Pyrrole-imidazole polyamide, TGFβ gene expression inhibitor, and pharmaceutical composition

Abstract

Provided is a pyrrole-imidazole polyamide that binds to the promoters of two or more genes and simultaneously controls transcription of the two or more genes. Also provided is a pharmaceutical composition comprising the pyrrole-imidazole polyamide. Also provided are: a pyrrole-imidazole polyamide that simultaneously controls transcription of HGF gene and TGF-β gene; a TGF-β gene expression inhibitor comprising the pyrrole-imidazole polyamide; and a pharmaceutical composition for treating a TGF-β-associated disease or a fibrous disease.

Description

[Technical Field]

[0001] The present invention relates to a pyrrole-imidazole polyamide, a TGF-β gene expression inhibitor, a pharmaceutical composition, and a method for producing a pyrrole-imidazole polyamide. This application claims priority based on Japanese Patent Application No. 2020-123988, filed on July 20, 2020, the contents of which are incorporated herein by reference. [Background technology]

[0002] Pyrrole-imidazole polyamides (PI polyamides) are minor groove binders that strongly hydrogen bond to the minor groove of double-stranded DNA in a sequence-specific manner. By designing PI polyamides to bind to the transcriptional regulatory region of a target gene's promoter, they can be used to suppress target gene transcription. Furthermore, by conjugating alkylating agents to PI polyamides, target gene expression can be suppressed in a sequence-specific manner. PI polyamides can be distributed in vivo, taken up by cells, and bind to the nucleus without the need for drug delivery systems (DDS) such as lipids or viral vectors. In this respect, PI polyamides have advantages over DNA-recognizing compounds such as conventional nucleic acid drugs. PI polyamides can be freely designed to target various genes. Because they can specifically suppress the transcriptional activity of disease-causing genes activated by disease, they have few side effects. Furthermore, PI polyamides have the potential to be used as orally administered gene-regulating drugs. Therefore, numerous drug discovery studies have been conducted using PI polyamides.

[0003] TGF-β1 is a responsible factor for fibrotic diseases such as progressive kidney damage, liver cirrhosis, pulmonary fibrosis, etc. The present inventors have developed a PI polyamide that binds to the TGF-β1 gene promoter and suppresses TGF-β1 gene expression (Patent Document 1). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Patent No. 4682312 Summary of the Invention [Problem to be solved by the invention]

[0005] Conventional PI polyamides were designed to target the promoter of a specific gene. Therefore, conventional PI polyamides could only regulate the transcription of a single gene. However, there are cases where it is desired to simultaneously regulate the transcription of two or more target genes.

[0006] Therefore, the present invention aims to provide a novel pyrrole-imidazole polyamide capable of simultaneously controlling the transcription of two or more genes, a pharmaceutical composition containing the pyrrole-imidazole polyamide, and a method for producing the pyrrole-imidazole polyamide. Another objective of the present invention is to provide a pyrrole-imidazole polyamide that increases HGF expression and suppresses TGF-β expression, which are useful as therapeutic agents for TGF-β-related diseases or fibrotic diseases, as well as a TGF-β gene expression inhibitor using the pyrrole-imidazole polyamide, and a pharmaceutical composition for treating TGF-β-related diseases or fibrotic diseases. [Means for solving the problem]

[0007] The present invention includes the following aspects. [1] A pyrrole-imidazole polyamide that binds to promoters of two or more genes and controls the transcription of the two or more genes. [2] The pyrrole-imidazole polyamide according to [1], wherein the two or more types of genes include a first gene and a second gene, and the first gene is a gene encoding an expression control factor for the second gene. [3] The pyrrole-imidazole polyamide according to [2], which binds to a promoter of the first gene and inhibits binding of a transcription factor to the promoter of the first gene. [4] The pyrrole-imidazole polyamide according to [1], wherein the two or more genes include an HGF gene and a TGF-β gene. [5] The pyrrole-imidazole polyamide according to [4], which promotes transcription of the HGF gene and inhibits transcription of the TGF-β gene. [6] The pyrrole-imidazole polyamide according to [5], which binds to a transcription repression region in the promoter of the HGF gene. [7] The pyrrole-imidazole polyamide according to [6], which binds to a region containing at least a part of the base sequence set forth in SEQ ID NO: 1 in the promoter of the HGF gene. [8] The pyrrole-imidazole polyamide according to [7], which binds to a region in the promoter of the HGF gene, the region comprising any one of the following sequences 1 to 3: Sequence 1: AGGTGAC Sequence 2: ACCTTTT Sequence 3: CTTTTCT [9] The pyrrole-imidazole polyamide according to any one of [4] to [8], which binds to a transcription-promoting region in the promoter of the TGF-β gene.

[10] A pyrrole-imidazole polyamide represented by the following formula (P-3), (P-5) or (P-7):

[0008] [ka]

[0009] [ka]

[0010] [ka] [In the formula, R 1 and R 2 R each independently represents a monovalent organic group. 1 and R 2 may be linked to each other to form a divalent organic group.]

[11] The pyrrole-imidazole polyamide according to

[10] , which is represented by the following formula: Hu-HGF-3, Hu-HGF-5, or Hu-HGF-7.

[0011] [ka]

[0012] [ka]

[0013] [ka]

[0014]

[12] A TGF-β gene expression inhibitor comprising the pyrrole-imidazole polyamide according to any one of [4] to

[11] .

[13] A pharmaceutical composition comprising the pyrrole-imidazole polyamide according to any one of [1] to

[11] .

[14] A pharmaceutical composition for treating a TGF-β-related disease, comprising the pyrrole-imidazole polyamide according to any one of [4] to

[11] .

[15] A pharmaceutical composition for treating a fibrotic disease, comprising the pyrrole-imidazole polyamide according to any one of [4] to

[11] .

[16] A method for producing a pyrrole-imidazole polyamide, comprising: (a) a step of designing a pyrrole-imidazole polyamide that binds to promoters of two or more types of genes; (b) a step of synthesizing the pyrrole-imidazole polyamide; and (c) a step of selecting, from the synthesized pyrrole-imidazole polyamides, a pyrrole-imidazole polyamide that controls the transcription of the two or more types of genes. [Effects of the Invention]

[0015] The present invention provides novel pyrrole-imidazole polyamides capable of simultaneously controlling the transcription of two or more genes, pharmaceutical compositions containing the pyrrole-imidazole polyamides, and methods for producing pyrrole-imidazole polyamides. The present invention also provides pyrrole-imidazole polyamides that increase HGF expression and suppress TGF-β expression, which are useful as therapeutic agents for TGF-β-related diseases or fibrotic diseases, as well as TGF-β gene expression inhibitors and pharmaceutical compositions for treating TGF-β-related diseases or fibrotic diseases, each using the pyrrole-imidazole polyamide. [Brief explanation of the drawings]

