Intestinal expression of programmed cell death ligand 1

Localized intestinal expression of PD-L1 polypeptides using chitosan nanoparticles addresses the unclear therapeutic potential of PD-L1, effectively treating inflammatory diseases by modulating immune responses and improving disease outcomes.

JP7750644B2Active Publication Date: 2025-10-07ENGENE INC
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2019524031
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-11-09
Filing Date
2017-11-09
Publication Date
2025-10-07
Estimated Expiration
2037-11-09

AI Technical Summary

Technical Problem

The role of PD-L1 in T cell activation is not fully understood, leading to uncertainties in its therapeutic potential for inflammatory diseases, and existing treatments for conditions like inflammatory bowel disease and graft-versus-host disease are not effective.

Method used

Localized intestinal expression of PD-L1 polypeptides, including soluble forms, is administered using chitosan or chitosan derivative nanoparticles to modulate immune responses and treat inflammatory diseases.

Benefits of technology

The method effectively reduces inflammation and improves survival rates in models of graft-versus-host disease and inflammatory bowel disease by enhancing regulatory T cell function.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007750644000001
    Figure 0007750644000001
  • Figure 0007750644000002
    Figure 0007750644000002
  • Figure 0007750644000003
    Figure 0007750644000003
Patent Text Reader

Abstract

Provided herein are methods and compositions for ameliorating inflammatory diseases, including intestinal expression of programmed cell death ligand 1. [Selected figure] Figure 9C
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to methods and compositions for the amelioration of inflammatory diseases that employ gene expression of PD-L1. [Background technology]

[0002] Immune activation in general, and the activation state of T cells in particular, is influenced by complex overlapping regulatory mechanisms mediated by a host of costimulatory (e.g., CD28, ICOS, OX40, etc.) and co-inhibitory (e.g., CTLA-4, programmed cell death-1 (“PD-1”), etc.) molecules on T cells. Programmed cell death ligand-1 (“PD-L1,” also known as B7H1) is constitutively expressed by dendritic cells and other antigen-presenting cells and appears to mediate T cell downregulation through its interaction with PD-1. Patsoukis et al., “Selective effects of PD-1 on Akt and Ras pathways regulate molecular components of the cell cycle and inhibit T cell proliferation,” Sci. Signal 5:ra46 (2012).

[0003] Unfortunately, however, the effects of PD-L1 interaction with CD80 are not as clear as the interplay between these two pathways. In some settings, blockade of PD-1 with soluble PD-L1 can strongly enhance T cell responses and promote graft-versus-host disease (GvHD). Blazar et al., Blockade of Programmed Death-1 Engagement Accelerates Graft-Versus-Host Lethality by an IFN-γ-Dependent Mechanism, J. Immunol. 171:1272-77 (2003). Conversely, other researchers have been able to ameliorate GvHD with a soluble form of PD-L1, but only in a PD-L1 knockout setting. Deng et al., B7H1 / CD80 Interaction Augments PD-1 Dependent T Cell Apoptosis and Ameliorates Graft-versus-Host Disease, J. Immunol. 194:560-74 (2105). Furthermore, the role of peripheral dendritic cells in T cell responses appears to be more complex than previously thought. For example, while immature peripheral dendritic cells do not normally initiate T cell differentiation, in a mouse model of experimental autoimmune encephalomyelitis (EAE), populations of dendritic cells have been observed to infiltrate the central nervous system (CNS) and promote epitope spreading. Spagnuolo et al., Involvement of Immune Regulation in Multiple Sclerosis, Immunology and Immunogenetics Insights 9:1-10.

[0004] Thus, there is a clear need in the art to better understand the role of PD-L1 in T cell activation in the context of immune defense and to better exploit the therapeutic potential of PD-L1 in inflammatory diseases. Summary of the Invention [Problem to be solved by the invention]

[0005] The present invention overcomes the aforementioned scientific uncertainties in the prior art by successfully employing localized intestinal expression of PD-L1 polypeptides, including soluble PD-L1 polypeptides, in the context of immune defense for the treatment of various inflammatory diseases, including, for example, inflammatory bowel disease (e.g., ulcerative colitis, Crohn's disease, etc.), as well as graft-versus-host disease induced by organ or bone marrow transplantation. Accordingly, in one aspect, the present invention provides a method of treating an inflammatory disease in a patient in need thereof, comprising administering to the intestine of the patient an expression vector comprising a PD-L1 nucleic acid. [Means for solving the problem]

[0006] In one embodiment, the PD-L1 polypeptide is a membrane-bound PD-L1 polypeptide. In a preferred embodiment, the PD-L1 polypeptide is human PD-L1 or a splice variant thereof. In one such embodiment, the PD-L1 nucleic acid encodes a PD-L1 polypeptide comprising the amino acid sequence of SEQ ID NO:1, or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:1.

[0007] In alternative embodiments, the PD-L1 polypeptide is a soluble PD-L1 polypeptide, for example, comprising the signal sequence, IgV domain, and IgC domain of PD-L1 and preferably human PD-L1 (i.e., amino acids 1-239 of SEQ ID NO: 1). In some embodiments, the soluble PD-L1 polypeptide may lack all or part of the signal sequence (e.g., it may comprise amino acids 19-238 of SEQ ID NO: 1).

[0008] In some embodiments, the PD-L1 nucleic acid is delivered by an expression vector encapsulated in a nucleic acid delivery vehicle. Preferred nucleic acid delivery vehicles include chitosan or chitosan derivative nanoparticles. In one such embodiment, the chitosan derivative nanoparticles comprise chitosan conjugated with arginine and / or gluconic acid. In another such embodiment, the chitosan derivative nanoparticles comprise chitosan conjugated with arginine and a hydrophilic polyol. In one embodiment, the hydrophilic polyol is glucose.

[0009] In another aspect, the invention provides an expression vector comprising a PD-L1 nucleic acid for treating an inflammatory disease in a patient in need thereof, wherein the expression vector is administered to the intestinal tract of the subject. In some embodiments, the PD-L1 nucleic acid comprises SEQ ID NO:2. Preferably, the PD-L1 nucleic acid comprises at least one synonymous mutation in SEQ ID NO:2. Even more preferably, the PD-L1 nucleic acid comprises multiple such mutations to aid in differentiation and, optionally, improved expression. In an exemplary embodiment, the PD-L1 nucleic acid comprises SEQ ID NO:3.

[0010] In some embodiments, the PD-L1 nucleic acid further comprises a heterologous sequence. The heterologous sequence may comprise an Fc domain, a protein tag, a conjugated therapeutic agent, or a combination thereof. In one embodiment, the N-terminal region of the PD-L1 polypeptide is fused to the Fc region of human IgG1, or a portion thereof. The PD-L1 polypeptide may be fused to the Fc region of human IgG1, or a portion thereof, via the amino acid sequence (GGGGS)n (SEQ ID NO: 5). In some embodiments, the IgG1 Fc is mutated to reduce antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDCC) by altering one or more of the following amino acids in the Fc domain: E233P, L234V, L235A, deletion of G236, A327G, A330S, and P331S. In an exemplary embodiment, the PD-L1 nucleic acid comprises SEQ ID NO: 4.

[0011] Inflammatory diseases that can be advantageously treated by the present invention include both chronic and acute conditions, including inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, inflammatory bowel disease, Crohn's disease, colitis, or those resulting from the overproduction of cytokines (e.g., TNF or IL-1), as well as GvDH.

[0012] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0013] The present disclosure is disclosed with reference to the accompanying drawings. [Brief explanation of the drawings]

[0014] [Figure 1] pVax-hPD-L1 vector (SEQ ID NO: 6). The plasmid sequence of the vector encoding the membrane-bound human PD-L1 polypeptide is shown, highlighting the optimized human PD-L1 cDNA.

[0015] [Figure 2] pVax-hPD-L1 Fc vector (SEQ ID NO: 7). The plasmid sequence of the vector encoding the soluble human PD-L1 Fc polypeptide is shown, highlighting the optimized human PD-L1 cDNA.

[0016] [Figure 3A] Figure 1 shows human PD-L1 plasmid and in vitro expression. (A) Plasmid map of the DNA sequence of optimized hPD-L1 cloned into a pVax backbone containing a plasmid replication origin (pUC ori;) under the control of the human cytomegalovirus immediate-early gene promoter (CMV;) along with a kanamycin resistance gene.

[0017] [Figure 3B] Figure 1 shows the expression of PD-L1 and PD-L1 Fc in vitro. HEK293T cells were transfected with 1 μg or 2.5 μg of Fc control (white), PD-L1-Fc (black), or PD-L1 (gray) plasmid DNA using Lipofectamine 2000 (Invitrogen). The content of PD-L1 protein in cell culture supernatants or cell lysates was quantified 48 hours after transfection.

[0018] [Figure 4] Figure 1 shows the in vitro expression of PD-L1-Fc resulting from polyplex transfection. (A-B) HEK-293T cells were transfected with increasing concentrations of PD-L1-Fc polyplexes containing pVAX-opt-hPD-L1-Fc DNA as indicated. (A) Supernatants were collected 48 hours post-transfection and assayed for hPD-L1-Fc protein by ELISA. Data were normalized to total cellular protein. (B) Table of EC50 and maximum protein expression.

[0019] [Figure 5-1]Figure 1 shows the purification and expression of Fc fusion constructs generated in vitro. (A) Protein expression confirmed by Coomassie gel staining. HEK293T cells were transfected with Fc control or PD-L1-Fc plasmid DNA using Lipofectamine 2000 (Invitrogen). 24 hours after transfection, the cell culture medium was replaced with serum-free medium. 72 hours after transfection, the cell culture supernatant was collected, and the Fc fusion proteins were purified using a Protein G HiTrap column (GE). The buffer was replaced with PBS using a PD-10 desalting column (GE), and the proteins were eluted in four equal fractions (elutions 1-4). (B) HEK293T cells were transfected with Fc control or PD-L1-Fc plasmid DNA using Lipofectamine 2000 (Invitrogen). 24 hours after transfection, the cell culture medium was replaced with serum-free medium. Cell culture supernatants were collected 72 hours after transfection, and the Fc fusion proteins were purified using a Protein G HiTrap column (GE). The buffer was exchanged with PBS using a PD-10 desalting column (GE), and the proteins were eluted in four equal fractions (F1–F4). PD-L1 protein concentrations were determined by ELISA.

