Novel Aureobasidium pullulans strains and uses thereof

Abstract

To provide an Aureobasidium pullulans (Aureobasidium pullulans) OFY11-1 strain.SOLUTION: The present invention discloses an Aureobasidium pullulans OFY11-1 strain; a cosmetic composition containing the strain or a fermented product thereof and method for producing the same; a quasi drug composition containing the strain or a fermented product thereof and a method for producing the same; a cosmetic composition or a quasi drug composition containing pullulan separated from the strain or a fermented product thereof; and a method for producing pullulan separated from the strain or a fermented product thereof.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to the Aureobasidium pullulans OFY11-1 strain; a cosmetic composition containing the strain or a fermentation product thereof and a method for producing the same; a quasi-drug composition containing the strain or a fermentation product thereof and a method for producing the same; a cosmetic composition or quasi-drug composition containing pullulan isolated from the strain or a fermentation product thereof; and a method for producing pullulan isolated from the strain or a fermentation product thereof. [Background technology]

[0002] Pullulan is an extracellular polysaccharide secreted by fungi, typically produced by the black yeast Aureobasidium pullulans. It is obtained by separating the sugars produced by fermenting the fungus and then purifying it. Pullulan is known to be easily soluble in water, has low viscosity, and has strong adhesive properties. Its excellent water-retaining capacity and emulsion stability properties allow it to be used as a cosmetic additive to improve product formulation and texture. It is also an edible substance, found in foods such as yokan (sweet bean paste) and tofu.

[0003] In addition to pullulan, extracts and fermented products of the strains themselves have been developed as cosmetic compositions, and plant fermented products of the strains are known to have skin-improving effects such as antioxidant effects and skin moisturizing effects depending on the type (Korean Patent Registration No. 10-2107193 (Patent Document 1)).

[0004] However, since the strain produces melanin pigment, the culture medium of the strain turns from yellow to black. Therefore, when producing extracts, fermented products, or products containing pullulan of the strain, purification / decolorization processes are required, which makes the production process complicated and results in a lack of efficiency and economy.

[0005] Under these circumstances, the present inventors have made extensive efforts to develop a strain that is highly effective in improving skin conditions and does not require a separate purification / bleaching process during product production. As a result, they have discovered a novel Aureobasidium pullulans strain derived from Dendrobium plants and completed the present invention. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Korean Patent Registration No. 10-2107193 Summary of the Invention [Problem to be solved by the invention]

[0007] One object of the present invention is to provide the Aureobasidium pullulans OFY11-1 strain.

[0008] Another object of the present invention is to provide a cosmetic composition containing the above strain or a fermentation product thereof, and a method for producing the same.

[0009] Another object of the present invention is to provide a quasi-drug composition containing the above strain or a fermentation product thereof, and a method for producing the same.

[0010] Another object of the present invention is to provide a cosmetic composition or a quasi-drug composition containing pullulan isolated from the above strain or its fermentation product.

[0011] Another object of the present invention is to provide a method for producing pullulan isolated from the above strain or its fermentation product.

[0012] Another object of the present invention is to provide a use of the above strain; a fermentation product thereof; or pullulan isolated from the above strain or the fermentation product thereof for improving skin. [Means for solving the problem]

[0013] This will be explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may also be applied to different descriptions and embodiments. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the following specific description is not intended to limit the scope of the present invention.

[0014] One aspect of the present invention provides the Aureobasidium pullulans OFY11-1 strain, deposited under accession number KCTC14158BP.

[0015] The term "Aureobasidium pullulans" as used herein refers to a yeast-like fungus widely distributed in nature, classified as a saprophyte that infects skin and nails, and generally known to produce pullulan and melanin pigments. The present inventors have developed a novel strain belonging to the genus Aureobasidium pullulans, named Aureobasidium pullulans OFY11-1, and deposited it under accession number KCTC14158BP. The strain can be obtained by isolating it from a plant of the genus Dendrobium, but is not limited thereto.

[0016] Specifically, the OFY11-1 strain is characterized by not producing black pigment.

[0017] The term "Dendrobium" as used herein refers to a perennial plant of the Orchidaceae family found primarily in tropical Asia, mostly as an epiphytic orchid growing on the trunks or branches of trees. A wide variety of species are found throughout southern, eastern, and Southeast Asia, with roots generally growing on the surface of trees or rocks, but rarely extending into the soil. Among these, yellow Dendrobium species have been designated as air-purifying plants by NASA (National Aeronautics and Space Administration). In the present invention, the species of the Dendrobium plant is not particularly limited as long as it is from the genus Dendrobium, but for purposes of the present invention, yellow Dendrobium may be used.

[0018] In the present invention, the method for isolating the above-mentioned strain from a Dendrobium plant is not particularly limited, and a strain having the same characteristics as the above-mentioned deposited strain can be isolated by a method commonly used in the technical field or a similar field.

