RNA inhibitors that suppress hepatitis B virus gene expression and their applications

The RNA inhibitor with modified strands and liver-targeting structures addresses the ineffectiveness of current hepatitis B treatments by directly disrupting HBV mRNA and combining with existing drugs to sustainably lower HBsAg, inducing HBsAb production for a functional cure.

JP7754524B2Active Publication Date: 2025-10-15KYLONOVA (XIAMEN) BIOPHARMA CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2023562671
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-04-13
Filing Date
2022-03-31
Publication Date
2025-10-15
Estimated Expiration
2042-03-31

AI Technical Summary

Technical Problem

Current frontline clinical drugs for hepatitis B, such as nucleosides and interferons, are ineffective in reducing hepatitis B surface antigen (HBsAg) levels, leading to immune tolerance and potential drug resistance, necessitating a new therapeutic mechanism to sustainably lower HBsAg and induce HBsAb production for functional cure.

Method used

An RNA inhibitor with complementary sense and antisense strands, modified with fluorine or methoxy groups and thiolated phosphates, coupled with liver-targeting 5' and 3'MVIP structures, directly disrupts HBV mRNA translation and can be combined with nucleoside analogs and interferon to reduce HBsAg expression, producing HBsAb and curing hepatitis B.

Benefits of technology

The RNA inhibitor effectively suppresses HBV gene expression, reducing HBsAg levels and inducing HBsAb production, offering a functional cure for hepatitis B by enhancing liver targeting and stability, while avoiding drug resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007754524000132
    Figure 0007754524000132
  • Figure 0007754524000133
    Figure 0007754524000133
  • Figure 0007754524000134
    Figure 0007754524000134
Patent Text Reader

Abstract

Provided is an RNA inhibitor that suppresses the expression of Hepatitis B virus genes and its application. The RNA inhibitor is formed by base pairing of a sense strand and an antisense strand, and the sense strand and the antisense strand are at least 85% complementary to each other in bases, and a part or all of the -OH at the 2' position of the nucleotide glycoside is replaced by a fluorine or methoxy group, and the phosphate between at least three consecutive nucleotides at the terminal is thiolated. The structure of the RNA inhibitor further includes 5'MVIP and 3'MVIP, which make the RNA inhibitor specific for targeting the liver. The RNA inhibitor can sustainably suppress the synthesis of HBV surface antigen HBsAg, and can also produce surface antibody HBsAb, and has a significant inhibitory effect on the most common types of HBV A, B, C and D, and can functionally cure Hepatitis B by using it in combination with a nucleoside analog or interferon.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the field of biochemistry, specifically to an RNA inhibitor that suppresses hepatitis B virus gene expression and its application. The RNA inhibitor is formed by base pairing between a sense strand and an antisense strand. At least 85% of the bases in the sense strand and the antisense strand are complementary to each other, and some or all of the -OH groups at the 2'-position of the nucleotide glycoside are substituted with fluorine or methoxy groups, and the phosphates between at least three consecutive nucleotides at the terminal are thiolated. The RNA inhibitor structure of the present invention further includes 5'MVIP and 3'MVIP, which are structures that make the RNA inhibitor liver-targeting specific. The 5'MVIP is coupled to the 5'-end of the sense strand and / or antisense strand of the RNA inhibitor, and the 3'MVIP is coupled to the 3'-end of the antisense strand and / or sense strand of the RNA inhibitor. Both the 5'MVIP and the 3'MVIP contain a liver-targeting-specific ligand X, a branched chain L, a linker B, and a connecting chain D. The 5'MVIP further comprises a relay R1 linked to the 5' end of the sense or antisense strand of the RNA inhibitor, and the 3'MVIP further comprises a relay R2 linked to the 3' end of the sense or antisense strand of the RNA inhibitor. The liver-targeting specific ligand X, branched chain L, or linker B may be the same or different within the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP. The RNA inhibitors provided by the present invention have efficacy not currently available in frontline clinical hepatitis B therapeutics, and can directly disrupt the function of HBV mRNA as a translation template and block the synthesis of the HBV surface antigen HBsAg. Furthermore, the RNA inhibitors of the present invention have significant inhibitory effects against the most common HBV types A, B, C, and D. They can be used in combination with nucleoside analogs and interferon to sustainably and efficiently reduce the expression level of HBsAg in HBV mice, producing the surface antibody HBsAb and functionally curing hepatitis B. [Background technology]

[0002] RNAi RNAi (RNA interference) was discovered in 1998 when Andrew Z. Fire and his colleagues performed experiments on antisense RNA suppression in Caenorhabditis elegans and named this process RNAi. This discovery was selected by Science magazine as one of the top ten scientific achievements of 2001 and ranked first in 2002. Since then, siRNAs, which use RNAi as their mechanism of action, have attracted widespread attention as potential gene therapy drugs, and in 2006, Andrew Fire and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of RNAi mechanisms. RNAi can be triggered by double-stranded RNA (dsRNA) in many organisms, including animals, plants, and fungi. During the RNAi process, an endonuclease called "Dicer" cleaves or "chops" long dsRNA into small fragments 21–25 nucleotides long. These small fragments, called small interfering RNAs (siRNAs), are loaded by the Argonaute protein (AGO2) with their antisense strand (guide strand). AGO2 loading occurs in the RISC-loading complex, a ternary complex consisting of Argonaute, Dicer, and dsRNA-binding protein (TRBP). During loading, AGO2 cleaves and ejects the sense strand (passenger strand). AGO2 then uses the antisense strand to bind to mRNAs containing perfectly complementary sequences and catalyzes the cleavage of these mRNAs, disrupting their translational template function and preventing further synthesis of associated proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex, loaded with the antisense strand, is recycled for another round of cleavage.

[0003] Hepatitis B is a disease caused by persistent infection with the hepatitis B virus for six months or more, resulting in varying degrees of pyroptosis or fibrosis in the liver. According to the World Health Organization, approximately 2 billion people are estimated to be infected worldwide. Of these, approximately 4 million people suffer acute infection each year, with approximately 350-400 million infected with hepatitis B, 68% of whom live in Africa and the Western Pacific. Approximately 1 million people die each year from hepatitis B-related diseases worldwide, of which 30% are due to cirrhosis and 45% are due to primary hepatocellular carcinoma. In China, 77% and 84% of patients with cirrhosis and primary hepatocellular carcinoma are attributable to the hepatitis B virus, respectively. Currently, frontline clinical drugs include nucleosides (NUCs) and interferon drugs, with the most common being nucleosides, such as lamivudine, entecavir, adefovir, and telbivudine. Tenofovir alafenamide is the newest NUC on the market, but its use is somewhat limited due to the risk of renal dysfunction. Nucleosides have the advantages of high bioavailability and safe oral administration. However, while nucleosides can effectively control symptoms, they all develop resistance with long-term use. After discontinuation, HBV DNA, ALT, and liver histology show varying degrees of rebound. Furthermore, long-term use of nucleosides can produce relatively obvious side effects, such as kidney damage and infant teratogenicity. The emergence of resistant viral strains is another side effect that must be faced with the long-term use of nucleoside drugs, which significantly reduces the cure rate and may even render the treatment ineffective. Because nucleoside drugs are reversible in terms of viral replication, treatment must be continued for at least one year to maximize therapeutic efficacy in most patients. Consequently, the emergence of resistance to these drugs reduces the desired efficacy. Nucleoside drugs must be taken daily, which reduces the patient's dependency on them.

[0004] Hepatitis B surface antigen (HBsAg) is the outer capsid protein of the hepatitis B virus (HBV) and is the first marker for detecting the virus. HBsAg positivity is the gold standard for diagnosing HBV infection. In patients with hepatitis B, HBsAg elimination before the onset of cirrhosis reduces the incidence of cirrhosis and hepatocellular carcinoma by 60-fold. Guidelines from the American Association for the Study of Liver Diseases (AASLD), the Asia-Pacific Association for the Study of the Liver (APASL), and the European Association for the Study of the Liver (EASL) list HBsAg seroelimination as one of the endpoints for treatment. Furthermore, high antigen levels induce immune tolerance, and reduction of HBsAg antigen levels can restore immunological control of HBV infection. Current frontline clinical drugs, including nucleosides (NUCs) and interferons, are ineffective at reducing HBsAg antigen levels, let alone eliminating them.

[0005] Treatment of hepatitis B remains a global health challenge, and there is an urgent need in this field to develop anti-HBV drugs with a new therapeutic mechanism that can efficiently and sustainably reduce the antigen HBsAg level, thereby inducing de novo production of HBsAb antibodies in hepatitis B patients and ultimately leading to a functional cure. Summary of the Invention

[0006] The present invention relates to an RNA inhibitor that suppresses gene expression of hepatitis B virus and its application. In the RNA inhibitor, the sense strand and antisense strand formed by base pairing are complementary to each other in at least 85% of the bases, and some or all of the -OH at the 2' position of the nucleotide glycoside are substituted with fluorine or methoxy groups, and the phosphates between at least three consecutive nucleotides at the terminal are thiolated, thereby increasing stability in vivo. The structure of the RNA inhibitor described in the present invention further comprises a 5'MVIP and a 3'MVIP to give the RNA inhibitor a liver-targeting-specific structure, wherein the 5'MVIP is coupled to the 5'-end of the sense strand and / or antisense strand of the RNA inhibitor, and the 3'MVIP is coupled to the 3'-end of the antisense strand and / or sense strand of the RNA inhibitor. Both the 5'MVIP and the 3'MVIP comprise a liver-targeting-specific ligand X, a branched chain L, a linker B, and a connecting chain D. The 5'MVIP further comprises a translocation junction R1 linked to the 5'-end of the sense strand or antisense strand of the RNA inhibitor, and the 3'MVIP comprises a translocation junction R2 linked to the 3'-end of the sense strand or antisense strand of the RNA inhibitor. The liver-targeting-specific ligand X, branched chain L, or linker B may be the same or different within the 5'MVIP and the 3'MVIP, or between the 5'MVIP and the 3'MVIP. The RNA inhibitors provided by the present invention have efficacy not found in current frontline clinical hepatitis B treatments, directly disrupting the function of HBV mRNA as a translation template and preventing the formation of the HBV surface antigen HBsAg. Furthermore, the RNA inhibitors of the present invention have significant inhibitory effects against the most common HBV types A, B, C, and D, and can be used in combination with nucleoside analogs and interferon to sustainably and efficiently reduce the expression level of HBsAg in HBV mice, producing the surface antibody HBsAb and functionally curing hepatitis B. Compared with similar technologies previously disclosed, the RNA inhibitors described in the present invention are primarily characterized by their ability to produce the surface antibody HBsAb in vivo, stimulating the body to regain immunity to HBV in vivo and functionally curing hepatitis B.

[0007] In one aspect, the present invention provides an RNA inhibitor that suppresses gene expression of hepatitis B virus or a pharmaceutically acceptable salt thereof, wherein: The RNA inhibitor is formed by base pairing between a sense strand and an antisense strand, each having a chain length of 15 to 30 bases, and preferably has a chain length of 19 to 23 bases.

[0008] In the above embodiment, it is preferable that the sense strand and the antisense strand are complementary to each other in at least 85% of their bases.

[0009] a part or all of -OH at the 2'-position of the nucleotide glycoside of the sense strand or the antisense strand may be substituted, and the substituent is a fluorine or a methoxy group; In addition, the phosphate bonds between at least three adjacent nucleotides at the end of the sense strand or antisense strand may be thiolated.

[0010] More preferably, the sense strand has SEQ ID NO. 1 shown below or a sequence that differs from SEQ ID NO. 1 by one, two or three nucleotides, and the antisense strand has SEQ ID NO. 2 or SEQ ID NO. 2 are sequences that differ by one, two, or three nucleotides, Sense strand: 5' ggguuuuucucguugacaa 3' SEQ ID NO.1 Antisense strand: 5' uugucaacgagaaaaacccuu 3' SEQ ID NO. 2 Here, g = guanosine, a = adenosine, u = uridine, c = cytidine.