[0020] [Figure 5-2] Figure 1 shows the purification and expression of Fc fusion constructs generated in vitro. (C) NIH / 3T3 cells were transfected in 6-well plates with wild-type PD-L1 plasmid DNA or control (pVax) using Lipofectamine 2000 (Invitrogen). 24 hours after transfection, cells were washed and replated in 96-well flat-bottom plates. PD-L1 expression on the cell surface was analyzed by flow cytometry the following day (day 2) and for the following three days. (D) NIH / 3T3 cells were transfected in 6-well plates with wild-type PD-L1 plasmid DNA or control (pVax) using Lipofectamine 2000 (Invitrogen). 24 hours after transfection, cells were washed and replated in 96-well flat-bottom plates. PD-L1 expression levels on the cell surface were analyzed by flow cytometry the following day (day 2) and for the following three days.

[0021] [Figure 6] Figure 1 shows the dose-dependent expression of PD-L1-Fc signals via the human PD-1 receptor. Cells were transfected with PD-L1-Fc and purified from cell culture supernatant. (A) PathHunter PD-1 signaling assay. Cells were stimulated (40 min) with increasing concentrations of PD-L1-Fc, and signal activation was measured by luminescence (RLU: relative light units). (B) PathHunter PD-1 signaling assay. Cells were incubated with recombinant IgG1-Fc or PD-L1-Fc (50 μg / mL, 40 min) in the presence or absence of anti-PD-1 (low: 0.1 μg / mL, high: 1.0 μg / mL), and signal activation was measured by luminescence (RLU: relative light units). Cell activation was assayed in triplicate, and data are presented as RLU compared to the unstimulated control. Data are presented as mean ± standard deviation and are representative of four independent experiments. Data were analyzed using Student's t-test, and asterisks indicate statistically significant differences (*, p≦0.05; **, p≦0.01; ***, p≦0.001).

[0022] [Figure 7A] Figure 7 shows that PD-L1-Fc produced with plasmid DNA inhibits T cell activation in vitro. (A) Purified CD4+ T cells were isolated and pooled from three C57BL / 6 mice. Cells were plated onto 96-well flat-bottom plates pre-coated with anti-CD3 (0.2μg / mL) alone or 5μg / mL of PD-L1-Fc produced in serum-free medium. Recombinant IgG1-Fc and recombinant PD-L1-Fc were used as controls. Cells were stimulated for 3 days, and cell activation was measured by flow cytometry to detect cell size within the FSC-SSC gate. Figure 7A discloses "GGGGS" as SEQ ID NO: 5 and "(GGGGS)3" as SEQ ID NO: 8.

[0023] [Figure 7B](B) PD-L1-Fc produced from plasmid DNA inhibits T cell activation in vitro. (C) NIH / 3T3 cells were transfected with wild-type PD-L1 plasmid DNA or a control (pVax) in a 6-well plate. 48 hours after transfection, the cells were replated in a 96-well V-bottom plate and incubated with various concentrations of recombinant human PD-1. Cells were washed, and PD-1 binding was analyzed by flow cytometry by staining APC-conjugated anti-human PD-1 or an isotype control, and assessing the detection of APC on transfected cells. Binding of PE-conjugated anti-human PD-L1 or an isotype control was also assessed. The reduced binding of anti-human PD-L1-PE is expected to be the result of steric hindrance of antibody binding, given that recombinant PD-1 binds to PD-L1 expressed on NIH / 3T3 cells.

[0024] [Figure 8A] Figure 1. Optimization of the disease model. (A) Male Rag1- / - mice were intraperitoneally injected with naive T cells, defined as CD4+CD25-CD45RBhigh, or left untreated. Transfer of naive T cells induced disease, as observed by weight loss.

[0025] [Figure 8B] Figure 1. Optimization of the disease model. (B) To induce acute graft-versus-host disease (GvHD), female BALB / c mice were irradiated with 700 cGY and transferred with allogeneic C57B16 / J bone marrow (10 cells) along with 2.5 splenocytes. Using these conditions, GvHD was successfully induced, as observed by the initial weight loss observed within the first 10 days. Furthermore, secondary weight loss was observed beginning at approximately day 20. The non-transplant group confirmed successful irradiation, and the BMT control confirmed successful transfer of allogeneic bone marrow.

[0026] [Figure 9A]Figure 8 shows the therapeutic efficacy of PD-L1 and PD-L1 Fc polyplexes in GvHD. (A) GvHD was induced as previously described in Figure 8B. Mice were left untreated or were injected weekly by enema with pVAX, PD-L1, or PD-L1 Fc polyplexes at a concentration of c1000 for 7 weeks. Animals were euthanized when they reached 75% of their original body weight. Animal weight was rescued by administration of PD-L1 and PD-L1 Fc polyplexes.

[0027] [Figure 9B] (B) Therapeutic efficacy of PD-L1 and PD-L1 Fc polyplexes in GvHD. Clinical signs of disease were reduced in mice treated with PD-L1 or PD-L1-Fc, and the mean clinical signs observed at day 21 were also reduced in mice treated with PD-L1 and PD-L1-Fc.

[0028] [Figure 9C] (C) Survival curves following induction of GvHD. All untreated and pVAX-treated animals died of disease, whereas approximately 40% of PD-L1 Fc-treated animals and 30% of PD-L1-treated animals (green) survived to day 75.

[0029] [Figure 10-1] Figure 8 shows the therapeutic efficacy of PD-L1 Fc and PD-L1 polyplexes in GvHD. (A) GvHD was induced as previously described in Figure 8B. Mice were left untreated or injected weekly by enema with pVAX or PD-L1 Fc polyplexes at a concentration of c1000 for 7 weeks. Animals were euthanized when they reached 75% of their original body weight. Animal weight was rescued by administration of PD-L1 Fc polyplexes.

[0030] [Figure 10-2]Figure 8 shows the therapeutic efficacy of PD-L1 Fc and PD-L1 polyplexes in GvHD. (B) GvHD was induced as previously described in Figure 8B. Mice were left untreated or injected weekly by enema with pVAX or PD-L1 polyplexes at a concentration of c1000 for 7 weeks. Animals were euthanized when they reached 75% of their initial body weight. Animal weight was rescued by administration of PD-L1 polyplexes. (C) Survival curves following GvHD induction. All pVAX-treated animals died of disease, whereas approximately 40% of PD-L1 Fc-treated animals and 30% of PD-L1-treated animals survived to day 75.

[0031] [Figure 11] Figure 8 shows the therapeutic effects of PD-L1 and PD-L1 Fc on GvHD. (A) GvHD was induced as previously described in Figure 8B. Mice were left untreated or were injected weekly by enema with pVAX, PD-L1, or PD-L1 Fc polyplexes at a concentration of c1000 for 7 weeks. Starting on day 18, there was a significant improvement in body weight in PD-L1 and PD-L1 Fc-treated animals compared with untreated or pVAX-treated animals. (B) Survival curves following GvHD induction. Untreated animals, as well as all pVAX-treated animals, succumbed to the disease. Meanwhile, 50% of PD-L1 Fc-treated animals and 25% of PD-L1-treated animals survived through day 45.

[0032] [Figure 12]Figure showing the administration of recombinant PD-L1 Fc in a DSS model of colitis. (A) Diagram adapted from Song et al., Gut 2015. Rag1- / - mice were administered 2% DSS in their drinking water and then intraperitoneally injected with recombinant PD-L1 Fc protein or PBS on day 2. Injection of recombinant PD-L1 Fc resulted in less severe weight loss than animals injected with PBS. (B) Rag1- / - mice were administered 4% DSS in their drinking water and then intraperitoneally injected with recombinant PD-L1 Fc or PBS on days 3 and 6. Animal weights were comparable throughout the study. However, no therapeutic effect was observed with PD-L1-Fc soluble protein, and therefore the results of Song et al. were not reproducible.

[0033] [Figure 13-1] Figure 8 shows the therapeutic efficacy of PD-L1 and PD-L1 Fc in a model of T-cell colitis. (A-B) T-cell colitis was induced as in Figure 8A. Starting 15 days post-transfer, mice were injected weekly with pVAX or PD-L1 c1000 polyplexes via enema for the following 6 weeks, or mice were left untreated. Animals that died from disease were given a fixed score of 75% of their initial body weight. PD-L1 polyplex injections prevented disease progression, as observed by unchanged body weight throughout the study. (B) Survival curves of mice following induction of T-cell colitis reveal that no PD-L1-treated animals died from disease. In contrast, one pVAX-treated animal and two untreated animals had to be euthanized.

[0034] [Figure 13-2] Figure 8 shows the therapeutic efficacy of PD-L1 and PD-L1 Fc in a model of T-cell colitis. T-cell colitis was induced as in Figure 8A. Animal body weight (C) and clinical signs (D) were monitored two to three times weekly, and the body weight on day 0 was used as the baseline body weight (100%; day 0 was the first day of intracolonic infusion, which corresponds to day 19 post-transfer). Animals received weekly intracolonic infusions for 7 weeks, starting on day 19 post-transfer.

[0035] [Figure 13-3] Figure 1 shows the therapeutic efficacy of PD-L1 and PD-L1 Fc in a model of T-cell colitis. (E) Survival of mice following induction of T-cell colitis. Animals were euthanized at 75% of their initial body weight or if activity was severely reduced. For graphing purposes, the body weight of euthanized mice was represented as 75% of their initial body weight for the remainder of the experiment. Similarly, the clinical scores of euthanized mice were represented as a maximum score of 8 until the end of the study. For (C-E), sucrose, n=8; pVAX, n=9; PD-L1-Fc, n=9.

[0036] [Figure 14] Administration of PD-L1 polyplexes induces FoxP3 expression on regulatory T cells. The mean fluorescence intensity (MFI) of FoxP3 was measured in regulatory T cells, defined as CD4+CD25+FoxP3+ cells, at endpoints in mesenteric lymph nodes and spleen. FoxP3 expression was higher in PD-L1-treated animals compared to the pVax group in both (A) mesenteric lymph nodes (MLN) and (B) spleen. DETAILED DESCRIPTION OF THE INVENTION

[0037] The present invention contemplates intestinal expression of PD-L1 nucleic acids for the treatment of inflammatory diseases.