[0016] [Figure 1] FIG. 1 is a diagram illustrating the relationship between HGF and TGF-β. [Figure 2] The nucleotide sequence of the human HGF promoter is shown. The underlined portion indicates the COUP-TF1 binding site (-108 to -96). [Figure 3] The design of two PI polyamides (Hu-HGF-1 and Hu-HGF-2) targeting the area surrounding the COUP-TF1 binding site is shown. The underlined parts indicate the COUP-TF1 binding site. Py: N-methylpyrrole unit; Im: N-methylimidazole unit; β: β-alanine unit; Ac: acetyl group; Dp: dimethylaminopropyl group. [Figure 4] Figure 1 shows the design of four PI polyamides (Hu-HGF-3, Hu-HGF-4, Hu-HGF-5, and Hu-HGF-6) that target the area surrounding the COUP-TF1 binding site. The underlined portion indicates the COUP-TF1 binding site. [Figure 5] The design of two PI polyamides (Hu-HGF-7 and Hu-HGF-8) that target the area surrounding the COUP-TF1 binding site is shown. The underlined portion indicates the COUP-TF1 binding site. [Figure 6] The structure of Hu-HGF-3 is shown. [Figure 7] The structure of Hu-HGF-5 is shown. [Figure 8] The structure of Hu-HGF-7 is shown. [Figure 9]The nucleotide sequence of the human TGF-β1 promoter is shown. "+1" indicates the transcription start site. The underlined portion indicates a transcription factor binding site. The dotted portion indicates a predicted transcription factor binding site. The sequence enclosed by a solid line indicates the binding site for Hu-HGF-3. The sequence enclosed by a dashed line indicates the binding site for Hu-HGF-7. [Figure 10] The human TGF-β1 promoter around the Hu-HGF-3 and Hu-HGF-7 binding sites is shown. The sequence enclosed by a solid line indicates the Hu-HGF-3 binding site. The sequence enclosed by a dashed line indicates the Hu-HGF-7 binding site. The dashed line indicates the predicted transcription factor binding site. [Figure 11] This shows the results of a gel shift assay of PI polyamides against the HGF promoter. Hu-HGF-1 and Hu-HGF-2 were used as PI polyamides. [Figure 12] 1 shows the results of a gel shift assay of PI polyamides against the HGF promoter. Hu-HGF-3 and Hu-HGF-4 were used as PI polyamides. [Figure 13] 1 shows the results of a gel shift assay of PI polyamides against the HGF promoter. Hu-HGF-5 and Hu-HGF-6 were used as PI polyamides. [Figure 14] The test protocols for HGF expression level analysis and TGF-β1 expression level analysis are outlined below. The procedures indicated as "For TGF-β1 expression analysis" were performed only for TGF-β1 expression analysis. [Figure 15] This shows the effect of Hu-HGF-3 on HGF mRNA expression levels in HDF cells. [Figure 16] This shows the effect of Hu-HGF-5 on HGF mRNA expression levels in HDF cells. [Figure 17] This shows the effect of Hu-HGF-7 on HGF mRNA expression levels in HDF cells. [Figure 18] This shows the effect of Hu-HGF-3 on the mRNA expression level of TGF-β1 in HDF cells. [Figure 19]This shows the effect of Hu-HGF-5 on the expression level of TGF-β1 mRNA in HDF cells. [Figure 20] This shows the effect of Hu-HGF-7 on the expression level of TGF-β1 mRNA. HGF cells were used. [Figure 21] This shows the effect of Hu-HGF-5 on the expression level of TGF-β1 mRNA in MC cells. [Figure 22] This shows the effect of Hu-HGF-3 on HGF protein expression in HDF cells. [Figure 23] This shows the effect of Hu-HGF-5 on HGF protein expression in HDF cells. [Figure 24] This shows the effect of Hu-HGF-7 on HGF protein expression in HDF cells. [Figure 25] This shows the effect of Hu-HGF-3 on TGF-β1 protein expression in HDF cells. [Figure 26] This shows the effect of Hu-HGF-5 on TGF-β1 protein expression in HDF cells. [Figure 27] This shows the effect of Hu-HGF-7 on TGF-β1 protein expression in HDF cells. [Figure 28] This figure shows the effect of Hu-HGF-3 on TGF-β1 protein expression in the presence of HGF siRNA. HDF cells were used. # indicates the result of a significant difference test compared to "1 DMSO" (# p<0.05). * indicates the result of a significant difference test compared to "2 DMSO + PMA + HGF siRNA" (*: p<0.05). [Figure 29] This figure shows the effect of Hu-HGF-6 on TGF-β1 protein expression in the presence of HGF siRNA. HDF cells were used. ** and *** indicate the results of a significant difference test compared to "2 DMSO + PMA + HGF siRNA" (**: p<0.01, ***: p<0.0001). [Figure 30] This shows the results of a TGF-β1 mRNA expression test using mismatched PI polyamide (HGF mismatch) in HDF cells. DETAILED DESCRIPTION OF THE INVENTION

[0017] [Pyrrole-imidazole polyamide (PI polyamide)] In one aspect, the present invention provides a pyrrole-imidazole polyamide that binds to promoter regions of two or more genes and regulates the transcription of the two or more genes.

[0018] PI polyamides are polyamides containing N-methylpyrrole units (Py) and N-methylimidazole units (Im), where Py and Im are linked by an amide bond (-C(=O)-NH-). PI polyamides generally contain a linker moiety (e.g., a γ-aminobutyric acid linker), which allows the entire polyamide to fold and assume a U-shaped conformation. In this U-shaped conformation, two chains containing Py and Im are arranged in parallel, sandwiching the linker moiety. Specific pair combinations in this double strand bind with high affinity to specific base pairs in DNA. This allows PI polyamides to enter the minor groove of the DNA double strand and bind to the DNA double strand in a sequence-specific manner.

[0019] In PI polyamides, a Py / Im pair binds to a CG base pair, an Im / Py pair binds to a GC base pair, and a Py / Py pair binds to an AT base pair or a TA base pair. PI polyamides may use a 3-hydroxypyrrole unit (Hp) and a β-alanine unit (β). The Hp / Py pair recognizes a TA base pair, the Py / Hp pair recognizes an AT base pair, the β / β pair recognizes a TA base pair or an AT base pair, the β / Im pair recognizes a CG base pair, the Im / β pair recognizes a GC base pair, and the β / Py pair and Py / β pair recognize a TA base pair or an AT base pair. By appropriately changing the composition and order of the pairs formed by the combination of Py, Im, β, and Hp, PI polyamides that bind to specific base sequences in DNA can be designed.

[0020] The number of pairs each consisting of a combination of Py, Im, Hp, and β constituting the PI polyamide is not particularly limited as long as it is 2 or more, but is preferably 3 to 12, more preferably 4 to 10, and even more preferably 4 to 8. When the PI polyamide has 5 or more pairs, it is preferable that at least one pair contains β.

[0021] The methyl group bonded to the nitrogen atom at position 1 of Py and Im may be substituted with a hydrogen atom or an aliphatic hydrocarbon group having 2 to 10 carbon atoms. The aliphatic hydrocarbon group may be linear or branched. The aliphatic hydrocarbon group may be saturated or unsaturated. The aliphatic hydrocarbon group is preferably an alkyl group, and examples thereof include an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, a sec-butyl group, an isobutyl group, and a tert-butyl group.

[0022] When the linker portion of the PI polyamide is a γ-aminobutyric acid linker, it may have a substituent at the α- or β-position. For example, it may be an N-α-N-γ-diaminobutyric acid linker in which the α-position is substituted with an amino group, or an N-β-N-γ-diaminobutyric acid linker in which the β-position is substituted with an amino group. The amino group may be modified with a molecule such as a fluorescent group or biotin.

[0023] Various molecules may be introduced into the terminal end of a PI polyamide. The molecules introduced into the terminal end of a PI polyamide are not particularly limited. Various molecules can be introduced into the terminal end of a PI polyamide, for example, via an amide bond. Examples of such molecules include, but are not limited to, fluorescent dyes, biotin, alkylating agents, etc. For example, an acetyl group may be introduced into the N-terminal end of a PI polyamide, and a dimethylaminopropylamino group may be introduced into the C-terminal end.

[0024] PI polyamides can be synthesized by known methods. For example, PI polyamides can be produced by automated synthesis using a solid-phase method (solid-phase Fmoc method) using Fmoc (9-fluorenylmethoxycarbonyl) (WO 03 / 000683). The solid-phase Fmoc method allows the termini of PI polyamides to be cleaved from the solid support as carboxylic acid residues. Therefore, various functional groups can be introduced into the molecular termini to produce PI polyamide derivatives. For example, compounds capable of alkylating DNA, such as duocarmycin, pyrrolobenzodiazepine, bleomycin, enediyne compounds, nitrogen mustard, and their derivatives, can also be introduced into the termini of PI polyamides. Because the solid-phase Fmoc method is an automated synthesis method using a commercially available protein (peptide) synthesizer, it is also possible to synthesize conjugates of pyrrole-imidazole polyamides with naturally occurring or non-naturally occurring proteins. Furthermore, the solid-phase Fmoc method has milder reaction conditions than the t-BOC method, making it possible to introduce organic compounds other than proteins (including compounds with functional groups that are unstable under acidic conditions). For example, it is possible to automatically synthesize conjugates of pyrrole-imidazole polyamides with DNA or RNA (or their derivatives).