[0011] Alternatively, and more preferably, the sense strand has the sequence set forth below in SEQ ID NO. 3 or SEQ ID NO. 3 and the antisense strand has a sequence that differs by one, two, or three nucleotides from SEQ ID NO. 4 or SEQ ID NO.4 are sequences that differ by one, two, or three nucleotides, Sense strand: 5'ggguuuuucuuguugacaa 3' SEQ ID NO. 3 Antisense strand: 5' uugucaacaagaaaaacccuu 3' SEQ ID NO. 4 Here, g = guanosine, a = adenosine, u = uridine, c = cytidine.

[0012] In order to increase the in vivo stability of the above RNA inhibitors, without affecting their activity or even enhancing their activity, the sense and antisense strands of the above RNA inhibitors can be modified, and the nucleotides therein may have modified groups, and the entire strand or a portion of the strand may be modified.

[0013] In a preferred embodiment, the sense strand after the RNA inhibitor modification has the following SEQ ID NO. 5 or SEQ ID NO. 5 The modified antisense strand has a sequence that differs by one, two, or three nucleotides from SEQ ID NO. 6 or SEQ ID NO. 6 are sequences that differ by one, two, or three nucleotides, Sense strand: 5' Gs fGs GU fU U fU fU fC UCGUUGA Cs As A 3' SEQ ID NO. 5 Antisense strand: 5' Us Us GUCA fA CGAG fA A fA fA ACC Cs Us U 3' SEQ ID NO. 6 where G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methylguanosine-3'-phosphorothioate, As = 2'-O-methyladenosine-3'-phosphorothioate, U = 2'-O-methyluridine-3'-phosphorothioate, Cs = 2'-O-methylcytidine-3'-phosphorothioate; fG = 2'-fluoroguanosine, fA = 2'-fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine; fGs = 2'-fluoroguanosine-3'-phosphorothioate, fAs = 2'-fluoroadenosine-3'-phosphorothioate, fUs = 2'-fluorouridine-3'-phosphorothioate, fCs = 2'-fluorocytidine-3'-phosphorothioate.

[0014] In another preferred embodiment, the sense strand after the RNA inhibitor modification has the following SEQ ID NO. 7 Or given SEQ ID NO. 7 The modified antisense strand has a sequence that differs by one, two, or three nucleotides from SEQ ID NO. 8 or SEQ ID NO. 8 are sequences that differ by one, two, or three nucleotides, Sense strand: 5' Gs Gs GU fU U fU fU fC UUGUUGA Cs As A 3' SEQ ID NO. 7 Antisense strand: 5' Us Us GUCA fA CAAG fA A fA AACC Cs Us U 3' SEQ ID NO. 8 where G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methylguanosine-3'-phosphorothioate, As = 2'-O-methyladenosine-3'-phosphorothioate, U = 2'-O-methyluridine-3'-phosphorothioate, Cs = 2'-O-methylcytidine-3'-phosphorothioate fG = 2'-fluoroguanosine, fA = 2'-fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine; fGs = 2'-fluoroguanosine-3'-phosphorothioate, fAs = 2'-fluoroadenosine-3'-phosphorothioate, fUs = 2'-fluorouridine-3'-phosphorothioate, fCs = 2'-fluorocytidine-3'-phosphorothioate.

[0015] In the above embodiment, preferably, the RNA inhibitor or a pharmaceutically acceptable salt thereof further comprises a combination of 5'MVIP and 3'MVIP, wherein: The 5'MVIP and 3'MVIP are ligand structures having a liver-targeting specific ligand X, and further comprising a branching chain L, a linker B, and a connecting chain D; The 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand, and further comprises a relay R1 linked to the 5' end of the sense strand or antisense strand; the 3'MVIP is coupled to the 3' end of the antisense strand and / or the sense strand and comprises a relay R2 linked to the 3' end of the sense strand or the antisense strand; The structure of the 5'MVIP is as shown in general formula I, and the structure of the 3'MVIP is as shown in general formula II, [ka] where: n and m are each an integer of 0-4, preferably an integer of 1-3, and n+m=2-6, preferably n+m=2, 3, or 4; The relay points R1 and R2 have -NH-, sulfur or oxygen atoms in their structures, and have at least one -NH-, sulfur or oxygen atom in their general structure. R1 and R2 are connected to the linking chain D of the 5'MVIP and 3'MVIP and the 5'-end and 3'-end of the sense strand and / or antisense strand, respectively, via the -NH-, sulfur or oxygen atom in their structures, thereby introducing a liver-targeting specific ligand X. The relay points R1 and R2 may be linear, branched or various cyclic structures, and the cyclic structure may be a saturated or unsaturated aliphatic carbocyclic group, or a 5- or 6-membered heterocyclic group or aromatic hydrocarbon group containing a sulfur, oxygen or nitrogen atom, etc. R1 is preferably -NH(CH2) x CH2O-, where x is an integer from 3 to 12, preferably from 4 to 6; R2 is preferably -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, where x1 is an integer from 1 to 4 and x2 is an integer from 0 to 4; The liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and derivatives thereof, preferably N-acetylgalactosamine and derivatives thereof, and the liver-targeting specific ligand X may be the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP.

[0016] the branched chain L is a C4-C18 straight chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, a C4-C10 aliphatic carbocyclic group, a phenyl group, or a combination of these groups, and the straight chain may be a branched chain containing ethyl alcohol or a carboxylic acid, the branched chain L is preferably a C7-C18 straight chain containing an amide group or a 6-membered aliphatic carbocyclic group, and the branched chains L may be the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP; The linker B is selected from the following structures: [ka] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, an amide group, a phosphoryl group, or a thiophosphoryl group; r is an integer of 0 to 4; and the linker B may be the same or different between the 5'MVIP and the 3'MVIP; The linking chain D is a C3-C18 linear chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aromatic hydrocarbon group, a C4-C10 aliphatic carbocyclic group, a 5- or 6-membered heterocyclic group containing 1-3 nitrogen atoms, or a combination of these groups, and the C3-C18 linear chain may have a branched chain of a methyl alcohol, methyl tert-butyl, methylphenol group, or a C5-C6 alicyclic group, and the linking chain D is preferably a C3-C10 linear chain containing two C=O, 6-membered aliphatic carbocyclic groups, or phenyl groups.

[0017] Specifically, in some embodiments, when n=0 (ie, there is no 5'MVIP), the structure of the MVIP may be:

[0018] [ka] In some embodiments, when n=1, the structure of the MVIP can be:

[0019] [ka] In some embodiments, when n=2, the structure of the MVIP can be:

[0020] [ka] In some embodiments, when n=3, the structure of the MVIP may be:

[0021] [ka] In some embodiments, when n=4, the structure of the MVIP may be:

[0022] [ka] In some embodiments, the n is the sum of the n of the 5'MVIPs simultaneously located at the 5' ends of the sense and antisense strands of the RNA inhibitor, and the m is the sum of the m of the 3'MVIPs simultaneously located at the 3' ends of the sense and antisense strands of the RNA inhibitor.

[0023] The liver-targeting specific ligand X is selected from structures for enhancing hepatocyte uptake of the RNA inhibitor, and may be a lipid, steroid, vitamin, sugar, protein, peptide, polyamine, or peptidomimetic structure. In the RNA inhibitors provided by the present invention, the liver-targeting specific ligand X introduced at the end of the sense strand or antisense strand of the RNA inhibitor may be the same or different. For example, it may be a structure for enhancing liver targeting, a structure for regulating the pharmacokinetics of the RNA inhibitor in vivo, or a structure with in vivo solubility activity. In some embodiments, the liver-targeting specific ligand X is one or more monosaccharides and derivatives thereof selected from the following structures:

[0024] The monosaccharide is one or more selected from mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, and ribose. Mannose is one or more selected from D-mannopyranose, L-mannopyranose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, and β-D-mannopyranose. Galactose is one or more selected from L-galactose, D-galactose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, and β-D-galactofuranose. Glucose is one or more selected from D-glucose, L-glucose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, and β-D-glucofuranose. The fructose may be one or more selected from α-D-fructofuranose and α-D-fructopyranose. The xylose may be one or more selected from D-xylofuranose and L-xylofuranose. The ribose may be one or more selected from ribose, D-ribose, and L-ribose. The monosaccharide derivative may be one or more selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives. The galactose derivative may be one or more selected from α-D-galactosamine, N-acetylgalactosamine, and 4-thio-β-D-galactopyranose. The glucose derivative may be one or more selected from 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, 5-thio-β-D-glucopyranose, and methyl-2,3,4-trio-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranose. The ribose derivative may be one or more selected from D-4-thioribose and L-4-thioribose.

[0025] In some preferred embodiments, the liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and derivatives thereof, and has the general structural formula: [ka] where W1 is hydrogen or a hydroxy protecting group and may be the same or different, and W is -OH, -NHCOOH, or -NHCO(CH2) q CH3, wherein q is an integer of 0-4 and W2 is -NH-, O, S or C.

[0026] In some embodiments, the liver-targeting specific ligand X is preferably one or more selected from the following structures: [ka] where W is -OH, -NHCOOH or -NHCO(CH2) q CH3, where q is an integer of 0-4.

[0027] In some embodiments, the liver-targeting specific ligands X may be the same or different in the same 5'MVIP or 3'MVIP structure.

[0028] In some embodiments, X between the 5'MVIP and the 3'MVIP may be the same or different.

[0029] The branched chain L is a C4-C18 linear chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, a C4-C10 aliphatic carbocyclic group, a phenyl group, or a combination thereof. The linear chain may be a branched chain containing ethyl alcohol or a carboxylic acid. The branched chain L is preferably a C7-C18 linear chain containing an amide group or a 6-membered aliphatic carbocyclic group. The length and structure of the branched chain affect the activity of the RNA inhibitor of the present invention.

[0030] In some embodiments, the branched chains L may be the same or different in the same 5'MVIP or 3'MVIP structure.

[0031] In some embodiments, the branching chains L between the 5'MVIP and the 3'MVIP may be the same or different.

[0032] In some embodiments, the branched chain L is one or more selected from the following structures: [ka] where r1 is a positive integer of 1-12, r2 is an integer of 0-20, and Z is H or an alkyl group or an amide group, such as a C1-C5 alkyl group, a C1-C5 amide group, or formamide.

[0033] The structure of the linker B is related to the number of specific ligands X that can be introduced, and the linker B contains -NH-, C, O, S, an amide group, a phosphoryl group, or a thiophosphoryl group, and is linear when n or m is 1, and has 2, 3, or 4 branches when n or m is 2, 3, or 4, respectively. The linker B can be selected from the following structural formulas: [ka] Here, A1 and A2 are each independently C, O, S, -NH-, carbonyl, an amide group, a phosphoryl group, or a thiophosphoryl group, and r is an integer of 0-4.

[0034] In some embodiments, when n or m is 1, 2, 3, or 4, the linker B is selected from the following structures: [ka] [ka] where r is an integer from 0 to 4.

[0035] In some embodiments, when n or m is 1, 2, 3, or 4, the linker B is selected from the following structural formulas: [ka] [ka] In some embodiments, the linker B is preferably one or more selected from the following structures: [ka] The linking chain D is a C3-C18 linear chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aromatic hydrocarbon group, a C4-C10 aliphatic carbocyclic group, a 5- or 6-membered heterocyclic group containing 1-3 nitrogen atoms, or a combination of these groups, and the C3-C18 linear chain may have a branched chain of a methyl alcohol, methyl tert-butyl, methylphenol group, or a C5-C6 alicyclic group, and the linking chain D is preferably a C3-C10 linear chain containing two C=O, 6-membered aliphatic carbocyclic groups, or phenyl groups.

[0036] In some embodiments, the linking chain D is one or more selected from the following structures: [ka] [ka] wherein each n is a positive integer from 1 to 20, and each n is the same or different integer, s is an integer from 2 to 13, and Z1 and Z2 are the same or different substituents such as C3-C10 alkyl groups.

[0037] In some embodiments, the linking chain D is preferably one selected from the following structures: [ka] [ka]

[0038] In some embodiments, the linking chain D is preferably one or more selected from the following structures:

[0039] [ka] In some most preferred embodiments, the linking chain D is a C3-C10 linear chain containing two C=O.

[0040] In some embodiments, the (XL) of the 5'MVIP structure n BD- and 3'MVIP constructs (XL) m BD- is one or more selected from the following structures: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] In some preferred embodiments, the (XL) of the 5'MVIP structure n BD- is selected from the structures shown in Table 1.