[0038] PD-L1 protein and polynucleotides PD-L1 polypeptides contemplated herein include the full-length sequence, soluble fragments thereof, and variants thereof.

[0039] The full-length PD-L1 protein generally contains a signal sequence, an IgV domain, an IgC domain, a transmembrane domain, and a cytoplasmic domain. The human sequence is publicly available in the GenBank database under the identifiers NM_014143.3 and NP_054862.1. The sequence of human PD-L1 transcript variant 1 is the canonical sequence, and all positional information listed for known isoforms is determined from this sequence. In this isoform, the signal sequence is represented by about amino acid 1 to about amino acid 18, the IgV domain is represented by about amino acid 19 to about amino acid 134, the IgC domain is represented by about amino acid 135 to about amino acid 227, the transmembrane domain is represented by about amino acid 239 to about amino acid 259, and the cytoplasmic domain is represented by about amino acid 260 to about amino acid 290. At least five transcript (i.e., splice) variants encoding different human PD-L1 isoforms are known and are described, for example, in U.S. Patent Publication No. 2016 / 0122829, the disclosure of which is expressly incorporated herein by reference.

[0040] Nucleic acid and amino acid sequence information for PD-L1 in several species is known in the art, for example, monkey PD-L1 (NM001083889.1 and NP_001077358.1), chimpanzee PD-L1 (XM_0011401705.2 and XP_001140705.1), mouse PD-L1 (NM021893.3 and NP_068693.1), rat PD-L1 (NM021893.3 and NP_068693.1), and the like. Many PD-L1 sequences are readily available in public databases, including porcine PD-L1 (NM_001191954.1 and NP_001178883.1), chicken PD-L1 (XM_424811.3 and XP_424811.3), bovine PD-L1 (NM_001163412.1 and NP_001156884.1), and canine PD-L1 (XM_541302.3 and XP_541302.3).

[0041] The PD-L1 nucleic acids of the invention generally comprise a nucleic acid sequence encoding a human PD-L1 polypeptide, where the PD-L1 polypeptide preferably comprises the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1, or a fragment thereof. In some embodiments, the PD-L1 polypeptide is a membrane-bound form, i.e., full-length PD-L1 comprising the transmembrane and cytoplasmic domains. In alternative embodiments, the PD-L1 polypeptide is a soluble PD-L1 polypeptide comprising at least the IgV and IgC domains of human PD-L1 and, optionally, a signal sequence. In one embodiment, the PD-L1 polypeptide comprises amino acids 1-239 of SEQ ID NO: 1, which corresponds to nucleotides 1-717 of the full-length cDNA sequence. In other embodiments, the soluble PD-L1 polypeptide may lack all or a portion of the signal sequence (e.g., it may comprise amino acids 19-239 of SEQ ID NO: 1). See, for example, U.S. Patent Publication No. 2017 / 0189476, the disclosure of which is expressly incorporated herein by reference. Table 1. Amino acid sequence of human PD-L1 MRIFAVFIFMTYWHLLNAFTVTVPKDLYVVEYGSNMTIECKFPVEKQLDLAALIVYWEMEDKNIIQFVHGEEDLKVQHSSYRQRARLLKDQLSLGNAALQITDVKLQDAGVYRCMISYGGADYKRITVKVNAPYNKINQRILVVDPVTSEHELTCQAEGYPKAEVIWTSSDHQVLSGKTTTTNSKREEKLFNVTSTLRINTTTNEIFYCTFRRLDPEENHTAELVIPELPLAHPPNERTHLVILGAILLCLGVALTFIFRLRKGRMMDVKKCGIQDTNSKKQSDTHLEET (SEQ ID NO: 1)

[0042] In some embodiments, the PD-L1 nucleic acid is identical to the native PD-L1 nucleic acid sequence (SEQ ID NO: 2) or a fragment thereof. Preferably, at least one synonymous nucleic acid substitution is made to allow for differentiation and detection of transcripts arising from endogenous human PD-L1 nucleotides following administration of the subject nucleic acid, and even more preferably, multiple such synonymous mutations are made. In particularly preferred embodiments, the PD-L1 nucleic acid sequence is codon optimized to improve expression. In exemplary embodiments, the PD-L1 nucleic acid preferably comprises the nucleic acid sequence of SEQ ID NO: 3, or a sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3.

[0043] In some embodiments, the PD-L1 polypeptides of the present invention may be fused to an Fc region or portion thereof. In an exemplary embodiment, the PD-L1 nucleic acid comprises the nucleic acid sequence of SEQ ID NO:4, or a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:4.

[0044] A PD-L1 nucleic acid of the invention may comprise exons 1-4 in total, as well as the first 35 nucleotides of exon 5. It is noted that the ATG site (start codon) is found at position 13 of exon 2. Thus, a PD-L1 nucleic acid of the invention may comprise the last 52 nucleotides of exon 2, all of exons 3 and 4, as well as the first 35 nucleotides of exon 5. Table 2. Human PD-L1 nucleic acid sequence ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCATTTACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTGCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTCCTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTAGATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCTCCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCACTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATCCAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA(SEQ ID NO: 2) Table 3. Nucleic acid sequence with optimized codons for membrane-bound PD-L1 ATGAGAATCTTCGCGGTGTTCATCTTCATGACCTACTGGCACCTCCTGAACGCTTTCACTGTGACCGTGCCTAAGGACCTCTACGTCGTGGAATACGGCTCCAACATGACCATCGAGTGCAAATTCCCAGTGGAGAAGCAGCTGGACCTGGCTGCCCTGATCGTGTACTGGGAAATGGAGGACAAGAACATCATCCAATTCGTGCATGGGGAGGAGGACCTGAAGGTCCAGCATTCGTCATATCGGCAAAGAGCCAGGCTGCTGAAGGATCAGCTGTCCCTCGGCAATGCGGCACTGCAGATTACCGATGTGAAGCTGCAGGACGCCGGAGTCTACCGGTGCATGATTTCCTACGGCGGAGCAGACTACAAGCGCATTACCGTGAAGGTCAACGCTCCCTACAACAAGATCAACCAGCGGATTCTGGTGGTCGACCCTGTGACCTCCGAGCATGAGCTGACCTGTCAAGCCGAAGGTTACCCGAAAGCGGAAGTGATCTGGACGTCGAGCGACCACCAGGTCTTGAGCGGAAAGACGACCACTACTAACAGCAAGCGGGAAGAGAAACTGTTTAACGTGACCAGCACTCTTCGGATCAACACCACCACTAACGAGATTTTCTACTGTACCTTTCGCCGGCTTGACCCGGAAGAAAATCACACCGCCGAGCTCGTGATCCCCGAGCTGCCCCTCGCCCACCCTCCTAACGAAAGAACCCACCTGGTCATCTTGGGGGCCATCCTGCTGTGCCTGGGAGTGGCCCTGACCTTCATTTTTAGGCTCCGAAAGGGCCGCATGATGGACGTGAAGAAATGCGGAATCCAGGACACTAACTCCAAGAAGCAGTCCGATACTCACCTGGAAGAAACCTAG(SEQ ID NO: 3) Table 4. Nucleic acid sequence of codon-optimized soluble PD-L1 fused with Fc fragment

[0045] Just as there is a known and definite correspondence between the amino acid sequence of a particular protein, as defined by the genetic code, and the nucleotide sequence capable of encoding that protein, there is a known and definite correspondence between the nucleotide sequence of a particular nucleic acid and the amino acid sequence encoded by that nucleic acid, as defined by the genetic code. Table 3 genetic code Alanine (Ala, A) GCA, GCC, GCG, GCT Arginine (Arg, R) AGA, ACG, CGA, CGC, CGG, CGT Asparagine (Asn, N) AAC, AAT Aspartic acid (Asp, D) GAC, GAT Cysteine ​​(Cys, C) TGC, TGT Glutamic acid (Glu, E) GAA, GAG Glutamine (Gln, Q) CAA, CAG Glycine (Gly, G) GGA, GGC, GGG, GGT Histidine (His, H) CAC, CAT Isoleucine (Ile, I) ATA, ATC, ATT Leucine (Leu, L) CTA, CTC, CTG, CTT, TTA, TTG Lysine (Lys, K) AAA, AAG Methionine (Met, M) ATG Phenylalanine (Phe, F) TTC, TTT Proline (Pro, P) CCA, CCC, CCG, CCT Serine (Ser, S) AGC, AGT, TCA, TCC, TCG, TCT Threonine (Thr, T) ACA, ACC, ACG, ACT Tryptophan (Trp, W) TGG Tyrosine (Tyr, Y) TAC, TAT Valine (Val, V) GTA, GTC, GTG, GTT

[0046] An important and well-known feature of the genetic code is its redundancy, whereby more than one coding nucleotide triplet may be employed for most of the amino acids used to make proteins. Thus, many different nucleotide sequences may code for a given amino acid sequence. Because such nucleotide sequences result in the production of the same amino acid sequence in all organisms, they are considered functionally equivalent (although certain organisms may translate some sequences more efficiently than they do others). Furthermore, occasionally, methylated variants of purines or pyrimidines may be found in a given nucleic acid sequence. Such methylation does not affect the coding relationship between the trinucleotide codon and the corresponding amino acid.

[0047] In view of the foregoing, the nucleotide sequence (or portion thereof) of a DNA or RNA encoding a fusion protein or polypeptide of the present invention can be used to derive the amino acid sequence of the fusion protein or polypeptide using the genetic code, which translates DNA or RNA into an amino acid sequence. Similarly, for the amino acid sequence of a fusion protein or polypeptide, the corresponding nucleotide sequence capable of encoding the fusion protein or polypeptide can be deduced from the genetic code (which, due to its redundancy, will result in multiple nucleic acid sequences for a given amino acid sequence). Thus, any description and / or disclosure herein of a polynucleotide sequence encoding a fusion protein or polypeptide should be considered to also include a description and / or disclosure of the amino acid sequence encoded by that nucleotide sequence. Similarly, any description and / or disclosure herein of the amino acid sequence of a fusion protein or polypeptide should also be considered to include a description and / or disclosure of all possible nucleotide sequences capable of encoding that amino acid sequence.