[0025] The solid-phase Fmoc method and the like enable the synthesis of PI polyamides having a carboxy group at their terminals. Specific examples include PI polyamides having a β-alanine residue (β-aminopropionic acid residue) or a γ-aminobutyric acid residue at their terminals. PI polyamides having a β-alanine residue or a γ-aminobutyric acid residue at their terminals can be synthesized by the solid-phase Fmoc method using a peptide synthesizer and a solid-phase support carrying aminopyrrolecarboxylic acid, aminoimidazolecarboxylic acid, β-alanine, or γ-aminobutyric acid, each of which has its amino group protected with Fmoc.

[0026] Specific examples of aminopyrrolecarboxylic acids include 4-amino-2-pyrrolecarboxylic acid, 4-amino-1-methyl-2-pyrrolecarboxylic acid, 4-amino-1-ethyl-2-pyrrolecarboxylic acid, 4-amino-1-propyl-2-pyrrolecarboxylic acid, 4-amino-1-butyl-2-pyrrolecarboxylic acid, etc. Specific examples of aminoimidazolecarboxylic acids include 4-amino-2-imidazolecarboxylic acid, 4-amino-1-methyl-2-imidazolecarboxylic acid, 4-amino-1-ethyl-2-imidazolecarboxylic acid, 4-amino-1-propyl-2-imidazolecarboxylic acid, 4-amino-1-butyl-2-imidazolecarboxylic acid, etc.

[0027] The solid-phase Fmoc method can also be used to synthesize, for example, a conjugate of a PI polyamide and FITC (fluorescein isothiocyanate). FITC has been known as a fluorescent labeling reagent for antibodies. The conjugate of a PI polyamide and FITC can be used to demonstrate that the PI polyamide recognizes a specific DNA sequence.

[0028] The PI polyamide of this embodiment binds to the promoters of two or more genes and controls the transcription of the two or more genes. Conventionally, PI polyamides have been designed to target the promoter of one specific gene with the aim of controlling the expression of the gene. On the other hand, the PI polyamide of this embodiment is designed based on the entirely new concept of simultaneously controlling the expression of two or more genes. The PI polyamide of this embodiment is designed to bind to the promoters of two or more genes. By binding to the promoters of two or more genes, it becomes possible to control the transcription of two or more genes with one type of PI polyamide. The PI polyamide of this embodiment is preferably designed to bind to a transcription-promoting region or a transcription-repressing region in the promoters of two or more genes.

[0029] As used herein, the term "promoter" refers to a region located upstream of a gene and regulating the transcription of the gene. As used herein, the term "transcription-promoting region" refers to a region located upstream of a gene, to which a transcription factor or a complex protein binds, thereby promoting transcription of the gene. A transcription-promoting region can usually be present in a promoter. As used herein, the term "transcriptional repression region" refers to a region located upstream of a gene, where transcription of the gene is repressed by binding of a transcription factor or a complex protein, etc. A transcriptional repression region can usually be present in a promoter. In this specification, the transcription-promoting region and the transcription-repressing region may be collectively referred to as the "transcriptional control region." As used herein, the term "transcriptional regulatory factor" refers to a protein (including transcription factors, complex proteins, etc.) that binds to the transcription-promoting region or transcription-repressing region of a specific gene and promotes or suppresses the transcription of the gene. As used herein, the term "expression control factor" refers to a protein (including transcription factors, conjugated proteins, etc.) that promotes or suppresses the expression of a specific gene. An expression control factor may be any protein whose presence upregulates or downregulates the expression of the specific gene, and includes transcription control factors.

[0030] When a transcription control factor binds to a transcription-promoting region in a promoter, gene transcription is initiated or promoted. When a transcription control factor binds to a transcription-repressing region in a promoter, gene transcription is repressed. Therefore, gene transcription can be inhibited by inhibiting the binding of a transcription control factor to a transcription-promoting region in a promoter. Also, gene transcription can be promoted by inhibiting the binding of a transcription control factor to a transcription-repressing region in a promoter. Therefore, when a PI polyamide binds to a transcription-promoting region in a promoter, binding of a transcription control factor to the transcription-promoting region is inhibited, and gene expression is inhibited. When a PI polyamide binds to a transcription-repressing region in a promoter, binding of a transcription control factor to the transcription-repressing region is inhibited, and gene expression is initiated or promoted.

[0031] As used herein, "regulating gene transcription" refers to changing the transcriptional activity of a gene. Transcriptional regulation may be up-regulation or down-regulation. When a PI polyamide binds to a transcription-promoting region in a promoter, the binding of a transcriptional regulator to the transcription-promoting region is inhibited, resulting in down-regulation of gene expression. When a PI polyamide binds to a transcription-repressing region in a promoter, the binding of a transcriptional regulator to the transcription-repressing region is inhibited, resulting in up-regulation of gene expression.

[0032] A PI polyamide that binds to promoters of two or more types of genes can be designed, for example, as follows.

[0033] First, two or more genes to be targeted by the PI polyamide are selected. The two or more genes can be selected arbitrarily depending on the purpose. Examples of the two or more genes include a combination of two or more genes whose expression is increased or decreased in a specific disease; a combination of a gene whose expression is increased in a specific disease and a gene whose expression is decreased in the specific disease; etc.

[0034] For example, the presence of cancer-specific oncogenes whose expression is elevated in cancer-specific manner is known. Examples of genes whose expression is elevated in cancer-specific manner include CA125, CEA, CD123, CD133, CD138, CD19, CD20, CD22, CD23, CD24, CD25, CD30, CD33, CD34, CD4, CD40, CD44, CD56, CD70, CD8, CLL-1, c-Met, PSA, PSMA, ROR1, HER2, MAGE, and p53. When the PI polyamide is intended for cancer therapy, two or more of these oncogenes may be selected as target genes. Alternatively, two or more target genes may be selected: an immune checkpoint molecule gene (PD1, PD-L1, CTLA-4, etc.) and an oncogene.

[0035] An example of a combination of a gene whose expression is increased in a specific disease and a gene whose expression is decreased in the specific disease is a combination of the TGF-β gene and the HGF gene.

[0036] Next, the promoter sequences of two or more target genes are analyzed to identify transcription-promoting regions and transcription-repressing regions. For example, for genes whose expression is to be repressed, transcription-promoting regions are obtained. For genes whose expression is to be promoted, transcription-repressing regions are obtained.

[0037] Next, for one of the two or more target genes, a PI polyamide that binds to a specific sequence in the obtained transcriptional regulatory region is designed. Then, it is confirmed whether the designed PI polyamide can bind to the transcriptional regulatory regions of the remaining target genes. If the PI polyamide can bind to the transcriptional regulatory regions of all the target genes, that PI polyamide is selected. If there is a target gene whose transcriptional regulatory region cannot be bound, another sequence in the transcriptional regulatory region is selected and the PI polyamide is redesigned. The redesigned PI polyamide is then confirmed to be capable of binding to the transcriptional regulatory regions of the remaining target genes. The above steps are repeated until PI polyamides capable of binding to the transcriptional regulatory regions of all target genes are obtained.

[0038] As described above, a PI polyamide that binds to the transcriptional regulatory regions of two or more types of genes can be obtained.

[0039] Whether the obtained PI polyamide binds to the transcriptional regulatory regions of two or more genes and exerts the desired expression control function can be confirmed by culturing cells having the target gene in the presence of the obtained PI polyamide.

[0040] The number of target genes of a PI polyamide is not particularly limited, and is, for example, 2 to 5, 2 to 4, 2 to 3, or 2.

[0041] In one embodiment, the PI polyamide can regulate the transcription of both a first gene and a second gene. In one embodiment, the first gene is a gene encoding a transcriptional regulator of the second gene.

[0042] When a first gene is an expression control factor that represses the expression of a second gene, the transcription of the second gene can be more strongly repressed by promoting the transcription of the first gene and inhibiting the transcription of the second gene with a PI polyamide. In this case, the PI polyamide preferably binds to a transcription repression region in the promoter of the first gene. Also, the PI polyamide preferably binds to a transcription promotion region in the promoter of the second gene. Furthermore, when a first gene is an expression control factor that represses the expression of a second gene, the transcription of the second gene can be more strongly promoted by repressing the transcription of the first gene and promoting the transcription of the second gene with a PI polyamide. In this case, the PI polyamide preferably binds to a transcription-promoting region in the promoter of the first gene. Furthermore, the PI polyamide preferably binds to a transcription-repressing region in the promoter of the second gene.