[0019] The term "black pigment" as used herein refers to a pigment that produces a black color, and may be, but is not limited to, a melanin pigment. Aureobasidium pullulans generally produces black pigments, and the culture broth and fermentation product of the strain turn black. However, the Aureobasidium pullulans OFY11-1 strain does not produce black pigments, and therefore the culture broth and fermentation product are more transparent than black, specifically a transparent solution (light yellow). This allows for increased productivity when producing products containing the strain or its fermentation product without the need for purification / decolorization processes.

[0020] As a specific example, the Aureobasidium pullulans OFY11-1 strain may be one that produces pullulan, but is not limited thereto.

[0021] The term "pullulan" as used herein refers to a polysaccharide formed by linking maltotriose units. Maltotriose is formed when glucose units are linked via α-1,4 bonds, and pullulan is formed when maltotriose units are linked via α-1,6 bonds. Pullulan is a polysaccharide secreted extracellularly by fungi. While there are no particular limitations on the method for producing pullulan, for the purposes of the present invention, pullulan is produced from the black yeast Aureobasidium pullulans OFY11-1 strain by fermenting the strain to separate the sugars produced, followed by a purification process. Pullulan is known for its water-solubility and low viscosity compared to other polysaccharides, yet its strong adhesive properties. It also has excellent water-retention capacity, promotes emulsion stability, and is used as an additive to improve product formulation and texture. It is used as an edible material, including in foods such as yokan and tofu, and as a raw material for forming a film in cosmetic compositions to soften and encase the surface. It is also used to bind powdered cosmetic ingredients and provide adhesiveness during the process of refining and compressing into cake form, or after compression. These properties allow for applications in a wide range of fields, including not only cosmetics but also the food, pharmaceutical, and printing industries. The Aureobasidium pullulans OFY11-1 strain of the present invention can also produce pullulan, and because it does not produce black pigments during the pullulan production process, a separate decolorization / purification process is not required, thereby improving economy and efficiency.

[0022] As one specific example, the Aureobasidium pullulans OFY11-1 strain may have one or more characteristics selected from the group consisting of promotion of beneficial skin bacteria, inhibition of harmful skin bacteria, skin soothing, improvement of skin inflammation, skin whitening, skin regeneration, and wound healing, but is not limited thereto.

[0023] The term "beneficial skin bacteria" as used herein refers to strains of normal skin flora that are beneficial to the skin, such as by alleviating inflammation and inhibiting the growth of harmful bacteria. For example, such beneficial bacteria may be Staphylococcus epidermidis, Staphylococcus warneri, Streptococcus mitis, Micrococcus luteus, Acinetobacter johnsonii, etc., and specifically, but is not limited to, Staphylococcus epidermidis. More specifically, such beneficial bacteria may be, but are not limited to, Staphylococcus epidermidis. Staphylococcus epidermidis induces the expression of antimicrobial peptides (AMPs) from skin epidermis cells, enhancing skin defense by promoting skin regeneration; Phenol soluble modulin (PSM), a component secreted by Staphylococcus epidermidis, enhances skin regeneration by destroying (destroying) the cell membranes of harmful bacteria and inhibiting their growth; Butyric acid, a component secreted by Staphylococcus epidermidis, inhibits the expression of inflammatory factors induced by ultraviolet rays, providing a skin soothing effect; live bacteria, when applied to the skin, increase skin moisture and inhibit moisture loss; and when applied to the skin, the skin pH becomes slightly acidic, improving the pH environment. Substances that promote the beneficial bacteria Staphylococcus epidermidis have beneficial effects on the skin.

[0024] The term "enhancement of beneficial skin bacteria" as used herein means promoting or improving the growth of the aforementioned beneficial bacteria. For purposes of the present invention, the enhancement of beneficial bacteria may be, but is not limited to, the enhancement of Staphylococcus epidermidis. In one embodiment of the present invention, it was confirmed that the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof enhances Staphylococcus epidermidis, and it was confirmed that the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof has the effect of enhancing beneficial skin bacteria (Example 4).

[0025] The term "harmful bacteria for the skin" as used herein refers to bacteria that have harmful effects on the skin, such as inflammation and acne. The "harmful bacteria" may be, but are not limited to, Staphylococcus aureus, Propionibacterium acnes, Corynebacterium minutissimum, etc.

[0026] The term "inhibition of harmful bacteria" as used herein means the killing or reduction of the growth of the aforementioned harmful bacteria. For purposes of the present invention, the inhibition of harmful bacteria may include, but is not limited to, the inhibition of Staphylococcus aureus. In one embodiment of the present invention, the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof was confirmed to inhibit Staphylococcus aureus, and the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof was confirmed to have an inhibitory effect on harmful skin bacteria (Example 4).

[0027] The term "soothing" as used herein means to relieve and soothe erythema or irritated areas of the skin, etc. For example, the soothing of the skin may be, but is not limited to, a reduction in transepidermal water loss or a reduction in redness of the skin.

