mRNA therapy for Pompe disease

Abstract

To provide mRNA therapy for Pompe disease.SOLUTION: The present invention provides, among other things, methods of treating Pompe disease, including administering to a subject in need of treatment a composition comprising an mRNA encoding acid α-glucosidase (GAA) at effective doses and administration intervals so that at least one symptom or feature of Pompe disease is reduced in intensity, severity or frequency or has delayed in onset. In some embodiments, the mRNA is encapsulated in a liposome comprising one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids and one or more PEG-modified lipids.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims priority from U.S. Provisional Application No. 62 / 135,338, filed March 19, 2015. No. 60 / 699,999, filed on Dec. 1, 2003, the disclosure of which is hereby incorporated by reference.

[0002] Sequence Listing This specification is the Sequence Listing ("SHR_1185WO_SL" on March 17, 2016) The .txt file was submitted electronically as a .txt file with the name of the project. It was created on March 17, 2017, and is 28,284 bytes in size. the entire contents of which are incorporated herein by reference. [Background technology]

[0003] Pompe disease (glycogenosis type II; acid alpha-glucosidase deficiency; acid maltase deficiency; GAA Deficiency; GSD II; Cardiac form of systemic glycogenosis type II; Diffuse glycogenic cardiac hypertrophy; Acid Maltase deficiency (AMD; or α-1,4-glucosidase deficiency) is a disorder characterized by lysomnia. The lysomsomal enzyme acid α-glucosidase (GAA) It is an autosomal recessive metabolic genetic disorder characterized by mutations in the gene for ketamine (also known as ketamine kinase). Mutations in the GAA gene cause the GAA enzyme to produce glycogen, maltose, and isomaltulose. This eliminates or reduces the ability of the enzyme to hydrolyze the α-1,4 and α-1,6 bonds of lactic acid bacteria. As a result, glycogen accumulates in the lysosomes and cytoplasm of cells throughout the body, causing damage to cells and tissues. Tissues particularly affected include skeletal and cardiac muscles. The lost glycogen causes progressive muscle weakness, cardiac hypertrophy, difficulty walking, and respiratory failure. Glass.

[0004] There are three forms, including classic infantile-onset disease, non-classic infantile-onset disease, and late-onset disease. The classical infantile form of Pompe disease is characterized by muscle weakness, hypotonia, and liver dysfunction. It is characterized by enlargement and heart defects. The incidence of this disease is approximately 1 in 140,000. Patients with this type of disease often die of heart failure within the first year of life. Non-classic infantile-onset syndrome is characterized by delayed motor acquisition, progressive muscle weakness, and possibly cardiac hypertrophy. Patients with this type of disease have a limited survival rate due to respiratory failure in early childhood. Late-onset disease occurs in youth, adolescence, or adulthood. It is characterized by progressive muscle weakness of the legs and trunk.

[0005] Currently, there is no cure for Pompe disease, and standard treatment involves supportive care for cardiomyopathy. These are enzyme replacement therapy (ERT) and physical therapy for muscle weakness and respiratory symptoms. Summary of the Invention [Means for solving the problem]

[0006] Summary of the Invention The present invention provides, inter alia, improved methods and compositions for treating Pompe disease based on mRNA therapy. The present invention provides a method for encapsulating mRNA encoding the human GAA protein in liposomes. administration of ribosomal proteins results in highly efficient and sustained protein production in vivo, e.g. , and glycogen levels in liver and muscle, which are clinically relevant disease markers. This includes the observation that it effectively reduces

[0007] In one aspect, the present invention provides a method for administering to a subject in need thereof an acid alpha glucosidase (GAA) and administering a composition comprising an mRNA encoding the compound at an effective dose and at an effective interval, thereby , reducing the intensity, severity, or frequency of at least one symptom or characteristic of Pompe disease The present invention provides methods for treating Pompe disease, including reducing or delaying the onset of the disease. In this form, mRNA is encapsulated within a liposome.

[0008] In another aspect, the present invention provides a method for administering to a subject in need thereof an amount of acid alpha glucosidase (GAA) administering a therapeutically effective amount of a composition comprising mRNA encoding a In some embodiments, methods for treating Pompe disease include treating atherosclerotic cardiomyopathy. encapsulates mRNA within liposomes.

[0009] In another aspect, the present invention provides a method for encapsulating an effective amount of mRNA encoding GAA in a liposome. The present invention provides a composition for treating Pompe disease, comprising:

[0010] In some embodiments, suitable liposomes comprise one or more cationic lipids, one or more a non-cationic lipid, one or more cholesterol-based lipids, and one or more PEG-modified lipids include.

[0011] In some embodiments, the one or more cationic lipids are selected from the group consisting of C12-200, MC3, D LinDMA, DLinkC2DMA, cKK‐E12, ICE (imidazole), H GT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DO GS, DODAP, DODMA & DMDMA, DODAC, DLenDMA, DMRI E, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinD AP, DLincarbDAP, DLinCDAP, KLin‐K‐DMA, DLin‐ K-XTC2-DMA, HGT4003, and combinations thereof .

[0012] In some embodiments, the one or more cationic lipids are compounds of formula I-c1-a : [ka] or a pharmaceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1‐3 is alkyl; each q is independently 2 to 6; Each R' is independently hydrogen or C 1‐3 is alkyl; Each R L independently C 8‐12 It is alkyl.

[0013] In some embodiments, the one or more cationic lipids are cKK-E12: [ka] Includes.

[0014] In some embodiments, the one or more non-cationic lipids suitable for the present invention are DSPC ( 1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-di Palmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl- sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn -glycero-3-phosphotidylcholine , DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine) , DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine) , DOPG (, 2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glyceroyl) cerol), and combinations thereof.

[0015] In some embodiments, the one or more cholesterol-based lipids are cholesterol, PEGylated cholesterol and DC-Chol (N,N-dimethyl-N-ethylcarboxamide) midocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine and combinations thereof.

