having a functional deficiency in p63. [3] The skin tissue described in [1] or [2] above, wherein the epidermis is mature epidermis. [4] Skin tissue described in any one of [1] to [3] above, in which 95% or more of the epidermal cells (preferably epidermal cells including basal cells) are the first cells, and 75% or more of the dermal cells are the second cells. [5] A method for producing skin tissue, comprising: Providing a host embryo (or a host embryo engineered to be so) that is incapable of (autonomously) developing a mature epidermis; injecting into said host embryo donor cells capable of differentiating into mature epidermis, said injection being carried out under conditions suitable for the cells to engraft into the skin; implanting the resulting embryo in or into the uterus of a pseudopregnant foster mammal and growing it to obtain an individual having a mature epidermis from the mammal; Isolating skin tissue from the obtained individual, including mature epidermis containing cells derived from the donor cells, a basement membrane, and a dermis containing cells derived from the host; A method comprising: [6] The method according to [5] above, wherein the host embryo incapable of developing a mature epidermis is a p63 knockout embryo. [7] The method according to [5] or [6] above, wherein the donor cells capable of differentiating into mature epidermis are cells selected from the group consisting of pluripotent cells and cells destined to become epidermis. [8] The method according to any one of [5] to [7] above, wherein the embryo is at any developmental stage from the 8-cell stage to the blastocyst stage. [9] The method according to any one of [5] to [7] above, wherein the embryo is at any developmental stage from the blastocyst stage to the formation of an epidermis containing K8 / K18-positive cells.
[10] The method according to any one of [5] to [7] above, wherein the embryo has an epidermis of K8 / K18-positive cells.
[0008]
[21] The skin tissue described in any one of [1] to [4] above or the method described in any one of [5] to [7] above, wherein the second cells lack the ability to differentiate into any or all of mature epidermal cells selected from the group consisting of spinous cells, granular cells, and keratinocytes.
[22] The skin tissue described in any one of [1] to [4] above or the method described in any one of [5] to [7] above, wherein the second cells lack the ability to differentiate into all of the mature epidermal cells selected from the group consisting of spinous cells, granular cells, and keratinocytes.
[23] The skin tissue or method described in
[21] above, wherein the second cells have the ability to differentiate into basal cells.
[24] The skin tissue or method described in
[22] above, wherein the second cells have the ability to differentiate into basal cells.
[25] The skin tissue according to any one of [1] to [4] above, the method according to any one of [5] to [7] above, or the skin tissue or method according to any one of
[21] to
[24] above, wherein the first cell has a p63 gene with normal function.
[0009]
[26] Any of the above skin tissues, wherein 95% or more of the epidermal cells are the first cells and less than 5% are the second cells.
[27] Any of the above-mentioned skin tissues, wherein 70% or more of the dermal cells are second cells and less than 30% are first cells.
[28] Any of the above-mentioned skin tissues, wherein 95% or more of the epidermal cells are the first cells and less than 5% are the second cells, and 70% or more of the dermal cells are the second cells and less than 30% are the first cells.
[29] Any of the above skin tissues, wherein 99% or more of the epidermal cells are first cells and less than 1% are second cells, and 90% or more of the dermal cells are second cells and less than 10% are first cells.
[30] Any of the above skin tissues, wherein 99% or more of the epidermal cells are first cells and less than 1% are second cells, and 50% or less of the dermal cells are second cells and 50% or more are first cells.
[31] Any of the above-mentioned skin tissues, wherein 95% or more of the epidermal cells are the first cells and less than 5% are the second cells, and 50% or more of the dermal cells are the second cells and less than 50% are the first cells.
[0010]
[41] A transplant material containing any of the above skin tissues.
[42] The transplant material described in
[41] above for use in skin transplantation in a subject.
[43] The transplant material described in
[42] above, wherein the subject has skin damage due to a burn or wound.
[0011]
[51] The skin tissue described in any one of the above, wherein the first cell is derived from a human and the second cell is derived from a non-human mammal.
[52] The skin tissue according to
[51] above, wherein the first cells are derived from a human and the second cells are derived from a pig.
[53] A skin tissue described in any of the above, wherein the first cells lack either or both of HLA class 1 and class II, thereby improving tolerance to immune rejection in allogeneic transplantation compared to when the expression is not suppressed.
[54] The skin tissue described in
[53] above, wherein both HLA class 1 and class II are deleted in the first cells, thereby improving tolerance to immune rejection in allogeneic transplantation compared to when the expression is not suppressed.
[55] The skin tissue described in
[53] above, wherein either or both of β2 microglobulin and CIITA are knocked out in the first cells, thereby improving tolerance to immune rejection in allogeneic transplantation compared to when the expression is not suppressed.
[56] The skin tissue described in
[54] above, in which both β2 microglobulin and CIITA are knocked out in the first cells, thereby improving tolerance to immune rejection in allogeneic transplantation compared to when the expression is not suppressed.
[57] Skin tissue according to any one of
[53] to
[56] above, in which one or more selected from the group consisting of HLA-G, HLA-E, CD47, and PD-L1 are forcibly expressed, thereby improving tolerance to immune rejection in allogeneic transplantation compared to when the expression is not suppressed.
[58] The skin tissue according to any one of
[53] to
[57] above, wherein one or more or all of HLA-A, HLA-B, and HLA-C selected from the group consisting of HLA-A, HLA-B, and HLA-C are knocked out at only one locus (HLA pseudo-homozygote formation), thereby improving tolerance to immune rejection in allogeneic transplantation compared to when the expression is not suppressed.
[0012]
[61] A product comprising any of the above-described skin tissues and a preservative solution suitable for preserving the skin tissues.
[62] The product according to
[61] above, wherein the preservative solution is physiological saline.
[63] The product according to
[61] above, wherein the preservative solution is a serum-free medium.
[64] The product according to
[63] above, wherein the preservative solution is a scientifically defined medium.
[65] Any of the above products, which contain one or both of an anti-inflammatory agent and an immunosuppressant.
[65] Any of the above products for use in grafting skin grafts.
[0013]
[71] A transplant material comprising the skin tissue according to any one of
[51] to
[54] above, for use in transplanting into a human subject from which the first cells are derived.
[72] A transplant material comprising the skin tissue described in
[53] or
[54] above, for use in transplanting into a human subject that is allogeneic to the human from whom the first cells were derived.
[0014]
[81] A method for producing any of the above skin tissues, transplant materials, or products, comprising: providing a host embryo that is incapable of developing a mature epidermis; injecting into said host embryo donor cells capable of differentiating into mature epidermis, said injection being carried out under conditions suitable for the cells to engraft into the skin; implanting the resulting embryo in or into the uterus of a pseudopregnant foster mammal and growing it to obtain an individual having a mature epidermis from the mammal; isolating skin tissue from the obtained individual, the skin tissue including mature epidermis containing cells derived from the donor cells, a basement membrane, and a dermis containing cells derived from the host; A method comprising:
[0015]
[91] A method for producing a non-human mammalian individual, comprising: A method comprising contacting cells (donor cells) that have the ability to form chimeras and differentiate into mature epidermis, or cells committed to epidermis or epidermal lineage cells, with the body surface of a non-human mammalian individual (host) before basal cells of the epidermis are formed, thereby obtaining a non-human mammalian individual having skin tissue containing host cells and donor cells.
[92] The method according to
[91] above, wherein the non-human mammal is a p63 knockout individual.
[93] The method according to
[91] or
[92] above, wherein the cells (donor cells) having the ability to form chimeras and the ability to differentiate into mature epidermis or cells committed to epidermis or epidermal lineage cells are human cells.