[0048] In some embodiments, the PD-L1 proteins of the present invention do not contain a signal sequence, as such a signal sequence is normally cleaved prior to secretion of the polynucleotide from the cell. In other embodiments, the PD-L1 proteins are soluble, i.e., consist of the IgV and IgC domains (i.e., the extracellular portion of full-length membrane-bound PD-L1), and may further include heterologous sequences, such as, for example, an Fc domain, a protein tag, a conjugated therapeutic agent, etc. Such soluble PD-L1 isoforms can be generated by alternative splicing in a number of ways known to those of skill in the art.

[0049] In a preferred embodiment, soluble PD-L1 comprises elimination of part of exon 5 and all of exons 6 and 7 of the full-length membrane-bound PD-L1 cDNA, as illustrated in Figure 2 herein. Soluble PD-L1 isoforms can be generated by fusing the N-terminal region of PD-L1 to the Fc of human IgG1, which in some embodiments can be linked by the amino acid sequence (GGGGS)n (SEQ ID NO: 5). In a preferred embodiment, the IgG1 Fc can be mutated to reduce antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDCC) by altering the following amino acids in the Fc domain: E233P, L234V, L235A, deletion of G236, A327G, A330S, and P331S. The Fc domain can be of human origin, and can also be derived from the Fc of human IgG1.

[0050] Nucleic acid delivery vehicle Administration of an expression vector containing a PD-L1 nucleic acid to achieve effective intestinal expression can be accomplished using methods known in the art. In a preferred embodiment, administration of a subject nucleic acid delivery vehicle is localized to the gastrointestinal tract (i.e., not administered systemically). In one embodiment, the nucleic acid delivery vehicle comprises a viral vector. In another embodiment, the nucleic acid delivery vehicle comprises a cationic liposome. In a preferred embodiment, the nucleic acid delivery vehicle comprises chitosan. In an alternative embodiment, a biological gene delivery vehicle (BGV), such as, for example, gastrointestinal bacteria, bacteriophage, virus-like particles, bioliposomes, etc., is used to deliver the PD-L1 polynucleotide to the gastrointestinal epithelium. For a review of BGVs currently under discussion, see Seow and Wood, Biological Gene Delivery Vehicles Beyond Viral Vectors, Molecular Therapy 17:767-777 (2009), the contents of which are incorporated herein in their entirety.

[0051] In certain embodiments, the nucleic acid delivery vehicle comprises a chitosan derivative, e.g., a chitosan incorporating additional functionalization, e.g., a chitosan with linked ligands. As used herein, "chitosan" is understood to include a broad category of chitosan-based polymers containing covalently modified N-acetyl-D-glucosamine and / or D-glucosamine units, as well as chitosan-based polymers incorporating other units or linked to other moieties. Derivatives are often based on modification of the hydroxyl or amine groups of glucosamine, e.g., arginine-functionalized chitosan. Examples of chitosan derivatives include, but are not limited to, trimethylated chitosan, PEGylated chitosan, thiolated chitosan, galactosylated chitosan, alkylated chitosan, PEI-incorporated chitosan, uronic acid-modified chitosan, glycol chitosan, etc. For further teachings regarding chitosan derivatives, see, for example, pp. 63-74 of "Non-viral Gene Therapy," K. Taira, K. Kataoka, T. Niidome (editors), Springer-Verlag Tokyo, 2005, ISBN 4-431-25122-7; Zhu et al., Chinese Science Bulletin, December 2007, vol. 52(23), pp. 3207-3215; and Varma et al., Carbohydrate Polymers 55(2004) 77-93.

[0052] Chitosans with a degree of deacetylation (DDA) greater than 50% are used in the present invention, with functionalization between 1% and 50% (the percentage of functionalization is determined relative to the number of free amino moieties in the chitosan polymer). The degree of deacetylation and functionalization imparts a specific charge density to the functionalized chitosan derivative. The resulting charge density affects solubility, nucleic acid binding and subsequent release, and interaction with mammalian cell membranes. Therefore, according to the present invention, these properties must be optimized for optimal efficacy. Exemplary chitosan derivatives are described in Baker et al.; Serial No. 11 / 657,382, filed January 24, 2007, which is incorporated herein by reference. In one embodiment, the doubly derivatized chitosan described herein comprises chitosan with a degree of deacetylation of at least 50%. In one embodiment, the degree of deacetylation is at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%. In a preferred embodiment, the doubly derivatized chitosan described herein comprises chitosan having a degree of deacetylation of at least 98%.

[0053] The chitosan derivatives described herein have a range of average molecular weights that are soluble at neutral and physiological pH, including, for purposes of the present invention, molecular weights ranging from 3 to 110 kDa. The embodiments described herein feature low average molecular weights (<25 kDa, from about 5 kDa to about 25 kDa) of derivatized chitosan, which can have desirable delivery and transfection properties, small size, and favorable solubility. Because low average molecular weight derivatized chitosans are generally more soluble than those with higher molecular weights, the former more readily release nucleic acids, creating nucleic acid / chitosan complexes that provide enhanced cell transfection.

[0054] In a preferred embodiment, administration of an expression vector containing a PD-L1 nucleic acid is achieved using chitosan or a chitosan derivative as a nucleic acid delivery vehicle. The chitosan derivatives described herein are produced by functionalizing the resulting free amino groups with positively charged and / or hydrophilic moieties. The derivatized chitosans described in International Patent Applications PCT / CA2013 / 050218 and PCT / CA2014 / 050921, the contents of which are incorporated herein by reference in their entireties, possess a number of advantageous properties for nucleic acid delivery vehicles, including their ability to effectively bind and complex negatively charged nucleic acids, their ability to be shaped into nanoparticles of controllable size, their ability to be taken up by cells, and their ability to release nucleic acids within cells at the appropriate time.

[0055] In a preferred embodiment, the term "doubly derivatized chitosan" or "DD-chitosan" is used to refer to a chitosan that has been doubly functionalized ("doubly functionalized chitosan" or "DF-chitosan"), for example, a chitosan that is conjugated with both Arg and a hydrophilic polyol, both of which are covalently attached to the chitosan. Arg may be covalently attached to the chitosan as a single amino acid or as a polypeptide. The hydrophilic polyol may be a sugar, such as glucose. By "DD-chitosan nucleic acid polyplex" or grammatical equivalents is meant a complex comprising multiple DD-chitosan molecules and multiple nucleic acid molecules encoding PD-L1 or a fragment thereof. In a preferred embodiment, the doubly derivatized chitosan is complexed with the nucleic acid encoding a PD-L1 polypeptide.

[0056] DD-chitosan PD-L1 nucleic acid polyplexes contain a PD-L1 nucleic acid component and a DD-chitosan component. Chitosan and DD-chitosan nucleic acid polyplexes may be prepared by methods known in the art. For example, the starting concentrations of functionalized chitosan and nucleotides may be adjusted to accommodate various amine-to-phosphate ratios (N / P), mixing ratios, and target nucleotide concentrations. A preferred method for polyplex formation is disclosed in WO 2009 / 039657, which is expressly incorporated herein by reference in its entirety.

[0057] Expression vectors and expression control regions The present invention relates to expression vectors comprising a PD-L1 nucleic acid, a promoter, and transcriptional and translational stop signals. Various nucleotide sequences and control sequences may be ligated together to create an expression vector that may contain one or more convenient restriction sites to allow for insertion or substitution of a nucleic acid encoding PD-L1 at such sites. Alternatively, a PD-L1 nucleic acid may be expressed by inserting a polynucleotide or nucleic acid construct comprising the PD-L1 nucleic acid into an appropriate vector for expression. In creating an expression vector, the PD-L1 coding sequence is located in the vector such that it is operably linked to appropriate control sequences for expression.

[0058] An expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and that can result in expression of a nucleic acid. The choice of vector will usually depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear plasmid or a closed circular plasmid. The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, and may be, for example, a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain a means for ensuring autonomous replication. Alternatively, the vector may be one that, upon introduction into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids may be used that together contain the entire nucleic acid to be introduced into the genome of the host cell or a transposon.

[0059] Vectors may optionally contain one or more selectable markers that allow for easy selection of transformed, transfected, transduced, etc. cells. A selectable marker is a gene the product of which provides biocide or viral resistance, resistance to heavy metals, photosynthetic nutrition for auxotrophs, etc. For autonomous replication, the vector may further contain an origin of replication that enables the vector to replicate autonomously in the host cell. The origin of replication may be a plasmid replicator that mediates autonomous replication in the cell. The term "origin of replication" or "plasmid replicator" refers to a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0060] In preferred embodiments, the expression vectors of the invention comprise a nucleic acid molecule encoding PD-L1 or a fragment thereof, comprising an expression control region operably linked to the coding region of the PD-L1 polypeptide as described herein. In some embodiments, the nucleic acid is DNA or RNA, e.g., mRNA. In some embodiments, the PD-L1 nucleic acid is an artificial nucleic acid. Preferred artificial nucleic acids include, but are not limited to, peptide nucleic acids (PNAs), phosphoramidate morpholino oligos (PMOs), locked nucleic acids (LNAs), glycol nucleic acids (GNAs), and threose nucleic acids (TNAs).

[0061] In one specific embodiment, the expression vector is pVAX_hPD-L1 as exemplified herein (Figure 1). In another specific embodiment, the expression vector is pVax_hPD-L1 Fc (Figure 2).

[0062] In some embodiments, the expression control region has constitutive activity. In many preferred embodiments, the expression control region does not have constitutive activity. This provides for dynamic expression of the PD-L1 nucleic acid. By "dynamic" expression is meant expression that varies over time. Dynamic expression may include several periods of low or no expression separated by periods of detectable expression. In many preferred embodiments, the PD-L1 nucleic acid is operably linked to a regulatable promoter. This provides for regulatable expression of the nucleic acid molecule. The expression control region includes regulatory polynucleotides (sometimes referred to herein as elements), such as promoters and enhancers, that affect expression of the operably linked PD-L1 nucleic acid.

[0063] The expression control elements included herein can be derived from bacteria, yeast, plants, or animals (mammalian or non-mammalian). Expression control regions include, for example, full-length promoter sequences, such as native promoter and enhancer elements, as well as subsequences or polynucleotide variants that retain all or part of the full-length or non-mutant function (e.g., retain some amount of nutritional regulation or cell / tissue-specific expression). As used herein, the term "functional" and grammatical variations thereof, when used in reference to a nucleic acid sequence, subsequence, or fragment, means that the sequence possesses one or more functions of the native nucleic acid sequence (e.g., the non-mutant or unmodified sequence). As used herein, the term "variant" refers to sequence substitutions, deletions, or additions, or other modifications (e.g., chemical derivatives, such as modified forms resistant to nucleases).