[0041] [Table 1(1)] [Table 1(2)] [Table 1(3)] [Table 1(4)] In some embodiments, the 5'MVIP may be absent, in which case m may be an integer from 2-4.

[0042] In some preferred embodiments, the (XL) of the 3'MVIP structure m BD- is selected from the structures shown in Table 2.

[0043] [Table 2(1)] [Table 2(2)] [Table 2(3)] [Table 2(4)] In the RNA inhibitors provided by the present invention, the 5'MVIP further comprises a relay R1 linked or coupled to the 5' end of the sense strand or antisense strand. The structure of the relay R1 has an -NH-, sulfur atom, or oxygen atom, and the general structure has at least one -NH-, sulfur atom, or oxygen atom. R1 is linked to the linker D of the 5'MVIP and the 5' end of the sense strand or antisense strand via the -NH-, sulfur atom, or oxygen atom in its structure, thereby introducing a liver-targeting-specific ligand X. The relay R1 may be linear, or may have a linear chain with an amide group, carboxyl group, or alkyl group branched chain, or various cyclic structures, such as saturated or unsaturated aliphatic carbocyclic groups, or 5- or 6-membered heterocyclic groups or aromatic hydrocarbon groups containing sulfur, oxygen, or nitrogen atoms.

[0044] In some embodiments, R1 is -B1(CH2) x CH2B2-, where x is an integer of 3-10, preferably 4-6, and groups B1 and B2 can each be -NH-, a sulfur atom, or an oxygen atom.

[0045] In some embodiments, R1 is -B1(CH2) x CH(B3CH3)B2-, where x is an integer from 3 to 10, B1 and B2 can each be -NH-, a sulfur atom or an oxygen atom, and the group B3 is a functional group containing nitrogen, sulfur, oxygen or a carboxyl group or an alkyl group such as methyl.

[0046] In some embodiments, R1 is -NH(CH2) x CHO-, where x is an integer between 3 and 10, preferably between 4 and 6, and is incorporated by two phosphoramidite monomers: i. One oxygen atom or sulfur atom therein is used to synthesize an R1 phosphoramidite monomer, which is then linked to the 5' end of the single-stranded RNA inhibitor by solid-phase synthesis. In the structure, -NH-, a sulfur atom, or an oxygen atom is used to link to the linker chain D in the 5'MVIP, thereby introducing a liver-targeting-specific ligand X to the 5' end of the RNA inhibitor. An exemplary structure of the monomer introduced to the 5' end of the RNA inhibitor is as follows: [ka] In some embodiments, the following structure is preferred: [ka] ii. In the R1 structure, -NH-, sulfur atom, or oxygen atom is first linked to the linking chain D, and the other -NH-, sulfur atom, or oxygen atom is used to synthesize a phosphoramidite and an ester in the synthesis of a 5'MVIP phosphoramidite monomer. The structural example of the 5'MVIP phosphoramidite monomer of the sense strand or antisense strand is as follows: [ka] In some embodiments, R1 is a heterocyclic or carbocyclic structure containing a nitrogen, sulfur, or oxygen atom; [ka] In some preferred embodiments, the 5'MVIP phosphoramidite monomer of the sense or antisense strand preferably has the following structure: [ka] In the general formula, when n is 1 to 4, the linker B moiety in the above monomer is branched 1 to 4 times to obtain the corresponding monomer compound, and the liver-targeting specific ligand X is introduced to the 5'-end of the sense strand or antisense strand via the above monomer compound by solid phase synthesis.

[0047] In some preferred embodiments, the relay R1 is -NH(CH2) x Preferably, it is CH2O-, where x can be an integer from 3 to 10, preferably an integer from 4 to 6, and the 5'MVIP phosphoramidite monomer structure is selected from the following structures: [ka] [ka] [ka] In the RNA inhibitors provided by the present invention, the 3'MVIP further comprises a relay R2 linked or coupled to the 3' end of the sense strand or antisense strand, the relay R2 having an -NH-, sulfur atom, or oxygen atom in its structure, and at least one -NH-, sulfur atom, or oxygen atom in its general structure. R2 is linked to the linker D of the 3'MVIP and the 3' end of the sense strand or antisense strand via the -NH-, sulfur atom, or oxygen atom in its structure, thereby introducing a liver-targeting-specific ligand X. The relay R2 may be linear, or may have a branched chain containing an amide group, a carboxyl group, or an alkyl group, or may have various cyclic structures, such as a saturated or unsaturated aliphatic carbocyclic group, or a 5- or 6-membered heterocyclic group or aromatic hydrocarbon group containing a sulfur, oxygen, or nitrogen atom.

[0048] In some embodiments, the relay R2 structure is as follows, which includes a heterocyclic structure such as a piperidinyl, pyrrolyl, thiazolyl, or benzene ring:

[0049] [ka] R2 described in the present invention forms an ester or amide with -NH-, sulfur atom, or oxygen atom in the R2 structure using succinic anhydride, and is also coupled with -NH- in the blank solid support to form a 3'MVIP solid support, and the 3'MVIP is then introduced to the 3' end of the sense strand or antisense strand using phosphoramidite solid phase synthesis.

[0050] In some embodiments, the heterocycle in the R2 structure is a pyrrole ring or a piperidine ring, and is linked to the linking chain D of the 3'MVIP by an aza atom in the ring, and an exemplary structure of the 3'MVIP solid support is as follows: [ka] In the general formula, when m is 1-4, the linker B moiety in the above monomer is branched 1-4 times to obtain the corresponding solid support.

[0051] In some embodiments, R2 is -B4(CH2) x1 CH(OH)(CH2) x2 CH2B5-, where x1 is an integer of 1 to 4, x2 is an integer of 0 to 4, and B4 and B5 are each -NH-, a sulfur atom, or an oxygen atom. [ka] In the general formula, when m is 1-4, the linker B moiety in the above monomer is branched 1-4 times to obtain the corresponding solid support.

[0052] In some preferred embodiments, R2 is -NHCH2CH(OH)CH2O-. An exemplary structure for introducing a 3'MVIP solid support is as follows: [ka] In the general formula, when m is 1-4, the linker B moiety in the above monomer is branched 1-4 times to obtain the corresponding solid support.

[0053] In some embodiments, the 3'MVIP solid support structure is: [ka] [ka] [ka] In some preferred embodiments, (XL) in the 5'MVIP ligand structure n The combinations of BD- and R1 are shown in Table 3.

[0054] [Table 3] In some embodiments, the 3'MVIP may be absent, in which case n may be 2-4.

[0055] In some embodiments, (XL) in the 3'MVIP ligand structure m The combinations of BD- and R2 are shown in Table 4.

[0056] [Table 4(1)] [Table 4(2)] The sense and antisense strands in the RNA inhibitor structure provided by the present invention have a chain length of 15-30, preferably 19-23, and are complementary to each other at least 85% of their bases. To enhance the stability of the sense and antisense strands in vivo, the sense and antisense strands of the RNA inhibitor may be modified to further enhance their activity without affecting their activity, and the nucleotides therein may have modified groups, and the entire chain may be modified or partially modified, preferably completely modified. The modification is a technique readily understood by researchers in the field, and one or more of the following can be selected from the glycosyl moiety: deoxyribose nucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, 3'-3' linked (inverted) nucleotides, nucleotides containing unnatural bases, bridging nucleotides, peptide nucleic acids (PNAs), unlocked nucleotide analogs, locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me / 2'-fluoro nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-modified nucleotides include, but are not limited to, 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides, and 2'-alkyl nucleotides. In the RNA inhibitors provided by the present invention, neither the sense strand nor the antisense strand of the RNA inhibitor need be uniformly modified, but rather, one or more types of modifications can be incorporated into a single nucleotide thereof.Such modifications can also occur in the base moiety, and modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2 / N-6 and O-6 substituted purines, 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl groups of adenine and guanine, 2-alkyl groups of adenine and guanine and other alkyl derivatives, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5- propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil, 4-thiouracil, 8-halogen, 8-amino, 8-mercapto, 8-thioalkyl groups, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0057] The RNA inhibitors described in the present invention have 2'-O-methyl nucleotides and / or 2'-deoxy-2'-fluoro nucleotides in part or all of the sense and antisense strands, and at least two consecutive phosphorothioate bonds exist between the nucleotides at the 5' end of the sense strand and the 3' end of the antisense strand, and preferably the phosphate bonds between three consecutive nucleotides at the terminals are thiolated.

[0058] In the RNA inhibitors provided by the present invention, if one single strand has a 3'MVIP, the other single strand complementary to this single strand may or may not have a corresponding 5'MVIP or 3'MVIP. If one single strand of the RNA inhibitor has a 5'MVIP, the other single strand complementary to it may or may not have a corresponding 3'MVIP or 5'MVIP. The 5'MVIP and 3'MVIP can also be simultaneously linked to the corresponding ends of the sense strand or antisense strand. That is, if a 5'MVIP is present at the 5' end of the sense strand, a 3'MVIP can also be present at its 3' end, and if a 5'MVIP is present at the 5' end of the antisense strand, a 3'MVIP can also be present at its 3' end. Alternatively, a 5'MVIP can be simultaneously placed at the 5' ends of both the sense strand and the antisense strand. Alternatively, a 3'MVIP can be simultaneously placed at the 3' ends of both the sense strand and the antisense strand.

[0059] In some embodiments, different positions of the sense and / or antisense strand of the RNA inhibitor are accessed by different 5'MVIP and 3'MVIP combinations, preferably from Table 5 below, to consider the effect of HBsAg levels on HBV.

[0060] [Table 5] In some embodiments, the RNA inhibitors or pharmaceutically acceptable salts thereof described in the present invention are preferably prepared or synthesized in the form of a carboxylate salt, sodium salt, triethylamine salt, or other pharmaceutically acceptable salt.

[0061] In some embodiments, the RNA inhibitor or a pharmaceutically acceptable salt thereof is more preferably a sodium salt or a triethylamine salt.

[0062] In some embodiments, the sense strand of the RNA inhibitor is selected from Table 6 below.

[0063] [Table 6(1)] [Table 6(2)] In some embodiments, the sense strand of an RNA inhibitor described in the present invention differs from each sequence in Table 6 by one, two, or three nucleotides.

[0064] In some embodiments, the antisense strand of the RNA inhibitor is selected from Table 7 below.

[0065] [Table 7(1)] [Table 7(2)] In some embodiments, the antisense strand of an RNA inhibitor described in the present invention differs from each sequence in Table 7 by one, two, or three nucleotides.

[0066] In some embodiments contemplated for in vivo effects, the sense or antisense strand of the RNA inhibitor is selected from Table 8 below.

[0067] [Table 8] TIFF0007754524000068.tif36170 In some embodiments, the sense or antisense strand of an RNA inhibitor described in the present invention differs from each sequence in Table 8 by one, two, or three nucleotides.

[0068] In some embodiments, the cell line HepG2.2.15 was used to synthesize 5'MVIP and 3'MVIP as the sense strand (SEQ ID NO. 5 ) and / or the antisense strand (SEQ ID NO. 6 The RNA inhibitor code, the single stranded and code is as shown in Table 9 below.

[0069] [Table 9(1)] [Table 9(2)] [Table 9(3)] [Table 9(4)] In some embodiments, it is preferred to place the combinations 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, 5'MVIP09 / 3'MVIP09 at the 5' end of the sense strand and the 3' end of the antisense strand.

[0070] In some embodiments, it is preferable to position 5'MVIP01 / 3'MVIP09, 5'MVIP09 / 3'MVIP01 at the 5' and 3' ends of the sense strand.

[0071] In another aspect, the present invention further provides the use of the RNA inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating hepatogenic diseases, wherein the hepatogenic diseases include hepatitis, liver tumor, liver cirrhosis, jaundice, type 2 diabetes, fatty liver, blood coagulation diseases, blood albumin and globulin-related diseases, hyperlipidemia, atherosclerosis, and primary hypertension.

[0072] In another embodiment, the present invention provides a pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, the dosage form of which is oral, intravenous, subcutaneous, or intramuscular injection, preferably subcutaneous injection.