[94] The method according to any one of
[91] to
[93] above, wherein the non-human mammal is a mouse or a pig.
[95] The method according to any one of
[91] to
[94] above, wherein the cells capable of forming chimeras and capable of differentiating into mature epidermis or cells committed to epidermis or epidermal lineage cells (donor cells) are human cells, and the non-human mammalian individual is a mouse or a pig.
[96] The method according to any one of
[91] to
[95] above, wherein the host cells and the donor cells are contained in the dermis.
[97] The method according to any one of
[91] to
[94] above, wherein the host cells and the donor cells are contained in the epidermis and the dermis, respectively.
[98] The method according to any one of
[91] to
[97] above, wherein the contacting is carried out by injecting the donor cells into the amniotic cavity of the host.
[99] The method according to any one of
[91] to
[98] above, wherein the contact or injection is carried out by transuterine administration.
[0016]
[0101] 1. A method for producing a non-human mammalian individual, comprising: A method comprising contacting cells (donor cells) that have the ability to form chimeras and differentiate into mature epidermis, or cells committed to epidermis or epidermal lineage cells, with the body surface of a non-human mammalian individual (host) before basal cells of the epidermis are formed, thereby obtaining a non-human mammalian individual having epidermis containing donor cells.
[0102] The method described in
[0101] above, wherein the non-human mammalian individual is a p63 knockout individual.
[0103] The method described in
[0101] or
[0102] above, wherein the cells (donor cells) that have the ability to form chimeras and differentiate into mature epidermis or cells committed to epidermis or epidermal lineage cells are human cells.
[0104] A method according to any one of
[0101] to
[0103] above, wherein the non-human mammal is a mouse or a pig.
[0105] A method according to any one of the above
[0101] to
[0104] , wherein the cells (donor cells) that have the ability to form chimeras and to differentiate into mature epidermis or cells committed to epidermis or epidermal lineage cells are human cells, and the non-human mammalian individual is a mouse or a pig.
[0106] A method according to any one of the above
[0101] to
[0105] , wherein the contacting is carried out by injecting the donor cells into the amniotic cavity of the host.
[0107] The method according to any one of
[0101] to
[0106] above, wherein the contact or injection is carried out by transuterine administration or intra-amniotic administration. [Brief explanation of the drawings]
[0017] [Figure 1] Figure 1 shows the appearance of p63 knockout mice at E18.5. [Figure 2] Figure 2 shows a scheme for producing p63 knockout embryos, injecting pluripotent cells (in this figure, GFP-positive embryonic stem cells (ESCs) are used) into the embryos, transplanting them into pseudopregnant foster mice, and obtaining chimeric embryos. [Figure 3] Figure 3 shows optical micrographs of a wild-type (WT) mouse fetus and an E19.5 chimeric embryo, as well as fluorescence micrographs of the GFP-derived fluorescence in the embryo. Fluorescence from the GFP-derived fluorescence is mainly detected on the body surface. [Figure 4] Figure 4 shows the left and right appearances of the chimeric embryo at E19.5 and a fluorescence microscope image of the GFP-derived fluorescence from the body surface (left and right) of the embryo. The numbers in the figure correspond to the individual numbers in Table 1. [Figure 5] FIG. 5 is a graph plotting the relationship between the chimeric contribution rate (chimerism) of donor cells in the spleen and the body surface area (proportion to the total surface area) on which epidermis is formed. [Figure 6]Figure 6 shows GFP-derived fluorescent images of the body surface after 7 and 56 days of skin tissue transplantation. In this experiment, skin tissue was isolated from newborn chimeras obtained by growing chimeric embryos and transplanted onto the area where the skin tissue of another mouse had been excised. [Figure 7A] FIG. 7A shows a fluorescence microscopy image (GFP, CK8 / K18, and p63) of the epidermis of a chimeric embryo. [Figure 7B] FIG. 7B is an image obtained by superimposing the images in FIG. 7A. [Figure 7C] FIG. 7C illustrates how the host cells in FIG. 7B are pushed aside by the donor cells, and the skin surface is occupied by the donor cells. [Figure 8A] FIG. 8A shows a fluorescent micrograph of a portion of the body surface of a chimeric embryo at E18.5. [Figure 8B] Figure 8B is a superimposed image of the image in Figure 8A. The expelled host cells are located further outside the outermost layer of the skin and are not left within the skin tissue. [Figure 9A] FIG. 9A shows the appearance of an E16.5 chimeric individual obtained by transplanting GFP-positive human HaCaT cells into the amniotic cavity of an E13.5 p63 knockout mouse embryo. [Figure 9B] FIG. 9B is an enlarged image of the square box in FIG. 9A. [Figure 9C] FIG. 9C shows a fluorescent microscopic image of the chimeric individual in FIG. 9A. [Figure 10A] FIG. 10A shows the relationship between the chimerism rate of embryos and the surface coverage rate of the formed skin. [Figure 10B] FIG. 10B is a fluorescence micrograph of a skin section from a chimeric embryo generated from a p63KO embryo and donor embryonic stem cells. [Figure 11A] FIG. 11A shows a fluorescence microscopic image of the epidermis of a wild-type embryo and a chimeric embryo generated from donor embryonic stem cells. [Figure 11B] FIG. 11B shows a fluorescence microscopic image of the epidermis of a chimeric embryo generated from a p63KO embryo and donor embryonic stem cells. [Figure 12]FIG. 12 shows the results of skin engraftment after transplantation of the skin tissue of the present disclosure. [Figure 13] FIG. 13 shows the results of constructing human epidermis on a mouse subject using the method of the present disclosure. Detailed Description of the Invention
[0018] As used herein, "subject" refers to a mammal, including, but not limited to, rodents such as mice and rats, livestock animals such as pigs, goats, llamas, sheep, and cows, pets such as dogs and cats, birds such as chickens, and primates such as monkeys. As used herein, an animal may be a non-human animal.
[0019] As used herein, the term "SCC chimeric animal" refers to an animal having tissues or organs in which cells from one individual and cells from another individual (e.g., allogeneic cells, or allogeneic or allogeneic cells that have been subjected to one or more genetic manipulations) are mixed at the cellular level. In the present invention, SCC chimeric animals can be obtained by introducing multiple (e.g., approximately 10) pluripotent cells into an embryo (e.g., a morula or blastocyst). More specifically, various embryos, from the 8-cell stage to the blastocyst stage, can be used, and methods for introducing pluripotent cells into such animal embryos are well known to those skilled in the art. When introducing cells into a blastocyst-stage embryo, the cells can be introduced, for example, into the blastocyst cavity. For early embryos up to the morula stage, the cells can be aggregated by contact. SCC chimeric animals can also be obtained by administering cells into the amniotic fluid of a fetus. In this embodiment, skin epithelial cells can be administered into the amniotic fluid. Pluripotent cells include pluripotent stem cells such as ES cells and iPS cells, and pluripotent cells such as inner cell mass (ICM), which can be introduced into embryos in the present invention. The number of pluripotent stem cells to be introduced into an embryo can also be determined appropriately and is not particularly limited, but can be, for example, about 3 to 10 when introduced into an embryo. In this specification, a "somatic cell chimeric animal" may be simply referred to as a "chimera."
[0020] As used herein, the term "host animal" refers to an individual such as an embryo (hereinafter also referred to as a "host embryo") into which cells such as pluripotent cells are introduced when producing a somatic chimeric animal.
[0021] As used herein, the term "embryo-introduced cells" refers to cells (hereinafter also referred to as "donor cells") that are introduced into an individual such as an embryo when producing a somatic cell chimeric animal.