[0064] As used herein, the term "operably linked" refers to the physical juxtaposition of components so described that allow them to function in their intended manner. In the example of an expression control element in operably linked linkage with a nucleic acid, the relationship is that the control element regulates expression of the nucleic acid. Typically, an expression control region that regulates transcription is juxtaposed near the 5' end of the transcribed nucleic acid (i.e., "upstream"). An expression control region can also be located at the 3' end of the transcribed sequence (i.e., "downstream") or within the transcript (i.e., in an intron). An expression control element can be located some distance from the transcribed sequence (e.g., 100-500, 500-1000, 2000-5000 or more nucleotides from the nucleic acid). A specific example of an expression control element is a promoter, which is usually located 5' to the transcribed sequence. Another example of an expression control element is an enhancer, which can be located 5' or 3' to the transcribed sequence or within the transcribed sequence.

[0065] Some expression control regions confer regulatable expression of an operably linked PD-L1 nucleic acid. A signal (sometimes called a stimulus) can increase or decrease expression of a PD-L1 nucleic acid operably linked to such an expression control region. Such expression control regions that increase expression in response to a signal are often referred to as inducible. Such expression control regions that decrease expression in response to a signal are often referred to as inhibitory. Typically, the amount of increase or decrease conferred by such elements is proportional to the amount of signal present; the greater the amount of signal, the greater the increase or decrease in expression.

[0066] Numerous regulatable promoters are known in the art. Preferred inducible expression control regions include those containing inducible promoters stimulated by small molecule compounds. In one embodiment, the expression control region is responsive to a chemical that can be delivered orally but is not normally found in food. Specific examples can be found in U.S. Patent Nos. 5,989,910; 5,935,934; 6,015,709; and 6,004,941, all of which are incorporated herein by reference in their entirety.

[0067] In one embodiment, the expression vector further comprises an integration sequence. In one embodiment, the expression vector comprises a single integration sequence. In another embodiment, the expression vector comprises a first and a second integration sequence for integrating the PD-L1 nucleic acid, or a portion thereof, into the genome of the target cell. In a preferred embodiment, the integration sequence(s) are functional in combination with a means of integration selected from the group consisting of mariner, sleeping beauty, FLP, Cre, ΦC31, R, lambda, and a means of integration derived from an integrating virus, such as AAV, retrovirus, and lentivirus.

[0068] In one embodiment, the subject compositions further comprise a non-therapeutic construct in addition to the PD-L1 construct, wherein the non-therapeutic construct comprises a nucleic acid sequence encoding a means of integration operably linked to a second expression control region. This second expression control region and the expression control region operably linked to the PD-L1 nucleic acid can be the same or different. The encoded means for integration is preferably selected from the group consisting of Mariner, Sleeping Beauty, FLP, Cre, ΦC31, R, Lambda, and a means of integration derived from an integrating virus, such as AAV, retrovirus, and lentivirus.

[0069] The procedures used to ligate the above-described elements to construct the recombinant expression vectors of the present invention are well known to those of skill in the art; see, e.g., Sambrook et al., 1989, supra.) For further teachings, see WO2008020318, expressly incorporated herein by reference in its entirety.

[0070] Pharmaceutical preparations The present invention also provides "pharmaceutically acceptable" or "physiologically acceptable" formulations comprising the DD-chitosan nucleic acid polyplex compositions of the present invention, which can be administered in vivo to a subject to practice a therapeutic method.

[0071] As used herein, the terms "pharmaceutically acceptable" and "physiologically acceptable" refer to carriers, diluents, excipients, etc. that can be administered to a subject, preferably without causing undue adverse side effects (e.g., nausea, abdominal pain, headache, etc.). Such formulations for administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.

[0072] Pharmaceutical formulations can be made from carriers, diluents, excipients, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., that are compatible with administration to a subject. Such formulations can be contained in tablets (coated or uncoated), capsules (hard or soft), microbeads, emulsions, powders, granules, crystals, suspensions, syrups, or elixirs. Additional active compounds and preservatives, particularly additives such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may also be present.

[0073] Excipients may include salts, isotonicity agents, serum proteins, buffers or other pH-controlling agents, antioxidants, viscosity-increasing agents, uncharged polymers, preservatives, or cryoprotectants. The excipients used in the compositions of the present invention may further include isotonicity agents and buffers or other pH-controlling agents. These excipients may be added to achieve a desired range of pH (about 6.0-8.0) and osmolality (about 50-400 mmol / L). Examples of suitable buffers include acetate buffer, borate buffer, carbonate buffer, citrate buffer, phosphate buffer, and sulfonated organic molecule buffer. Such buffers may be present in the composition at a concentration of 0.01-1.0% (w / v). The isotonicity agent may be selected from any of those known in the art, such as mannitol, dextrose, glucose, and sodium chloride, or other electrolytes. Preferably, the isotonicity agent is glucose or sodium chloride. The isotonicity agent may be used in an amount that imparts to the composition an osmotic pressure that is the same as or similar to that of the biological environment to which it is introduced. The concentration of the isotonicity agent in the composition may range from about 0.1 to 10%, depending on the nature of the specific agent used. When glucose is used, it is preferably used at a concentration of 1-5% w / v, more particularly 5% w / v. When the isotonicity agent is sodium chloride, it is preferably employed in an amount of up to 1% w / v, particularly 0.9% w / v. The compositions of the present invention may further contain a preservative. Examples of preservatives include polyhexamethylene-biguanidine, benzalkonium chloride, stabilized oxychloro complexes (e.g., those known as Purite®), phenylmercuric acetate, chlorobutanol, sorbic acid, chlorhexidine, benzyl alcohol, parabens, and thimerosal. Typically, such preservatives are present at a concentration of about 0.001-1.0%. Additionally, the compositions of the present invention may also contain a cryopreservative. Preferred cryopreservatives are glucose, sucrose, mannitol, lactose, trehalose, sorbitol, colloidal silicon dioxide, dextran with a preferred molecular weight below 100,000 g / mol, glycerol, and polyethylene glycol with a molecular weight below 100,000 g / mol or mixtures thereof. Most preferred are glucose, trehalose, and polyethylene glycol.Typically, such cryopreservatives are present at a concentration of about 0.01-10%.

[0074] Pharmaceutical preparations can be formulated to be compatible with the intended route of administration. For example, for oral administration, the composition can be incorporated with excipients and used in the form of tablets, troches, capsules, e.g., gelatin capsules, or coatings, such as enteric coatings (Eudragit® or Slateric®). Pharmaceutically compatible binders and / or adjuvants can be included in the oral preparations. Tablets, pills, capsules, troches, etc. can contain any of the following ingredients or compounds of a similar nature: binders such as microcrystalline cellulose, gum tragacanth, or gelatin; excipients such as starch or lactose; disintegrants such as alginic acid, Primogel, or cornstarch; lubricants such as magnesium stearate or other stearates; glidants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavoring agents such as peppermint, methyl salicylate, or flavorings.

[0075] For example, controlled release formulations, including implants and microencapsulated delivery systems, can also include carriers to protect the composition against rapid degradation or elimination from the body. For example, a time delay material such as glyceryl monostearate or glyceryl stearate alone or in combination with a wax may be employed.

[0076] Suppositories and other rectally administrable formulations (e.g., those that can be administered by enema) are also contemplated. Further regarding rectal delivery, see, e.g., Song et al., Mucosal drug delivery: membranes, methodologies, and applications, Crit. Rev. Ther. Drug. Carrier Syst., 21:195-256, 2004; Wearley, Recent progress in protein and peptide delivery by noninvasive routes, Crit. Rev. Ther. Drug. Carrier Syst., 8:331-394, 1991.

[0077] Additional pharmaceutical formulations suitable for administration are known in the art and may be applicable to the methods and compositions of the present invention (see, e.g., Remington's Pharmaceutical Sciences, (1990) 18th ed., Mack Publishing Co., Easton, Pa.; The Merck Index (1996) 12th ed., Merck Publishing Group, Whitehouse, NJ; and Pharmaceutical Principles of Solid Dosage Forms, Technonic Publishing Co., Inc., Lancaster, Pa., (1993)).

[0078] Enteral administration The subject compositions may be administered orally. Oral administration may involve swallowing, so that the compound enters the digestive tract. The compositions of the present invention may be administered directly into the digestive tract. Syringes, endoscopes, cannulas, intubation tubes, catheters, and other devices may be used for such administration. Formulations suitable for oral administration include, for example, solid formulations such as tablets, capsules, coated capsules containing microparticles or coated microparticles; liquids or powders, lozenges (including those filled with liquids), gums, multiparticulates and nanoparticles, gels, films, suppositories, and sprays. Liquid formulations include suspensions, solutions, syrups and elixirs. Liquid formulations may also be prepared by the reconstitution of a solid.

[0079] Tablet dosage forms generally contain a disintegrant. Examples of disintegrants include sodium starch glycolate, sodium carboxymethylcellulose, calcium carboxymethylcellulose, croscarmellose sodium, crospovidone, polyvinylpyrrolidone, methylcellulose, microcrystalline cellulose, lower alkyl-substituted hydroxypropylcellulose, starch, pregelatinized starch, and sodium alginate. Generally, the disintegrant will constitute 1% to 25% by weight of the dosage form, preferably 5% to 20% by weight.

[0080] Binders are commonly used to impart cohesive properties to tablet formulations. Suitable binders include microcrystalline cellulose, gelatin, sugars, polyethylene glycol, natural and synthetic gums, polyvinylpyrrolidone, pregelatinized starch, hydroxypropyl cellulose, and hydroxypropyl methylcellulose. Tablets may also contain diluents such as lactose (monohydrate, spray-dried monohydrate, anhydrous, etc.), mannitol, xylitol, dextrose, sucrose, sorbitol, microcrystalline cellulose, starch, and dibasic calcium phosphate dihydrate.