[0073] In another aspect, the present invention provides pharmaceutical compositions containing the above-described RNA inhibitors or pharmaceutically acceptable salts thereof and other hepatitis B therapeutic agents. Other hepatitis B therapeutic agents include, but are not limited to, clinically used nucleoside analogs or interferons, as well as several investigational candidate hepatitis B therapeutic agents. For example, in one embodiment of the immunomodulatory agent, the inhibitory effect of the RNA inhibitors described in the present invention on HBV HBsAg expression was compared with that of tenofovir, a current first-line drug used in chronic hepatitis B treatment, in a transgenic mouse model. Experimental results confirmed that the anti-hepatitis B nucleoside analogs have no inhibitory effect on HBV HBsAg and do not affect the HBsAg inhibitory effect of the RNA inhibitors described in the present invention when used in combination.

[0074] In some embodiments, the RNA inhibitors described in the present invention are used in combination with entecavir or interferon, the first-line drugs currently used to treat chronic hepatitis B, to examine their inhibitory effects on HBV and whether or not there is any mutual interference. Experiments were conducted to evaluate the HBV inhibitory effects of combined administration of the RNA inhibitors described in the present invention and various concentrations of entecavir or interferon in the widely used HepG2.2.15 cell line.

[0075] In some embodiments, a negative control siRNA is used to detect the sense strand. Code in Table 8 146, and the antisense strand is Code in Table 8 147 and discusses the inhibitory effect of the RNA inhibitors of the present invention on the four common subtypes of HBV, A, B, C and D.

[0076] In some embodiments, the cell line HepG2.2.15 is used to identify the different X, L, B, D, R1 and R2 in the 5'MVIP and / or 3'MVIP structures of the sense strand of the RNA inhibitor (SEQ ID NO. 5 ), antisense strand (SEQ ID NO. 6The effect of the resulting RNA inhibitors on the reduction of HBV HBsAg levels was evaluated. When any of X, L, B, D, R1, and R2 was different, the other parts of the corresponding 5'MVIP and / or 3'MVIP were the same as 5'MVIP09 / 3'MVIP09.

[0077] In some embodiments, the cell line HepG2.2.15 was used to examine the influence of different liver-targeting specific ligands X on the effect of the RNA inhibitor in reducing HBV HBsAg levels.

[0078] [Table 10] In some embodiments, the cell line HepG2.2.15 was used to examine the influence of different branched chain Ls on the activity of the RNA inhibitor.

[0079] [Table 11(1)] [Table 11(2)] Note: RNA inhibitors marked with an * indicate that the L structures are different within the same 5'MVIP or 3'MVIP structure or between 5'MVIP and 3'MVIP.

[0080] In some embodiments, the cell line HepG2.2.15 was used to examine the influence of linker B on the effect of the RNA inhibitor on reducing HBV HBsAg levels.

[0081] [Table 12(1)] [Table 12(2)] [Table 12(3)] [Table 12(4)] [Table 12(5)] [Table 12(6)] [Table 12(7)] Note: RNA inhibitors marked with an * indicate that the linker B structure between the 5'MVIP and 3'MVIP is different.

[0082] In some embodiments, the cell line HepG2.2.15 was used to examine the effect of linker D on the reduction of HBV HBsAg levels by the above-mentioned RNA inhibitor.

[0083] [Table 13] Note: RNA inhibitors marked with an * indicate that the linker D structure between the 5'MVIP and 3'MVIP is different.

[0084] In some embodiments, the cell line HepG2.2.15 was used to examine the influence of the above-mentioned RNA inhibitors on the reduction of HBV HBsAg levels from different relay points R1.

[0085] [Table 14] In some embodiments, the cell line HepG2.2.15 was used to examine the influence of the above-mentioned RNA inhibitors on the reduction of HBV HBsAg levels from different relay points R2.

[0086] [Table 15] In some embodiments, the sequence of the RNA inhibitor Ky-22 described in the present invention was further optimized and adjusted, including considering the number of sequence mers, the number of nucleotide phase differences allowed, and the number of fluorinated and thiolated terminals, and the impact of these adjustments on the HBsAg level-reducing effect and duration of effect of the RNA inhibitor. The sequences are shown in Table 16.

[0087] [Table 16] As a result of the embodiment, Ky-2201, which has a sense strand length of 21-mer, did not show a significant improvement in HBsAg levels or the duration of the lowering effect compared to Ky-22, and even showed a slight decrease. Therefore, the RNA inhibitor provided by the present invention is most preferably a 19-mer sense strand. Compared to Ky-22, Ky-2203 has one nucleotide change in each of the sense strand and antisense strand, which does not significantly affect the HBsAg level lowering or the duration of the effect. Based on the design of Ky-2203, there is no significant difference in the action effect between Ky-2204, which has a sense strand length of 21-mer, and Ky-2203. When the number of fluorinated residues was adjusted based on Ky-2203, the activity of Ky-2208, which has a relatively low number of fluorinated residues, was slightly superior to Ky-2203. The RNA inhibitors Ky-2205, obtained by altering the two overhanging nucleotides at the 3' end of the sense strand of Ky-2204, Ky-2206, obtained by altering the two nucleotides at the 3' end of the antisense strand of Ky-22, and Ky-2202, obtained by altering the two overhanging nucleotides at the 3' end of the sense strand of Ky-2201, showed no significant difference in activity from before the alteration. This indicates that the RNA inhibitors of the present invention can tolerate differences of 1-3 nucleotides in the sense strand or antisense strand, respectively. Ky-2207, obtained by removing the thiolation of the phosphate bond between three consecutive nucleotides at the 5' end of the sense strand and the 3' end of the antisense strand, significantly affects the HBsAg level-reducing effect and duration of effect compared to Ky-22.

[0088] In the present invention, the sense strand is preferably a 19-mer sequence and the antisense strand is preferably a 21-mer sequence, with a difference of 1-3 nucleotides allowed.

[0089] In some embodiments, a comparative anti-hepatitis B virus dose-effect study and combination study was conducted in a transgenic mouse model using the RNA inhibitor Ky-2208 and the nucleoside analog tenofovir (TDF). The results showed that tenofovir (TDF) had no effect on reducing HBsAg, while Ky-2208 efficiently reduced HBsAg levels, reducing them by up to 99.98%, and when used in combination with tenofovir (TDF), the efficacy of the RNA inhibitor of the present invention was not affected.

[0090] In some embodiments, the inhibitory effect of the RNA inhibitors Ky-08, Ky-10, Ky-19, Ky-13, Ky-21, Ky-22, Ky-23, Ky-26, Ky-27, Ky-29, Ky-37, and Ky-39 provided by the present invention on HBsAgk expression in an HBV transgenic mouse model was investigated. Experimental results showed that the RNA inhibitors Ky-19, Ky-26, Ky-37, and Ky-39 were able to reduce HBsAg expression levels by 93.0%-99.5% or more in vivo in HBV transgenic mice for at least four consecutive weeks.

[0091] In some embodiments, the RNA inhibitor Ky-2208 provided by the present invention reduces HBsAg levels by 98.2-99.6% in AAV-HBV mice for approximately 140 days, induces the production of surface antibodies HBsAb in the mice, and demonstrates the potential to functionally cure hepatitis B. [Brief explanation of the drawings]

[0092] In order to make the objectives, technical solutions and beneficial effects of the present invention clearer, the present invention provides the following drawings. [Figure 1] 1 is a high-resolution mass spectrogram of ERCd-01-c2 synthesized in Example 1.1.5. [Figure 2]1 is a high-resolution mass spectrogram of 3'MVIP17-c1 synthesized in Example 1.2.6. [Figure 3] 1 shows a high-resolution mass spectrogram of 5'MVIP09-ERCd-PFP-c2 synthesized in Example 1, 2.1.2. [Figure 4] FIG. 10 is a diagram showing the suppressive effect of Ky-00 to Ky-26 on HBsAg levels in the cell line HepG2.2.15 in Example 1 of Example 2. [Figure 5] FIG. 10 is a diagram showing the suppressive effect of Ky-27 to Ky-44 on HBsAg levels in the cell line HepG2.2.15 in Example 2 of Example 2. [Figure 6] In Examples 3, 4 and 6 of Example 2, the influence of different X / L / D on the effect of RNA inhibitors on reducing HBV HBsAg levels is shown. [Figure 7] This is a diagram showing the influence of linker B on the effect of RNA inhibitors on reducing HBV HBsAg levels in Example 5 of Example 2. [Figure 8] This is a diagram showing the influence of RNA inhibitors from different relay points R1 / R2 on the effect of reducing HBV HBsAg levels in Examples 7 and 8 of Example 2. [Figure 9] FIG. 10 is a graph showing the HBsAg suppression effect of Ky-22 in combination with entecavir or interferon in HepG2.2.15 cells in Example 9 of Example 2. [Figure 10] FIG. 10 is a graph showing the HBeAg suppression effect of Ky-22 in combination with entecavir or interferon in HepG2.2.15 cells in Example 9 of Example 2. [Figure 11] This is a diagram showing the HBV DNA suppression effect of Ky-22 in combination with entecavir or interferon in HepG2.2.15 cells in Example 9 of Example 2. [Figure 12] This is a diagram showing the inhibitory effect of Ky-22 on four different genotypes (A, B, C, D) of HBV cell lines in Example 10 of Example 2. [Figure 13]This is a diagram showing the HBsAg suppression effect of RNA inhibitors in an HBV transgenic mouse model in Example 1 of Example 3. [Figure 14] FIG. 10 is a diagram showing the HBsAg suppression effect in HBV transgenic mice by adjusting the Ky-22 sequence in Example 2 of Example 3. [Figure 15] FIG. 10 is a diagram showing the results of examining the dose effect of Ky-2208 in an AAV-HBV mouse model in Example 3 of Example 3. [Figure 16] 10 is a histogram showing the effect of Ky-2208 on HBsAb production in an AAV-HBV mouse model in Example 3 of Example 3. [Figure 17] This is a diagram showing the results of a study comparing and combining Ky-2208 with TDF in HBV-Tg mice in Example 4 of Example 3. DETAILED DESCRIPTION OF THE INVENTION

[0093] The following embodiments show some embodiments disclosed in the present invention, but are not limited thereto.In addition, the present inventors expect that specific embodiments will be applied when providing specific embodiments.For example, RNA inhibitors with certain similar or similar chemical structures are used to treat different hepatic diseases.

[0094] explanation: DMSO: dimethyl sulfoxide; DMF: N,N-dimethylformamide; HOBt: 1-hydroxybenzotriazole; HBTU: O-(benzotriazole-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate; DIPEA (DIEA): N,N-diisopropylethylamine; DCM: dichloromethane; DMAP: 4-dimethylaminopyridine; DMT-CL: 4,4'-dimethoxytriphenylmethyl chloride; MEOH: methanol; TBTU: O-(benzotriazole-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroboric acid; [ka] A solid support, such as macroporous aminomethyl resin.

[0095] Example 1: Synthesis of RNA inhibitors Ky-19, Ky-22, Ky-2208, Ky-26, Ky-37, and Ky-39 The RNA inhibitors of the present invention are prepared by the solid-phase phosphoramidite method, whereby the sense and antisense strands are prepared, and then the sense and antisense strands are annealed to obtain the final product. The basic steps of the solid-phase phosphoramidite method include: 1) deprotection: removal of the solid support hydroxyl-protecting group (DMTr) of the starting monomer; 2) coupling: addition of the first phosphoramidite monomer, which initiates a 3'-5' coupling reaction; 3) oxidation: oxidation of the resulting nucleotide phosphite to a more stable nucleotide phosphate (i.e., oxidation of trivalent phosphorus to pentavalent phosphorus); and 4) blocking: blocking the 5'-OH of the nucleotide monomer that did not react in the previous step by capping it to prevent further reaction. These steps are repeated until the final phosphoramidite monomer is added. Next, the ester bond between the solid support and the starting monomer is cleaved with aqueous methylamine and aqueous ammonia, and the various base and phosphate protecting groups on the resulting oligonucleotides, cyanoethyl (P), benzoyl (mA, fA), and acetyl (mC), are removed. The oligonucleotides are then separated and purified by HPLC, filtered to sterilize, and lyophilized to obtain the corresponding sense or antisense strands.