[0016] In some embodiments, the liposome further comprises one or more PEG-modified lipids. In some embodiments, the one or more PEG-modified lipids have a chain length of C6 to C 20 The alkyl chain ( Poly(ethylene) glycol chains of up to 5 kDa in length covalently attached to lipids bearing In some embodiments, the PEG-modified lipid comprises N-octanoyl-sphingosine. Derivatives such as thion-1-[succinyl(methoxypolyethylene glycol)-2000] In some embodiments, the PEG-modified or PEGylated lipid is a PEG-3 ceramide. The copolymers are hydroxylated cholesterol or dimyristoylglycerol (DMG)-PEG-2K.

[0017] In some embodiments, suitable liposomes include cKK-E12, DOPE, cholesterol, and the like. C12-200, DOPE, cholesterol and DMG -PEG2K; HGT4003, DOPE, cholesterol and DMG-PEG2K; or a combination selected from ICE, DOPE, cholesterol and DMG-PEG2K include.

[0018] In some embodiments, cationic lipids (e.g., cKK-E12, C12-200 , ICE and / or HGT4003) accounts for approximately 30 to 60% (e.g., approximately 3 0-55%, approx. 30-50%, approx. 30-45%, approx. 30-40%, approx. 35-50%, approx. 3 In some embodiments, the molar ratio of the cationic surfactant is about 5 to 45%, or about 35 to 40%. ionic lipids (e.g., cKK-E12, C12-200, ICE and / or HGT40 03) is approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55% of the liposomes , or about 60% molar ratio.

[0019] In some embodiments, the cationic lipid(s) (e.g., cKK-E12, C1 2‐200, ICE and / or HGT4003) and non-cationic lipid(s) (e.g. DOPE), cholesterol-based lipid(s) (e.g., cholesterol), The ratio of PEGylated lipid(s) (e.g., DMG-PEG2K) to PEG-2K is approximately 30-60%, respectively. In some embodiments, the ratio may be between 0:25-35:20-30:1-15. Cationic lipid(s) (e.g., cKK-E12, C12-200, ICE and / or or HGT4003), non-cationic lipid(s) (e.g., DOPE), and cholesterol. terol-based lipid(s) (e.g., cholesterol) and PEGylated lipid(s) (e.g., For example, the ratio of DMG-PEG2K is approximately 40:30:20:10, respectively. In some embodiments, the cationic lipid(s) (e.g., cKK-E12, C12 -200, ICE and / or HGT4003) and non-cationic lipid(s) (e.g. DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and P The ratio of EGTA to EGTA lipid(s) (e.g., DMG-PEG2K) was approximately 40: In some embodiments, the cationic lipid(s) (e.g., cKK‐E12, C12‐200, ICE and / or HGT4003) and non-cationic a cholesterol-based lipid(s) (e.g., DOPE) and a cholesterol-based lipid(s) (e.g., cholesterol) to PEGylated lipid(s) (e.g., DMG-PEG2K) and approximately 40:32:25:3, respectively. In some embodiments, the cationic lipid Protein(s) (e.g., cKK-E12, C12-200, ICE and / or HGT4 003), non-cationic lipid(s) (e.g., DOPE), and cholesterol-based lipid a substrate(s) (e.g., cholesterol) and a PEGylated lipid(s) (e.g., DMG -PEG2K) is approximately 50:25:20:5.

[0020] In some embodiments, the size of the liposomes is determined by the length of the largest diameter of the liposome particle. In some embodiments, suitable liposomes are about 500 nm, 40 0nm, 300nm, 250nm, 200nm, 150nm, 100nm, 75nm, In some embodiments, suitable liposomes have a size of about 100 nm or less. The size is less than 100 nm, 90 nm, 80 nm, 70 nm, or 60 nm. In certain embodiments, the liposomes have a size of less than about 100 nm.

[0021] In some embodiments, the mRNA is administered at a dose of about 0.1 to 5.0 mg / kg body weight, for example, about 0 .1~4.5, 0.1~4.0, 0.1~3.5, 0.1~3.0, 0.1~2.5, 0 .1~2.0, 0.1~1.5, 0.1~1.0, 0.1~0.5, 0.1~0.3, 0 0.3~5.0, 0.3~4.5, 0.3~4.0, 0.3~3.5, 0.3~3.0, 0 0.3~2.5, 0.3~2.0, 0.3~1.5, 0.3~1.0, 0.3~0.5, 0 0.5~5.0, 0.5~4.5, 0.5~4.0, 0.5~3.5, 0.5~3.0, 0 0.5-2.5, 0.5-2.0, 0.5-1.5, or 0.5-1.0 mg / kg body weight In some embodiments, the mRNA is administered at a dose ranging from about 5.0, 4.5, 4 0.0, 3.5, 3.0, 2.5, 2.0, 1.5, 1.0, 0.8, 0.6, 0.5, 0 Administer at doses of 0.4, 0.3, 0.2, or 0.1 mg / kg body weight or less. In this form, the mRNA is administered at a dose of about 1.0 mg / kg.

[0022] In some embodiments, the provided compositions are administered intravenously. The composition is administered intramuscularly. In certain embodiments, intramuscular administration is administered to skeletal, smooth, and cardiac muscles. In some embodiments, the provided compositions are administered to a muscle selected from the group consisting of: In certain embodiments, pulmonary delivery is administered via aerosolization, inhalation, nebulization, or the like. In some embodiments, the provided composition is administered via a respirable It is formulated as a particle, a nebulizable lipid, or an inhalable dry powder.

[0023] In some embodiments, provided compositions are administered once daily, once weekly, twice weekly, twice monthly, or once monthly. In some embodiments, provided compositions are administered once every 7 days, once every 10 days, once every 14 days, or once every 18 days. It is given once a day, once every 28 days, or once every 30 days.

[0024] In some embodiments, regular administration of a therapeutically effective amount results in the production of GAA protein in the liver. In some embodiments, regular administration of a therapeutically effective amount results in the development of muscle tissue or GAA protein is expressed in muscle cells. Muscle tissue includes, for example, skeletal muscle, smooth muscle, Muscle cells can be, for example, myocytes, myotubes, myoblasts, cardiac myocytes, and combinations thereof. In some embodiments, the therapeutically effective Regular administration of these doses results in the detection of GAA protein in the serum.