[0022] As used herein, the term "pluripotent cells" refers to pluripotent stem cells such as ES cells and iPS cells, as well as pluripotent cells such as inner cell mass (ICM). Pluripotent cells are known to be capable of differentiating into almost all cells of a fetus or adult.
[0023] As used herein, "genetic manipulation" refers to genetic modification. As used herein, modification of gene expression refers to modification that results in enhanced or attenuated gene expression. Attenuation of gene expression can be achieved by gene disruption.
[0024] As used herein, "genetic modification" refers to a gene that is different from the wild type, including artificial modification. Representative examples of genetic modification include transgenics and knockout. In knockout, for example, but not limited to, a mutation such as a nonsense mutation or a frameshift mutation is introduced into the target gene, or the regulatory region of the target gene is disrupted to induce functional loss of the target gene. In knockout, an exogenous gene such as a marker gene may be introduced into the target gene or to replace the target gene.
[0025] As used herein, "comprises" means that the listed components are included and that unlisted components may or may not be included. As used herein, "consists of" means that the listed components are included and that unlisted components may be included to an unavoidable extent.
[0026] As used herein, "epithelium" refers to tissues that cover the outer surface of an animal, as well as the interior of body cavities or organs. As used herein, "skin" refers to tissues that cover the outer surface of an animal. Skin is composed of an epidermal epidermis and an underlying dermis, a connective tissue system. The epidermis is primarily composed of keratinocytes. Keratinocytes originate from a single layer of basal cells containing keratinocyte stem cells. As they mature, they migrate to the surface, resulting in layers of keratinocytes with different morphologies depending on the stage of maturation (e.g., the basal layer (a layer consisting of basal cells), the spinous layer, the granular layer, and the stratum corneum). Approximately 95% of the epidermis is keratinocytes, while the remaining 5% consists of Langerhans cells and Merkel cells, which are involved in immunity and perception. The epidermis normally does not contain blood vessels or nerves. Skin has a basement membrane just below the epidermis. The basement membrane, which has a basal lamina and a zona pellucida, is interposed between the epidermis and dermis. Basal cells adhere to the basal lamina via the zona pellucida on the side opposite the dermis (epidermal side), causing active cell division. The epidermis and dermis are strongly bound together via the basement membrane. Keratinocytes are firmly connected to each other by structures responsible for intercellular adhesion, such as desmosomes, and it is thought that the basement membrane and basal cells are bound together via the zona pellucida by hemidesmosomes. The dermis is a layer of skin that consists of the dermal papilla and reticular dermis, located between the epidermis and subcutaneous tissue. The dermis is primarily composed of fibrous connective tissue. Approximately 70% of the dermis is collagen, with the remainder composed of fibers such as elastic fibers (elastin), extracellular matrix, and hyaluronic acid. The dermis contains organs such as blood vessels, lymphatic vessels, sweat glands, and hair follicles. The dermis also contains fibroblasts that produce collagen fibers, macrophages involved in immunity and inflammation, mast cells, and plasma cells. Deeper than the dermis lies the subcutaneous tissue. The epidermis is derived from the ectoderm, while the dermis is mainly composed of fibroblasts, which are derived from the mesoderm, and are therefore developmentally distinct. In addition to fibroblasts, the dermis also contains blood vessels and nerves, but it is believed that the blood vessels are derived from the endoderm and the nerves are derived from the ectoderm. The above is thought to be the general structure of human epithelium and skin.
[0027] According to the present disclosure, a skin tissue can be provided. The skin tissue includes an epidermis, a basement membrane, and a dermis. The epidermis is attached to one side of the basement membrane (the basal cells on that side), and the dermis is attached to the other side of the basement membrane (the basal lamina). A zona pellucida can be interposed between the dermis and the basal lamina. By laminating the epidermis, basement membrane, and dermis to form a structure, the skin tissue can have higher mechanical strength than a structure consisting of only the epidermis. The skin tissue provided by the present disclosure can be used as a graft material for skin transplantation. In the graft material, the epidermis is preferably made of autologous or allogeneic cells, while the dermis may contain allogeneic or xenogeneic cells. In a preferred embodiment, the epidermis is made of autologous cells, and more preferably, the autologous cells do not contain foreign substances (e.g., foreign genes, products of foreign genes, and other antigenic substances). This is because such a graft material can survive in an individual after transplantation.
[0028] In the skin tissue of the present disclosure, the epidermis contains a first cell and the dermis contains a second cell. The epidermis is derived from the ectoderm, while the dermis is derived from the mesoderm, and thus they are developmentally different. Thus, the epidermis contains ectodermal cells, and the dermis contains mesodermal cells. Thus, the first cell can be an ectodermal cell, and the second cell can be a mesodermal cell. Furthermore, the first cell has the ability to differentiate into mature epidermal cells, but the second cell does not have the ability to differentiate into mature epidermal cells due to genetic modification, gene knockdown, or the like. In a preferred embodiment, the second cell does not have the ability to differentiate into any or all of the cells selected from the group consisting of basal cells, keratinocytes, granular cells, and spinous cells. In one embodiment, the second cell may or may not have the ability to differentiate into basal cells. According to the examples described below, if the second cell does not have the ability to differentiate into mature epidermal cells, the cell can be replaced by the first cell even if the second cell has the ability to differentiate into basal cells. Thus, the basal cell can include the first cell. In a preferred embodiment, the first cell has an allogeneic relationship with the second cell. In a preferred embodiment, the first cell has a xenogeneic relationship with the second cell. For example, the first cell can be derived from a human, and the second cell can be derived from a mammal selected from the group consisting of primates, pigs, goats, sheep, llamas, and cattle (e.g., the second cell can be pigs). As used herein, the term "cells capable of differentiating into mature epidermal cells" refers to cells that have differentiated into mature epidermal cells, in addition to undifferentiated cells capable of differentiating into mature epidermal cells.
[0029] In a preferred embodiment, the first cells may have the ability to differentiate into one or more or all of the cells selected from the group consisting of basal cells, keratinocytes, granular cells, and spinous cells. Also, in a preferred embodiment, the second cells have reduced, or preferably no, ability to differentiate into mature epidermal cells. In a preferred embodiment, the first cells have the ability to differentiate into one or more or all of the cells selected from the group consisting of basal cells, keratinocytes, granular cells, and spinous cells, and the second cells have reduced, or preferably no, ability to differentiate into any or all of the cells selected from the group consisting of keratinocytes, granular cells, and spinous cells. In this embodiment, the second cells may have the ability to differentiate into basal cells.
[0030] In a preferred embodiment, the first cell has the ability to differentiate into one or more or all of the cells selected from the group consisting of basal cells, keratinocytes, granular cells, and spinous cells, and the second cell can be a cell with a functional deficiency of p63. In a preferred embodiment, the first cell has a p63 gene with normal function. In this way, substantially all cells in the epidermis can be derived from the first cell. The dermis can be a chimera of the first cell and the second cell.
[0031] The epithelium of p63-deficient individuals has a single layer of cells expressing keratin K8 / K18 on a basement membrane, and no further development progresses (see Shalom-Feuerstein et al., Cell Death Differ., 18:887-896, 2011, incorporated herein by reference in its entirety). When donor cells capable of differentiating into epidermis are introduced into p63-deficient embryos and allowed to develop, the host cells on the basement membrane are almost completely removed, and nearly 100% or 100% of the epidermis is donor cell-derived (the epidermis is composed of donor cell-derived cells). The skin obtained in this manner can be preferably used as the skin of the present disclosure. Recent advances in genome editing technology have made it possible to edit the genomes of various mammalian embryos, including primates, livestock, and pets, and to disrupt p63. Thus, by appropriately generating p63KO animal embryos or individuals having an epidermis composed of human cells, the skin of the present disclosure can be obtained in which the first cells are human cells and the second cells are cells from any mammal, such as a primate, livestock, or pet animal.