[0028] The term "inflammation" as used herein refers to a defense response of biological tissues to a given stimulus, a complex lesion characterized by the simultaneous occurrence of three phenomena: tissue degeneration, circulatory disorders and exudation, and tissue proliferation. More specifically, inflammation is part of innate immunity. Like other animals, human innate immunity recognizes cell surface patterns that are specific to pathogens. Phagocytes recognize cells with such surfaces as non-self and attack the pathogens. When pathogens penetrate the body's physical barriers, an inflammatory response occurs, a nonspecific defense mechanism that creates a hostile environment for microorganisms invading a wound. When an inflammatory response causes injury or an external infectious agent enters the body, white blood cells, responsible for the initial immune response, approach the body and express cytokines. Therefore, the expression level of intracellular cytokines serves as an indicator of the activation of the inflammatory response.

[0029] The term "ameliorating skin inflammation" as used herein means suppressing or alleviating inflammation that has developed in the skin. In one embodiment of the present invention, it was confirmed that the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof has an inhibitory effect on the production of nitric oxide (NO), a representative redness-inducing and inflammatory substance, and that the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof has skin soothing and inflammation-ameliorating effects (Example 5).

[0030] The term "skin whitening" in the present invention refers not only to lightening skin color by inhibiting melanin synthesis, but also to improving hyperpigmentation of the skin, such as age spots or freckles, caused by ultraviolet rays, hormones, or genetics. In one example of the present invention, it was confirmed that the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof inhibits melanin synthesis compared to the publicly known strains, and thus has a skin whitening effect (Example 6).

[0031] The term "skin regeneration" as used herein refers to the process of skin tissue recovery following damage caused by external and internal factors, such as ultraviolet rays, external pollutants, wounds, and trauma, and internal factors such as stress.

[0032] The term "wound" as used herein encompasses all injuries to the living body, and refers to a state in which the living body is injured.

[0033] The term "wound healing" refers to the recovery of biological damage, and the wound healing process can be divided into the acute phase, repair phase, and scarring phase. The acute phase, also known as the exudation phase, is a stage in which a series of reactions occur to remove tissue destruction or foreign matter from the injured site, which may be accompanied by inflammatory and blood coagulation reactions. The repair phase, also known as the proliferation phase, is a stage in which blood vessels are formed and the injured site is repaired. During this stage, active cell proliferation and active synthesis of collagen and proteoglycans, which are intercellular substances within granulation tissue, a type of connective tissue, occur, allowing epidermal cells to gain mobility and divide to regenerate epidermal tissue. The scarring phase is a stage in which the cell proliferation rate decreases, collagen fibers are cross-linked, and the physical strength of the injured site increases. Finally, the vascular system retracts, and tissue different from the surrounding normal tissue is established at the injured site. Wounds are healed by repeating these steps, but wound healing is not limited to a specific process as long as the biological damage is repaired.

[0034] In one example of the present invention, it was confirmed that the above strain or its fermentation product further activates skin cells compared to the publicly known strain, and that the above strain or its fermentation product has a skin regeneration or wound healing effect (Example 7).

[0035] In one specific example, the strain may be derived from a plant of the genus Dendrobium, but is not limited thereto as long as it has the same properties as the deposited strain Aureobasidium pullulans OFY11-1. The Dendrobium is as described above.

[0036] Another aspect of the present invention provides a cosmetic composition comprising the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof. The strain is as described above.

[0037] The term "fermentation" as used herein refers to the process in which microorganisms use their own enzymes to decompose organic matter, but is not a putrefaction reaction. Fermentation and putrefaction proceed through similar processes, but fermentation is when useful substances are produced as a result of decomposition, while putrefaction is when foul-smelling or harmful substances are produced.

[0038] In the present invention, the method for obtaining a fermented product from the above-mentioned strain is not particularly limited, and the product can be obtained by a method commonly used in the art or a similar field.

[0039] In the present invention, the fermented product is obtained by treating the isolated strain with sugar, which is the strain's energy source, and fermenting the treated strain. The temperature and fermentation time of the fermentation process are not particularly limited and may be selected in a variety of ways depending on the fermentation precursor material, fermentation conditions, and the type of material to be obtained from the fermented product.

[0040] In the present invention, the fermentation step is preferably carried out at a temperature of 20°C to 35°C, more preferably 25°C to 30°C, and even more preferably around 28°C, and the fermentation period is preferably 1 to 10 days, more preferably 4 to 8 days, and even more preferably around 6 days.