[0096] The concentrations of the annealed sense and antisense strand reconstituted solutions were precisely measured and mixed at equimolar concentrations. Then, 1 / 20 of this volume of 1 M PBS solution was added and mixed again. The mixture was heated to 95°C for 5 minutes, and then allowed to cool to 40°C or room temperature over 3 hours. HPLC analysis was performed. If less than 5% of the single strands remained, the reaction was considered complete.

[0097] When 3'MVIP is present at the 3' end of the sense strand or antisense strand of the RNA inhibitor of the present invention, the starting monomer for solid phase synthesis of the solid support of 3'MVIP is represented by the following general formula: [ka] When m is 1 to 4, the linker B moiety in the general formula is branched 1 to 4 times to obtain the corresponding 3'MVIP solid support.

[0098] When m is 1, the obtained solid support is used as a starting monomer for solid-phase synthesis of the antisense strand of the RNA inhibitor Ky-26 and the sense strand of Ky-39; when m is 2, the obtained solid support is used as a starting monomer for solid-phase synthesis of the sense strand of the RNA inhibitor Ky-37 and the antisense strands of Ky-22 and Ky-2208; and when m is 3, the obtained solid support is used as a starting monomer for solid-phase synthesis of the antisense strand of the RNA inhibitor Ky-19.

[0099] When 5'MVIP is present at the 5' end of the sense or antisense strand of the RNA inhibitor of the present invention, the 5'MVIP phosphoramidite monomer is the last phosphoramidite monomer used in solid-phase synthesis of the sense or antisense strand. The general formula of the 5'MVIP phosphoramidite monomer is as follows: [ka] When n is 1-4, the linker B moiety in the general formula is branched 1-4 times to give the corresponding 5'MVIP phosphoramidite monomer.

[0100] When n is 1, the resulting 5'MVIP phosphoramidite monomer is used as the final monomer for solid-phase synthesis of the sense strands of the RNA inhibitors Ky-19, Ky-26, and Ky-37; when n is 2, the resulting 5'MVIP phosphoramidite monomer is used as the final monomer for solid-phase synthesis of the sense strands of the RNA inhibitors Ky-39, Ky-22, and Ky-2208.

[0101] The sense and antisense strands of these RNA inhibitors described in this invention require chemical synthesis of the corresponding 3'MVIP solid support and 5'MVIP phosphoramidite monomers prior to solid-phase synthesis of the phosphoramidites. The chemical synthesis process is described as follows.

[0102] 1. Synthesis of 3'MVIP Solid Support 1.1 Synthesis of solid supports for the sense strand of RNA inhibitor Ky-37 and the 3'MVIP09 antisense strands of Ky-22 and Ky-2208 [ka] Synthesis process description: Synthesis of ERC-01-c1 [ka] 2-Amino-1,3-propanediol (5.0 g, 54.9 mmol) was weighed, and 50 mL of DMSO and 5 mL of sodium hydroxide solution (1 g / mL) were added. The mixture was cooled to 0°C, and t-butyl acrylate (20 mL, 137.8 mol) was added dropwise over 2 hours. The mixture was allowed to react at room temperature for 48 hours. Petroleum ether (100 mL) was added to the mixture, and the organic phase was washed twice with saturated brine, dried, and passed through a chromatography column (eluent: ethyl acetate:petroleum ether = 25%-75%). The column was loaded with 0.05% triethylamine, and 6.2 g of a colorless oil was obtained.

[0103] Synthesis of ERC-01-c2 [ka] ERC-01-c1 (6.2 g, 17.9 mmol) was weighed, added to 50 mL of dichloromethane, and 23 mL of 25% sodium carbonate solution. Benzyl chloroformate (8.2 mL, 57.4 mmol) was added dropwise over 2 hours at room temperature. The mixture was allowed to react overnight at room temperature, washed three times with saturated brine, dried over anhydrous sodium sulfate, and evaporated to dryness. The mixture was passed through a chromatography column (ethyl acetate:petroleum ether = 5%-30%) to obtain 4.0 g of an oil.

[0104] Synthesis of ERC-01-c3 [ka] ERC-01-c2 (4.0 g, 8.3 mmol) was added, and 12 mL of formic acid was added, followed by reaction at room temperature overnight. The solvent was evaporated under reduced pressure to obtain 2.8 g of a product.

[0105] 1.1.4. Synthesis of ERCd-01-c1 [ka] Compounds ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), HOBt (2.24 g) and HBTU (3.36 g) were added, and then DIEA (4.16 mL) was slowly added. The reaction mixture was stirred at room temperature for 3 hours. Water was then added, and the aqueous layer was extracted with dichloromethane (2 x 10 mL). The combined organic layers were washed sequentially with saturated sodium bicarbonate (80 mL), water (2 x 60 mL), and saturated brine (60 mL), dried over anhydrous sodium sulfate, and evaporated under reduced pressure. The residue was purified by silica gel column chromatography (eluent: 3-15% MeOH in DCM) to give 3.24 g of a pale yellow solid.

[0106] 1.1.5. Synthesis of ERCd-01-c2 [ka] ERCd-01-c1 (3.24 g, 2.6 mmol) was dissolved in methanol (60 mL), and 10% palladium-carbon (0.3 g) and acetic acid (2.0 mL) were added. Hydrogen was then added under atmospheric pressure, and the reaction was allowed to proceed overnight. The reaction mixture was filtered through diatomaceous earth, and the filtrate was evaporated to dryness under reduced pressure to obtain 2.9 g of an oily product, ERCd-01-c2. Its high-resolution mass spectrogram is shown in Figure 1.

[0107] 1.1.6. Synthesis of 3'MVIP09-c1 [ka] SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added to a reaction flask, followed by 10 mL of DCM. The mixture was dissolved under stirring. TBTU (0.963 g) and DIPEA (0.517 g) were added, followed by overnight reaction. Water was added, and the mixture was extracted with DCM. The organic phase was washed with saturated brine, dried, filtered, and concentrated. Finally, the product was purified by passing through a silica gel column to obtain 1.3 g of the product.

[0108] 1.1.7. Synthesis of 3'MVIP09-c2 [ka] 3'MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added to a reaction flask and dissolved with stirring at room temperature. DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were then added in sequence and the mixture was stirred at room temperature. TLC analysis was performed. Upon completion of the reaction, the DCM was concentrated, water was added, and the mixture was extracted with DCM. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated. Finally, the product was purified by passing through a silica gel column to obtain 1.55 g of the product.

[0109] 1.1.8. Solid Support Synthesis of 3'MVIP09 [ka] 3'MVIP09-c2 (0.86 g, 0.5 μmol) was dissolved in 10 mL DMF in a reaction flask. HBTU (0.19 g), DIPEA (0.194 g), and macroporous aminomethyl resin (2.0 g) were added in that order. The mixture was shaken for 24 h on a shaker, filtered, and the resin was washed with 10% methanol / DCM and end-capped with 25% acetic acid / pyridine. The degree of substitution was 150 μmol / g.

[0110] 1.2 Synthesis of solid support for 3'MVIP17, the antisense strand of the RNA inhibitor Ky-19 [ka] 1.2.1. Synthesis of SANC-01-c1 [ka] For the synthesis steps, refer to 1.1.1. Synthesis of ERC-01-c1 in Example I.

[0111] 1.2.2. Synthesis of SANC-01-c2 [ka] For the synthesis steps, refer to 1.1.2. Synthesis of ERC-01-c2 in Example I.

[0112] 1.2.3. Synthesis of SANC-01-c3 [ka] For the synthesis steps, refer to 1.1.3. Synthesis of ERC-01-c3 in Example I.

[0113] 1.2.4. Synthesis of SANCd-01-c1 [ka] For the synthesis steps, refer to 1.1.4. Synthesis of ERCd-01-c1 in Example I.

[0114] 1.2.5. Synthesis of SANCd-01-c2 [ka] For the synthesis steps, refer to 1.1.5. Synthesis of ERCd-01-c2 in Example I.

[0115] 1.2.6. Synthesis of 3'MVIP17-c1 [ka] The synthesis steps refer to 1.1.6. Synthesis of 3'MVIP09-c1 in Example I, and the high-resolution mass spectrogram of the synthesized 3'MVIP17-c1 is shown in Figure 2.

[0116] 1.2.7. Synthesis of 3'MVIP17-c2 [ka] For the synthesis steps, refer to 1.1.7. Synthesis of 3'MVIP09-c2 in Example 1.

[0117] 1.2.8. Solid Support Synthesis of 3'MVIP17 [ka] The synthesis steps refer to 1.1.8 Solid Support Synthesis of 3'MVIP09 in Example 1.

[0118] 1.3 Synthesis of solid supports for the antisense strand of RNA inhibitor Ky-26 and the sense strand of Ky-39 with 3'MVIP01 [ka] Synthesis process description 1.3.1. Synthesis of 3'MVIP01-c1 [ka] For the synthesis steps, refer to 1.1.6. Synthesis of 3'MVIP09-c1 in Example 1.

[0119] 1.3.2. Synthesis of 3'MVIP01-c2 [ka] For the synthesis steps, refer to 1.1.7. Synthesis of 3'MVIP09-c2 in Example 1.

[0120] 1.3.3. Solid Support Synthesis of 3'MVIP01 [ka] The synthesis steps refer to 1.1.8. Solid Support Synthesis of 3'MVIP09 in Example 1.

[0121] 2. Synthesis of 5'MVIP phosphoramidite monomer 2.1 When n is 2, the resulting 5'MVIP phosphoramidite monomer is used as the final monomer for solid phase synthesis of Ky-22, Ky-2208, and Ky-39 sense strands.

[0122] Synthesis of 5'MVIP09 phosphoramidite monomer [ka] 5'MVIP09 phosphoramidite monomer 2.1.1. Synthesis of 5'MVIP09-ERCd-PFP-c1 [ka] ERCd-01-c2 (2.18 g, 2.0 mmol) was weighed and dissolved in DMF (50 mL), and 1,5-pentanedioic acid monobenzyl ester (0.53 g, 2.4 mmol), DIPEA (0.78 g), and TBTU (0.84 g) were added. The mixture was stirred at room temperature overnight, quenched with water (50 mL), extracted with DCM (30 mL), washed with 10% citric acid (50 mL), saturated sodium bicarbonate (50 mL), and pyridine (100 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain product 5'MVIP09-ERCd-PFP-c1 (2.15 g).

[0123] 2.1.2. Synthesis of 5'MVIP09-ERCd-PFP-c2 [ka] 5'MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% palladium on carbon (0.21 g) were weighed, added to methanol (50 mL), and hydrogen was added at room temperature with stirring. The mixture was allowed to react overnight. Upon completion of the reaction, the palladium on carbon was filtered through diatomaceous earth and rotary evaporated to give crude 5'MVIP09-ERCd-PFP-c2 (1.9 g). Its high-resolution mass spectrogram is shown in Figure 3.

[0124] 2.1.3. Synthesis of 5'MVIP09-ERCd-PFP [ka] Crude 5'MVIP09-ERCd-PFP-c2 (1.9 g, 1.58 mmol) was weighed and dissolved in DCM (60 mL), DIPEA (1.33 g) was added, cooled, and pentafluorophenyl trifluoroacetate (2.21 g, 7.9 mmol) was added. After stirring at room temperature for 2 h, the mixture was evaporated by rotary evaporation and further dissolved in DCM (60 mL). The mixture was washed with saturated sodium bicarbonate (30 mL), 10% citric acid (30 mL), and saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and evaporated by rotary evaporation to give crude 5'MVIP09-ERCd-PFP (2.35 g). After pump-off, the mixture was used directly in the next step without further purification.

[0125] 2.1.4. Synthesis of 5'MVIP09 phosphoramidite monomer-c1 [ka] The crude 5'MVIP09-ERCd-PFP (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL), DIPEA (0.82 g, 6.32 mmol), and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added, and the mixture was stirred overnight at room temperature. 10% citric acid (30 mL) was added, and the mixture was extracted with DCM (30 mL * 3), washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain the product 5'MVIP09 monomer-c1 (1.73 g).