[0032] A functional defect of p63 can be generated by disrupting or knocking down the p63 gene. Disruption of the p63 gene can be achieved by one or more of the following: disruption of the regulatory region of the p63 gene; introduction of a nonsense mutation, a frameshift mutation, or a missense mutation into the p63 gene; and introduction of a knockout cassette into the coding region. Disruption of the p63 gene or introduction of a knockout cassette can be achieved by those skilled in the art using, for example, genome editing techniques. Genome editing techniques include TALE nucleases (TALENs), zinc finger nucleases (ZFNs), and the CRISPR / Cas9 system, and these techniques can be used to generate cells with a functional defect of p63. More specifically, a target region is defined within the p63 gene, and a TALEN, ZFN, or CRISPR / Cas9 designed to cleave the target region is introduced into the cell to cleave the target region. When the cleaved target region is repaired by the cell's self-repair mechanism, the cut ends are religated. However, during this repair process, random deletion of base sequences can occur, resulting in nonsense mutations and frameshift mutations. Furthermore, if donor DNA containing a knockout cassette is present during this repair process, the genomic DNA incorporates the donor DNA, thereby enabling gene disruption. The donor DNA has an upstream homology arm with a sequence homologous to the upstream region of the cleavage site and a downstream homology arm with a sequence homologous to the downstream region of the cleavage site, and the knockout cassette is contained between the upstream and downstream homology arms. The knockout cassette may contain, for example, a selectable marker gene (e.g., a drug selection marker gene or a gene encoding a visualization marker such as a fluorescent protein) for selecting cells into which the knockout cassette has been inserted. In this way, those skilled in the art can obtain cells containing a disrupted gene using genome editing techniques designed to appropriately cut the target region. Alternatively, introduction of the knockout cassette may be performed by classical homologous recombination. Whether the p63 gene has been disrupted can be confirmed by sequencing the target region.Whether the p63 gene is disrupted can also be confirmed by testing whether the cells have the ability to differentiate into mature epidermis. This can be confirmed by obtaining p63 knockout individuals using ES cells carrying the disrupted gene (p63 knockout ES cells) or fertilized eggs carrying the disrupted gene, and then confirming the formation of epidermis.
[0033] In one aspect, the present disclosure provides an isolated skin tissue comprising an epidermis, a basement membrane, and a dermis, wherein the epidermis is attached to one side of the basement membrane and the dermis is attached to the other side of the basement membrane, and the epidermis comprises first cells and the dermis comprises second cells, the second cells lacking the ability to differentiate into mature epidermal cells. In a preferred aspect, the first cells may have a normally functional p63 gene, and the second cells may have a functional deficiency in p63, e.g., a disrupted p63 gene.
[0034] In this embodiment, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more of the cells of the epidermis (particularly keratinocytes, which may include the basal layer (a layer consisting of basal cells), the spinous layer, the granular layer, and the stratum corneum) may be composed of the first cells. Also, 60% or more, preferably 70% or more, more preferably 80% or more, even more preferably 90% or more, even more preferably 95% or more, 96% or more, 97% or more, 98% or more, and particularly preferably 99% or more of the dermis may be composed of the second cells. The contribution rate of the first cells to the dermis is thought to depend on the chimera-forming ability of the first cells in the embryo. Even if the chimera-forming ability of the first cells in the embryo is low, the chimera-forming ability of the first cells in the keratinocytes can be maintained at a high value, while the chimera-forming ability in tissues other than the epidermis can be kept low, which is preferable.
[0035] In a preferred embodiment, in the skin tissue of the present disclosure, 95% or more of the cells in the epidermis are first cells, and 75% or more of the cells in the dermis are second cells.In a preferred embodiment, in the skin tissue of the present disclosure, 99% or more of the cells in the epidermis are first cells, and 95% or more of the cells in the dermis are second cells.In a preferred embodiment, in the skin tissue of the present disclosure, 99% or more of the cells in the epidermis are first cells, and 99% or more of the cells in the dermis are second cells.
[0036] In the skin tissue of the present disclosure, the first cell is derived from the donor cell described below, and the second cell is derived from the host embryo described below. Therefore, the technical requirements for the donor cell and the host embryo can be applied to the technical requirements for the first cell and the second cell, respectively.
[0037] According to the present disclosure, there is provided a composition comprising first cells for use in producing a skin tissue of the present disclosure in which 99% or more of the epidermal cells are first cells and 99% or more of the dermal cells are second cells. Also according to the present disclosure, there is provided a composition comprising second cells for use in producing a skin tissue of the present disclosure in which 99% or more of the epidermal cells are first cells and 99% or more of the dermal cells are second cells. Also according to the present disclosure, there is provided a kit for use in producing a skin tissue of the present disclosure in which 99% or more of the epidermal cells are first cells and 99% or more of the dermal cells are second cells, the kit comprising first cells and second cells. In the kit, it is preferred that the first cells and the second cells are contained in separate containers.
[0038] According to the present disclosure, a transplant material comprising the skin tissue of the present disclosure may be provided. The transplant material of the present disclosure may be used to repair wounds. The transplant material of the present disclosure may be used to treat body surfaces with burns. If necessary, the damaged skin may be excised, and the transplant material of the present disclosure may be transplanted onto the body surface from which the skin has been excised. The transplant material of the present disclosure may also be used to treat skin diseases such as intractable ulcers and bullous diseases. The transplant material of the present disclosure may further be used to screen active pharmaceutical ingredients (e.g., compounds) for use in the treatment of burns, cosmetics, skin tumors, etc.
[0039] According to the present disclosure, a method for producing the skin tissue of the present disclosure (hereinafter referred to as the "method for producing the skin tissue of the present disclosure") is provided.
[0040] The method for producing a skin tissue of the present disclosure includes providing a host embryo. The host embryo is an embryo that has reduced, or preferably does not have, the ability to differentiate into mature epidermal cells. In one embodiment, the host embryo has been genetically engineered (e.g., by gene knockout or knockdown) to reduce, or preferably not have, the ability to differentiate into mature epidermal cells. The host embryo is a source of second cells for the skin tissue of the present disclosure. The method for producing a skin tissue of the present disclosure may include injecting donor cells that have the ability to differentiate into mature epidermal cells into the host embryo to form a chimeric individual. The injection may be performed under conditions suitable for the donor cells to take root in the skin.