[0041] In the present invention, the fermented product obtained from the above-mentioned strain includes not only the fermented substance itself but also all kinds of substances including the fermented product generated from the above-mentioned strain, such as the culture medium of the strain in which the strain and culture coexist, the fermented product obtained by filtering the strain from the above-mentioned culture medium, the fermented product obtained by sterilizing the strain from the above-mentioned culture medium and filtering it, an extract obtained by extracting the above-mentioned fermented product or a culture medium containing the same, a diluted solution obtained by diluting the above-mentioned fermented product or its extract, a dried product obtained by drying the above-mentioned fermented product or its extract, and a lysate obtained by collecting and crushing the cells of the above-mentioned strain.

[0042] In the present invention, the composition of the strain or its fermentation product is not limited, but for the purposes of the present invention, it may contain pullulan. The pullulan is as described above.

[0043] As one specific example, the cosmetic composition is for improving skin condition, and the skin condition improvement may be one or more cosmetic compositions selected from the group consisting of promoting beneficial skin bacteria, inhibiting harmful skin bacteria, soothing skin, alleviating skin inflammation, skin whitening, skin regeneration, and wound healing, but is not limited thereto. Compositions containing the strain or its fermentation product have been confirmed to have the effects of promoting beneficial skin bacteria, inhibiting harmful skin bacteria, soothing skin, alleviating skin inflammation, skin whitening, skin regeneration, and wound healing, and are used as compositions for promoting beneficial skin bacteria, inhibiting harmful skin bacteria, soothing skin, alleviating skin inflammation, skin whitening, skin regeneration, and wound healing (Examples 4 to 8). Furthermore, the stability of compositions containing the strain or its fermentation product has also been confirmed, and they can be used as cosmetic or quasi-drug compositions, etc. (Example 9).

[0044] In the cosmetic composition of the present invention, the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof may be contained in an amount of preferably 0.001 to 90%, more preferably 0.01 to 30%, and more preferably 0.05 to 10%, based on the total weight of the cosmetic composition.

[0045] The cosmetic composition of the present invention may be in a dosage form selected from the group consisting of, but not limited to, a solution, an ointment for external use, a cream, a foam, a nutritious lotion, a softening lotion, a perfume, a pack, a softening lotion, a milky lotion, a makeup base, an essence, a soap, a liquid cleanser, a bath additive, a sunscreen cream, a sun oil, a suspension, an emulsion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a powder foundation, an emulsion foundation, a wax foundation, a patch, and a spray.

[0046] The cosmetic composition of the present invention may further contain one or more cosmetically acceptable carriers that are commonly incorporated into skin cosmetics, and may appropriately incorporate common ingredients such as oils, water, surfactants, moisturizers, lower alcohols, thickeners, chelating agents, pigments, preservatives, fragrances, etc., but is not limited thereto.

[0047] The cosmetically acceptable carrier contained in the cosmetic composition of the present invention varies depending on the formulation of the cosmetic composition.

[0048] When the cosmetic formulation of the present invention is an ointment, paste, cream, or gel, the carrier component may be, but is not limited to, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. These may be used alone or in combination of two or more.

[0049] When the dosage form of the present invention is a solution or emulsion, a solvent, solubilizer, or emulsifier may be used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, etc. In particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, sesame oil, glycerol aliphatic esters, polyethylene glycol, or sorbitan fatty acid esters may be used, but are not limited to these. These may be used alone or in combination.

[0050] When the dosage form of the present invention is a suspension, the carrier components may include, but are not limited to, liquid diluents such as water, ethanol, or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters, and polyoxyethylene sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tragacanth, which may be used alone or in combination.

[0051] When the dosage form of the present invention is a soap, the carrier component may be, but is not limited to, alkali metal salts of fatty acids, fatty acid hemiester salts, fatty acid protein hydrolysates, isethionates, lanolin derivatives, fatty alcohols, vegetable oils, glycerol, sugars, etc. These may be used alone or in combination of two or more.

[0052] When the dosage form of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder or mixtures thereof may be used as a carrier component, and particularly in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether may be further included.

[0053] Meanwhile, all of the ingredients described in the present invention may be preferably included in the product of the present invention within the range not exceeding the maximum use values ​​specified in the regulations on cosmetic safety standards and China's "Cosmetic Safety and Technical Standards."

[0054] Another aspect of the present invention provides a quasi-drug composition comprising the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof. Specifically, the quasi-drug composition is for improving skin conditions, and the improvement of skin conditions may be achieved by one or more quasi-drug compositions selected from the group consisting of promoting beneficial skin bacteria, suppressing harmful skin bacteria, soothing skin, alleviating skin inflammation, whitening skin, regenerating skin, and healing wounds, but is not limited thereto.

[0055] The above-mentioned strains, fermented products thereof, improvement of skin condition, promotion of beneficial skin bacteria, inhibition of harmful skin bacteria, skin soothing, improvement of skin inflammation, skin whitening, skin regeneration, and wound healing are as described above.

[0056] The term "quasi-drug" in the present invention may be selected from the group consisting of body cleansers, disinfectants, detergents, dishwashing detergents, cleaning detergents, toothpaste, mouthwashes, wet wipes, detergents, soaps, hand washes, hair cleansers, hair softeners, humidifier fillers, masks, ointments, and filter fillers, but is not limited thereto.