[0081] Tablets may optionally contain surface active agents such as sodium lauryl sulfate and polysorbate 80, and glidants such as silicon dioxide and talc. When present, surface active agents may comprise from 0.2% to 5% by weight of the tablet, and glidants may comprise from 0.2% to 1% by weight of the tablet.

[0082] Tablets also generally contain a lubricant such as magnesium stearate, calcium stearate, zinc stearate, sodium stearyl fumarate, and mixtures of magnesium stearate with sodium lauryl sulfate. Lubricants generally comprise 0.25% to 10% by weight of the tablet, preferably 0.5% to 3%.

[0083] Other possible ingredients include antioxidants, colorants, flavorants, preservatives and taste-masking agents. Tablet blends may be compressed directly or by roller to form tablets. Tablet blends or portions of blends may alternatively be wet-, dry-, or melt-granulated, melt congealed, or extruded before tabletting. The final formulation may comprise one or more layers, which may be coated or uncoated; it may also be encapsulated.

[0084] Tablet formulation is discussed in Pharmaceutical Dosage Forms: Tablets, Vol. 1, by H. Lieberman and L. Lachman (Marcel Dekker, New York, 1980).

[0085] Consumable oral films for human or veterinary use are typically pliable, water-soluble or water-swellable thin film dosage forms that typically contain film-forming polymers, binders, solvents, humectants, plasticizers, stabilizers or emulsifiers, viscosity modifiers, and solvents, which may be fast-dissolving or mucoadhesive. Some components of the formulation may perform more than one function.

[0086] Also included in the present invention are multiparticulate beads comprising the compositions of the present invention.

[0087] Other possible ingredients include antioxidants, colorants, flavors and flavor enhancers, preservatives, salivary gland stimulants, cooling agents, co-solvents (including oils), emollients, bulking agents, anti-foaming agents, surfactants and taste masking agents.

[0088] Films according to the invention are typically prepared by evaporative drying of thin aqueous films coated onto a peelable backing support or paper, which may be done in a drying oven or drying tunnel, typically a combined coater dryer, or by freeze-drying or vacuuming. Solid dosage forms for oral administration may be formulated to be immediate and / or modified release, including delayed-, sustained-, pulsed-, controlled-, targeted-, and programmed-release.

[0089] Other suitable release technologies are known, such as high energy dispersions and osmotically coated particles.

[0090] Rectal / vaginal administration The compounds of the invention may also be administered rectally or vaginally, for example, in the form of a suppository, pessary, or enema. Cocoa butter is a traditional suppository base, but various alternatives may be used as appropriate.

[0091] Formulations for rectal / vaginal administration may be formulated to be immediate and / or modified release, including delayed-, sustained-, pulsed-, controlled-, targeted-, and programmed-release.

[0092] While preventing or inhibiting the progression or worsening of an inflammatory disease or condition or symptom is a satisfactory outcome, a dose, or "effective amount," for treating a subject is preferably sufficient to produce a measurable or detectable amelioration of one, some, or all of the symptoms of the condition. Thus, the amount of PD-L1 protein produced to ameliorate a condition treatable by the methods of the invention will depend on the condition and the desired outcome, but can be readily ascertained by one of skill in the art. An appropriate amount will depend on the condition being treated, the desired therapeutic effect, as well as the individual subject (e.g., bioavailability within the subject, gender, age, etc.). An effective amount can be ascertained by measuring the relevant physiological effect.

[0093] Veterinary applications are also contemplated by the present invention. Thus, in one embodiment, the present invention provides a method of treating a non-human mammal involving administering to the non-human mammal in need thereof chitosan-based nanoparticles of the present invention.

[0094] Treatment methods The subject compositions and methods are advantageously used in modulating inflammation. For example, therapeutic polypeptides may inhibit the proliferation and differentiation of cells involved in the inflammatory response. These molecules can be used to treat inflammatory conditions, chronic and acute, including inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, inflammatory bowel disease (IBD), Crohn's disease, colitis, or those resulting from the overproduction of cytokines (e.g., TNF or IL-1). Inflammatory diseases of particular interest for treatment in the present invention include, but are not limited to, Crohn's disease and inflammatory bowel disease.

[0095] The therapeutic compositions of the present invention may be used to treat and / or prevent organ rejection or graft-versus-host disease (GvHD). Organ rejection occurs through the destruction of transplanted tissue by host immune cells via an immune response. Similarly, an immune response is involved in GvHD, in which foreign transplanted immune cells destroy host tissue. Administration of the therapeutic compositions of the present invention, which inhibit immune responses, particularly T cell proliferation, differentiation, or chemotaxis, may be an effective therapy in preventing organ rejection or GvHD.

[0096] The examples set forth herein illustrate some embodiments of the present disclosure, but should not be construed as limiting the scope of the disclosure in any way. [Example]

[0097] Example 1 Plasmid construction and production

[0098] Both the optimized PD-L1 and PD-L1-Fc DNA sequences were cloned into a pVAX-backbone cloning vector. The plasmid contained a plasmid replication origin (pUC ori) with a kanamycin resistance gene (KAN) under the control of the human cytomegalovirus immediate-early gene promoter (CMV). The designed plasmid was custom synthesized by DNA2.0 (Newark, CA). Upon receipt, the DNA was reconstituted according to the manufacturer's recommendations. Briefly, the absorbent paper containing the DNA was placed into a small 0.2 mL test tube with a perforated bottom (achieved with a 23G needle). The small tube was then placed into a larger 1.5 mL test tube. 200 μL of water was added to the absorbent paper, incubated at RT for 1 minute, and then the tube was centrifuged at maximum speed for 1 minute. The solubilized DNA was collected in a 1.5 mL test tube. The DNA was then used to transform chemically competent E. coli DH5α bacteria. Briefly, 10 μL of eluted DNA was added to 100 μL of thawed E. coli DH5α cells under sterile conditions. After a 30-minute incubation on ice, the cells were heat-shocked at 42°C for 30 seconds and then incubated on ice for 2 minutes. 30 μL of Luria-Bertani (LB) medium was added to the DH5α transformed cells and incubated at 37°C for 1 hour with shaking at 80 rpm. The culture was then plated on an LB agar plate containing kanamycin (50 μg / mL) and incubated at 37°C for 16 hours. The next day, an isolated single colony was used to inoculate 6 mL of LB broth containing kanamycin (50 μg / mL). The culture was incubated at 37°C on a shaker (180 rpm) for 5–6 hours. The culture was then used to inoculate 2.5 L of LB medium, which was then incubated at 37°C on a shaker for 16 hours. Plasmid DNA was isolated from this large bacterial culture using the EndoFree Plasmid Giga Kit (QIAGEN) according to the manufacturer's instructions. Upon isolation, the PD-L1 and PD-L1-Fc DNA inserts within the plasmids were verified using restriction enzymes, and the fragment sizes were confirmed by agarose gel analysis.

[0099] Example 2 In vitro expression of PD-L1 and PD-L1-Fc

[0100] To evaluate in vitro expression from polyplexes, HEK-293T cells were seeded in 6-well tissue culture plates at a density of 800,000 cells per well in high-glucose DMEM complete medium (10% fetal bovine serum, 50 units / mL penicillin, 50 μg / mL streptomycin) and incubated overnight at 37°C and 5% CO2. The following day, PD-L1-Fc polyplexes were briefly thawed in a 37°C water bath. Each polyplex was diluted with sterile water to a DNA concentration of 12.5–200 μg / mL, corresponding to 0.5–8 μg of DNA per well, and kept on ice until transfection. The HEK-293T supernatant was removed from each well, and the cells were gently washed with 2 mL of pre-warmed OptiMEM. 1 mL of pre-warmed OptiMEM was gently added to each well. 40μL of diluted polyplexes were added to the wells and the plate was gently swirled to ensure proper mixing. The cells were incubated for 3 hours at 37℃ and 5% CO2. Following incubation, the cell culture medium was removed by pipetting and replaced with 2mL of pre-warmed DMEM complete medium, and the cells were incubated for 48 hours at 37℃ and 5% CO2. 48 hours after transfection, the cell culture medium was removed from wells transfected with PD-L1-Fc polyplexes or from untransfected cells as controls. Cell debris was removed from the supernatant by centrifugation (1500rpm, 4℃ for 5 minutes), and the supernatant was stored at -80℃ until analysis. To quantify total cellular protein, cell culture supernatant was removed from the wells, transfected cells were washed with cold PBS, and 500 μL of lysis buffer (50 mM Tris pH 8.0, 1% Triton X-100, 100 mM NaCl, 1 mM EDTA, 10% glycerol plus complete protease inhibitor cocktail) was added to the wells. The plate was left on ice for 2-3 minutes, and cells were harvested using a cell scraper, transferred to a 1.5 mL microcentrifuge tube, and left on ice for 30 minutes. Cell debris was removed from the lysate by centrifugation (13,000 rpm, 10 minutes at 4 °C), and total protein was measured by Lowry assay.

[0101] PD-L1 protein concentrations were measured by ELISA according to the manufacturer's protocol. Briefly, 96-well plates were coated with anti-human PD-L1 capture antibody and incubated overnight at 25°C. The next day, plates were washed with 0.05% Tween® 20 in PBS and blocked with 1% bovine serum albumin (BSA) in PBS for 1 hour, followed by an additional wash step. Samples or standards were added to the plates and incubated at 25°C for 2 hours. Biotinylated goat anti-human PD-L1 detection antibody was added to the wells for 2 hours, followed by washing and the addition of streptavidin-HRP for 20 minutes. The wells were washed, and HRP was detected by the addition of tetramethylbenzidine solution for 20 minutes. The reaction was terminated by the addition of 2N sulfuric acid, and the plates were read at 450 nm on a SpectraMAXPlus (ENG0214) using SoftMaxPro software. PD-L1 protein levels were calculated using lyophilized standard proteins provided by the manufacturer. Protein samples were fitted to a standard four-parameter logistic curve. In some cases, PD-L1 protein levels were normalized to total protein in transfected cells and expressed as ng of PD-L1-Fc per mg of total cellular protein.

[0102] To evaluate the transfection capacity of PD-L1-Fc polyplexes, HEK-293T cells were transfected with increasing amounts of DNA contained within the DD-X polymer. Quantitation of PD-L1 protein showed a dose-dependent increase in hPD-L1-Fc expression with increasing amounts of pVAX-opt-hPD-L1-Fc plasmid DNA (Figure 4A). Although the maximum expression of PD-L1-Fc (ng / mg) showed some variation between transfections, the EC50 was similar between independent transfections (Figure 4B).