[0041] The donor cells may be, for example, pluripotent cells. The donor cells may also be, for example, cells capable of differentiating into mature epidermis (e.g., stem cells and progenitor cells) or cells committed to epidermis or epidermal lineage cells (e.g., keratinocytes such as epidermal stem cells, basal cells, spinous cells, granular cells, and keratinocytes). The donor cells may preferably be pluripotent cells. The donor cells may also preferably be cells capable of differentiating into mature epidermis or cells committed to epidermis or epidermal lineage cells, particularly epidermal stem cells or basal cells. Any cells capable of differentiating into mature epidermis may be used as donor cells, except in cases where engraftment is significantly inhibited and donor cell-derived epidermis is not formed. As long as the cells have the ability to differentiate into mature epidermis, cells at various stages of differentiation can be used as donor cells. This is evident from the fact that skin having an epidermis composed of donor cells can be obtained using pluripotent stem cells as donor cells, and that skin having an epidermis composed of donor cells can also be obtained using HaCaT cells as donor cells. Furthermore, by contacting donor cells with a host embryo before the formation of basal cells (e.g., CK8 / K18-positive cells) of the host embryo, basal cells and epidermis can be formed from cells derived from the donor cells. Donor cells can be autologous or allogeneic, preferably autologous, and more preferably unmodified autologous. Unmodified means that they have not been transformed (e.g., modified by genetic recombination). When donor cells are allogeneic, they can preferably be resistant to immune rejection (i.e., have improved tolerance to immune rejection). Donor cells preferably lack either or both of HLA class I and class II in their genomic DNA, thereby improving tolerance to immune rejection in allogeneic transplants. HLA class I deletion can be achieved by knockout of β2-microglobulin or knockout of HLA class I. HLA class II deletion can be achieved by knockout of CIITA or knockout of HLA class II.Moreover, overexpression or forced expression of one or more genes selected from the group consisting of HLA-G, HLA-E, CD47, and PD-L1 can improve tolerance to immune rejection in allogeneic transplantation compared to when their expression is not suppressed. Furthermore, knocking out one or more or all genes selected from the group consisting of HLA-A, HLA-B, and HLA-C at only one locus (HLA pseudohomozygote formation) can also improve tolerance to immune rejection in allogeneic transplantation compared to HLA heterozygotes. Donor cells may also be knocked in with a suicide gene linked to the control of an inducible promoter to enable active elimination after transplantation for some reason.
[0042] In a preferred embodiment, multiple donor cells can be contacted with (or administered to) one host embryo. The number of donor cells administered to one host embryo can be, for example, about 3 to 10, such as 3 to 5, 5 to 7, or 8 to 10.
[0043] Donor cells may have low chimera-contributing potential (chimera-forming potential). For example, as long as they have chimera-forming potential, they may have a chimera-contributing rate of 50% or less, 40% or less, 30% or less, 20% or less, 15% or less, 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less. Chimera-contributing potential can be determined as the proportion of donor-cell-derived cells among the total cells of an individual or a portion of an individual (e.g., a specific organ) in a chimeric individual developed by injecting donor cells into a normal embryo (e.g., a blastocyst stage of a normal embryo). If donor cells have low chimera-contributing potential, their contribution to tissues other than the epidermis may be limited. This is preferable because it can alleviate ethical issues.
[0044] When the host embryo is at the 8-cell to blastocyst stage, the donor cells can be mixed with the cells of the host embryo or injected into the blastocyst cavity of the host embryo. When the host embryo is at the blastocyst stage or later, the donor cells can be administered into the amniotic cavity, thereby bringing the donor cells into contact with the surface of the host embryo. These injection methods are merely examples, and various other injection methods exist. Those skilled in the art can select or determine an appropriate injection method to use in the methods of the present disclosure.
[0045] The host embryo (referred to herein as a "chimeric embryo") into which the donor cells have been injected or administered can be transplanted into the uterus of a pseudopregnant foster mammal, where it can be allowed to engraft and then grow. The pseudopregnant foster mammal is preferably of the same species as the host embryo. This can promote the engraftment of the host embryo into the uterus.
[0046] The resulting chimeric embryo may have skin tissue comprising the epidermis, basement membrane, and dermis. By further growing the resulting chimeric embryo, the epidermis matures and develops into an epidermis comprising a stratum corneum, a granular layer, and a spinous layer. From the resulting chimeric embryo or a chimeric individual obtained by further growing the chimeric embryo, skin tissue comprising the epidermis, basement membrane, and dermis, preferably skin tissue comprising mature epidermis, basement membrane, and dermis, can be isolated. Isolation can be performed by physical excision.
[0047] The isolated skin tissue can be stored in an appropriate solution, such as physiological saline or a liquid medium, under suitable conditions (e.g., oxygen concentration, carbon dioxide concentration, and temperature conditions). The oxygen concentration can be, for example, about 20%, the carbon dioxide concentration can be 0 to about 5%, and the temperature condition can be 0 to about 37°C (particularly, body temperature).
[0048] In some embodiments, the host embryo can be a non-human mammal embryo. In some embodiments, the donor cells can be human cells or non-human mammal cells. In some embodiments, the host embryo can be a pig embryo, and the donor cells can be human cells. As shown in the Examples below, cell engraftment has been confirmed between mice and humans, which are evolutionarily more distant than between pigs and humans. Therefore, human cells can be introduced into many non-human mammal embryos to form chimeric embryos or chimeric individuals. Human cells can be derived from the recipient's skin, but preferably from organoids with human epidermis, including, but not limited to, organoids obtained by the method described in Lee, J. et al. Nature 582, 399-404, 2020. In this way, human cells that are allogeneic to the recipient (particularly cells capable of differentiating into mature epidermis) can be obtained. Furthermore, when introduced into the host embryo before the immune system is established, allogeneic or xenogeneic cells can engraft into the embryo without immune rejection. However, inflammation may occur in the skin after birth (see WO2018 / 139502A). Therefore, before inflammation is observed in the skin tissue of the present disclosure after birth, the skin tissue can be treated with an anti-inflammatory agent or an immunosuppressant. After inflammation is observed in the skin tissue of the present disclosure after birth, the skin tissue can also be treated with an anti-inflammatory agent or an immunosuppressant.
[0049] Immunosuppressants include, but are not limited to, calcineurin inhibitors such as cyclosporine and tacrolimus, mTOR inhibitors such as rapamycin and everolimus, antimetabolites such as azathioprine, mizoribine, methotrexate, mycophenolate mofetil, and leflunomide, and alkylating agents such as cyclophosphamide, and can be used in the present invention. Anti-inflammatory agents include, but are not limited to, steroidal anti-inflammatory drugs (SAIDs) and non-steroidal anti-inflammatory drugs (NSAIDs), and can be used in the present invention. Steroids include cortisol, prednisolone, triamcinolone, beclomethasone, betamethasone, fluticasone, dexamethasone, and hydrocortisone, and can be used in the present invention. Other anti-inflammatory agents include inflammatory cytokine inhibitors such as anti-inflammatory cytokine antibodies, e.g., anti-TNF-α antibodies, and soluble cytokine antibodies, e.g., soluble TNF receptors, and can be used in the present invention. In one embodiment of the present invention, a steroidal anti-inflammatory agent that functions as both an immunosuppressant and an anti-inflammatory agent can be preferably used. In the present invention, sufficient effects can be expected simply by suppressing either the immune response or inflammation.
[0050] The skin tissue of the present disclosure can be preserved in physiological saline or a medium containing an anti-inflammatory agent and / or an immunosuppressant, and then transplanted into an individual (referred to herein as a "recipient") (e.g., a human) in need of skin tissue. Due to the presence of the dermis, the transplanted skin tissue can regenerate skin on the recipient's body surface in the presence of an anti-inflammatory agent and / or an immunosuppressant. On the recipient's body surface, cells derived from the host embryo are expected to be removed over time and replaced by recipient cells. Therefore, after a sufficient amount of time has passed after transplantation, skin regeneration can be expected in the recipient.
[0051] Therefore, the donor cells may preferably be recipient-derived cells (preferably recipient-derived induced pluripotent cells from the viewpoint of ease of acquisition), and the obtained transplant material containing skin tissue may be used for transplantation into the recipient. [Example]
[0052] Materials and Experimental Methods 1) Pluripotent stem cells Mouse embryonic stem cells (ESCs) were established from C57BL / 6N mice and C57BL / 6N-Tg (CAG-EGFP) mice (line names: B6ES2 and SGE2), respectively. Rat ESCs were established from BN rats (line name: BN2i-4). ESCs were cultured using mitomycin C-treated mouse embryonic fibroblasts as feeders. Culture medium was N2B27 medium supplemented with 1 μM PD0325901, 3 μM CHIR99021, and 1000 U / ml mouse leukocyte inhibitory factor (LIF).