[0043] When a first gene is an expression control factor that promotes the expression of a second gene, the transcription of the second gene can be more strongly promoted by promoting the transcription of the first gene and the transcription of the second gene with a PI polyamide. In this case, the PI polyamide preferably binds to a transcription repression region in the promoter of the first gene. Also, the PI polyamide preferably binds to a transcription repression region in the promoter of the second gene. Furthermore, when a first gene is an expression control factor that promotes the expression of a second gene, the transcription of the second gene can be more strongly suppressed by suppressing the transcription of the first gene and the transcription of the second gene with a PI polyamide. In this case, the PI polyamide preferably binds to a transcription-promoting region in the promoter of the first gene. Furthermore, the PI polyamide preferably binds to a transcription-promoting region in the promoter of the second gene.

[0044] The first gene and the second gene are not particularly limited, and any one can be used. As a combination of the first gene and the second gene, any combination may be selected depending on the purpose from, for example, the combinations of two or more target genes listed above. An example of the first gene is the HGF gene. An example of the second gene is the TGF-β gene.

[0045] When the first gene is the HGF gene and the second gene is the TGF-β gene, the PI polyamide preferably has the function of promoting transcription of the HGF gene and inhibiting transcription of the TGF-β gene. Hereinafter, a PI polyamide in which the first gene is the HGF gene and the second gene is TGF-β may be referred to as a "PI polyamide (P)."

[0046] Figure 1 is a diagram illustrating the relationship between HGF and TGF-β. TGF-β activates fibroblasts, mesangial cells, and induces epithelial-mesenchymal transition, promoting tissue fibrosis. HGF exhibits angiogenic, anti-apoptotic, and anti-fibrotic effects, and also inhibits the expression of TGF-β. Therefore, increasing the expression level of HGF suppresses the expression level of TGF-β, thereby inhibiting the progression of fibrosis.

[0047] PI polyamide (P) promotes transcription of the HGF gene and inhibits transcription of the TGF-β gene. When HGF expression levels increase due to the promotion of HGF gene transcription, the inhibitory effect of HGF on TGF-β expression becomes stronger. Furthermore, because PI polyamide (P) directly inhibits transcription of the TGF-β gene, the additive effect of this inhibitory effect on TGF-β expression by HGF strongly suppresses TGF-β protein expression. Therefore, PI polyamide (P) can efficiently inhibit the progression of fibrosis caused by TGF-β.

[0048] PI polyamide (P) can suppress TGF-β expression through two expression suppression mechanisms: an HGF-mediated TGF-β expression suppression mechanism by promoting HGF gene transcription (hereinafter also referred to as "expression suppression mechanism 1"), and a TGF-β expression suppression mechanism by inhibiting TGF-β gene transcription (hereinafter also referred to as "expression suppression mechanism 2"). Therefore, PI polyamide (P) can suppress TGF-β expression at lower concentrations than conventional PI polyamides that suppress TGF-β expression only through expression suppression mechanism 2.

[0049] PI polyamide (P) preferably binds to the transcription repression region in the promoter of the HGF gene (hereinafter also referred to as "HGF promoter"), thereby inhibiting the binding of a transcription control factor to the transcription repression region in the HGF promoter. By inhibiting the binding of a transcription control factor to the transcription repression region in the HGF promoter, transcription repression of the HGF gene due to binding of the transcription control factor to the transcription repression region does not occur. As a result, transcription of the HGF gene is promoted.

[0050] PI polyamide (P) preferably binds to a region of the HGF promoter that contains at least a portion of the nucleotide sequence (AGGTGACCTTTTC) set forth in SEQ ID NO: 1. The nucleotide sequence set forth in SEQ ID NO: 1 is a sequence predicted as a binding site for COUP-TF1 based on analysis of the human HGF promoter. It has been reported that COUP-TF1 binding sites are often transcriptional repression regions. It has been reported that COUP-TF1 often acts as a transcriptional repressor by binding to the binding site.

[0051] Specific examples of sequences in the HGF promoter to which PI polyamides (P) bind include regions containing any of the following sequences 1 to 3. As shown in the Examples below, PI polyamides (Hu-HGF-3, Hu-HGF-5, and Hu-HGF-7) designed to bind to the following sequences 1 to 3 can effectively suppress the expression of TGF-β1. Sequence 1: AGGTGAC Sequence 2: ACCTTTT Sequence 3: CTTTTCT

[0052] PI polyamide (P) preferably inhibits transcription of the TGF-β gene by binding to a transcription repression region in the promoter of the TGF-β gene (hereinafter referred to as "TGF-β promoter"). Preferably, PI polyamide (P) inhibits transcription of the TGF-β gene by inhibiting the binding of a transcription control factor to the transcription repression region in the TGF-β promoter. TGF-β may be any of TGF-β1, TGF-β2, and TGF-β3, but is preferably TGF-β1. PI polyamide (P) may also change the three-dimensional structure of the TGF-β promoter by binding to a peripheral region of the TGF-β promoter, thereby inhibiting the binding of a transcription control factor to the transcription repression region in the TGF-β promoter.

[0053] Suitable examples of the PI polyamide (P) are listed below.

[0054] [ka]

[0055] [ka]

[0056] [ka] [In the formula, R 1 and R 2 R each independently represents a monovalent organic group. 1 and R 2 may be linked to each other to form a divalent organic group.]

[0057] In the formulas (P-3), (P-5) and (P-7), R 1 and R 2 R each independently represents a monovalent organic group. 1 and R 2is not particularly limited and can be any organic group. 1 and R 2 Any molecule may be introduced into the PI polyamide terminal via, for example, an amide bond. Examples of the molecule to be introduced include those exemplified above as molecules to be introduced into the PI polyamide terminal.

[0058] R 1 For example, -NHCO-R 11 (R 11 R may be a group represented by a monovalent organic group. 11 is not particularly limited, and examples thereof include aliphatic hydrocarbon groups. The aliphatic hydrocarbon group may be linear, branched, or cyclic. The aliphatic hydrocarbon group may be saturated or unsaturated. The number of carbon atoms in the aliphatic hydrocarbon group may be, for example, 1 to 10 carbon atoms, 1 to 5 carbon atoms, 1 to 3 carbon atoms, or 1 or 2 carbon atoms. The R 11 As the group, an alkyl group is preferable, and examples thereof include a methyl group and an ethyl group.

[0059] R 2 For example, -CONH-R 21 (R 21 R may be a group represented by a monovalent organic group. 21 is not particularly limited, and examples thereof include an aliphatic hydrocarbon group which may have a substituent. The aliphatic hydrocarbon group may be linear, branched, or cyclic. The aliphatic hydrocarbon group may be saturated or unsaturated. The number of carbon atoms in the aliphatic hydrocarbon group may be, for example, 1 to 15, 1 to 10, or 1 to 6 carbon atoms. Examples of substituents that the aliphatic hydrocarbon group may have include, but are not limited to, an amino group, a hydroxy group, and a carboxy group. The aliphatic hydrocarbon group may have a carbon chain in which some of the carbon atoms constituting the carbon chain are substituted with -O-, -CO-, -COO-, -CONH-, etc. 21 is -β-R 22 (β is a β-alanine unit; R 22R may be a group represented by a monovalent organic group. 22 is not particularly limited, and examples thereof include an aliphatic hydrocarbon group which may have a substituent. Examples of the aliphatic hydrocarbon group which may have a substituent include R 21 The same as those listed in R 22 Examples of R include dimethylaminoalkyl groups and aminoalkyl groups. 22 Specific examples of the group include a dimethylaminopropyl group and an aminopropyl group.