[0025] In some embodiments, regular administration of a therapeutically effective amount of a provided composition results in liver damage in a subject. GAA protein levels were significantly higher than baseline liver GAA protein levels before treatment. In some embodiments, regular administration of a therapeutically effective amount of a provided composition results in an increase in the level of the subject's Subject's muscle GAA protein levels are compared to baseline muscle GAA protein levels before treatment. In some embodiments, the muscle is a skeletal muscle (e.g., striated muscle, voluntary muscle). ), smooth muscle (e.g., visceral muscle, involuntary muscle), or cardiac muscle. Periodic administration of a therapeutically effective amount of a provided composition results in a subject's muscle glycogen levels increasing to a therapeutically acceptable level. In some embodiments, muscle glycogen levels are reduced relative to the previous baseline. Regular administration of a therapeutically effective amount of a provided composition results in a subject's liver glycogen levels increasing to a therapeutically acceptable level. In some embodiments, liver glycogen levels are reduced relative to a previous baseline. Periodic administration of a therapeutically effective amount of a provided composition results in a subject's serum creatine kinase level decreases compared to pretreatment baseline serum creatine kinase levels. In embodiments, regular administration of a therapeutically effective amount of a provided composition results in a subject's urinary glucose The tetrasaccharide (Glcα1‐6Glcα1‐4Glcα1‐4Glc(Glc4) levels were significantly higher after treatment. In some embodiments, the Glc4 levels are reduced relative to the pre-baseline Glc4 levels. Periodic administration of a therapeutically effective amount of the composition results in a subject's serum aspartate transaminase level. enzymes (e.g., AST, aspartate aminotransferase, serum glutamate Quizaloxaloacetic transaminase (AST) levels compared with baseline AST levels before treatment In some embodiments, regular administration of a therapeutically effective amount of a provided composition results in: The subject's serum alanine transaminase (e.g., ALT, alanine aminotransferase) serum glutamic pyruvic transaminase (GPT) levels were measured at baseline before treatment. In some embodiments, the therapeutic effects of the provided compositions are As a result of regular administration of an effective amount, the subject's serum lactate dehydrogenase (e.g., LDH, lactate Dehydrogenase) levels are reduced compared to baseline LDH levels before treatment. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in a biological sample GAA enzyme activity levels during treatment were higher than baseline GAA enzyme activity levels before treatment. Rise.

[0026] In some embodiments, administration of a provided composition results in an increase in liver GAA protein levels in a subject. The level of steroids increases compared to the baseline level before treatment. In some embodiments, administration of a provided composition results in liver GAA protein levels. Protein levels are increased by at least about 10%, 20%, or 30% compared to pre-treatment baseline levels. %, 40%, 50%, 60%, 70%, 80%, 90%, or 95% increase. In some embodiments, administration of provided compositions results in liver GAA protein levels that are higher than those of untreated subjects. elevated relative to the subject's liver GAA protein levels.

[0027] In some embodiments, administration of a provided composition results in an increase in GAA protein in the skeletal muscle of a subject. The quality level increases compared to the baseline level before treatment. is measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in skeletal muscle GAA protein levels are at least approximately 10% higher than pretreatment baseline levels; 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% increase In some embodiments, administration of a provided composition results in an increase in skeletal muscle GAA protein levels. The level of GAA protein is elevated compared to skeletal muscle GAA protein levels in untreated subjects.

[0028] In some embodiments, administration of a provided composition results in an increase in GAA protein in the myocardium of a subject. Levels are elevated compared to baseline levels before treatment. Baseline levels are usually In some embodiments, administration of a provided composition results in an increase in myocardial GA. A protein levels are at least approximately 10% above baseline levels before treatment. %, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% increase In some embodiments, administration of a provided composition results in an increase in myocardial GAA protein levels. , elevated compared to myocardial GAA protein levels in untreated subjects.

[0029] In some embodiments, administration of a provided composition results in an increase in GAA protein in the smooth muscle of a subject. The quality level increases compared to the baseline level before treatment. is measured immediately prior to treatment. In some embodiments, administration of provided compositions results in an increase in smooth muscle GAA protein levels are at least approximately 10% higher than pretreatment baseline levels; 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% increase In some embodiments, administration of provided compositions results in an increase in smooth muscle GAA protein levels. The level of GAA protein in smooth muscle is elevated compared to that of untreated subjects.

[0030] In some embodiments, administration of a provided composition results in expression of GAA protein in muscle cells of a subject. Increased protein levels compared to baseline levels before treatment. In some embodiments, the muscle cells are myocytes, myotubes, myoblasts, or the like. In some embodiments, the administration of a provided composition comprises administering a As a result, muscle cell GAA protein levels were reduced compared to baseline levels before treatment. At most about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, In some embodiments, administration of a provided composition results in an increase in muscle cell GAA protein levels are higher than those of muscle cells from untreated subjects and rises.

[0031] In some embodiments, administration of a provided composition results in the proliferation of liver cells (e.g., hepatocytes) in a subject. GAA protein levels in the thyroid gland, thyroid alveoli, and sinusoidal lining cells increased compared to baseline levels before treatment. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, Administration of a provided composition results in a decrease in liver cell GAA protein levels relative to a pre-treatment baseline. At least about 10%, 20%, 30%, 40%, 50%, 60%, 70% compared to the level , 80%, 90%, or 95% increase. In some embodiments, administration of provided compositions As a result, the GAA protein levels in liver cells were significantly higher than those in untreated subjects. It increases compared to protein levels.

[0032] In some embodiments, administration of a provided composition results in a decrease in GA in the plasma or serum of a subject. Protein A levels increase compared to baseline levels before treatment. In some embodiments, the level of IL-1 is measured immediately prior to treatment. , plasma or serum GAA protein levels compared to baseline levels before treatment At least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 %, or 95% increase. In some embodiments, administration of a provided composition results in an increase in plasma or GAA protein levels in plasma or serum of untreated subjects were compared with those in plasma or serum of untreated subjects. Increased relative to protein levels.