[0126] 2.1.5. 5'MVIP09 phosphoramidite monomer [ka] 5'MVIP09 phosphoramidite monomer-c1 (1.3 g, 1.0 mmol) was weighed and dissolved in acetonitrile (30 mL), followed by the addition of diisopropylamine triazole (0.22 g). Bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.2 mmol) was added in an ice bath, and the reaction was carried out at room temperature for 4 hours. The completion of the reaction was confirmed by HPLC, and the mixture was concentrated and purified by column chromatography to obtain the product 5'MVIP09 monomer (1.2 g).

[0127] 2.2 When n is 1, the resulting 5'MVIP phosphoramidite monomer is used as the final monomer for solid-phase synthesis of the sense strands of Ky-19, Ky-26, and Ky-37.

[0128] Synthesis of 5'MVIP01 phosphoramidite monomer [ka] For the phosphoramidite monomer of 5'MVIP01, YICd-01-c2 (1.12 g, 2.0 mmol) was weighed out, but other procedures were as described in 2.1.1. to 2.1.5.

[0129] Example 2: In vitro testing Example 1: Using the cell line HepG2.2.15, the effect of RNA inhibitors obtained by coupling 5'MVIP and 3'MVIP to different ends of the sense and antisense strands to reduce the HBsAg level of HBV is evaluated. Test procedure: Prepare the corresponding RNA inhibitors Ky-00 to Ky-26 according to the method described in Example 1, and prepare DMEM medium containing 10% fetal bovine serum. Prepare medium containing 0.05, 0.5, and 5 nM RNA inhibitor samples in the culture medium. Incubate HepG2.2.15 cells at 10 5Cells were seeded at a density of 10 ...

[0130] The obtained test data are shown in Figure 4. As shown in Figure 4, the inhibitory effect of Ky-19, Ky-22 and Ky-2 on HBsAg is superior to that of other compounds.

[0131] Example 2: Using the cell line HepG2.2.15, we evaluated the effect of the resulting RNA inhibitors in reducing HBV HBsAg levels when 5'MVIP and 3'MVIP were placed simultaneously at the two ends of the sense or antisense strand of an RNA inhibitor, or when 5'MVIP or 3'MVIP was placed simultaneously at the same end of the antisense and sense strands, for example, the 3' or 5' end.

[0132] Test procedure: Prepare the corresponding RNA inhibitors Ky-27 to Ky-44 according to the method described in Example 1, and prepare DMEM medium containing 10% fetal bovine serum. Prepare medium containing 0.05, 0.5, and 5 nM RNA inhibitor samples in the culture medium. Incubate HepG2.2.15 cells at 10 5 Cells were seeded at a cell density of 1000 kJ / cm2. After incubation in 10% fetal bovine serum DMEM medium at 37°C, 5% CO2 for 24 hours, the above RNA inhibitor samples were added at different concentrations to intervene. After incubation for 72 hours, the supernatant was collected and compared with the supernatant of untreated HepG2.2.15 cells using an HBsAg detection kit (Shanghai Kehua, ELISA method) to calibrate the relative percentage of HBsAg in the sample intervention group. The test data obtained are shown in Figure 5.

[0133] Of the RNA inhibitors tested, the sense strand is SEQ ID NO. 5 and the antisense strand is SEQ ID NO. 6wherein the 5' end of the sense strand is coupled to 5'MVIP and the 3' end of the antisense strand is coupled to 3'MVIP.

[0134] Example 3: Using the cell line HepG2.2.15, we evaluate the effect of different liver-targeting specific ligands X on the reduction of HBV HBsAg levels by RNA inhibitors. We investigated the effect of different liver-targeting specific ligands, X, on the reduction of HBV HBsAg levels by RNA inhibitors. Among the RNA inhibitors obtained, Ky-22, Ky-22-X2 to Ky-22-X6, in addition to the change in X structure, L, B, D, and R1 / R2 match the combination of 5'MVIP09 / 3'MVIP09.

[0135] In the tested RNA inhibitor, the sense strand is SEQ ID NO. 2, the antisense strand is SEQ ID NO. 59, the 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0136] Test procedure: Prepare the corresponding RNA inhibitors according to the method described in Example 1, and prepare DMEM medium containing 10% fetal bovine serum. Prepare a medium containing 10 nM RNA inhibitor samples in the culture medium. Incubate HepG2.2.15 cells at 10 5 Cells were seeded at a density of 10 ...

[0137] Of the RNA inhibitors tested, the sense strand is SEQ ID NO. 5 and the antisense strand is SEQ ID NO. 6 wherein the 5' end of the sense strand is coupled to 5'MVIP and the 3' end of the antisense strand is coupled to 3'MVIP.

[0138] Example 4: Evaluating the effect of different branched-chain L-ribonucleotide inhibitors on reducing HBV HBsAg levels using the HepG2.2.15 cell line We investigated the effect of different branched chain L RNA inhibitors on the reduction of HBV HBsAg levels. Among the RNA inhibitors obtained, Ky-22, Ky-22-L2 to Ky-22-L14 not only had altered L structures, but also had X, B, D, and R1 / R2 matching the combination of 5'MVIP09 / 3'MVIP09.

[0139] In the tested RNA inhibitor, the sense strand is SEQ ID NO. 2, the antisense strand is SEQ ID NO. 59, the 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0140] Test procedure: Prepare the corresponding RNA inhibitors according to the method described in Example 1, and prepare DMEM medium containing 10% fetal bovine serum. Prepare a medium containing 10 nM RNA inhibitor samples in the culture medium. Incubate HepG2.2.15 cells at 10 5 Cells were seeded at a density of 10 ...

[0141] Of the RNA inhibitors tested, the sense strand is SEQ ID NO. 5 and the antisense strand is SEQ ID NO. 6 wherein the 5' end of the sense strand is coupled to 5'MVIP and the 3' end of the antisense strand is coupled to 3'MVIP.

[0142] Example 5: Using the cell line HepG2.2.15, evaluate the effect of linker B on the reduction of HBV HBsAg levels by RNA inhibitors The effect of different linker B on the reduction of HBV HBsAg levels by RNA inhibitors was examined. Among the obtained RNA inhibitors, Ky-22, Ky-22-B2 to Ky-22-B7, Ky-19, Ky-19-B2 to Ky-19-B12, Ky-26, Ky-26-B2 to Ky-26-B7, Ky-37, Ky-37-B2 to Ky-37-B6, and Ky-39, Ky-39-B2 to Ky-39-B6, in addition to the changes in B structure, X, L, D, and R1 / R2 match the combination of 5'MVIP09 / 3'MVIP09.

[0143] In the tested RNA inhibitor, the sense strand is SEQ ID NO. 2, the antisense strand is SEQ ID NO. 59, the 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0144] Test procedure: Prepare the corresponding RNA inhibitor according to the method described in Example 1, and prepare a DMEM medium containing 10% fetal bovine serum. Prepare a medium containing 10 nM RNA inhibitor sample in culture medium. Prepare HepG2.2.15 cells at a cell density of 105. Incubate the cells in 10% fetal bovine serum DMEM medium at 37°C and 5% CO2 for 24 hours, then add the drug for intervention. After 72 hours of incubation, collect the supernatant and use an HBsAg detection kit (Shanghai Kehua, ELISA method) to calibrate the relative percentage of HBsAg in the sample intervention group compared with the supernatant of HepG2.2.15 cells without intervention.

[0145] Of the RNA inhibitors tested, the sense strand is SEQ ID NO. 5 and the antisense strand is SEQ ID NO. 6 wherein the 5' end of the sense strand is coupled to 5'MVIP and the 3' end of the antisense strand is coupled to 3'MVIP.

[0146] Example 6: Using the cell line HepG2.2.15, evaluate the effect of RNA inhibitors on the reduction of HBV HBsAg levels from linker D. We considered the effect of different linker chains D on the reduction of HBV HBsAg levels by RNA inhibitors. Among the obtained RNA inhibitors, Ky-22, Ky-22-D2 to Ky-22-D5, in addition to the change in D structure, X, L, B, and R1 / R2 correspond to the most preferred MVIP09 combination of MVIP5'MVIP09 / 3'.

[0147] In the tested RNA inhibitor, the sense strand is SEQ ID NO. 2, the antisense strand is SEQ ID NO. 59, the 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0148] Test procedure: Prepare the corresponding RNA inhibitors according to the method described in Example 1, and prepare DMEM medium containing 10% fetal bovine serum. Prepare a medium containing 10 nM RNA inhibitor samples in the culture medium. Incubate HepG2.2.15 cells at 10 5 Cells were seeded at a density of 10 ...

[0149] Of the RNA inhibitors tested, the sense strand is SEQ ID NO. 5 and the antisense strand is SEQ ID NO. 6 wherein the 5' end of the sense strand is coupled to 5'MVIP and the 3' end of the antisense strand is coupled to 3'MVIP.

[0150] Example 7: Evaluating the effect of different R1 to RNA inhibitors on reducing HBV HBsAg levels using the HepG2.2.15 cell line We considered the influence of different relay sites R1 on the effect of RNA inhibitors in reducing HBV HBsAg levels. The obtained RNA inhibitors Ky-22, Ky-22-R1-1 to Ky-22-R1-5 not only have different R1 structures, but also X, L, B, D, and R2, which correspond to the most favorable MVIP combination of 5'MVIP09 / 3'MVIP09.

[0151] In the tested RNA inhibitor, the sense strand is SEQ ID NO. 2, the antisense strand is SEQ ID NO. 59, the 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0152] Test procedure: Prepare the corresponding RNA inhibitors according to the method described in Example 1, and prepare DMEM medium containing 10% fetal bovine serum. Prepare a medium containing 10 nM RNA inhibitor samples in the culture medium. Incubate HepG2.2.15 cells at 10 5 Cells were seeded at a density of 10 ...

[0153] Of the RNA inhibitors tested, the sense strand is SEQ ID NO. 5 and the antisense strand is SEQ ID NO. 6 wherein the 5' end of the sense strand is coupled to 5'MVIP and the 3' end of the antisense strand is coupled to 3'MVIP.

[0154] Example 8: Evaluating the effect of different R2 RNA inhibitors on reducing HBV HBsAg levels using the HepG2.2.15 cell line We investigated the effect of different R2 relay sites on the RNA inhibitors' ability to reduce HBV HBsAg levels. The resulting RNA inhibitors, Ky-22, Ky-22-R2-1 to Ky-22-R2-11, differed not only in their R2 structure but also in their X, L, B, D, and R1, which correspond to the most preferred MVIP combination of 5'MVIP09 / 3'MVIP09. The corresponding RNA inhibitors were prepared according to the method described in Example 1.

[0155] In the tested RNA inhibitor, the sense strand is SEQ ID NO. 2, the antisense strand is SEQ ID NO. 59, the 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0156] Test procedure: Prepare the corresponding RNA inhibitors according to the method described in Example 1, and prepare DMEM medium containing 10% fetal bovine serum. Prepare a medium containing 10 nM RNA inhibitor samples in the culture medium. Incubate HepG2.2.15 cells at 10 5 Cells were seeded at a density of 10 ...

[0157] Of the tested RNA inhibitors, Ky-22, the sense strand is SEQ ID NO. 5 and the antisense strand is SEQ ID NO. 6 wherein the 5' end of the sense strand is coupled to 5'MVIP and the 3' end of the antisense strand is coupled to 3'MVIP.

[0158] Example 9: To investigate whether Ky-22 interacts with entecavir or interferon, the first-line drugs currently used in chronic hepatitis B treatment, to determine whether there is a mutual interference effect on the HBV inhibitory effect. The study evaluates the inhibitory effect of the RNA inhibitors described in this invention in combination with different concentrations of entecavir (ETV) or interferon (IFN-α) on HBV in the widely used HepG2.2.15 cell line.

[0159] In the tested RNA inhibitor Ky-22, the sense strand is SEQ ID NO. 2, the antisense strand is SEQ ID NO. 59, the 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0160] Test procedure: Prepare DMEM medium containing 10% fetal bovine serum. Prepare medium containing 10 nM of the RNA inhibitor Ky-22 sample in culture medium. Incubate HepG2.2.15 cells at 10 5 The cells were seeded at a cell density of 1000 kJ / cm2 and cultured in 10% fetal bovine serum DMEM medium at 37°C, 5% CO2 for 24 hours, then drugs were added for intervention. After 72 hours of culture, the supernatant was collected and HBsAg, HBeAg, and HBV DNA were detected. The relative percentages of HBsAg, HBeAg, and HBV DNA in the sample treatment group were calibrated by comparing with the supernatant of HepG2.2.15 cells without intervention.