[0053] 2) HaCaT cells HaCaT cells were purchased from Cell Lines Service and cultured in Cnt-07 (CellnTEC) medium. For fluorescent labeling, BN2i-4 and HaCaT cells were transfected with a lentiviral vector carrying an EGFP expression cassette under the control of the CAG promoter. After transfection, only the GFP (+) population was sorted using a flow cytometer (BD, FACS Aria III), and GFP-positive cells were used in the experiments. Hereafter, the fluorescently labeled cells are referred to as "BN2i-4-EGFP" and "HaCaT-EGFP."
[0054] 3)Animals Slc:ICR mice, C57BL / 6N-Tg(CAG-EGFP) mice, DBA / 2CrSlc mice, and BN / SsNSlc rats were purchased from Japan SLC and used in the experiments. All animal experiments were approved by the Ethics Committee of the Institute of Medical Science, The University of Tokyo, and were conducted in accordance with established guidelines.
[0055] 4) Creation of p63 mutant chimeric animals To generate p63 knockout embryos, we generated zygotes with small deletions and insertions using CRISPR / Cas9 genome editing. First, one-cell zygotes were collected from ICR females (0.5 dpc) that had a confirmed vaginal plug after natural mating. The zygotes were cultured in KSOM / AA medium for several hours and then electroporated in a ribonucleoprotein (RNP)-containing electrode solution. The RNP-containing electrode solution was prepared by mixing Opti-MEM medium (Thermo) with a final concentration of 2.94 μM sgRNA (IDT, Alt-R™ CRISPR-Cas9 sgRNA, which recognizes the base sequence CACGGATAACAGCGCCCTGT in exon 5 of p63) and a final concentration of 0.61 μM Cas9 protein (IDT, Alt-R™ Sp Cas9 Nuclease). To obtain p63 mutant chimeras, the zona pellucida of fertilized eggs cultured to the 8-cell stage after p63 gene disruption was perforated (using a piezo or laser perforation device), and donor ESCs (SGE2 or BN2i-4-CAG-EGFP) were microinjected into the perivitelline space at 2–5 cells per embryo. The injected chimeric embryos were cultured in KSOM / AA medium until embryo number 1 was reached, and then transferred to the uterus of pseudopregnant mice to generate chimeric fetuses. In the skin grafting experiments, we used fertilized eggs (BDF1-EGFP) obtained by in vitro fertilization of C57BL / 6N-Tg (CAG-EGFP) eggs and DBA2 sperm instead of ICR mouse fertilized eggs. We then injected these fertilized eggs with B6ES2 derived from C57BL / 6N mice to generate chimeric embryos.
[0056] 5) Genotyping Tail sections from p63 mutant mice were collected and lysed in Proteinase K-containing lysis buffer (20 mM Tris-HCl, 100 mM NaCl, 5 mM EDTA, 0.1% SDS). After heating at 60°C for 5 minutes to 24 hours, Proteinase K was inactivated by heating at 98°C for 2 minutes to obtain genomic DNA extracts. Primers (CACGTTTGTACAAGCCAGAACTTA, TCTTTTGGT CTTCCCGAGCCT) were designed to flank the mutation region, and the target sequence was amplified by PCR. The nucleotide sequence was confirmed by Sanger sequencing, and genotypes were determined by TIDE analysis (doi:10.1093 / nar / gku936). For chimera fetuses, host splenic lymphocytes (GFP- / CD45+ / DAPI- or GFP+ / CD45+ / DAPI-) were sorted using a flow cytometer and genotyped in the same manner. In subsequent experiments, individuals in which frameshift mutation alleles or large deletion alleles of 50 base pairs or more accounted for 90% or more of the total alleles were analyzed.
[0057] 6) Intrauterine injection Pseudopregnant mice (E13.5) implanted with p63 mutant embryos under isoflurane inhalation anesthesia underwent laparotomy to expose the uterus. The uterine wall was punctured with a glass needle, and HaCaT-EGFP was injected into the amniotic cavity with 5 μl of medium. The abdomen was then closed. On day 3 after implantation, p63 mutant embryos were excised and examined for cell engraftment under a fluorescent microscope. Skin samples were collected and evaluated pathologically.
[0058] 7) Skin graft To harvest the skin grafts, pseudopregnant mice (E18.5) implanted with p63 mutant chimera embryos were subjected to cesarean section to remove the fetuses. Mice normally give birth on day 19.5 of gestation, which corresponds to the day before birth. The chimera fetuses were identified under a fluorescent microscope, and skin samples were removed from the p63 mutant chimera fetuses and manually separated with scissors. Full-thickness skin was removed from the flanks of recipient mice (8-12 week old C57BL / 6N mice) or recipient rats (3-6 week old BN rats), and the grafts were sutured with nylon thread. Gauze was placed on the graft and tied over with nylon thread. After fixation, the entire circumference of the mouse's trunk was fixed with tape. The fixation was removed on the 7th day after transplantation, and the graft site was then observed over time to evaluate survival. Control groups for the allograft experiment included a group in which skin from a p63 mutant chimera fetus was grafted onto BDF1-GFP (positive control 1), a group in which skin from a WT-chimera fetus created by injecting B6ES2 into BDF1-EGFP fertilized eggs was grafted onto C57BL / 6N-Tg (CAG-EGFP) (negative control 1), and a group in which skin from a BDF1-EGFP fetus was grafted onto BDF1-EGFP (positive control 2). Skin from BDF1-EGFP fetuses was transplanted onto C57BL / 6N-Tg (CAG-EGFP) rats (negative control 2), and skin grafting experiments were performed on each group. For the xenografting experiments, tacrolimus (a calcineurin inhibitor, an immunosuppressant that primarily targets T cell immunity) was administered intraperitoneally at 0.5 μg per gram of rat body weight from the day of skin grafting until postoperative day 14. Control groups included a group in which skin from C57BL / 6N-Tg (CAG-EGFP) rats was transplanted onto BN rats (negative control), and a group in which skin from BN fetuses was transplanted onto BN rats (positive control), and both groups underwent skin grafting experiments.
[0059] 8) Chimerism analysis Chimerism analysis of epidermal (keratinocytes, melanocytes), dermal (fibroblasts), and splenic lymphocytes was performed using flow cytometry. Epidermis was harvested by removing the dermis from skin that had been selectively treated with basement membrane treatment after incubation in CnT-07 medium supplemented with 25 U / ml dispase II (Thermo) at 4°C for 12 hours. Among the epidermal cell fraction negative for the pan-hemocyte marker CD45 and the dead cell stain PI, CD49f(+) cells were identified as keratinocytes, and CD117(+) cells were identified as melanocytes. Chimerism was measured based on the GFP positivity rate. The keratinocytes obtained in this manner are thought to include basal cells, granular cells, spinous cells, and keratinocytes. For the dermis, finely sliced dermal pieces were cultured in dishes containing DMEM high glucose + 10% FBS for several days, and the attached cells were analyzed. After pipetting, the spleen was hemolyzed with ACK buffer, and CD45 (+) was analyzed as leukocytes.
[0060] 9)Histological analysis Chimeric fetuses (E8.5, E14.5, E18.5) and skin grafts (14, 28, and 90 days after surgery) were harvested and immersed overnight in 4% PFA. Paraffin blocks and sections were prepared according to the standard procedure. For immunostaining, the specimens were deparaffinized stepwise using xylene and ethanol, followed by antigen inactivation using citrate buffer (121°C, 20 minutes). Primary antibodies were added to 0.2% Triton solution and incubated overnight. After washing, the specimens were stained by incubation with fluorescently labeled secondary antibodies at room temperature for 1 hour. The specimens were imaged using a fluorescence microscope (Keyence BZ-9000) or a confocal laser scanning fluorescence microscope (Fuji film FV3000).