[0103] Example 3 Purification of Fc fusion protein (PD-L1-Fc) 5 × 10 6HEK293T cells were plated into T75 flasks at 100 cells / flask and incubated at 37°C. The following day, cells were transfected with PD-L1-Fc plasmid DNA (9 μg / flask, 3 mL per flask) using Lipofectamine 2000 (Invitrogen) as recommended by the manufacturer and incubated at 37°C. After 24 hours, DMEM was replaced with 12 mL of EXCELL serum-free medium (Sigma-Aldrich). After 48 hours (72 hours post-transfection), the supernatant was collected and stored at -20°C until purification. The Fc fusion protein was purified using a Protein G HiTrap column (GE) as recommended by the manufacturer. The buffer was then exchanged using a PD-10 desalting column, and the protein was eluted in four fractions with PBS (Gibco). The presence of protein was detected by Coomassie staining. The concentration of PDL1 in each fraction was measured by ELISA (Duoset, R&D) as recommended by the manufacturer.

[0104] Example 4 In vitro PD-L1-Fc functional assay

[0105] To assess the functionality of Fc-fused PD-L1 constructs, anti-mouse CD3 (0.2 μg / mL, eBioscience) and / or anti-mouse CD28 (1 μg / mL, eBioscience) were added to wells of a 96-well flat-bottom plate in PBS (50 μl / well) with or without 5 μg / mL of PDL1-Fc produced in serum-free medium in vitro or commercially available rhPDL1-Fc (Adipogen). rhIgG1-Fc (Adipogen) was used as a negative control.

[0106] The plates were placed on a medium-speed plate shaker for 1 hour and then incubated overnight at 4°C. The next day, spleens were removed from three mice (Jackson Laboratories). Splenocytes were isolated by triturating the spleens with the frosted end of a microscope slide. Red blood cells were lysed in 5 mL of homemade ACK lysis buffer for 1 minute, and lysis was stopped by adding 45 mL of PBS (10% FBS). After centrifugation and decanting, cells from three mice were resuspended in supplemented RPMI medium (10% FBS, NEAA, L-glutamine, 2-ME; Multicell), pooled, counted, and adjusted to the appropriate concentration. A portion of the cells was stained with CellTrace Violet (Life Technologies) as recommended by the manufacturer. PBS was carefully removed from aCD3 / aCD28 96-well plates by pipetting. Cells were then seeded into wells of RPMI medium (200,000 cells / well) and incubated at 37°C for 3 or 4 days. At each time point, cells were transferred to a new 96-well V-bottom plate and stained with a live cell identification dye (eBioscience) for 30 minutes in the dark, allowing cells to be fixed on ice. Cells were washed twice with cold FACS buffer (PBS 2% FBS) and acquired on a flow cytometer (BD LSR II). Cell proliferation was measured by monitoring the peak of cell division in the CellTrace violet channel. Cell activation was measured by detecting cell size using a FSC-SSC gate.

[0107] To determine whether opt-hPD-L1-Fc binds to the human PD-1 receptor and activates intracellular signals, we used the PathHunter Jurkat PD-1 (SHP2) signaling assay (DiscoverX). Prior to running this assay, we generated a large batch of purified PD-L1-Fc protein. Briefly, PD-L1-Fc was expressed from the construct by transfecting HEK-293T cells with PD-L1-Fc plasmid DNA. Briefly, 3.9 x 10 cells were transfected into 30 ml of DMEM (Multicell) complete medium (10% FBS, 100 U / ml penicillin, 100 μg / ml streptomycin) in a T175 flask. 5HEK-293T cells were plated and incubated overnight at 37°C and 5% CO2. The next day, the medium was aspirated from the flask, and the cells were washed once with 10 ml of PBS (Multicell). Cells were transfected with 49 μg of PD-L1-Fc plasmid in 5.5 ml of OptiMEM (Gibco) using Lipofectamine 2000 (Life Technologies; 100 μl per flask). The cells were incubated for 2 hours (37°C and 5% CO2), after which 40 ml of DMEM complete medium was added to the flask. The cells were incubated for 24 hours, the medium was aspirated, and the cells were washed with 10 mL of PBS. EXCELL serum-free medium (45 mL; Sigma) was added to the flask and incubated at 37°C and 5% CO2. After 24 hours (48 hours post-transfection), the supernatant was removed and centrifuged at 1500 rpm for 5 minutes to remove cell debris. The supernatant was transferred to a new 50 mL tube and stored at -80°C. PD-L1-Fc was purified using a Protein G HiTrap column (GE) as recommended by the manufacturer. The buffer was exchanged with PBS using a PD-10 desalting column (GE) as recommended by the manufacturer. PD-L1-Fc was stored at -80°C until the protein was concentrated and quantified. PD-L1-Fc protein was concentrated using an Amicon Ultra-4 centrifugal filter (Millipore, Sigma) as recommended by the manufacturer. Protein was immediately quantified by PD-L1 ELISA (R&D). In some cases, the PD-L1-Fc concentrate was diluted to 1 mg / mL with PBS and stored at -80°C.

[0108] To assess intracellular activation via the human PD-L1 receptor, PathHunter cells were cultured as recommended by the manufacturer. Cells were centrifuged and resuspended in prewarmed Assay Complete Cell Plating Reagent. Cells were plated into wells of a white 96-well flat-bottom tissue culture plate (50 μl / well; 20,000 cells / well) and incubated at room temperature for 15 minutes. AssayComplete Cell Plating Reagent (10 μl / well) with or without anti-PD-1 (clone NAT105, Abcam) was added to the wells. Purified PD-L1-Fc protein or recombinant non-soluble human IgG1-Fc (Adipogen) was prepared in AssayComplete Cell Plating Reagent and added to the cells (50 μl / well). Cells were incubated at 37°C and 5% CO2 for 40 minutes. PathHunter Bioassay Reagent 1 was added to the cells (10 μl / well), and the plate was placed on a plate shaker at 350 rpm for 1 minute. Cells were incubated at room temperature in the dark for 15 minutes. PathHunter Bioassay Reagent 2 (40 μl) was added to each well, and cells were incubated at room temperature in the dark for 1 hour. Luminescence was read using a luminometer (enSpire-Perkin Elmer). Data were analyzed as luminescence (RLU; relative fluorescence units) compared to unstimulated controls. Data are presented as mean ± standard deviation. Data were analyzed using Student's t-test, and asterisks indicate statistical significance ( * , p ≤ 0.05; ** , p ≤ 0.01; *** , p ≤ 0.001).

[0109] The results described above are summarized here. To determine whether the protein expressed from the pVAX-opt-hPD-L1-Fc plasmid binds to the human PD-1 receptor and initiates intracellular signaling, we used the PathHunter Jurkat PD-1 (SHP2) signaling assay (DiscoverX). Signaling through the PD-1 receptor increased with increasing doses of purified PDL1-Fc and appeared to plateau at the maximum dose of 14.7 μM (783 μg / ml; Figure 6A). To confirm that this dose-dependent induction of luminescence was due to the specific interaction between PDL1 and PD-1, we used a competition assay (Figure 6B). Stimulation of PathHunter cells with purified PDL1-Fc, but not recombinant IgG1-Fc, resulted in increased luminescence, indicating that signaling induction was not due to PD-1 binding to the Fc fragment fused to the PD-L1 protein. Furthermore, PDL1-Fc-induced luminescence was suppressed when cells were incubated with anti-human PD-1 prior to stimulation with PD-L1-Fc, indicating that binding and signaling through the PD-1 receptor was due to the specific interaction between PDL1 and PD-1.

[0110] Example 5 In vitro expression and functional assay of wild-type membrane-bound PD-L1

[0111] To determine the dynamics of hPD-L1 expression on the cell surface, NIH / 3T3 cells were plated in 6-well plates (400,000 cells / well; 2 mL; DMEM 10% FBS) and incubated overnight at 37°C. The following day, cells were transfected with wild-type PD-L1 construct plasmid or pVAX control using Lipofectamine 2000 as recommended by the manufacturer. 24 hours after transfection, cells were washed with PBS, enzyme-free dissociation buffer (EFDB, Gibco; 2 mL / well) was added, incubated at 37°C for 5 minutes, and the cells were resuspended by gently pipetting them off the plate. Cells were centrifuged at 1500 rpm for 5 minutes and resuspended in DMEM (10% FBS). Cells were replated in 96-well flat-bottom plates (10,000 cells / well) and cultured for 2-5 days. At each time point, the supernatant was removed, the cells were resuspended in EFDB as described above, and the cells were distributed into a 96-well V-bottom plate for FACS staining. Cells were stained with anti-human PD-L1-PE (BioLegend) at 0.2 ng / well and the fixable live cell recognition dye, eFluor780 (eBioScience), as recommended by the supplier, for 30 minutes on ice in the dark. Cells were washed twice, resuspended in FACS buffer, and acquired on a flow cytometer.

[0112] A PD-1 binding assay was employed to examine the functionality of hPD-L1 expressed on the surface of NIH / 3T3 cells. NIH / 3T3 cells were transfected in 6-well plates as described above. 48 hours after transfection, cells were resuspended in EFDB as described above, centrifuged, resuspended in FACS buffer, and plated in 96-well V-bottom plates. Cells were centrifuged at 1500 rpm for 5 minutes, decanted, and resuspended (50 μl) with or without various concentrations of rhPD-1 (R&D) and incubated at 37°C for 30 minutes. Cells were centrifuged, washed twice with FACS buffer, and stained with anti-human PDL1-PE (0.2 ng / well) or isotype control, 0.8 ng / well anti-human PD-1-APC (eBioScience) or isotype control, and a live cell recognition dye for 30 minutes on ice in the dark. Cells were then washed twice, resuspended in FACS buffer, and acquired using a BD LSR II flow cytometer. Data were analyzed using FlowJo 10.2 software (Tree Star, OR, CA).

[0113] Example 6 In vivo efficacy testing

[0114] Models of GvHD

[0115] Ten-week-old female BALB / cSPF mice (Charles River) received a total total body irradiation of 700 cGy (RS2000 Biological Research X-ray source) in two 350 cGy fractionated doses, with the first irradiation administered in the afternoon of day -1 and the second in the morning of day 0. Eight- to 10-week-old male C57Bl6 / j mice (Charles River) were used for donor cells.