[0060] R 1 and R 2 may be linked to each other to form a divalent organic group. In this case, the PI polyamide represented by formula (P-3), (P-5), or (P-7) forms a cyclic structure. Peptides with a cyclic structure are known to be suitable for oral administration (Keiichi Masuya, J. Pharmacol. J. Pharmacol. 148, 322-328 (2016)). It has also been reported that the binding properties of PI polyamides do not change significantly even when the PI polyamides are cyclic (David M. Chenoweth, J. Am. Chem. Soc. 2009 May 27; 131(20): 7182-7188). Therefore, PI polyamides with a cyclic structure are promising as orally administered drugs.

[0061] Specific examples of the PI polyamide (P) represented by the above formula (P-3), (P-5), or (P-7) are listed below.

[0062] [ka]

[0063] [ka]

[0064] [ka]

[0065] [TGF-β gene expression inhibitor] In one aspect, the present invention provides a TGF-β gene expression inhibitor comprising a PI polyamide (P).

[0066] As described above, PI polyamide (P) can effectively suppress TGF-β gene expression, and therefore, PI polyamide (P) can be used as an agent for suppressing TGF-β gene expression.

[0067] As used herein, "gene expression" refers to the transcription and translation of a gene to produce a protein encoded by the gene. "Gene expression inhibitor" refers to a drug that has the effect of suppressing the production of a protein encoded by the gene.

[0068] The TGF-β gene expression inhibitor of this embodiment may be used in vitro or in vivo. When used in vitro, it is preferably used in human cells or common marmoset cells. When used in vivo, it is preferably administered to humans or common marmosets. When used in vivo, it may be formulated as a pharmaceutical composition as described below.

[0069] [Pharmaceutical composition] In one aspect, the present invention provides a pharmaceutical composition comprising the PI polyamide.

[0070] The PI polyamide of the above embodiment can regulate the transcription of two or more target genes, and therefore can be used as a pharmaceutical composition for treating diseases accompanied by abnormal gene expression. The two or more target genes can be appropriately selected depending on the disease to be treated.

[0071] In one aspect, the present invention provides a pharmaceutical composition for treating a TGF-β-related disease, comprising a PI polyamide (P). In one aspect, the present invention provides a pharmaceutical composition for treating a fibrotic disease, comprising a PI polyamide (P).

[0072] As used herein, "TGF-β-related disease" refers to a disease caused by an increase in TGF-β. Examples of TGF-β-related diseases include, but are not limited to, fibrotic diseases, various kidney diseases, and male-pattern frontal alopecia. "Fibrotic disease" refers to a disease that occurs with fibrosis of tissues or organs. Fibrotic diseases are not particularly limited, but include, but are not limited to, liver cirrhosis, pulmonary fibrosis, renal fibrosis, pancreatic fibrosis, myocardial fibrosis, myelofibrosis, retroperitoneal fibrosis, mesenteric fibrosis, mammary fibrosis, cystic fibrosis, gastrointestinal fibrosis, adipose tissue fibrosis, systemic sclerosis, localized scleroderma, keloids, hypertrophic scars, scars after skin wounds or skin ulcers, and skin fibrosis. Fibrotic diseases preferably include, but are not limited to, the various liver diseases, various kidney diseases, pancreatic fibrosis, myocardial fibrosis, and various skin fibrosis diseases described below.

[0073] Hepatic stellate cells play an important role in the production of extracellular matrix during the process of liver fibrosis (Bataller R et al., Gastroenterology 118, 1149, 2000). Stellate cells are activated by TGF-β1, which in turn induces the secretion of TGF-β1 from inflammatory cells in injured livers. At the same time, the expression of TGF-β1 receptors in activated stellate cells increases, leading to an autocrine increase in extracellular matrix proteins via TGF-β1 (Watanabe Hisataka et al., Modern Medicine, Vol. 35 (No. 2), 2003). Based on these findings, the various liver diseases mentioned above can be considered examples of TGF-β-related diseases.

[0074] Furthermore, TGF-β expression has been shown to increase in parallel with extracellular matrix in renal biopsies from animal models of renal diseases, including IgA nephropathy, focal glomerulosclerosis, crescentic lupus nephritis, focal sclerosing lupus nephritis, diffuse proliferative lupus nephritis, diabetic nephropathy, and hypertensive nephrosclerosis, as well as from patients with glomerulonephritis or diabetic nephropathy (Yamamoto T et al., Kidney Int 49:461, 1996; Border WA et al., Kidney Int 51:1388, 1997). Border et al. also reported that administration of anti-TGF-β to Thy-1 nephritis rats inhibited the accumulation of extracellular matrix in the renal glomeruli (Border WA et al., Kidney Int 51:1388, 1997). These findings suggest that the above renal diseases can be exemplified as TGF-β-related disorders.

[0075] Furthermore, in animal models of myocardial infarction, TGF-β expression is continuously elevated in the infarct lesion during the scar formation stage, and is involved in promoting myocardial fibrosis (Ono et al.: Circulation 98:149, 1998). Based on these facts, myocardial fibrosis after myocardial infarction can be exemplified as a TGF-β-related disease.

[0076] Furthermore, administration of anti-TGF-β antibodies or TGF-β soluble receptors to pulmonary fibrosis model animals improved pulmonary fibrosis (Giri SN et al: Thorax 1993). These facts suggest that pulmonary fibrosis is an example of a TGF-β-related disease.

[0077] Furthermore, while there have been numerous reports of high expression of TGF-β1 in human chronic pancreatitis, it has also been shown that administration of recombinant TGF-β to an animal model of recurrent acute pancreatitis induces fibrosis in the inflamed areas of the pancreas and high expression of fibronectin mRNA. Conversely, administration of a TGF-β1 neutralizing antibody during pancreatitis model creation suppresses extracellular matrix production and the mRNA expression of type I and III collagens and fibronectin (Makino, Naohiko et al.: Modern Medicine, Vol. 35, No. 2, 2003). Based on these findings, fibrosis in chronic pancreatitis can be exemplified as a TGF-β-related disease.

[0078] Furthermore, TGF-β has been proposed as a cause of scleroderma, and Mori et al. reported that TGF-β induces skin fibrosis in a mouse model of skin fibrosis (Mori et al: J Cell Physiol 181:153, 1999). Based on these facts, various skin fibrosis diseases can be exemplified as TGF-β-related diseases.

[0079] It has also been reported that megakaryocytes in patients with myelofibrosis exhibit elevated TGF-β mRNA expression (Reilly J et al., Clin Haematol, 11751-767, 1998), platelet TGF-β levels are elevated (Martyre MC et al., Br J Haematol, 77:80-86, 991), and plasma TGF-β levels are significantly elevated (Rameshwar P et al., Am J Haematol, 59:133-142, 1998). According to Rameshwar et al., monocyte adhesion in patients with myelofibrosis activates NF-κB, inducing IL-1 production, which in turn enhances TGF-β production, leading to bone marrow fibrosis (Rameshwar et al., J Immunol, 165:2271-2277, 2000). These findings suggest that myelofibrosis is an exemplary TGF-β-related disease.

[0080] In addition, it has been reported that in cultured cell lines from patients with male pattern baldness, androgen induces TGF-β1 production from dermal papilla cells, and this TGF-β1 suppresses epidermal cell proliferation (Shigeki et al: FASEB J 16:1967-1969, 2002). Based on these facts, male pattern baldness can be exemplified as a TGF-β-related disease.

[0081] The subject to which the pharmaceutical composition of this embodiment is administered is preferably a human. The pharmaceutical composition of this embodiment is preferably administered to a human or a common marmoset. When the pharmaceutical composition of this embodiment is administered to a human, the effect of the pharmaceutical composition of this embodiment can be confirmed by animal experiments using primates. Common marmosets are preferably used as primates.