[0057] In addition to the above-mentioned components, the quasi-drug composition of the present invention may further contain a pharmaceutically acceptable carrier, excipient, or diluent, as necessary. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effects of the present invention, and may include, for example, a filler, extender, binder, wetting agent, disintegrant, surfactant, lubricant, sweetener, flavoring agent, preservative, etc.

[0058] Representative examples of pharmaceutically acceptable carriers, excipients, or diluents of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, gelatin, glycerin, gum acacia, alginate, calcium phosphate, calcium carbonate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, propylene glycol, polyethylene glycol, vegetable oils, injectable esters, witepsol, macrogol, Tween 61, cocoa butter, lauric butter, and the like.

[0059] When the strain or fermentation product of the present invention is used as a quasi-drug, it may further contain one or more active ingredients exhibiting the same or similar functions. For example, known ingredients for promoting beneficial skin bacteria, inhibiting harmful skin bacteria, soothing the skin, alleviating skin inflammation, whitening the skin, regenerating the skin, and healing wounds may be included. The inclusion of additional ingredients for wrinkle reduction, whitening the skin, improving skin troubles, and moisturizing the skin can further enhance the wrinkle reduction, skin whitening, alleviating skin troubles, and moisturizing effects of the composition of the present invention. When adding these ingredients, consideration should be given to skin safety when used in combination, ease of formulation, and stability of the active ingredients.

[0060] The quasi-drug composition of the present invention may further comprise one or more ingredients selected from the group consisting of skin anti-aging ingredients known in the art, such as retinoic acid, TGF, animal placenta-derived protein, betulinic acid, and chlorella extract; non-steroidal anti-inflammatory ingredients known in the art, such as flufenamic acid, ibuprofen, benzydamine, indomethacin, prednisolone, dexamethasone, allantoin, azulene, and hydrocortisone; and derivatives thereof and various plant extracts. The additional ingredients may be included in an amount of 0.0001% to 10% by weight of the total composition, and the above content range may be adjusted depending on factors such as skin safety and ease of formulation of the bacterial strain or fermentation product of the present invention.

[0061] The formulation method, dosage, method of use, constituents, etc. of the quasi-drug can be appropriately selected from ordinary techniques known in the technical field.

[0062] Another aspect of the present invention provides a cosmetic composition containing pullulan isolated from the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof. The strain or fermentation product thereof, pullulan, and cosmetic composition are as described above.

[0063] Another aspect of the present invention provides a quasi-drug composition comprising pullulan isolated from the Aureobasidium pullulans OFY11-1 strain or a fermentation product thereof. The strain or fermentation product thereof, pullulan, and quasi-drug composition are as described above.

[0064] Another aspect of the present invention provides a method for preparing a cosmetic composition, comprising fermenting the Aureobasidium pullulans OFY11-1 strain. The strain, fermentation, and cosmetic composition are as described above. Specifically, the method is characterized by not requiring a decolorization step, but is not limited thereto.

[0065] The method for producing the cosmetic composition of the present invention can be appropriately selected from conventional techniques known in the art. While common black yeast strains produce black pigments, and cosmetic compositions containing black yeast strains or their fermentation products require additional purification / bleaching processes to improve product quality, the strain of the present invention, unlike common black yeast strains, does not produce black pigments and therefore does not require additional purification / bleaching processes after fermentation of the strain.

[0066] Another aspect of the present invention provides a method for producing a quasi-drug composition, comprising fermenting the Aureobasidium pullulans OFY11-1 strain. The strain, fermentation, and quasi-drug composition are as described above. Specifically, the production method is characterized by, but is not limited to, not requiring an additional decolorization process. The method for producing a quasi-drug composition can be appropriately selected from conventional techniques known in the art. However, since the strain does not produce black pigments, unlike common black yeast strains, no additional purification / decolorization process is required after fermentation of the strain.

[0067] Another aspect of the present invention provides a method for producing pullulan, comprising fermenting the Aureobasidium pullulans OFY11-1 strain. Specifically, the method further comprises a step of separating pullulan from the fermentation product, and is characterized by the absence of an additional decolorization process, but is not limited thereto. The strain, fermentation, and pullulan are as described above. A method for producing pullulan can be appropriately selected from conventional techniques known in the art. However, because the strain does not produce black pigments, unlike common black yeast strains, no additional purification / decolorization process is required after fermentation of the strain.

[0068] Another aspect of the present invention is to provide use of the Aureobasidium pullulans OFY11-1 strain, a fermentation product thereof, or pullulan isolated from the strain or the fermentation product for skin improvement. The strain, fermentation product, pullulan, and skin improvement are as described above.