[0061] result p63 knockout mouse models exhibit epidermal vasculature, including a partial or complete absence of squamous epithelium (see Mills et al., Nature, 398:708-713, 1999 and Yang et al., Nature, 398:714-718, 1999, which are incorporated herein by reference in their entireties). p63-deficient epithelium remains with a monolayer of non-proliferating cells expressing K8 / K18 and fails to develop (see Shalom-Feuerstein et al., Cell Death Differ., 18:887-896, 2011, which is incorporated herein by reference in its entirety). In this example, we used a CRISPR / Cas9-mediated deletion of the p63 gene, targeting exon 5 of p63, to generate p63 knockout embryos (see Figure 1).
[0062] We then introduced normal pluripotent stem cells into p63 knockout mouse embryos, which do not completely lack the epidermis, to generate chimeric individuals. Specifically, as shown in Figure 2, we transfected p63-targeting CRISPR / Cas9 into p63 knockout embryos at E0.5. At E2.5, GFP-positive mouse ESCs were injected into the blastocyst cavity as pluripotent stem cells. These embryos were then grown to E3.5 blastocysts and transplanted into the uterus of pseudopregnant foster mothers. At E19.5, the resulting chimeric individuals were observed under both optical and fluorescent microscopes.
[0063] The results are shown in Figure 3. A wild-type individual and three chimeric individuals are lined up. Among the chimeric individuals, some had areas with formed epidermis and others without (the second and third individuals from the left), and one had an almost completely formed epidermis (the first individual from the right).
[0064] The relationship between the chimera-forming ability (%) of pluripotent stem cells and the area of regenerated epidermis (%) was investigated. The chimera-forming ability of pluripotent stem cells was calculated as the percentage of GFP-positive donor cells relative to the total cells in the splenic lymphocytes obtained from each chimeric individual. The chimera-forming ability of pluripotent stem cells was also calculated as the percentage of GFP-positive donor cells relative to the total cells in the keratinocytes obtained from each chimeric individual. The area of regenerated epidermis was calculated as the percentage of the area of GFP-positive epidermis relative to the total surface area of the individual. The results are shown in Table 1.
[0065] [Table 1]
[0066] As shown in Table 1, the proportion of donor-derived cells in splenic lymphocytes was very low, whereas the proportion of GFP-positive epidermal area in the epidermis was substantially large. This indicates that the contribution of donor cells to the epidermis is significant even when donor cells with low chimera-forming ability are used. Furthermore, in none of the individuals was there any mature epidermis on the surface where GFP-positive epidermis had not formed (see, for example, Figure 4).
[0067] Figure 5 shows a graph plotting the results of Table 1. As shown in Figure 5, even donor cells with low chimera-forming ability, which hardly form chimeras in organs other than the skin (the spleen in this case), clearly contribute strongly to the skin.
[0068] Furthermore, the proportion of GFP-positive donor cells among skin keratinocytes was nearly 100%, indicating that the formed epidermis was essentially derived from donor cells, suggesting that donor cells form the epidermis by eliminating immature epidermal cells formed in the host.
[0069] Histological analysis of the skin of chimeric individuals revealed that the epidermis and hair follicles were derived solely from donor cells, whereas the dermis was chimeric with both donor and host cells (derived from p63KO embryos).
[0070] The GFP-positive skin (including the epidermis and dermis) of the resulting chimeric individual was excised and transplanted onto the skin of a wild-type C57BL / 6N mouse. Seven days after transplantation, the transplanted skin was observed, revealing the presence of GFP-positive cells in the transplanted area, as shown in Figure 6. These GFP-positive cells could still be observed 56 days after transplantation (see Figure 6).
[0071] Epidermal progenitor cells (K8 / K18-positive cells) were found on the skin surface of p63 knockout mice. However, no p63-derived cells were observed in the epidermis of E19.5 chimeric individuals (see, for example, the keratinocyte data in Table 1). Therefore, we observed the skin of E14.5 chimeric individuals. CK8 / K18-positive host cells (derived from p63 knockout embryos) and GFP-positive cells (derived from donor cells) were distinguished by fluorescent staining. p63 expression was also confirmed by fluorescent staining. As shown in Figure 7A, we observed skin areas in which the presence of CK8 / K18-positive host cells (derived from p63 knockout embryos) and GFP-positive cells (derived from donor cells) could be confirmed on the same skin.
[0072] Merging these photographs, as shown in Figure 7B, revealed that donor GFP-positive / p63-positive cells were found on the basement membrane, while host CK8 / K18-positive cells were observed to be lifted up and pushed aside by the donor cells, resulting in detachment from the basement membrane.
[0073] In previous organ complementation methods, donor cells occupied niches vacated by organ loss, resulting in the formation of donor-derived organs (see WO2010 / 021390A and WO2008 / 102602A, which are incorporated herein by reference in their entireties). In contrast, the results of this example showed that donor cells did not occupy vacant niches, but rather pushed aside and eliminated existing host cells. This suggests that host cells were eliminated by donor cells through cell competition.
[0074] GFP-positive donor cells and CK8 / K18-positive host cells in the skin of E18.5 chimeras were observed under a fluorescence microscope, and it was found that at E18.5, host-derived cells had been removed from the basement membrane, which was now almost entirely occupied by GFP-positive donor cells.
[0075] We investigated the relationship between the chimerism rate and epidermal coverage in embryos. Global chimerism is the percentage of donor cells in the embryo. Skin coverage (skin covered area) is the percentage of the area where skin was formed. As shown in Figure 10A, at a chimerism rate of approximately 30%, skin formed over nearly 100% of the surface. Even at a chimerism rate of approximately 23%, skin formed over more than 90% of the surface. This demonstrates that even at low chimerism, skin formation occurs at a higher percentage of the surface. Staining of tissue sections revealed that the epidermis and appendages were dominated by EGFP-positive cells derived from pluripotent stem cells, while the dermis was a chimera of donor and embryo origin (i.e., the resulting skin was semi-autologous). This demonstrated that semi-autologous skin regeneration was possible.
[0076] Importantly, skin can be harvested from individuals with low skin coverage and used as a skin graft material. Skin graft materials include the epidermis and dermis, and transplantation of this graft material into a subject is thought to promote skin survival in the subject. However, if host cells become contaminated with the epidermis, the skin may be rejected, preventing the survival of the grafted skin, as described below.
[0077] When chimeric embryos were constructed as described above using wild-type embryos and donor cells instead of p63KO embryos, the epidermis was mixed with donor cells and embryo-derived host cells, as shown in Figure 11A. The proportion of host cells in the epidermis was high, and when the resulting skin (including the epidermis and dermis) was grafted onto another individual, the skin was rejected. In contrast, when chimeric embryos were constructed as described above using p63KO embryos and donor cells, nearly 100% or 100% of the epidermis was derived from donor cells, as shown in Figure 11B. When skin (including the epidermis and dermis) from the area where the epidermis formed was grafted onto another individual, the skin survived. Skin with nearly 100% or 100% donor cell-derived epidermis was easily harvested from chimeras constructed using p63KO embryos and donor cells. Furthermore, epidermis derived from nearly 100% or 100% donor cells was suitable for skin grafting.