[0082] The pharmaceutical composition of this embodiment may contain optional ingredients in addition to the PI polyamide. Examples of the optional ingredients include pharmaceutically acceptable carriers. A "pharmaceutically acceptable carrier" refers to a carrier that does not inhibit the physiological activity of the active ingredient and is not substantially toxic to the recipient. "Not substantially toxic" refers to the ingredient not being toxic to the recipient at a commonly used dose. In the pharmaceutical composition of this embodiment, a pharmaceutically acceptable carrier is a carrier that does not inhibit the binding of the PI polyamide to the promoter of a target gene and is not substantially toxic to the recipient. When the PI polyamide is a PI polyamide (P), a pharmaceutically acceptable carrier is a carrier that does not inhibit the ability of the PI polyamide (P) to promote HGF gene transcription and inhibit TGF-β gene transcription, and is not substantially toxic to the recipient. Pharmaceutically acceptable carriers include any known pharmaceutically acceptable ingredients that are typically considered inactive ingredients. Pharmaceutically acceptable carriers are not particularly limited, and examples thereof include solvents, diluents, vehicles, excipients, glidants, binders, granulating agents, dispersing agents, suspending agents, wetting agents, lubricants, disintegrants, solubilizers, stabilizers, emulsifiers, fillers, preservatives (e.g., antioxidants), chelating agents, flavoring agents, sweeteners, thickeners, buffers, coloring agents, etc. One type of pharmaceutically acceptable carrier may be used alone, or two or more types may be used in combination.

[0083] The pharmaceutical composition of this embodiment may contain optional ingredients other than the pharmaceutically acceptable carrier. The optional ingredients are not particularly limited, and any ingredient commonly used in the pharmaceutical field can be used without particular limitation. The pharmaceutical composition of this embodiment may also contain active ingredients other than PI polyamides. Examples of active ingredients include, but are not limited to, vitamins and their derivatives, anti-inflammatory agents, blood circulation promoters, stimulants, hormones, irritant-relieving agents, analgesics, cell activators, plant, animal, and microbial extracts, antipruritics, anti-inflammatory and analgesic agents, antifungals, antihistamines, hypnotics and sedatives, tranquilizers, antihypertensive agents, hypotensive diuretics, antibiotics, anesthetics, antibacterial substances, antiepileptic drugs, coronary vasodilators, herbal medicines, antipruritics, and keratin softening and peeling agents. The other ingredients may be used alone or in combination.

[0084] The dosage form of the pharmaceutical composition of this embodiment is not particularly limited and can be any dosage form commonly used for pharmaceutical preparations. The pharmaceutical composition of this embodiment may be an oral formulation or a parenteral formulation. Examples of oral formulations include tablets, coated tablets, pills, powders, granules, capsules, syrups, fine granules, liquids, drops, and emulsions. Examples of parenteral formulations include injections, suppositories, ointments, sprays, topical solutions, ear drops, eye drops, nasal drops, and inhalants. Pharmaceutical compositions of these dosage forms can be formulated according to standard methods (e.g., methods described in the Japanese Pharmacopoeia).

[0085] The administration route of the pharmaceutical composition of this embodiment is not particularly limited, and it can be administered orally or parenterally. Parenteral routes include all administration routes other than oral, such as intravenous, intramuscular, subcutaneous, intranasal, intradermal, ophthalmic, intracerebral, rectal, intravaginal, and intraperitoneal administration. Administration may be local or systemic. Preferred administration routes for the pharmaceutical composition of this embodiment include, for example, intravenous injection or intramuscular injection. When administered orally, it is preferable that the PI polyamide (P) contained in the pharmaceutical composition of this embodiment has a cyclic structure.

[0086] The pharmaceutical composition of this embodiment can be administered in a therapeutically effective amount of PI polyamide. The term "therapeutically effective amount" refers to the amount of a drug effective for treating or preventing a target disease. For example, a therapeutically effective amount of PI polyamide (P) can be an amount capable of delaying the onset and / or progression of a TGF-β-related disease or a fibrotic disease. The therapeutically effective amount can be determined appropriately depending on the patient's symptoms, body weight, age, and sex, as well as the dosage form and administration method of the pharmaceutical composition. For example, the pharmaceutical composition of this embodiment can be administered in a single dose of PI polyamide of 0.001 to 1,000 mg per kg of the subject's body weight. The dose may be 0.01 to 800 mg / kg, 0.1 to 500 mg / kg, 1 to 100 mg / kg, or 1 to 50 mg / kg.

[0087] The pharmaceutical composition of this embodiment may contain a therapeutically effective amount of the PI polyamide per unit dosage form. For example, the content of the PI polyamide in the pharmaceutical composition of this embodiment may be 0.01 to 90% by mass, 0.1 to 80% by mass, or 1 to 50% by mass.

[0088] The administration interval of the pharmaceutical composition of this embodiment may be appropriately determined depending on the symptoms, body weight, age, sex, etc. of the patient, as well as the dosage form of the pharmaceutical composition and the administration method, etc. The administration interval may be, for example, every few hours, once a day, once every 2 to 3 days, once a week, etc.

[0089] The pharmaceutical composition of this embodiment may be used in combination with other pharmaceuticals, for example, other therapeutic drugs for fibrotic diseases.

[0090] [PI polyamide manufacturing method] In one aspect, the present invention provides a method for producing pyrrole-imidazole polyamides, comprising the steps of: (a) designing pyrrole-imidazole polyamides that bind to promoters of two or more genes; (b) synthesizing the pyrrole-imidazole polyamides; and (c) selecting, from the synthesized pyrrole-imidazole polyamides, pyrrole-imidazole polyamides that regulate the transcription of the two or more genes.

[0091] <Process (a)> In step (a), a PI polyamide is designed to bind to the promoters of two or more genes.

[0092] Step (a) may include, for example, the following steps (i) to (iv): (i) Two or more genes are selected as targets of the PI polyamide. (ii) Identifying transcription-promoting or transcription-repressing regions for the two or more genes. (iii) For a first gene among the two or more genes, a PI polyamide is designed that binds to the transcription-promoting region or the transcription-repressing region. (iv) From the designed PI polyamides, a PI polyamide that binds to a transcription promoting region or a transcription repressing region of a gene other than the first gene among the two or more types of genes is selected.

[0093] Regarding (i): Any two or more genes are selected as targets of the PI polyamide. Examples of combinations of two or more genes include those listed above in the section on [Pyrrole-imidazole polyamides (PI polyamides)].

[0094] Regarding (ii): For each of two or more genes, the promoter sequence is analyzed to identify a transcription-promoting region or a transcription-repressing region. For example, for genes whose expression is to be repressed, a transcription-promoting region is obtained. For genes whose expression is to be promoted, a transcription-repressing region is obtained.

[0095] Next, the promoter sequences of the two or more target genes are analyzed to identify transcription-promoting regions and transcription-repressing regions. For example, for genes whose expression is to be repressed, a transcription-promoting region is obtained. For genes whose expression is to be promoted, a transcription-repressing region is obtained. For example, the promoter sequences of a first gene and a second gene are analyzed to identify a transcription-promoting region or a transcription-repressing region of the first gene and a transcription-promoting region or a transcription-repressing region of the second gene.

[0096] Regarding (iii): A PI polyamide that binds to a transcription-promoting region or a transcription-repressing region of a first gene among the two or more target genes is designed. When the purpose is to suppress the expression of the first gene, a PI polyamide that binds to a transcription-promoting region is designed. When the purpose is to promote the expression of the first gene, a PI polyamide that binds to a transcription-repressing region is designed. In this case, it is preferable to design a plurality of PI polyamides. Examples of methods for designing a plurality of PI polyamides include a method of designing a PI polyamide for each of a plurality of transcription-promoting regions or transcription-repressing regions; a method of designing a plurality of PI polyamides for one transcription-promoting region or transcription-repressing region by shifting the target sequence; and a combination thereof.

[0097] Regarding (iv): From the PI polyamides designed in (iii), a PI polyamide that binds to a transcription-promoting region or a transcription-repressing region of a target gene other than the first gene among the two or more target genes is selected. For example, a sequence to which the PI polyamide designed in (iii) can bind (hereinafter also referred to as a "candidate PI polyamide binding sequence") is obtained. Next, using the candidate PI polyamide binding sequence as a query sequence, sequences of the transcription-promoting region or the transcription-repressing region of target genes other than the first gene are searched for. As a result, if the candidate PI polyamide binding sequence is present in the transcription-promoting region or the transcription-repressing region of all target genes other than the first gene, a PI polyamide that targets the candidate PI polyamide binding sequence is selected. For example, from the PI polyamides designed in (iii), a PI polyamide that can bind to a transcription-promoting region or a transcription-repressing region of a second gene is selected.