[0069] A composition containing the strain of the present invention or a fermentation product thereof has excellent effects of promoting beneficial skin bacteria, inhibiting harmful skin bacteria, soothing skin, improving skin inflammation, whitening skin, regenerating skin, and healing wounds, and can be usefully used in cosmetic compositions, quasi-drug compositions, etc. Furthermore, the strain of the present invention has the excellent effect of not producing black pigments, and since a separate decolorization / purification process is not required to produce the composition and pullulan of the present invention, the composition or pullulan can be produced economically and efficiently. [Brief explanation of the drawings]

[0070] [Figure 1] FIG. 1 is a graph showing the results of comparing the color of the fermentation liquid of the Aureobasidium pullulans OFY11-1 strain of the present invention with that of the publicly-known Aureobasidium pullulans strain. DETAILED DESCRIPTION OF THE INVENTION

[0071] The present invention will be described in more detail with reference to the following examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples. [Example]

[0072] Example 1: Discovery of a new strain isolated from Dendrobium The present inventors have been conducting research to find a microorganism that does not produce black pigment among Aureobasidium pullulans, which is known to produce pullulan. A new strain of Aureobasidium pullulans that produces pullulan was isolated from a Dendrobium plant, which is one of the air-purifying plants designated by NASA (National Aeronautics and Space Administration).

[0073] The following ITS sequences of the isolated strains were analyzed by NCBI blast analysis. As a result, the sequence matched 98.54 to 99.26% with existing strains, confirming that the isolated strains are distinct from existing strains.

[0074] ITS sequence of OFY11-1 strain (SEQ ID NO: 1): TACTGGCAACCTACTGATCGAGGTCAACCTAGAAAATAAAGGTTTCAGTCGGCAGAAGTCCTCCTTTGACAGACGTCGAATAAATTCTACTACGCCTAAAGCCGGTGAGGCCTCGCCGAGGTCTTTAAGGCGCGC CCAACTAAGGACGGCACCCAATACCAAGCATAGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATT ACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTATTCAAAATTTTAACTCAGACGACCGGTTTGATAACAAGAGTTTGGTTTAACTCTGGCGGGCGCTCGC CTGGGACGAATCCCCAGCGGCTCGAGACCGAGCGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAAAGGGTTGGAGGTCGGGCGCTGAGCACCCTTACTCTTTAATGATCCTTCCGCAGGTTACCCTTACGGAAG

[0075] Furthermore, a comparison of the gene sequence with that of the Aureobasidium pullulans strain (NCBI GenBank accession number: KP050667.1), which corresponds to a known strain isolated from Dendrobium officinale, showed a 99.06% identity, confirming once again that the strain discovered in Example 1 is a novel strain different from the known strain.

[0076] The novel strain was named Aureobasidium pullulans OFY11-1 and was internationally deposited with the Korea Comprehensive Biological Resource Center (KCTC), an international depository under the Budapest Treaty, on March 26, 2020, and was assigned the deposit number KCTC14158BP on April 8, 2020.

[0077] Example 2: Production of fermented products from novel strains In this example, to produce a fermentation product of the novel strain, the novel strain OFY11-1 was pre-cultured and main cultured for 5 to 7 days. For the pre-culture, OFY11-1 was inoculated into a vessel containing the regular medium PDB (Potato Dextrose Broth) and cultured with shaking at 160 rpm at 28°C. The pre-culture was then inoculated into a vessel containing the main culture medium and cultured with shaking at 160 rpm at 28°C.

[0078] <Main culture medium (pH 6.5)> Sucrose 40g / L, yeast extract 1g / L, (NH4)2SO4 0.3 g / L, NaCl 1 g / L, K2HPO4 5 g / L, MgSO4 0.2 g / L

[0079] The culture was then centrifuged and the supernatant was collected to obtain the culture medium of the OFY11-1 bacteria. Because the culture medium is produced as a result of OFY11-1 decomposing organic compounds, it can be mixed with fermented products.

[0080] Example 3: Confirmation of non-production of black pigment in fermented products of novel strains To confirm whether the novel strain isolated from a Dendrobium plant produces black pigments, a fermentation product of the publicly-identified strain was produced in the same manner as in Example 2, and the color of the fermentation product of the novel strain produced in Example 2 was compared with that of the publicly-identified strain.

[0081] - Official strain: Aureobasidium pullulans KCTC 6459 - New strain: Aureobasidium pullulans OFY11-1

[0082] As a result, the product fermented by the public strain was black, while the product from which the cells were removed was cloudy yellow, confirming that additional purification / decolorization steps were necessary when applying it to products such as cosmetics or quasi-drugs.On the other hand, the product fermented by the novel strain was pink, while the product from which the cells were removed was light yellow, confirming that additional purification / decolorization steps were not necessary when applying it to products (Figure 1).

[0083] In other words, when applying culture broth, fermentation products, extracts, fractions, and fermentation products to products, it was found that using the novel strain isolated from a plant of the genus Dendrobium is more economical and efficient than using the publicly known strain.