[0161] The chemical concentration is: ETV: 10 μM, 1 μM, 0.1 μM; IFN-a: 1000IU / mL, 100IU / mL, 10IU / mL; Ky-22: 0.125 μg / mL; ETV+Ky-22: 10μM+0.125μg / mL, 1μM+0.125μg / mL, 0.1μM+0.125μg / mL; IFN-a +Ky-22: 1000IU / mL+0.125μg / mL, 100IU / mL+0.125μg / mL, 10IU / mL+0.125μg / mL.

[0162] HBV stable integrated cells of four genotypes (A, B, C, and D) in the logarithmic growth phase were digested into a cell suspension and placed in a 48-well plate (300 μl / well). Approximately 300,000 cells were placed in each well and incubated with Ky-22 or negative control siRNA (sense strand) at the following concentrations until the cells reached 70% confluence (approximately 24 h after seeding in the well plate). Code in Table 8 146, the antisense strand Code in Table 8 147) and 4.1μg / mL, 2.2μg / mL, 1.1μg / mL, 0.6μg / mL, 0.3μg / mL, 0.15μg / mL, 0.0725μg / mL, 0.03625μg / mL, 0.018125μg / mL, 0.0090625μg / mL, 0.00453125μg / mL, 0.00226563μg / mL, 0.00113281μg / mL, 0.000566406μg / mL, 0.000283203μg / mL.

[0163] Example 10: Study of the inhibitory effect of Ky-22 on four different genotype (A, B, C, D) HBV cell lines Explanation of the test process Cell line construction: HBV gene integration was performed using the Sleeping Beauty transposon system on HepG2 cells. Cell culture conditions: DMEM + 10% FBS, 37°C, 5% CO2. HBV 1.3ploid genes of four different genotypes (A, B, C, D) were ligated into the PT2 / HB vector using Gibson Assembly® Master Mix. At the same time, red fluorescent protein and puromycin resistance genes were used as markers for cell line screening. The constructed plasmids were co-transfected with pCMV(CAT)T7-SB100 into HepG2 cells using the X-treme GENE HP DNA Transfection Reagent. The transfection method was as follows: Following the manufacturer's instructions, the transfection system required for cell transfection in 10cm culture dishes was prepared. HepG2 cells were then incubated for 20 minutes at 70% confluence, and the resulting cell suspension was added to the prepared transfection system. After thorough mixing, the cells were cultured in a culture tank. 48 hours after transfection, puromycin resistance was screened at 2μg / mL. Puromycin-resistant cells (i.e., cells that did not integrate with HBV) were identified, and HBV-integrated cells were expanded. Cells with high red fluorescence intensity (i.e., cells with high HBV integration copy numbers) were selected by flow cytometry, yielding four HBV-stably integrated cell lines of different genotypes.

[0164] HBV stable integrated cells of four genotypes (A, B, C, and D) in the logarithmic growth phase were digested into a cell suspension and placed in a 48-well plate (300 μl / well), with approximately 300,000 cells per well. The cells were incubated until the confluence reached 70% (approximately 24 h after plating in the well plate), and Ky-22 or negative control siRNA (sense strand: SEQ ID NO. 146, antisense strand: SEQ ID NO. 147) at the following concentrations was added: 4.1μg / mL, 2.2μg / mL, 1.1μg / mL, 0.6μg / mL, 0.3μg / mL, 0.15μg / mL, 0.0725μg / mL, 0.03625μg / mL, 0.018125μg / mL, 0.0090625μg / mL, 0.00453125μg / mL, 0.00226563μg / mL, 0.00113281μg / mL, 0.000566406μg / mL, 0.000283203μg / mL.

[0165] Alternatively, without adding any chemicals, the supernatant was collected after 24 hours, 48 ​​hours, and 72 hours, and then stored at -20°C. The medium was replaced with fresh, additive-free medium, and the HBsAg content in the cell supernatant was detected.

[0166] The test data are shown in Figure 12. The results showed that compared with the negative control siRNA treatment group (Control), Ky-22 exhibited significant inhibitory effects against HBV genotypes A, B, C, and D, with EC50 (ng / mL) of 22.72, 25.45, 29.06, and 23.35, respectively.

[0167] Example 3 In Vivo Dose-Effect Studies Example 1: Study of the effect of RNA inhibitors on the reduction of HBsAg in an HBV transgenic mouse model The corresponding RNA inhibitors Ky-08, Ky-10, Ky-13, Ky-19, Ky-21, Ky-22, Ky-23, Ky-26, Ky-27, Ky-29, Ky-37 and Ky-39 were prepared by the method described in Example 1, and 65 male HBV transgenic mice weighing 25-35g and aged 8-10 weeks were selected. They were housed in an animal room meeting SPF standards, with a temperature of 16-26°C, humidity of 40-70%, and cycling light (12 hours light and 12 hours dark), and allowed to drink water and eat food ad libitum.

[0168] HBV HBsAg was detected before animal grouping and randomized according to HBV HBsAg expression levels to ensure that the average HBV HBsAg levels in each group were as consistent as possible. Mice were divided into 13 groups, each with five mice, including the control group (saline) and treatment groups 1-12. All groups were administered a single 3mg / kg dose. The day of administration was designated day 0. Each group received a subcutaneous injection of 0.04mL / 10g of the test solution on day 0. The animals were observed for 4-6 weeks, with blood collection times being day 0, day 7, day 14, day 21, day 28, day 35, and day 42. At each blood collection time for each group, whole blood was collected via the orbital venous plexus of the mice, centrifuged at 3000×g for 5 minutes, and the supernatant was collected for HBV HBsAg expression detection.

[0169] The HBsAg levels of animals in each administration group were classified into pre-administration and control groups, and the test data are shown in FIG.

[0170] Research results show that the RNA inhibitors described in the present invention significantly reduce HBV HBsAg levels within the first three weeks, with the optimal reduction rate reaching 99.8%. Due to differences in the positions of 5'MVIP and / or 3'MVIP coupling, the duration of the HBsAg-reducing effect of each RNA inhibitor varies. Among them, Ky-19, Ky-22, Ky-26, Ky-29, Ky-37 and Ky-39 maintain their HBV HBsAg level reduction effect of more than 93% even at d28, and Ky-22 has the best effect retention, maintaining its HBV HBsAg level reduction effect of more than 91% even at d35.

[0171] Example 2: Examining the effect of Ky-22 sequence modification on the suppressive effect of HBsAg in HBV transgenic mice The corresponding RNA inhibitors Ky-22, Ky-2201 to Ky-2208 were prepared using the method described in Example 1, and 50 male HBV transgenic mice, weighing 25 to 35 g and aged 8 to 13 weeks, were selected and kept in an animal room meeting SPF standards, with a temperature of 16 to 26°C, humidity of 40 to 70%, and cycling light (12 hours light and 12 hours dark), allowing them to drink water and eat food ad libitum.

[0172] HBV HBsAg was detected before animal grouping and randomly grouped according to HBV HBsAg expression levels to ensure that the average HBV HBsAg levels in each group were as consistent as possible. Mice were divided into 10 groups, each with five mice, including a control group (saline) and nine treatment groups. All groups were administered a single 3mg / kg dose. The day of administration was designated d0. Each group received a 0.04mL / 10g subcutaneous injection of the test solution. The animals were observed for 6 weeks, with blood collection times at d0, d7, d14, d21, d28, d35, and d42. At each blood collection time for each group, whole blood was collected via the orbital plexus of the mice, centrifuged at 3000 x g for 5 minutes, and the supernatant was collected for HBV HBsAg expression detection.

[0173] [Table 17] The HBsAg levels of animals in each administration group are classified into pre-administration and control groups.

[0174] The test data are shown in Figure 14. The results show that compared with Ky-22, Ky-2201, which has a 21-mer sense strand length, does not significantly improve HBsAg level reduction and duration of effect, and even slightly reduces it. Therefore, the RNA inhibitor provided by the present invention is most preferably a 19-mer sense strand length. Compared with Ky-22, Ky-2203, which has one nucleotide change in each of the sense and antisense strands, does not significantly affect HBsAg level reduction and duration of effect. Based on the design of Ky-2203, Ky-2201, which has a 21-mer sense strand length, is also suitable. The effects of Ky-4 and Ky-2203 were not significantly different. By adjusting the number of fluorinations based on Ky-2203, Ky-2208, which has a relatively low number of fluorinations, was slightly more effective than Ky-2203. The RNA inhibitors Ky-2205 and Ky-2206, obtained by modifying two overhanging nucleotides at the 3' end of the sense or antisense strand, did not show significant differences in their effects compared to before modification. This indicates that the RNA inhibitors of the present invention can tolerate differences of 1-3 nucleotides in the sense and antisense strands, respectively. Compared to Ky-22, Ky-2207, in which the thiolation of the phosphate bonds between three consecutive nucleotides at the 5' end of the sense strand and the 3' end of the antisense strand is canceled, has a significant effect on the reduction of HBsAg levels and the duration of effect. In the present invention, a sequence in which the sense strand is 19-mer in length and the antisense strand is 21-mer in length is preferred, and a difference of 1 to 3 nucleotides is allowed therein.

[0175] Example 3: In the AAV-HBV mouse model, we examine the dose response of Ky-2208, the effect of repeated single-dose administration on reducing HBsAg, and whether or not surface antibodies HBsAb are produced. Experimental procedure: Thirty-six mice of appropriate age were collected and housed in a barrier facility for approximately 7 days. Daily observation revealed no significant abnormalities. The experiment was conducted. The HBV virus was thawed at 4°C. rAAV8-1.3HBV (Beijing FivePlus Molecular Medicine Institute Co. Ltd., ayw, virus lot number: A2020051801) was injected into the mouse tail vein using an insulin syringe. Each mouse received 1 x 10 11 The mice were injected with 1000 mg / kg of HBsAg. After modeling, blood was collected from the animals at week 4, centrifuged, and serum was collected for HBsAg detection. After modeling, blood was collected at week 6 to detect HBsAg in the serum. Based on the HBsAg detection results, 30 mice were randomly divided into 5 groups, with the average HBsAg levels of each group being as consistent as possible. After grouping, administration began at week 2, and blood was collected on the day of administration to detect HBsAg, marking day d0. The administration information and blood collection points for each group are shown in the table below.

[0176] [Table 18] The HBsAg levels of animals in each administration group were divided into pre-administration and control groups, and the obtained test data, HBsAg and HBsAb, are shown in Figures 15 and 16, respectively.

[0177] The experimental results showed that during the 140-day observation period, the 9mg / kg Ky-2208 group reduced HBsAg levels in the AAV-HBV mouse model by 93.1%-99.6%, and the repeated administration group maintained an inhibitory effect of over 95% even after 112 days of observation. By day 98, a single dose had already detected the surface antibody HBsAb in the HBV model mice, generating new anti-HBV immunity in the mice.

[0178] Example 4: A comparative study of Ky-2208 and tenofovir (TDF), a frontline drug currently used in the treatment of chronic hepatitis B, and the presence or absence of inhibitory and interference effects on HBV HBsAg in an HBV transgenic mouse model when used in combination. Test procedure description: 48 HBV-Tg male mice, weighing 25-35g and aged 8-13 weeks, were housed in an SPF-grade animal room with a temperature of 16-26°C, humidity of 40-70%, and cycling light (12 hours light and 12 hours dark), with free access to water and food. The solvent used for compound preparation was saline, with a working solution concentration of 0.75mg / mL. HBV HBsAg was detected before animal grouping. The 48 male mice were randomly divided into six groups, each with eight mice, according to HBV HBsAg expression levels, with the average HBV HBsAg levels in each group being as consistent as possible. Six groups were divided into one control group (0.9% saline) and five treatment groups. A single dose was administered on day 0, and mice in each group received the corresponding test product solution subcutaneously at 0.04mL / 10g on day 0. Whole blood was collected from the mouse orbital venous plexus on d0 before administration, and on d7, d14, d21, and d28 after administration, and centrifuged at 3000×g for 5 minutes. The supernatant was collected on d0, d7, d14, d21, and d28, and the samples were sent for HBV HBsAg detection.