[0098] Alternatively, the step (a) may include, for example, the following steps (iii') and (iv') instead of the steps (iii) and (iv). (iii') A target sequence to which the same PI polyamide can bind is searched for in the transcription-promoting or transcription-repressing regions of the two or more genes. (iv') A PI polyamide capable of binding to the target sequence detected by (iii') is designed.

[0099] Regarding (iii'): In PI polyamides, the Py / Im pair binds to a CG base pair, the Im / Py pair binds to a GC base pair, and the Py / Py pair binds to an AT or TA base pair. The Hp / Py pair binds to a TA base pair, the Py / Hp pair binds to an AT base pair, the β / β pair binds to a TA or AT base pair, the β / Im pair binds to a CG base pair, the Im / β pair binds to a GC base pair, and the β / Py pair and Py / β pair bind to a TA or AT base pair. Based on the binding rules, target sequences to which the same PI polyamide can bind are searched for in the transcription-promoting or transcription-repressing regions of all target genes. For example, target sequences to which the same PI polyamide can bind are searched for in the transcription-promoting or transcription-repressing regions of a first gene and the transcription-promoting or transcription-repressing regions of a second gene.

[0100] Regarding (iv'): When a target sequence to which the same PI polyamide can bind is found by (iii'), a PI polyamide capable of binding to the target sequence is designed.

[0101] <Process (b)> In step (b), the PI polyamide designed in step (a) is synthesized. PI polyamides can be synthesized by known methods such as the solid-phase Fmoc method.

[0102] <Process (c)> In step (c), PI polyamides that regulate the transcription of the two or more types of genes are selected from the PI polyamides synthesized in step (b).

[0103] Cells expressing all target genes are cultured in the presence of the PI polyamide synthesized in step (b). If target gene expression is promoted or suppressed compared to cells cultured in the absence of the PI polyamide, it can be determined that the PI polyamide controls the transcription of the target genes. For example, suppose a PI polyamide is designed to bind to a transcription-promoting region of a first gene and a transcription-repressing region of a second gene. In this case, when cells are cultured in the presence of the PI polyamide, transcription of the first gene is suppressed and transcription of the second gene is promoted. Gene expression may be confirmed by either mRNA or protein. The amount of mRNA transcription can be measured, for example, by Northern blotting, RT-qPCR, etc. The amount of protein expression can be measured, for example, by Western blotting, ELISA, etc.

[0104] The method according to this embodiment makes it possible to produce a PI polyamide that binds to promoters of two or more genes and controls the transcription of the two or more genes.The method according to this embodiment makes it possible to produce the PI polyamides exemplified above.

[0105] [Other aspects] In one aspect, the present invention provides use of a PI polyamide (P) in the manufacture of a pharmaceutical composition for treating or preventing a TGF-β-related disease or a fibrotic disease. In one aspect, the present invention provides a PI polyamide (P) for use in treating or preventing a TGF-β-related disease or a fibrotic disease. In one aspect, the present invention provides a method for treating a TGF-β-related disease or a fibrotic disease, comprising administering a PI polyamide (P) to a subject (e.g., a patient suffering from a TGF-β-related disease or a fibrotic disease). In one aspect, the present invention provides a PI polyamide (P) for treating or preventing a TGF-β-related disease or a fibrotic disease. [Example]

[0106] The present invention will be described below with reference to experimental examples, but the present invention is not limited to the following experimental examples.

[0107] [PI polyamide design] (Analysis of the human HGF gene promoter) The human HGF gene promoter was analyzed using the gene analysis software PROMO to predict the binding site of transcriptional regulators. A binding site for COUP-TF1 (-108 to -96; AGGTGACCTTTTC: SEQ ID NO: 1), which functions as a transcriptional regulator, was identified (see Figure 2). Eight PI polyamides were designed to target the region surrounding this COUP-TF1 binding site (Hu-HGF-1, Hu-HGF-2: Figure 3; Hu-HGF-3, Hu-HGF-4, Hu-HGF-5, Hu-HGF-6: Figure 4; Hu-HGF-7, Hu-HGF-8: Figure 5). In anticipation of using common marmosets for in vivo studies, regions homologous to humans and common marmosets were selected as target regions for the PI polyamides.

[0108] The structures and compositions of Hu-HGF-3, Hu-HGF-5, and Hu-HGF-7 are shown in Figures 6 to 8, respectively. The sequences to which Hu-HGF-3, Hu-HGF-5, and Hu-HGF-7 can bind are shown in Table 1. In Table 1, the underlined sequences are those present in the TGF-β1 promoter.

[0109] [Table 1]

[0110] (Analysis of the human TGF-β1 promoter) The sequence of the human TGF-β1 promoter is shown in Figure 9. In Figure 9, the sequence enclosed by a solid line indicates the binding sequence of Hu-HGF-3, and the sequence enclosed by a dashed line indicates the binding sequence of Hu-HGF-7.

[0111] The predicted binding sites of transcriptional regulators around the binding region of PI polyamides are shown in Figure 10. There are multiple predicted binding sites of transcriptional regulators around the binding region of Hu-HGF-3 and Hu-HGF-5.

[0112] (Synthesis of PI polyamide) The eight PI polyamides (Hu-HGF-1, Hu-HGF-2, Hu-HGF-3, Hu-HGF-4, Hu-HGF-5, Hu-HGF-6, Hu-HGF-7, and Hu-HGF-8) designed above were synthesized by Fmoc solid-phase synthesis using a peptide synthesizer PSSM8 (Shimazu). Each synthesized PI polyamide was purified using a C18 HPLC column.

[0113] [Gel shift assay] Oligonucleotides of the human HGF promoter were synthesized, and gel shift assays were performed using the eight PI polyamides synthesized above. 32 The complexes were labeled with T4 polynucleotide kinase using [P]-ATP and incubated with PI polyamide in binding buffer (40 mM Tris, pH 7.9, 250 mM NaCl, 25 mM EDTA, 25 mM DTT, 100 mM KCl) for 15 min at 37 °C. The resulting complexes were electrophoresed on a 20% polyacrylamide gel and visualized by autoradiography.

[0114] Gel shift assays confirmed that all PI polyamides exhibited gel shifts upon incubation with double-stranded DNA of the HGF promoter. The results of gel shift assays for Hu-HGF-1 and Hu-HGF-2 are shown in Figure 11 . The results of gel shift assays for Hu-HGF-3 and Hu-HGF-4 are shown in Figure 12 . The results of gel shift assays for Hu-HGF-5 and Hu-HGF-6 are shown in Figure 13 . Gel shift assay confirmed that all eight PI polyamides bind to the human HGF promoter.

[0115] [Evaluation of HGF mRNA expression levels] The cells were cultured with the addition of PI polyamide, and the effect of PI polyamide on HGF mRNA expression was evaluated. An outline of the test protocol is shown in Figure 14. Human dermal fibroblasts (HDF cells) were maintained in 10% FBS-DMEM medium. The medium was replaced with 0.5% FBS-DMEM medium and cultured for 24 hours. -11 ~10 -7 M PI polyamide was added. As a negative control, DMSO was added instead of PI polyamide. After the addition of PI polyamide or DMSO, the cells were cultured for 15 hours and then harvested.

[0116] Total RNA was extracted from the collected cells using ISOGEN (Nippon Gene), and reverse transcription was performed using PrimeScript® Reverse Transcriptase (Takara Bio) to prepare cDNA. RT-qPCR was performed using the cDNA prepared above as template DNA to quantify HGF mRNA. Power SYBR® Green PCR Master Mix (Applied Biosystems) was used for RT-qPCR. The expression level of HGF mRNA was normalized based on the expression level of 18S rRNA.