[0084] Example 4: Evaluation of the in vitro prebiotic potential of novel strain fermentates To evaluate the in vitro prebiotic potential of the novel fermented bacterial product, the degree of promotion of beneficial bacteria and inhibition of harmful bacteria among normal skin flora was compared before and after treatment with the fermented product. Staphylococcus epidermidis was selected as a representative beneficial bacterium, and Staphylococcus aureus was selected as a representative harmful bacterium. The growth rates of the beneficial and harmful bacteria were compared before and after treatment with the fermented product.

[0085] Evaluation of the growth rate of beneficial bacteria The growth rate of beneficial bacteria was evaluated as follows. A sterile liquid medium was prepared using a commonly used TSB (tryptic soy broth) medium. A glycerol stock solution of S. epidermidis was inoculated into the sterile liquid TSB medium and pre-cultured at 30-37°C for 6-18 hours. This pre-culture was repeated 1-2 times. Then, the bacterial fermentation product prepared in Example 2-1 was added to the sterile liquid TSB medium at a concentration of 10%, and the pre-culture solution was inoculated and cultured at 30-37°C for 6-18 hours.

[0086] After cultivation, the optical density (OD) was measured immediately after inoculation and during the stationary phase, and the ratio of these values ​​(growth rate) was used as the statistical variable. The growth rates of the control group not treated with the fermented product and the experimental group treated with the fermented product were compared to determine whether the sample had a significant effect on bacterial growth. Evaluations were performed 3-6 times or more, and the average and standard deviation of the growth rates were calculated, followed by a t-test to verify significance.

[0087] Evaluation of harmful fungal growth rates Separately from the evaluation of beneficial bacteria, the growth rate of harmful bacteria was evaluated in a separate experiment. To this end, the growth rate of S. aureus, a representative harmful bacterium, was evaluated, and the evaluation conditions and methods were the same as those for evaluating the growth rate of beneficial bacteria.

[0088] The results of the evaluation of the growth rates of the beneficial and harmful bacteria are summarized in Table 1 below.

[0089] [Table 1]

[0090] As shown in Table 1 above, it was confirmed that the fermented product of the novel strain had an excellent beneficial bacteria promoting effect and an inhibitory effect on harmful bacteria of up to 27.75%.

[0091] Example 5: Evaluation of the skin soothing and inflammation-reducing effects of a novel fermented strain (NO Assay) To verify the skin soothing and anti-inflammatory effects of the novel strain fermentation product, the NO production inhibitory effects of the novel strain fermentation product and the publicly-known strain fermentation product were compared using Raw 264.7 cells. The novel strain fermentation product, the publicly-known strain fermentation product, and the positive control sample prepared in Example 2 were diluted to different concentrations, pretreated for 30 minutes, treated with 1 mg / ml LPS, and cultured for 24 hours. The NO production inhibitory effect was then evaluated using an NO quantification kit as follows, and the results are shown in Table 2.

[0092] - Official strain: A. pullulans KCTC 6459 - Positive control group: L-NMMA 20mg / mL - NO production suppression capacity (%) = {1 - (NO production amount with sample addition / NO production amount without sample addition)} x 100

[0093] [Table 2]

[0094] As shown in Table 2 above, the fermented product of the publicly-known strain had a slight effect compared to the positive control group, whereas the fermented product of the novel strain had skin soothing and anti-inflammatory effects that were approximately 3.4 times greater than those of the fermented product of the publicly-known strain.

[0095] Example 6: Evaluation of the whitening effect of a novel fermented strain (Melanin test) To verify the whitening effect of the fermented product, melanocytes were treated with the fermented product of the new strain and the fermented product of the publicly-known strain, and the degree of reduction in the amount of melanin pigment in the melanocytes was measured and compared.

[0096] The fermented products of the bacterial strains prepared in Example 2-1, the fermented products of the publicly-known bacterial strains, and the positive control sample were diluted to various concentrations and applied to B16f10 melanocytes. After culturing for 72 hours, melanin was quantified to evaluate the whitening efficacy. The melanin content was calculated relative to the total protein content and calculated as a percentage based on the DMSO control. The results are shown in Table 3 below.

[0097] - Official strain: A. pullulans KCTC 6459 - Positive control group: arbutin 500 ppm (Lim YJ et al., 2009, Arch Pharm Res.)

[0098] [Table 3]

[0099] As shown in Table 3 above, the fermented product of the public strain had a slight effect compared to the positive control group, while the fermented product of the novel Dendrobium strain had a whitening effect that was about 2.5 times greater than that of the fermented product of the public strain.