[0116] The study included three control groups (n=5): a non-irradiated group, a non-transplanted group, and a group that received 10 million BMTs only; and four treatment groups (n=8) that received 10 million BMTs and 2.5 million splenocytes. Beginning on day 1, mice were treated by enema once a week for the next 6 weeks (7 doses total) or left untreated. Animals were monitored daily for weight and clinical signs. Animals with weight loss greater than 25% and a clinical score of 8 or greater were terminated.

[0117] Weekly intracolonic administration of PD-L1 or PD-L1-Fc polyplexes reduced weight loss compared to pVAX control-treated animals (Figures 9A, 10A, 10B, and 11A). Mice receiving PD-L1 or PD-L1-Fc also showed a reduction in clinical signs associated with GvHD (Figure 9B) and improved survival compared to untreated and pVAX control-treated animals (Figures 9C, 10C, and 11B). Without being bound by theory, it is contemplated herein that as T cells pass through the gastrointestinal tract, they are exposed to PD-L1 polypeptides and become "tolerized." Upon leaving the gastrointestinal tract, T cells enter the circulation and can suppress the function of effector T cells. Tolerized T cells may result in the upregulation of regulatory T cell subsets and / or the reduction or suppression of pathogenic effector cells. Furthermore, PD-L1 has been shown to upregulate molecules important for epithelial repair. Without being bound by theory, it is also contemplated herein that, given that there is damage to gut barrier function following irradiation and disease, an increase in PD-L1, leading to increased epithelial repair, may also serve to restore gut barrier function.

[0118] Example 7 T cell colitis model

[0119] Total CD4+ T cells were isolated from the spleens of 6-8 week-old female C57BL / 6 mice via negative selection using a magnetic-activated cell sorting (MACS) CD4+ T cell isolation kit (Miltenyi Biotec, Auburn, CA). Subsequently, enriched cells were sorted for CD4+CD25-CD45RBhigh naive T cells using a FACS (FACSAria™, BD Biosciences, San Jose, CA). 5 x 105 CD4+CD25-CD45RBhigh cells were transferred intraperitoneally (IP) into 6-8 week-old female recipient B10-RAG2-deficient mice (Jackson).

[0120] Animals were monitored for weight and clinical signs two to three times weekly. On day 14, the presence of CD4 T cells was confirmed by flow cytometry staining for CD4. Weekly enema treatments began on days 15 or 19 after T cell transfer (a total of six or seven treatments). Animals were monitored twice weekly for weight and clinical signs. Animals with greater than 25% weight loss and severe clinical signs were terminated.

[0121] Weekly administration of PD-L1-Fc polyplexes by intracolonic infusion reduced weight loss and clinical signs of disease in PD-L1-Fc-treated mice compared to pVAX and sucrose control mice (Figure 13C-D). Furthermore, treatment with PD-L1-Fc polyplexes improved survival of mice compared to the control group (Figure 13E).

[0122] While the present disclosure has been described with reference to preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents substituted for elements thereof to adapt to a particular situation without departing from the scope of the disclosure. Accordingly, it is intended that the present disclosure not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this disclosure, but that the present disclosure will include all embodiments coming within the scope and spirit of the appended claims.

Claims

1. A pharmaceutical composition for use in treating inflammatory bowel disease, ulcerative colitis, Crohn's disease, or graft-versus-host disease (GvHD) by localized intestinal expression of human programmed cell death-ligand 1 ("PD-L1") polypeptide in a patient in need of such treatment, wherein the pharmaceutical composition contains an expression vector comprising a PD-L1 nucleic acid encoding a human PD-L1 polypeptide and is prepared for administration to the gastrointestinal tract of the patient; the expression vector is encapsulated in chitosan derivative nanoparticles comprising chitosan conjugated with arginine and a hydrophilic polyol; The PD-L1 nucleic acid is: a human PD-L1 polypeptide having 95% or more sequence identity with SEQ ID NO: 3, wherein the human PD-L1 polypeptide is a membrane-bound PD-L1 polypeptide (amino acids 1 to 259 of SEQ ID NO: 1) comprising a signal sequence, an IgV domain, an IgC domain, and a transmembrane domain of human PD-L1; or a PD-L1 polypeptide having 95% or more sequence identity to SEQ ID NO:4, wherein the PD-L1 polypeptide is fused at its N-terminus to an Fc region of human IgG1, and the Fc region of the human IgG1 is mutated to reduce antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDCC) by having one or more amino acid modifications in the Fc domain: E233P, L234V, L235A, deletion of G236, A327G, A330S, and P331S; The pharmaceutical composition comprising the sequence

2. 2. The pharmaceutical composition of claim 1, wherein the PD-L1 polypeptide is fused to the Fc region of human IgG1 or a portion thereof via the amino acid sequence (GGGGS)n (SEQ ID NO: 5).

3. The pharmaceutical composition of claim 1, wherein the PD-L1 nucleic acid has 95% or more sequence identity to SEQ ID NO: 4, the human PD-L1 polypeptide is fused to the N-terminus of the Fc region of human IgG1, and the Fc of the human IgG1 is mutated to reduce antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDCC) by changing one or more of the following amino acids in the Fc domain: E233P, L234V, L235A, deletion of G236, A327G, A330S, and P331S.

4. The pharmaceutical composition described in claim 3, wherein the Fc region of the human IgG1 contains all of the deletions of E233P, L234V, L235A, and G236, and the modifications of A327G, A330S, and P331S.

5. The pharmaceutical composition of claim 3, wherein the PD-L1 nucleic acid comprises the sequence of SEQ ID NO:

4.

6. The pharmaceutical composition of claim 1, wherein the PD-L1 nucleic acid has a sequence identity of 95% or more with SEQ ID NO: 3, and the PD-L1 polypeptide is a membrane-bound PD-L1 polypeptide (amino acids 1 to 259 of SEQ ID NO: 1) comprising or consisting of the signal transduction sequence, IgV domain, IgC domain, and transmembrane domain of human PD-L1.

7. The pharmaceutical composition of claim 6, wherein the PD-L1 polypeptide further comprises the cytoplasmic domain of human PD-L1.

8. The pharmaceutical composition of claim 6, wherein the PD-L1 nucleic acid comprises the sequence of SEQ ID NO:

3.

9. A pharmaceutical composition for localized intestinal expression of a human PD-L1 polypeptide, comprising an expression vector comprising a PD-L1 nucleic acid encoding the human PD-L1 polypeptide; the sequence of the PD-L1 nucleic acid comprises at least one synonymous substitution, preferably multiple synonymous substitutions, compared to SEQ ID NO: 2 for detection after administration, and the expression vector is encapsulated in chitosan derivative nanoparticles comprising chitosan conjugated with arginine and a hydrophilic polyol; The PD-L1 nucleic acid is: a human PD-L1 polypeptide having 95% or more sequence identity with SEQ ID NO: 3, wherein the human PD-L1 polypeptide is a membrane-bound PD-L1 polypeptide (amino acids 1 to 259 of SEQ ID NO: 1) comprising a signal sequence, an IgV domain, an IgC domain, and a transmembrane domain of human PD-L1; or a PD-L1 polypeptide having 95% or more sequence identity to SEQ ID NO:4, wherein the PD-L1 polypeptide is fused at its N-terminus to an Fc region of human IgG1, and the Fc region of the human IgG1 is mutated to reduce antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDCC) by having one or more amino acid modifications in the Fc domain: E233P, L234V, L235A, deletion of G236, A327G, A330S, and P331S; The pharmaceutical composition comprising the sequence 10. The pharmaceutical composition of claim 9, wherein the PD-L1 polypeptide is fused to the Fc region of human IgG1 or a portion thereof via the amino acid sequence (GGGGS)n.

11. The pharmaceutical composition of claim 9, wherein the PD-L1 nucleic acid has a sequence having 95% or more sequence identity with SEQ ID NO:4, the PD-L1 polypeptide is fused at the N-terminus to the Fc region of human IgG1, and the Fc of the human IgG1 is mutated to reduce antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDCC) by having one or more amino acid modifications in the Fc domain, including deletion of E233P, L234V, L235A, G236, A327G, A330S, and P331S.

12. The pharmaceutical composition described in claim 11, wherein the Fc of the human IgG1 has all of the following modifications: deletion of E233P, L234V, L235A, G236, A327G, A330S and P331S.

13. The pharmaceutical composition of claim 11, wherein the PD-L1 nucleic acid comprises the sequence of SEQ ID NO:

4.

14. The pharmaceutical composition of claim 9, wherein the PD-L1 nucleic acid has 95% or more sequence identity with SEQ ID NO: 3, and the human PD-L1 polypeptide is a membrane-bound PD-L1 polypeptide (amino acids 1 to 259 of SEQ ID NO: 1) comprising a signal sequence, an IgV domain, an IgC domain, and a transmembrane domain of human PD-L1.

15. The pharmaceutical composition of claim 14, wherein the PD-L1 polypeptide further comprises the cytoplasmic domain of human PD-L1.

16. The pharmaceutical composition of claim 14, wherein the PD-L1 nucleic acid comprises the sequence of SEQ ID NO:

3.

17. Use of a pharmaceutical composition described in any one of claims 9 to 16 in the preparation of a medicament for treating an inflammatory disease in a patient in need thereof, wherein the inflammatory disease is inflammatory bowel disease, ulcerative colitis, Crohn's disease or graft-versus-host disease (GvHD).

Citation Information

Patent Citations

  • Controlled release composition

    JP2005532387A

  • Gastric-resistant pharmaceutical dosage form containing n-(2-(2-phthalimidoethoxy)-acetyl)-l-alanyl-d-glutamic acid (lk-423)

    JP2007530492A

  • Bi-derivative chitosan nanoparticles and methods for their preparation and use for in vivo gene delivery.

    JP2015512372A

  • Dually derivatized chitosan nanoparticles and methods of making and using the same for gene transfer in vivo

    WO2015042711A1

  • A pharmaceutical composition containing combinations of nicotinamide and 5-aminosalicylic acid for beneficially influencing the intestinal microbiota and / or treating gastrointestinal inflammation

    WO2015086838A2