[0179] See the table below for specific dosing regimens.

[0180] [Table 19] The experimental data obtained are shown in Figure 17. Experimental results show that the nucleoside analog anti-hepatitis B drug TDF has no inhibitory effect on HBV HBsAg, and when used in combination, it does not affect the HBsAg inhibitory effect of the RNA inhibitor described in this invention. When Ky-2208 is used alone or in combination with TDF, HBsAg levels can be reduced by 99.95% and 99.98%, respectively.

Claims

1. An RNA inhibitor that suppresses hepatitis B virus gene expression or a pharmaceutically acceptable salt thereof, The RNA inhibitor is formed by base pairing of a sense strand and an antisense strand having a length of 19-23; The sense strand is SEQ ID NO. 1 and the antisense strand is SEQ ID NO. 2; Sense strand: 5' ggguuuuuucucguugacaa 3' SEQ ID NO. 1 Antisense strand: 5' uugucaacgagaaaaaacccuu 3' SEQ ID NO. 2 (wherein g=guanosine, a=adenosine, u=uridine, c=cytidine) or a pharmaceutically acceptable salt thereof.

2. 2. The RNA inhibitor according to claim 1 or a pharmaceutically acceptable salt thereof, The sense strand is SEQ ID NO. 5 and the antisense strand is SEQ ID NO. 6; Sense strand: 5' Gs fGs GU fU U fU fU fC U C GU U G A Cs As A 3' SEQ ID NO. 5 Antisense strand: 5' Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U 3' SEQ ID NO. 6 (wherein G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'-thioadenylic acid, Us = 2'-O-methyl-3'-thiouridylic acid, Cs = 2'-O-methyl-3'-thiocytidylic acid; fG = 2'-fluoroguanylic acid, fA = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid) The RNA inhibitor further comprises a combination of 5'MVIP and 3'MVIP; The 5'MVIP and 3'MVIP are ligand structures having a liver-targeting specific ligand X, and further comprising a branched chain L, a linker B, and a connecting chain D; The 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand, and a relay site R 1 Further comprising: The 3'MVIP is coupled to the 3' end of the antisense strand and / or the sense strand, and the relay R 2 Including, The structure of the 5'MVIP is as shown in general formula I, and the structure of the 3'MVIP is as shown in general formula II, 【Chemical 1】 (where n and m are each an integer between 0 and 4, and n+m=an integer between 2 and 6) The relay point R 1 and R 2 The structure has -NH-, a sulfur atom, or an oxygen atom, and the structure has at least one -NH-, a sulfur atom, or an oxygen atom, and R 1 and R 2 are linked to the linking strand D of the 5'MVIP and 3'MVIP and the 5'-end and 3'-end of the sense strand and / or antisense strand by -NH-, a sulfur atom, or an oxygen atom in the structure, respectively; R 1 is -NH(CH 2 ) x CH 2 O—, where x is an integer from 3 to 12, or R 1 Ha -O(CH 2 ) 6 O-, -S(CH 2 ) 6 O- or -NH(CH 2 ) 6 S- and R 2 is -NH(CH 2 ) x1 CH(OH)(CH 2 ) x2 CH 2 O—, where x1 is an integer of 1 to 4 and x2 is an integer of 0 to 4, or R 2 teeth, 【Chemistry 2】 and the liver-targeting specific ligand X is selected from galactose, galactosamine and N-acetylgalactosamine, and the liver-targeting specific ligand X may be the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP; the branched chain L is a C4-C18 linear chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, a C4-C10 aliphatic carbocyclic group, a phenyl group, or a combination of these groups, and the branched chain L may be the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP; The linker B is selected from the following structures: 【Chemistry 3】 (Here, A 1 and A 2 are each independently C, O, S, —NH—, carbonyl, an amide group, a phosphoryl group, or a thiophosphoryl group, r is an integer of 0 to 4, and the linker B may be the same or different between the 5′MVIP and the 3′MVIP), An RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the linking chain D is a C3-C18 linear chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aromatic hydrocarbon group, a C4-C10 aliphatic carbocyclic group, a 5- or 6-membered heterocyclic group containing 1 to 3 nitrogen atoms, or a combination of these groups.

3. 3. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 2, wherein the liver-targeting specific ligand X is N-acetylgalactosamine.

4. 3. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 2, wherein the C4-C18 linear chain of the branched chain L has a branched chain of ethyl alcohol or a carboxylic acid.

5. 3. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 2, wherein the branched chain L is a C7-C18 linear chain containing an amide group or a 6-membered aliphatic carbocyclic group.

6. 3. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 2, wherein the C3-C18 linear chain of said linking chain D has a branched chain of methyl alcohol, methyl tert-butyl, a methylphenol group, or an alicyclic group.

7. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 2, wherein said linking chain D is a C3-C10 linear chain containing two C═O, 6-membered aliphatic carbocyclic groups, or phenyl groups.

8. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 7, wherein said linking chain D is a C3-C10 linear chain containing two C=O groups.

9. The R 1 is -NH(CH 2 ) x CH 2 3. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 2, wherein x is O- and x is an integer of 4 to 6.

10. The R 1 is -NH(CH 2 ) 6 10. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 9, wherein the RNA inhibitor is O-.

11. The R 1 teeth 【Chemistry 4】 3. The RNA inhibitor of claim 2, wherein:

12. The RNA inhibitor of claim 2 or a pharmaceutically acceptable salt thereof, The 5'MVIP is 5'MVIP01 or 5'MVIP09 shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09, or 3'MVIP17 shown below, 【Chemistry 5】 or a pharmaceutically acceptable salt thereof.

13. 13. The RNA inhibitor of claim 12, or a pharmaceutically acceptable salt thereof, An RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17 or 5'MVIP09 / 3'MVIP09, or the combination of the sense strand 5'MVIP and the sense strand 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

14. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 13, wherein the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP09 / 3'MVIP09.

15. An RNA inhibitor that suppresses hepatitis B virus gene expression or a pharmaceutically acceptable salt thereof, The RNA inhibitor is formed by base pairing of a sense strand and an antisense strand having a length of 19-23; the sense strand is SEQ ID NO. 7; the antisense strand is SEQ ID NO. 8; Sense strand: 5' Gs Gs G U fU U fU fU fC U U G U G A Cs As A 3' SEQ ID NO. 7 Antisense strand: 5' Us Us G U C A fA C A A G fA A fA A A C C Cs Us U 3' SEQ ID NO. 8 (wherein G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'-thioadenylic acid, Us = 2'-O-methyl-3'-thiouridylic acid, Cs = 2'-O-methyl-3'-thiocytidylic acid; fG = 2'-fluoroguanylic acid, fA = 2'-fluoroadenylic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluorocytidylic acid; fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenylic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid) The RNA inhibitor further comprises a combination of 5'MVIP and 3'MVIP; The 5'MVIP and 3'MVIP are ligand structures having a liver-targeting specific ligand X, and further comprising a branched chain L, a linker B, and a connecting chain D; The 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand, and a relay site R 1 Further comprising: The 3'MVIP is coupled to the 3' end of the antisense strand and / or the sense strand, and the relay R 2 Including, The structure of the 5'MVIP is as shown in general formula I, and the structure of the 3'MVIP is as shown in general formula II, 【Chemistry 6】 (wherein n and m are each an integer between 0 and 4, and n+m=an integer between 2 and 6); The relay point R 1 and R 2 The structure has at least one -NH-, sulfur atom or oxygen atom, and R 1 and R 2 are linked to the linking strand D of the 5'MVIP and 3'MVIP and the 5'-end and 3'-end of the sense strand and / or antisense strand by -NH-, a sulfur atom, or an oxygen atom in the structure, respectively; R 1 is -NH(CH 2 ) x CH 2 O—, where x is an integer from 3 to 12, or R 1 Ha -O(CH 2 ) 6 O-, -S(CH 2 ) 6 O- or -NH(CH 2 ) 6 S- and R 2 is -NH(CH 2 ) x1 CH(OH)(CH 2 ) x2 CH 2 O—, and x1 is an integer from 1 to 4, or R 2 teeth 【Chemistry 7】 and the liver-targeting specific ligand X is selected from galactose, galactosamine, and N-acetylgalactosamine, and the liver-targeting specific ligand X may be the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP; the branched chain L is a C4-C18 linear chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, a C4-C10 aliphatic carbocyclic group, a phenyl group, or a combination of these groups, and the branched chain L may be the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP; The linker B is selected from the following structures: 【Chemistry 8】 (Here, A 1 and A 2 are each independently C, O, S, —NH—, carbonyl, an amide group, a phosphoryl group, or a thiophosphoryl group, r is an integer of 0 to 4, and the linker B may be the same or different between the 5′MVIP and the 3′MVIP), An RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the linking chain D is a C3-C18 linear chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aromatic hydrocarbon group, a C4-C10 aliphatic carbocyclic group, a 5- or 6-membered heterocyclic group containing 1 to 3 nitrogen atoms, or a combination of these groups.

16. 16. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 15, wherein the liver-targeting specific ligand X is N-acetylgalactosamine.

17. 16. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 15, wherein the C4-C18 linear chain of the branched chain L has a branched chain of ethyl alcohol or carboxylic acids.

18. 16. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 15, wherein the branched chain L is a C7-C18 linear chain containing an amide group or a 6-membered aliphatic carbocyclic group.

19. 16. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 15, wherein the C3-C18 linear chain of said linking chain D has a branched chain of methyl alcohol, methyl tert-butyl, a methylphenol group, or an alicyclic group.

20. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 15, wherein said linking chain D is a C3-C10 linear chain containing two C=O, 6-membered aliphatic carbocyclic groups, or phenyl groups.

21. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 20, wherein said linking chain D is a C3-C10 linear chain containing two C=O.

22. The R 1 is -NH(CH 2 ) x CH 2 16. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 15, wherein x is O- and x is an integer of 4 to 6.

23. The R 1 is -NH(CH 2 ) 6 23. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 22, wherein said RNA inhibitor is O-.

24. The R 2 teeth 【Chemistry 9】 16. The RNA inhibitor of claim 15, wherein:

25. 16. The RNA inhibitor of claim 15, or a pharmaceutically acceptable salt thereof, The 5'MVIP is 5'MVIP01 or 5'MVIP09 shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09, or 3'MVIP17 shown below, 【Chemistry 10】 or a pharmaceutically acceptable salt thereof.

26. 26. The RNA inhibitor of claim 25, or a pharmaceutically acceptable salt thereof, An RNA inhibitor or a pharmaceutically acceptable salt thereof, wherein the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17 or 5'MVIP09 / 3'MVIP09, or the combination of the sense strand 5'MVIP and the sense strand 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

27. 27. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 26, wherein the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP09 / 3'MVIP09.

28. Use of an RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 27 in the preparation of a medicament for the treatment of a hepatogenic disease, comprising: The hepatic diseases include hepatitis, liver tumor, liver cirrhosis, jaundice, type 2 diabetes, fatty liver, blood coagulation diseases, blood albumin and globulin-related diseases, hyperlipidemia, atherosclerosis, and primary hypertension.

29. 29. The use according to claim 28, wherein the hepatic disease is hepatitis B.

30. A pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof described in any one of claims 1 to 27 and a pharmaceutically acceptable excipient, the pharmaceutical composition being in the form of an oral administration, an intravenous administration, a subcutaneous administration, or an intramuscular administration.

31. 31. The pharmaceutical composition of claim 30, wherein the dosage form is a subcutaneous injection.

32. A pharmaceutical composition comprising the RNA inhibitor of any one of claims 1 to 27 or a pharmaceutically acceptable salt thereof and a nucleoside analog or interferon that is a therapeutic agent for chronic hepatitis B, wherein the nucleoside analog is selected from the group consisting of lamivudine, entecavir, adefovir, telbivudine, tenofovir, and tenofovir alafenamide.

33. 33. The pharmaceutical composition of claim 32, wherein the nucleoside analog is selected from entecavir and tenofovir.

Citation Information

Patent Citations

  • Novel compound and application thereof

    CN110846320A

  • New compounds and their applications

    JP2022540363A

  • RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)

    US20030206887A1

  • Novel compound and application thereof

    WO2020259497A1