[0078] Furthermore, we performed an experiment in which the epidermis and dermis of skin (skin of the present disclosure) constructed as described above using EGFP-expressing p63KO embryos (BDF1 strain) and donor cells (B6 strain) were transplanted onto the B6 strain (Group C). As controls, we performed autograft experiments (Group A) (transplantation of EGFP-expressing BDF1 strain skin onto the BDF1 strain) and allograft experiments (Groups B and D) (transplantation of EGFP-expressing BDF1 strain skin onto the B6 strain). In Group A, skin harvested from a BDF1-Tg(CAG-EGFP) mouse was transplanted onto another BDF1-Tg(CAG-EGFP) mouse. BDF1-Tg(CAG-EGFP) mice are the F1 offspring of EGFP-expressing B6 mice and DBA2 mice. In Group A, both the epidermis and dermis of the graft were immunologically matched to those of the transplant recipient. In group B, skin harvested from BDF1-Tg(CAG-EGFP) mice was transplanted onto B6-Tg(CAG-EGFP) mice. In group B, neither the epidermis nor the dermis of the graft were immunologically matched to the recipient. In group D, chimeric mice were generated by injecting wild-type B6-derived ES cells into fertilized embryos of BDF1-Tg(CAG-EGFP) mice expressing EGFP and carrying the wild-type p63 gene. Chimeric skin grafts (the epidermis was also chimeric between the donor and host embryos) harvested from these chimeras were transplanted onto B6-Tg(CAG-EGFP) mice. In group D, neither the epidermis nor the dermis of the graft contained host embryo-derived components that were immunologically mismatched to the recipient.
[0079] In the above experiment, the survival rate of the skin after transplantation was observed. The results are shown in Figure 12. As shown in Figure 12, in Group A, 100% of the autologous transplanted skin survived. In contrast, in Groups B and D, the survival rate of the allogeneic transplanted skin dramatically deteriorated within two weeks. The skin of the present disclosure (Group C) showed good long-term survival. These results indicate that as long as the epidermis is composed of autologous cells, high survival is achieved even when the dermis is composed of both autologous and allogeneic cells. In the skin of the present disclosure, the epidermis, hair follicles, sebaceous glands, and sweat glands were derived from donor cells, while the dermis, nerves, blood vessels, and arrector pili muscles were chimeric with donor cells and embryonic cells. These findings suggest that the presence of immunologically incompatible cells in the dermis, nerves, blood vessels, and arrector pili muscles has little effect on the long-term survival of the transplanted skin. Instead of the experiment in Group C, when an experiment was performed in which the epidermis and dermis of skin (skin of the present disclosure) constructed as described above using p63KO embryos (BDF1 strain) and donor cells expressing EGFP (B6 strain) was transplanted into the B6 strain (Group C'), the engraftment of EGFP-expressing donor cells was partially rejected. Since EGFP expression induced rejection, it was considered preferable that donor cells do not contain antigens (especially foreign or xenoantigens).
[0080] Previous studies have reported that transuterine cell injection into embryos results in cell engraftment (see Cohen et al., PNAS, 113(6):1570-5, 2016, incorporated herein by reference in its entirety). Therefore, in this example, we labeled immortalized human keratinocytes (HaCaT cells) with EGFP and transplanted them into p63 knockout embryos at E13.5 via amniotic cavity injection. No immunosuppressants were used during transplantation. At E16.5, the embryos were removed and the GFP signal derived from the donor cells was observed under a stereomicroscope and a fluorescent microscope. As shown in Figures 9A and 9B, HaCaT cells contributed to the skin, and as shown in Figure 9C, cell engraftment in the embryos was observed.
[0081] Mice donated with HaCaT cells were allowed to grow until E18.5. As shown in Figure 13, a human epidermis derived from human epidermal cells was constructed on a portion of the surface of the resulting chimeric mice. Sections of the resulting skin were stained for nuclei with DAPI and immunohistochemically stained for Krt14, a mature keratinocyte marker. When observed under a fluorescence microscope, as shown in Figure 13, GFP-labeled human epidermis formed a Krt14-positive epidermis on the mouse dermis, and the epidermis had the multilayered structure seen in normal skin. Thus, skin tissue with human epidermis could be constructed on the skin of a xenogeneic animal. This suggests that human epidermis can also be constructed on pig dermis. Furthermore, pig skin is sometimes used as a skin graft material for human transplants, and using human epidermis is expected to improve engraftment efficiency (see Figure 12).
[0082] In this way, skin can be constructed on the dermis, with an epidermis composed of autologous cells. When the epidermis is composed of autologous cells or immunologically compatible cells, grafted skin containing the epidermis has shown good long-term survival. In this case, even if the dermis contains immunologically incompatible cells, this has little effect on the survival of the grafted skin. Therefore, it is believed that skin containing an epidermis composed of autologous cells and a dermis containing the non-human animal cells, prepared from p63-disrupted non-human animal embryos and human cells, can be preferably used for autologous skin transplantation into humans.
Claims
1. 1. An isolated skin tissue comprising an epidermis, a basement membrane, and a dermis, wherein the epidermis is attached to one side of the basement membrane and the dermis is attached to the other side of the basement membrane, and wherein the epidermis comprises a first cell and the dermis comprises a second cell, and the second cell has a functional defect in p63 and has reduced or no ability to differentiate into a mature epidermal cell.
2. The skin tissue of claim 1 , wherein the second cell is a cell in which the p63 gene has been knocked out.
3. The skin tissue according to claim 1 or 2, wherein the epidermis is mature epidermis.
4. The skin tissue according to claim 1 or 2, wherein 95% or more of the cells in the epidermis are first cells and 75% or more of the cells in the dermis are second cells.
5. The skin tissue according to claim 3 , wherein 95% or more of the cells in the epidermis are first cells and 75% or more of the cells in the dermis are second cells.
6. A method for producing skin tissue, comprising: Providing a non-human mammalian host embryo that has a functional deficiency in p63 and is unable to autonomously develop a mature epidermis; injecting donor cells capable of differentiating into mature epidermis into said non-human mammal host embryo, said injection being carried out under conditions suitable for engraftment of said cells into the skin; transplanting the obtained embryo into the uterus of a pseudopregnant foster mother non-human mammal and growing it therein to obtain an individual having a mature epidermis from the pseudopregnant foster mother non-human mammal; Isolating skin tissue from the obtained individual, including mature epidermis containing cells derived from the donor cells, a basement membrane, and a dermis containing cells derived from the host; A method comprising:
7. The method of claim 6, wherein the non-human mammalian host embryo that is incapable of developing a mature epidermis is a p63 knockout embryo.
8. The method according to claim 6 or 7, wherein the donor cells capable of differentiating into mature epidermis are cells selected from the group consisting of pluripotent cells and cells committed to the epidermis.
9. The method according to claim 6 or 7, wherein the embryo is at any developmental stage from the 8-cell stage to the blastocyst stage.
10. The method according to claim 6 or 7, wherein the embryo is at any developmental stage from the blastocyst stage to the stage at which an epidermis containing K8 / K18-positive cells is formed.
11. The method according to claim 6 or 7, wherein the embryo has an epidermis of K8 / K18-positive cells.
12. 1. A method for producing a non-human mammalian individual, comprising: A method for obtaining a non-human mammalian individual having skin tissue comprising host cells and donor cells, the method comprising contacting cells capable of forming chimeras and capable of differentiating into mature epidermis, or cells committed to epidermis or epidermal lineage cells (donor cells), with the body surface of the non-human mammalian individual having a functional deficiency in p63 and reduced or no ability to differentiate into mature epidermal cells, the non-human mammalian individual before basal cells of the epidermis are formed, thereby obtaining a non-human mammalian individual having skin tissue comprising host cells and donor cells.
Citation Information
Patent Citations
Finding and treatment of inflammation after birth in chimeric animal
WO2018139502A1