[0033] In some embodiments, administration of a provided composition results in an increase in serum creatine kinase in a subject. levels decrease compared to baseline levels before treatment. Baseline levels are usually In some embodiments, administration of a provided composition results in serum clearance. Creatine kinase levels were significantly higher than baseline serum creatine kinase levels immediately before treatment. at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% In some embodiments, administration of a provided composition results in a serum Creatine kinase levels were approximately 2000 IU / L, 1500 IU / L, and 1000 IU / L. L, 750IU / L, 500IU / L, 250IU / L, 100IU / L, 90IU / L , 80 IU / L, 70 IU / L, or even below 60 IU / L. In some embodiments, administration of provided compositions results in serum creatine kinase levels that are higher than those of untreated subjects. serum creatine kinase levels are reduced compared to those of

[0034] In some embodiments, administration of a provided composition results in a subject's urinary Glc4 level: Decreased compared to pre-treatment baseline levels. Baseline levels are usually measured immediately before treatment. In some embodiments, administration of a provided composition results in urinary Glc4 levels , at least about 10%, 20%, 30%, or 40% compared to baseline levels immediately before treatment , 50%, 60%, 70%, 80%, 90%, or 95% reduction. In some embodiments, administration of the provided compositions results in urinary Glc4 levels of about 100 mmol Glc4 / mol creatinine, 90mmol Glc4 / mol creatinine, 80mmol Glc4 / mol creatinine, 70mmol Glc4 / mol creatinine, 60m mol Glc4 / mol creatinine, 50mmol Glc4 / mol creatinine , 40mmol Glc4 / mol creatinine, 30mmol Glc4 / mol Creatinine creatinine or creatinine to less than 20 mmol Glc4 / mol. In some embodiments, administration of provided compositions results in urinary Glc4 levels that are higher than those of untreated subjects. The urinary Glc4 level is reduced compared to that of

[0035] In some embodiments, administration of a provided composition results in muscle glycogen levels in a subject. The baseline level is usually lower than the baseline level immediately after treatment. In some embodiments, muscle glycogen levels are measured prior to administration of a provided composition. The level of the blood glucose level is at least approximately 10%, 20%, 30%, 40%, or 50% higher than the baseline level immediately before treatment. 0%, 50%, 60%, 70%, 80%, 90%, or 95% reduction. In embodiments, administration of provided compositions results in muscle glycogen levels greater than those of an untreated subject. In certain embodiments, the muscle is a skeletal muscle, a smooth muscle, or is the cardiac muscle.

[0036] In some embodiments, administration of a provided composition results in liver glycogen levels in a subject The baseline level is usually lower than the baseline level immediately after treatment. In some embodiments, liver glycogen levels are measured prior to administration of a provided composition. The level of the blood glucose level is at least approximately 10%, 20%, 30%, 40%, or 50% higher than the baseline level immediately before treatment. 0%, 50%, 60%, 70%, 80%, 90%, or 95% reduction. In embodiments, administration of provided compositions results in liver glycogen levels greater than or equal to those of an untreated subject. It decreases compared to the level of lymphogen.

[0037] In some embodiments, administration of provided compositions results in an increase in serum aspartate levels in a subject. AST levels are reduced compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. Administration of AST resulted in serum AST levels increasing by at least 10% compared to baseline levels immediately before treatment. Approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or In some embodiments, administration of provided compositions results in a decrease in serum AST levels by 95%. However, approximately 600IU / L, 500IU / L, 400IU / L, 300IU / L, 200IU / L, 100IU / L, 50IU / L, 25IU / L, 20IU / L or 10IU / L In some embodiments, administration of provided compositions results in a decrease in serum AST levels. The serum AST level is reduced compared to that of untreated subjects.

[0038] In some embodiments, administration of a provided composition results in an increase in serum alanine transamination in a subject. ALT levels decrease compared to baseline levels before treatment. The baseline level is measured immediately prior to treatment. In some embodiments, administration of a provided composition As a result, serum ALT levels increased by at least approximately 10% compared to baseline levels immediately before treatment. %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% In some embodiments, administration of a provided composition results in a serum ALT level of about 1000IU / L, 900IU / L, 800IU / L, 700IU / L, 600IU / L , 500IU / L, 400IU / L, 300IU / L, 200IU / L, 100IU / L , 50 IU / L, 25 IU / L, 20 IU / L, or less than 10 IU / L. In some embodiments, administration of provided compositions results in serum ALT levels that are higher than those of untreated subjects. The body's serum ALT levels are reduced.

[0039] In some embodiments, administration of a provided composition results in an increase in serum lactate dehydrogenase levels in a subject. LDH levels decrease compared to baseline levels before treatment. In some embodiments, the level of IL-1 is measured immediately prior to treatment. , serum lactate dehydrogenase (LDH) levels were lower than the baseline levels immediately before treatment. At least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% In some embodiments, administration of a provided composition results in a serum LD H levels are approximately 2000IU / L, 1500IU / L, 1000IU / L, and 900IU / L, 800IU / L, 700IU / L, 600IU / L, 500IU / L, 400IU / 1, 300 IU / L, 200 IU / L, or less than 100 IU / L. In some embodiments, administration of provided compositions results in serum LDH levels that are higher than those of untreated subjects. LDH levels are lower than those of serum LDH.

[0040] In some embodiments, administration of a provided composition results in a detection of G in a biological sample from a subject. AA enzyme activity is elevated compared to pre-treatment baseline levels. The level is measured immediately before treatment. Biological samples include, for example, whole blood, serum, plasma, urine, and In some embodiments, tissue samples (e.g., muscle, liver, skin fibroblasts) are used. administration of the provided compositions results in an increase in GAA enzyme activity compared to baseline levels immediately prior to treatment. at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% In some embodiments, administration of a provided composition results in an increase in GA A enzyme activity is elevated compared to GAA enzyme activity in untreated subjects.

[0041] In some embodiments, administration of a provided composition results in a detection of G in a biological sample from a subject. AA mRNA expression levels are elevated compared to baseline expression levels before treatment. The baseline level is measured immediately before treatment. Examples include serum, plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administration of provided compositions results in increased GAA mRNA expression levels immediately after treatment. At least approximately 10%, 20%, 30%, 40%, or 50% compared to previous baseline levels , 60%, 70%, 80%, 90%, or 95% increase. Administration of provided compositions results in GAA mRNA expression levels greater than or equal to GAA m in untreated subjects. Increased relative to RNA expression levels.