[0117] The primers used for RT-qPCR are shown below. Human HGF Forward: TGACCTCTATGAAAACAAAGACTACA (SEQ ID NO: 4) Reverse: GCTGACATTTGATGCCACTCTTAG (SEQ ID NO: 5) Human 18S rRNA Forward: TCAAGAACGAAAGTCGGACG (SEQ ID NO: 6) Reverse: GGACATCTAAGGGCATCACA (SEQ ID NO: 7)

[0118] The results using Hu-HGF-3, Hu-HGF-5, and Hu-HGF-7 as PI polyamides are shown in Figures 15 to 17, respectively. For all three types, an increase in HGF mRNA expression was confirmed compared to the negative control (DMSO). For all PI polyamides, a low dose (10 -11 ~10 -9 There was a tendency for the expression level of HGF mRNA to be more elevated when the sera were in the sera of ...

[0119] [Evaluation of TGF-β1 mRNA expression level] The cells were cultured with the addition of PI polyamide, and the effect of PI polyamide on the expression level of TGF-β1 mRNA was evaluated. An outline of the test protocol is shown in Figure 14. The cells were cultured and collected in the same manner as above, except that 0.1 µM PMA (phorbol 12-myristate 13-acetate) was added 3 hours after the addition of PI polyamide or DMSO. Total RNA was extracted from the cells and subjected to RT-qPCR. TGF-β1 mRNA expression was normalized by 18S rRNA expression.

[0120] The primers used for RT-qPCR are shown below. Human TGF-β1 Forward: CTCGGCTGGAAGTGGATCCA (SEQ ID NO: 8) Reverse: TGTACAGGGCCAGGACCTTG (SEQ ID NO: 9)

[0121] The results for the PI polyamides Hu-HGF-3, Hu-HGF-5, and Hu-HGF-7 are shown in Figures 18 to 20, respectively. The addition of 0.1 μM PMA induced the expression of TGF-β1 mRNA. When any of the PI polyamides was used, the expression of TGF-β1 mRNA was induced within 10 -12 ~10 -10 At an extremely low concentration of 1M, PMA-stimulated TGF-β1 mRNA expression was suppressed.

[0122] Figure 21 shows the results when human renal mesangial (MC) cells were used instead of HDF cells. Hu-HGF-5 was used as the PI polyamide. It was confirmed that the addition of PI polyamide also suppressed PMA-stimulated TGF-β1 mRNA expression in MC cells.

[0123] [Evaluation of HGF protein expression level] The cells were cultured with the addition of PI polyamide, and the effect of PI polyamide on HGF protein expression was evaluated. Cells were cultured and harvested as described in [Evaluation of HGF mRNA expression]. Cells were disrupted and subjected to Western blotting using an anti-HGF antibody (Catalog (MAB294), Monoclonal Mouse, R&D System). HGF protein expression was normalized based on the expression level of β-actin.

[0124] The results using Hu-HGF-3, Hu-HGF-5, and Hu-HGF-7 as PI polyamides are shown in Figures 22 to 24, respectively. For all three types, an increase in HGF protein expression was confirmed compared to the negative control (DMSO). For all PI polyamides, a low dose (10 -11 ~10 -10 There was a tendency for HGF protein expression to be more elevated when the cells were in the sham-treated group.

[0125] [Evaluation of TGF-β1 protein expression level] The cells were cultured with the addition of PI polyamide, and the effect of PI polyamide on the expression level of TGF-β1 protein was evaluated. Cells were cultured and harvested as in [Evaluation of TGF-β1 mRNA expression]. Cells were disrupted and subjected to Western blotting using an anti-TGF-β antibody (Catalog (Y241), Polyclonal, Rabbit, Peptide Institute, Inc.). TGF-β protein expression levels were normalized based on the expression levels of β-actin.

[0126] The results for the PI polyamides Hu-HGF-3, Hu-HGF-5, and Hu-HGF-7 are shown in Figures 25 to 27, respectively. The addition of 0.1 μM PMA induced the expression of TGF-β1 protein. When any of the PI polyamides was used, the expression of TGF-β1 protein was induced within 10 -11 It was confirmed that an extremely low concentration of 100mg significantly suppressed PMA-stimulated TGF-β1 protein expression.

[0127] [Evaluation of TGF-β1 expression levels in the presence of HGF siRNA] To confirm whether PI polyamides directly reduce TGF-β1 expression, we performed a test using HGF siRNA. In the presence of HGF siRNA, HGF expression is suppressed. Therefore, the effect of increased HGF expression can be eliminated. Therefore, by acting PI polyamides on cells in the presence of HGF siRNA, we can confirm whether PI polyamides directly suppress TGF-β1 expression.

[0128] HGF siRNA was used (HSS179212 (ThermoFisher Scientific)). It was confirmed that HGF siRNA specifically suppressed HGF mRNA expression (data not shown).

[0129] Cells were cultured and harvested as described in "Assessment of HGF mRNA expression levels," except for the addition of 10 nM HGF siRNA. Cells were lysed and subjected to Western blotting using an anti-HGF antibody (Catalog (MAB294), Monoclonal Mouse, R&D System). HGF protein expression levels were normalized by β-actin expression levels.

[0130] The results using Hu-HGF-3 and Hu-HGF-5 as PI polyamides are shown in Figures 28 to 29. In Figures 28 to 29, the numbers on the horizontal axis indicate the following: The PMA concentration was 0.1 μM, and the HGF siRNA concentration was 10 nM. 1:DMSO 2: DMSO + PMA + HGF siRNA 3:DMSO+PMA+HGF siNRA+10 -11 M PI Polyamide 4:DMSO+PMA+HGF siNRA+10 -10 M PI Polyamide 5:DMSO+PMA+HGF siNRA+10 -9 M PI Polyamide

[0131] Both Hu-HGF-3 and Hu-HGF-5 significantly suppressed TGF-β protein expression in the presence of HGF siRNA. These results suggest that Hu-HGF-3 and Hu-HGF-5 bind to the TGF-β promoter region and directly inhibit TGF-β expression.

[0132] [Evaluation of TGF-β1 mRNA expression using mismatched PI polyamides] A mismatched PI polyamide (HGF mismatch) was synthesized that was not designed to bind to the transcriptional repression region of the HGF gene or the transcriptional promotion region of the TGF-β1 gene. Cells were cultured in the same manner as in [Evaluation of TGF-β1 mRNA expression level], except that the mismatched PI polyamide was used, and TGF-β1 mRNA expression level was evaluated. The structure of the HGF mismatch is shown below.

[0133] [ka]

[0134] The results are shown in Figure 30. HGF mismatch did not affect the amount of TGFβ mRNA expression. [Industrial Applicability]

[0135] The present invention provides pyrrole-imidazole polyamides capable of simultaneously controlling the transcription of two or more genes, pharmaceutical compositions containing the pyrrole-imidazole polyamides, and pyrrole-imidazole polyamides useful as therapeutic agents for TGF-β-related diseases or fibrotic diseases, as well as TGF-β gene expression inhibitors and pharmaceutical compositions for treating TGF-β-related diseases or fibrotic diseases, each of which uses the pyrrole-imidazole polyamide.

Claims

1. Pyrrole-imidazole polyamides represented by the following formula (P-3), (P-5) or (P-7): 【Chemical 1】 【Chemistry 2】 【Chemistry 3】 [In the formula, R １ is -NHCO-R １１ (R １１ represents an aliphatic hydrocarbon group having 1 to 10 carbon atoms), and R ２ is -CONH-R ２１ (R ２１ represents a group represented by the formula (an aliphatic hydrocarbon group having 1 to 15 carbon atoms which may have a substituent). １ and R ２ may be linked to each other to form a divalent organic group.

2. 2. The pyrrole-imidazole polyamide according to claim 1, which is represented by the following formula: Hu-HGF-3, Hu-HGF-5, or Hu-HGF-7. 【Chemistry 4】 【Chemistry 5】 【Chemistry 6】

3. A TGF-β gene expression inhibitor comprising the pyrrole-imidazole polyamide according to claim 1 or 2.

4. A pharmaceutical composition comprising the pyrrole-imidazole polyamide according to claim 1 or 2.

5. A pharmaceutical composition for treating a TGF-β-related disease, comprising the pyrrole-imidazole polyamide according to claim 1 or 2.

6. A pharmaceutical composition for treating fibrotic diseases, comprising the pyrrole-imidazole polyamide according to claim 1 or 2.

Images