[0100] Example 7: Evaluation of the skin cell activity effect of a novel fermented strain To verify the skin cell activation effect of the novel strain fermentation product, the cell activity of the novel strain fermentation product and the publicly-known strain fermentation product was compared using human fibroblast cultures. The novel strain fermentation product prepared in Example 2 and the positive control sample were diluted to different concentrations and treated for 48 hours, after which the cell activity was confirmed using a CCK-8 kit. The cell activity value of the sample was calculated as the percentage increase compared to the control (DMEM containing 0% serum). The results are shown in Table 4 below.

[0101] - Positive control: FBS 3%

[0102] [Table 4]

[0103] As shown in Table 4 above, it was confirmed that 0.01% of the fermented product had an excellent skin cell activation effect. The cell activation effect of 0.1% of the fermented product was also confirmed using the same method, and it was confirmed that it showed an even more excellent skin cell activation effect.

[0104] Example 8: Efficacy evaluation of pullulan isolated from the fermentation product of a novel strain To verify the efficacy of pullulan isolated from the fermentation product of the novel strain, the effects of pullulan isolated from the fermentation product of the novel strain on inhibiting harmful bacteria, anti-inflammatory, whitening, and cell activation were compared. To this end, the effects of each were evaluated in the same manner as in Examples 4 to 7, and the results are shown in Table 5.

[0105] [Table 5]

[0106] As shown in Table 5 above, pullulan isolated from OFY11-1 fermentation product was also confirmed to have excellent effects of inhibiting harmful bacteria on the skin, anti-inflammatory, whitening, and cell activation.

[0107] Example 9: Fermentation of the novel strain and confirmation of the applicability of pullulan produced by the novel strain In terms of safety, we evaluated whether not only pullulan but also the fermentation product of the novel bacteria could be applied to individuals in the form of cosmetics or quasi-drugs.

[0108] A patch test was conducted to evaluate safety. 20 healthy adult volunteers without skin diseases at the test site were recruited as study subjects; an appropriate amount of sample was applied to each chamber of the patch test unit; the patch test unit with the sample applied was attached to the test site; the patch test unit was removed after a certain period of time; and skin irritation was evaluated two hours after the patch test unit was removed. Specifically, the 20 volunteers underwent patch tests using the closed patch test method with the novel strain fermentation product (1% and 3%) and pullulan isolated from the novel strain fermentation product (0.5% and 1.5%).

[0109] As a result, it was confirmed that neither the fermentation product of the novel strain nor pullulan samples showed a significant level of irritation, confirming that not only pullulan but also the fermentation product of the novel strain can be applied to individuals in the form of cosmetics or quasi-drugs.

[0110] From the above description, those skilled in the art to which the present application pertains will understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are merely illustrative and not limiting. The scope of the present application should be interpreted as including within the meaning and scope of the claims below, and any modifications or variations derived from the equivalent concepts thereof, rather than the above detailed description.

[0111] [Accession number] Depository institution name: Korea Institute of Bioscience and Biotechnology Accession number: KCTC14158BP Date of acceptance: 20200326

Claims

1. Aureobasidium pullulans OFY11-1 strain deposited under accession number KCTC14158BP.

2. The strain of claim 1 , wherein the strain does not produce black pigment.

3. The strain of claim 1 , wherein the strain produces pullulan.

4. The strain of claim 1, wherein the strain has one or more characteristics selected from the group consisting of promoting beneficial skin bacteria, suppressing harmful skin bacteria, soothing the skin, improving skin inflammation, whitening the skin, regenerating the skin, and wound healing.

5. The strain of claim 1 , wherein the strain is derived from Dendrobium spp.

6. A cosmetic composition comprising the strain of claim 1 or a fermentation product thereof.

7. The cosmetic composition according to claim 6, wherein the cosmetic composition is for improving skin condition, and the improvement of skin condition is one or more selected from the group consisting of promoting beneficial skin bacteria, suppressing harmful skin bacteria, skin soothing, improving skin inflammation, skin whitening, skin regeneration, and wound healing.

8. The cosmetic composition according to claim 6, wherein the composition activates skin cells.

9. The cosmetic composition according to claim 6, wherein the strain or a fermentation product thereof contains pullulan.

10. A quasi-drug composition comprising the strain of claim 1 or a fermentation product thereof.

11. The quasi-drug composition according to claim 10, wherein the quasi-drug composition is for improving skin conditions, and the improvement of skin conditions is one or more selected from the group consisting of promoting beneficial skin bacteria, suppressing harmful skin bacteria, skin soothing, improving skin inflammation, skin whitening, skin regeneration, and wound healing.

12. 10. A method for producing a cosmetic ingredient, comprising fermenting the strain of claim 1, wherein the method does not require any additional bleaching process.

13. 10. A method for producing a raw material for a quasi-drug, comprising fermenting the strain of claim 1, wherein the method does not require any additional decolorization process.

14. 10. A method for producing pullulan, comprising fermenting the strain of claim 1, wherein said method does not require any further decolorization step.

15. 15. The method of claim 14, further comprising separating the pullulan from the fermentate.

Images