[0042] In some embodiments, the mRNA is codon optimized. The codon-optimized mRNA is SEQ ID NO: 3 (corresponding to the codon-optimized human GAA mRNA sequence). In some embodiments, the mRNA has the 5'UTR sequence of SEQ ID NO: 8 (5 'corresponding to UTR sequence X). In some embodiments, the mRNA has the sequence of SEQ ID NO: 9 In some embodiments, the mRNA has a 3'UTR sequence (corresponding to 3'UTR sequence Y). A has the 3'UTR sequence of SEQ ID NO: 10 (corresponding to the 3'UTR sequence Y). In embodiments, the codon-optimized mRNA is SEQ ID NO: 11 or SEQ ID NO: 12 (5'UTR and 3'UTR sequence) corresponding to the codon-optimized human GAA mRNA sequence.

[0043] In some embodiments, the mRNA comprises one or more modified nucleotides. In embodiments, the one or more modified nucleotides are pseudouridine, N-1-methyl- Pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine C-5 propynyl cytidine, C5- Propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine Lysine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cysteine C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deaza Azaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine In some embodiments, the mRNA is unmodified. is.

[0044] In one aspect, the present invention provides a method for treating a brain tumor comprising administering to a subject a subject an effective amount of mRNA encoding acid alpha glucosidase (GAA). A composition for treating Pompe disease is provided, which comprises A encapsulated in a liposome, wherein the liposome cationic lipid cKK‐E12: [ka] Includes.

[0045] In one embodiment, the liposome comprises one or more non-cationic lipids, one or more cholesterol In some embodiments, the lipid composition further comprises a PEG-based lipid, and one or more PEG-modified lipids. One or more non-cationic lipids are DSPC (1,2-distearoyl-sn-glycero-3 -phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine) phosphorus), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine ), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine (ph DPPE (1,2-dipalmitoyl-sn- glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn- Glycero-3-phosphoethanolamine), DOPG (2-dioleoyl-sn-glyceroyl ceramide-3-phospho-(1'-rac-glycerol)).

[0046] In another embodiment, the one or more cholesterol-based lipids are cholesterol and / or PEGylated cholesterol. In a further embodiment, one or more PEG modifications Lipids have chain lengths of C6 to C 20 Maximum chain length covalently attached to lipids with alkyl chain(s) of Contains a 5 kDa poly(ethylene) glycol chain.

[0047] In another embodiment, the liposome comprises cKK-E12, DOPE, cholesterol, and D In certain embodiments, the cationic lipid comprises MG-PEG2K. In another embodiment, the cationic lipid is present in the liposome at a molar ratio of about 30-50%. It accounts for approximately 40% of the molar ratio.

[0048] In another embodiment, cKK-E12:DOPE:cholesterol:DMG-PEG2K In certain embodiments, the molar ratio of cKK-E1 is approximately 40:30:20:10. 2: The molar ratio of DOPE:cholesterol:DMG-PEG2K was approximately 40:30:2. In yet another embodiment, the ratio is cKK-E12:DOPE:cholesterol: The molar ratio of DMG-PEG2K is approximately 40:32:25:3. Liposomes have a size of approximately less than 100 nm.

[0049] In one embodiment, the composition is formulated for intravenous administration. In another embodiment, the composition is administered intramuscularly. In another embodiment, the mRNA has SEQ ID NO: 3. In an embodiment, the mRNA further comprises the 5'UTR sequence of SEQ ID NO: 8. In certain embodiments, the mRNA further comprises the 3'UTR sequence of SEQ ID NO: 9 or SEQ ID NO: 10. In this embodiment, the mRNA has SEQ ID NO:11 or SEQ ID NO:12.

[0050] In one aspect, the present invention provides a method for treating a brain tumor comprising administering to a subject a subject an effective amount of mRNA encoding acid alpha glucosidase (GAA). A composition for treating Pompe disease is provided, which comprises A encapsulated in a liposome, wherein the mRNA is SEQ ID NO: 3, and further the liposomes may contain cationic or non-cationic lipids, cholesterol These include terol-based lipids and PEG-modified lipids.

[0051] In one aspect, the present invention provides a method for treating a brain tumor comprising administering to a subject a subject an effective amount of mRNA encoding acid alpha glucosidase (GAA). A composition for treating Pompe disease is provided, which comprises A encapsulated in a liposome, wherein the mRNA is SEQ ID NO: 11 or SEQ ID NO: 12, and further, the liposome is cationic or non-cationic. These include thionic lipids, cholesterol-based lipids, and PEG-modified lipids.

[0052] Other features, objects, and advantages of the present invention are set forth in the detailed description, appended claims, and accompanying drawings, which are set forth below. However, in order to carry out the invention, While the specifications, drawings, and claims illustrate embodiments of the present invention, they are not intended to be limiting. It should be understood that these are merely examples and are not limiting. Various changes and modifications will be apparent to those skilled in the art. In certain embodiments, for example, the following are provided: (Item 1) A method for treating Pompe disease, comprising administering to a subject in need thereof an amount of acid alpha-glucosidase (G AA) at an effective dose and at an effective interval, reducing the intensity, severity, or frequency of at least one symptom or characteristic of the disease; or The method of treatment further comprises delaying the onset of the disease. (Item 2) A method for treating Pompe disease, comprising administering to a subject in need thereof an amount of acid alpha-glucosidase (G and administering a therapeutically effective amount of a composition comprising mRNA encoding a medicament for hypertrophic cardiomyopathy to a subject. The method of treatment comprises treating (Item 3) 3. The method according to item 1 or 2, wherein the mRNA is encapsulated in a liposome. (Item 4) The liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more The method according to item 3, comprising the cholesterol-based lipid and one or more PEG-modified lipids. (Item 5) The one or more cationic lipids may be C12-200, MC3, DLinDMA, DLi nkC2DMA, cKK‐E12, ICE (imidazole), HGT5000, HGT 5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, D ODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincar bDAP, DLinCDAP, KLin‐K‐DMA, DLin‐K‐XTC2‐DMA a cationic lipid selected from the group consisting of HGT4003, HGT4003, and mixtures thereof; Item 5. The method according to item 4, comprising: (Item 6) The one or more cationic lipids may be cKK-E12: [ka] Item 6. The method according to item 5, comprising: (Item 7) The one or more non-cationic lipids may be DSPC (1,2-distearoyl-sn-glycol). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3- phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanol) diaminopropylamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine) DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine) 2-dioleoyl-sn-glycero-3-phospho-(1'-rac- Any of items 4 to 6, selected from the group consisting of glycerol) and combinations thereof 10. The method according to claim 1. (Item 8) The one or more cholesterol-based lipids may be cholesterol and / or PEGylated cholesterol. The method according to items 4 to 7, wherein the compound is terol. (Item 9) The one or more PEG-modified lipids have a chain length of C6 to C 20 having alkyl chain(s) of Item 4~ containing poly(ethylene) glycol chains of up to 5 kDa in length covalently bound to lipids 9. The method of any one of claims 8 to 8. (Item 10) Any of the preceding items, wherein the cationic lipid comprises about 30 to 50% by weight of the liposome. The method according to any one of claims 1 to 4. (Item 11) 11. The method of claim 10, wherein the cationic lipid comprises about 40% by weight of the liposome. (Item 12) The molar ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid was 12. The method according to any one of items 4 to 11, wherein the ratio is approximately 40:30:20:10. (Item 13) The ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid was 12. The method according to any one of items 4 to 11, wherein the ratio is approximately 40:30:25:5. (Item 14) The ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid was 12. The method according to any one of items 4 to 11, wherein the ratio is approximately 40:32:25:3. (Item 15) The liposomes comprising: cKK‐E12, DOPE, cholesterol and DMG‐PEG2K; C12‐200, DOPE, cholesterol and DMG‐PEG2K; HGT4003, DOPE, cholesterol and DMG-PEG2K; or A combination selected from ICE, DOPE, cholesterol, and DMG-PEG2K 16. The method according to any one of items 3 to 15, comprising: (Item 16) 16. The method according to any one of items 3 to 15, wherein the liposomes have a size of less than about 100 nm. The method described. (Item 17) The mRNA is administered at an effective dose ranging from about 0.1 to 5.0 mg / kg body weight. Item 10. The method according to any one of items 1 to 7. (Item 18) The mRNA is administered at an effective dose ranging from about 0.1 to 3.0 mg / kg body weight. Item 10. The method according to any one of items 1 to 7. (Item 19) The mRNA is administered at an effective dose ranging from about 0.1 to 1.0 mg / kg body weight. Item 10. The method according to any one of items 1 to 7. (Item 20) Any of the preceding items, wherein the mRNA is administered at an effective dose of about 1.0 mg / kg body weight. 10. The method according to claim 1. (Item 21) The method of any one of the preceding items, wherein the composition is administered intravenously. (Item 22) Item 11. The method of any one of the preceding items, wherein the composition is administered intramuscularly. (Item 23) The intramuscular administration is performed in a muscle selected from the group consisting of skeletal muscle, smooth muscle, cardiac muscle, and combinations thereof. The method according to item 22, wherein the method is performed on a muscle. (Item 24) The method of any one of the preceding items, wherein the composition is administered once a week. (Item 25) 24. The method of any one of items 1 to 23, wherein the composition is administered twice a week. (Item 26) 24. The method of any one of items 1 to 23, wherein the composition is administered twice a month. (Item 27) 24. The method of any one of items 1 to 23, wherein the composition is administered once a month. (Item 28) 24. The method of any one of items 1 to 23, wherein the composition is administered once every 14 days. (Item 29) 2. The method of claim 1, wherein said administration of said composition results in expression of GAA protein in the liver. 10. The method according to any one of claims 1 to 9. (Item 30) said administration of said composition also induces expression of GAA protein in muscle tissue or muscle cells. 2. The method of any one of the preceding items, (Item 31) Item 30. The muscle tissue is selected from skeletal muscle, smooth muscle, cardiac muscle, and combinations thereof. The method described below. (Item 32) The muscle cells include myocytes, myotubes, myoblasts, cardiomyocytes, cardiomyocyte blasts, and combinations thereof. 31. The method of claim 30, selected from the group consisting of: (Item 33) Any of the preceding items, wherein administration of the composition results in GAA protein expression in serum. 1. The method according to claim 1. (Item 34) said administering said composition results in said subject's urinary Glc4 level being higher than or equal to a pre-treatment baseline level; The method of any one of the preceding items, wherein the urinary Glc4 level is reduced compared to normal. (Item 35) said administration of said composition results in said subject's muscle glycogen levels being higher than a pre-treatment baseline; 4. The method of any one of the preceding items, wherein muscle glycogen levels are reduced compared to normal muscle glycogen levels in the control group. . (Item 36) said administering said composition results in said subject's liver glycogen levels being higher than or equal to a pre-treatment baseline The method of any one of the preceding items, wherein the liver glycogen level is reduced compared to that of the control. . (Item 37) said administering said composition results in an increase in serum aspartate transaminase levels in said subject; bell compared with baseline serum aspartate transaminase levels before treatment Item 10. The method of any one of the preceding items, wherein the ATP is reduced. (Item 38) said administering said composition results in a serum alanine transaminase level in said subject , a decrease in serum alanine transaminase levels compared to baseline levels before treatment. A method according to any one of the line items. (Item 39) said administering said composition results in said subject having a serum creatine kinase level lower than pre-treatment A decrease in serum creatine kinase levels compared to baseline in any of the preceding 10. The method according to claim 1. (Item 40) said administering said composition results in said subject's serum lactate dehydrogenase level increasing to a level consistent with treatment; Any of the preceding items that decrease serum lactate dehydrogenase levels compared to the previous baseline The method according to any one of claims 1 to 5. (Item 41) said administering said composition results in a decrease in the level of GAA enzyme activity in a biological sample from said subject; Increased GAA enzyme activity compared to baseline levels in pre-treatment biological samples , The method according to any one of the preceding items. (Item 42) Item 10. The method of any one of the preceding items, wherein the mRNA is codon-optimized. (Item 43) 43. The method of claim 42, wherein the codon-optimized mRNA has SEQ ID NO: 3. (Item 44) 44. The method of item 43, wherein the mRNA further comprises the 5'UTR sequence of SEQ ID NO:8. (Item 45) the mRNA further comprises the 3'UTR sequence of SEQ ID NO: 9 or SEQ ID NO: 10. 43. The method according to claim 43. (Item 46) Any one of the preceding items, wherein the mRNA has SEQ ID NO: 11 or SEQ ID NO: 12. The method described below. (Item 47) Item 10. The method of claim 1, wherein the mRNA comprises one or more modified nucleotides. How to do it. (Item 48) The one or more modified nucleotides may be pseudouridine, N-1-methyl-pseudouridine, Lysine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl Nyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine , C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaglycine Anosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine and 48. The method according to item 47, comprising administering to a subject a therapeutically effective amount of 2-thiocytidine or 2-thiocytidine. (Item 49) 47. The method of any one of items 1 to 46, wherein the mRNA is unmodified. (Item 50) An effective amount of mRNA encoding acid alpha-glucosidase (GAA) is encapsulated in liposomes A composition for treating Pompe disease comprising a liposome containing a cationic lipid cKK- E12: [ka] The therapeutic composition comprising: (Item 51) the liposomes comprising one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids. (Item 52) The one or more non-cationic lipids may be DSPC (1,2-distearoyl-sn-glycol). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3- phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanol) diaminopropylamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine DPPE (1,2-dipalmitoyl phosphotidylcholine) -sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl -sn-glycero-3-phosphoethanolamine), DOPG (,2-dioleoyl-s n-glycero-3-phospho-(1'-rac-glycerol)) and their combinations 52. The composition according to item 51, selected from the group consisting of: (Item 53) The one or more cholesterol-based lipids may be cholesterol and / or PEGylated cholesterol. 53. The composition according to item 51 or 52, wherein the compound is selected from the group consisting of terols. (Item 54) The one or more PEG-modified lipids have a chain length of C6 to C 20 having alkyl chain(s) of An item containing a poly(ethylene) glycol chain of a maximum chain length of 5 kDa covalently attached to a lipid 54. The composition according to any one of claims 51 to 53. (Item 55) The liposome contains cKK-E12, DOPE, cholesterol, and DMG-PEG2 55. The composition according to any one of items 50 to 54, comprising K. (Item 56) Items 50 to 55, wherein the cationic lipid accounts for about 30 to 50 mol % of the liposome. The composition according to any one of the preceding claims. (Item 57) 57. The composition according to item 56, wherein the cationic lipid accounts for about 40 mol % of the liposome. thing. (Item 58) The molar ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K was 58. The composition according to any one of items 55 to 57, wherein the ratio is about 40:30:20:10. (Item 59) The molar ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K was 58. The composition according to any one of items 55 to 57, wherein the ratio is about 40:30:25:5. (Item 60) The molar ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K was 58. The composition according to any one of items 55 to 57, wherein the ratio is about 40:32:25:3. (Item 61) 61. Any one of items 50 to 60, wherein the liposomes have a size of less than about 100 nm. The composition described in (Item 62) 62. The composition according to any one of items 50 to 61, wherein the composition is formulated for intravenous administration. thing. (Item 63) 62. The composition according to any one of items 50 to 61, wherein the composition is formulated for intramuscular administration. thing. (Item 64) 64. The composition of any one of items 50 to 63, wherein the mRNA has SEQ ID NO: 3. (Item 65) 65. The composition of item 64, wherein the mRNA further comprises a 5'UTR sequence of SEQ ID NO:8. (Item 66) the mRNA further comprises the 3'UTR sequence of SEQ ID NO: 9 or SEQ ID NO: 10. 64. The composition according to claim 64. (Item 67) 67. The composition of any one of items 50 to 66, wherein the mRNA has SEQ ID NO: 11 or SEQ ID NO: 12. (Item 68) 1. A composition for treating Pompe disease, comprising an effective amount of mRNA encoding acid alpha-glucosidase (GAA) encapsulated in a liposome, the mRNA having SEQ ID NO: 3; and The liposomes are composed of cationic lipids, non-cationic lipids, cholesterol-based lipids, and P The therapeutic composition further comprises an EG-modified lipid. (Item 69) 1. A composition for treating Pompe disease, comprising an effective amount of mRNA encoding acid alpha-glucosidase (GAA) encapsulated in a liposome, the mRNA having SEQ ID NO: 11 or SEQ ID NO: 12; and The liposomes are composed of cationic lipids, non-cationic lipids, cholesterol-based lipids, and P The therapeutic composition further comprises an EG-modified lipid.

[0053] The drawings are for illustrative purposes only and are not limiting. [Brief explanation of the drawings]

[0054] [Figure 1A] An example of GAA mRNA detection by in situ hybridization performed on muscle tissue from a mouse 6 hours after treatment with a single intravenous dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 1B] An example of GAA mRNA detection by in situ hybridization performed on muscle tissue from a mouse 12 hours after treatment with a single intravenous dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 2A] 1 shows an example of glycogen depletion in the liver of a GAA knockout mouse 24 hours after treatment with a single intravenous dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles. [Figure 2B] An example of glycogen accumulation in the liver of a GAA knockout mouse that was not treated with GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 3] An example of GAA mRNA detection by in situ hybridization performed on muscle tissue from a mouse 24 hours after treatment with a single intramuscular dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 4A] 1 shows an example of glycogen depletion in the quadriceps muscle of a GAA knockout mouse 24 hours after treatment with a single intramuscular dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles. [Figure 4B] 1 shows an example of glycogen depletion in the quadriceps muscle of a GAA knockout mouse 24 hours after treatment with a single intramuscular dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles. [Figure 4C] An example of glycogen levels in the quadriceps muscle of a GAA knockout mouse that was not treated with GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 4D] An example of glycogen levels in the quadriceps muscle of a GAA knockout mouse that was not treated with GAA mRNA-encapsulated lipid nanoparticles is shown. DETAILED DESCRIPTION OF THE INVENTION

[0055] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions for this and other terms are set forth throughout the specification. which describes the background of the invention and provides further details regarding its implementation. Publications and other reference materials are incorporated herein by reference.

[0056] Alkyl: As used herein, "alkyl" refers to an alkyl group having 1 to 15 carbon atoms. A linear or branched saturated hydrocarbon group ("C 1‐15 It refers to the radical of an alkyl group. In some embodiments, the alkyl group has 1 to 3 carbon atoms ("C 1‐3 Alkyl "). C 1‐3 Examples of alkyl groups are methyl (C1), ethyl (C2), and n-propyl. (C3), and isopropyl (C3). In some embodiments, alkyl The group has 8 to 12 carbon atoms ("C 8‐12 C 8‐12 Alkyl Examples include n-octyl (C8), n-nonyl (C9), and n-decyl (C 10 ), n‐u Indecyl (C 11 ), n-dodecyl (C 12 ) are examples, but are not necessarily limited to these. The prefix "n-" (normal) refers to an unbranched alkyl group. Examples: For example, n-C8 alkyl refers to -(CH2)7CH3, and n-C 10 Alkyl is -(CH 2) Refers to 9CH3, etc.

[0057] Amino acid: As used herein, the term "amino acid" refers to, in its broadest sense, It refers to any compound and / or substance that can be incorporated into a polypeptide chain. In the form, amino acids have the general structure H2N-C(H)(R)-COOH. In embodiments, the amino acid is a naturally occurring amino acid. The amino acid is a synthetic amino acid; in some embodiments, the amino acid is a d-amino acid. In some embodiments, the amino acid is an l-amino acid. Any of the 20 standard l-amino acids commonly found in naturally occurring peptides "Non-standard amino acids" refer to those prepared synthetically or obtained from natural sources. As used herein, the term "amino acid" refers to any amino acid other than the standard amino acids, whether or not it is a nucleotide. As used herein, "synthetic amino acid" includes chemically modified amino acids, including salts, These include, but are not necessarily limited to, amino acid derivatives (such as amides), and / or substitutions. The carboxy-terminal and / or amino-terminal amino acids in the peptide are not specified. The amino acids contained therein alter the circulating half-life of peptides without adversely affecting their activity. methylation, amidation, acetylation, protecting groups and / or other chemical groups that can be The amino acids may be modified by substitution. The amino acids may be involved in disulfide bonds. Amino acids are those that contain one or more chemical entities (e.g., methyl groups, acetate groups, acetyl groups, Phosphate group, formyl moiety, isoprenoid group, sulfate group, polyethylene glycol moiety, lipid and post-translational modifications such as association with a nucleotide moiety (e.g., a protein moiety, a carbohydrate moiety, a biotin moiety, etc.). The term "amino acid" is used interchangeably with "amino acid residue," and The term may refer to free amino acids and / or amino acid residues of peptides. Whether a term refers to an amino acid or a peptide residue depends on the context in which the term is used. It should be obvious.

[0058] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In this context, "animal" refers to non-human animals at any stage of development. The target animals are mammals (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, etc.). In some embodiments, the animal is a mammal (e.g., a mammal, a mammalian species, a mammalian animal, a mammalian species ... , mammals, birds, reptiles, amphibians, fish, insects, and / or worms, but must In some embodiments, the animal may be a transgenic animal, including, but not limited to, a mammal. The animal may be a genetically modified animal, a genetically modified animal, and / or a clone.

[0059] Approximately or about: As used herein, When used in a context, the term "approximately" or "about" is used when applying it to one or more values ​​of interest. In certain embodiments, the term "approximately" refers to a value similar to the stated reference value. "approximately" or "about" means "to the best of our knowledge" unless otherwise specified; indicates a value in either direction (greater or less) unless the context clearly indicates otherwise. 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, Refers to a range of numbers that fall within 1% or less (such numbers exceed 100% of the possible values). (Except when

[0060] Biologically active: As used herein, the phrase "biologically active" means a biologically It refers to the property of any agent that makes it active in a system, especially in an organism. For example, when administered to an organism, An agent that has a biological effect on an organism is considered biologically active if it do.

[0061] Delivery: As used herein, the term "delivery" includes both local and systemic delivery. For example, delivery of mRNA involves delivering the mRNA to a target tissue and producing the encoded protein. The situation where the substance is expressed and retained within the target tissue (also called "local distribution" or "local delivery") and delivering the mRNA to the target tissue, where the encoded protein is expressed and the patient secreted into the circulatory system (e.g., serum) and distributed throughout the body, where it is taken up by other tissues ( This includes situations where the systemic distribution is incomplete or incompletely distributed (also referred to as "systemic distribution" or "systemic delivery").

[0062] Expression: As used herein, "expression" of a nucleic acid sequence refers to the synthesis of a polypeptide from an mRNA. translation into, and assembly of, multiple polypeptides into intact proteins (e.g., enzymes) and / or polypeptides or fully assembled proteins (e.g., enzymes In this application, the terms "expression" and "production" and their grammatical equivalents are used interchangeably. The word present is used in the same sense.

[0063] Functional: As used herein, a "functional" biomolecule has a property that characterizes it. and / or a biological molecule in an active form.

[0064] Half-life: As used herein, the term "half-life" refers to the time period during which a nucleic acid or protein concentration decreases. The time it takes for a quantity, such as intensity or activity, to fall to half of its value measured at the beginning of a period It is the time spent together.

[0065] Improve, increase, or decrease: As used herein, the term "improve" "Increase" or "decrease" or grammatical equivalents refer to the treatments described herein. Baseline measurements, such as measurements in the same individual before initiation of treatment, or as described herein compared to measurements in a control subject (or control subjects) in the absence of treatment A "control subject" is a subject suffering from the same type of disease as the subject being treated. The subjects are approximately the same age.

[0066] In vitro: As used herein, the term "in vitro" refers to the They do not live in living organisms but in artificial environments, e.g., in test tubes or reaction vessels, in cell cultures, etc. This refers to an event that occurs.

[0067] In vivo: As used herein, the term "in vivo" refers to a living organism, including humans and Refers to events that occur within multicellular organisms, such as non-human animals. In the context of cell-based systems, In this context, the term refers to events that occur within living cells (as opposed to, for example, in vitro systems). May also be used to point.

[0068] Isolated: As used herein, the term "isolated" means (1) originally produced In the case of (natural and / or experimental settings), at least some of the relevant components (2) substances and / or entities isolated from or produced or prepared by human hands; An isolated substance and / or entity is one that is isolated from the organism in which it was first discovered. of other ingredients associated with these, approximately 10%, approximately 20%, approximately 30%, approximately 40%, approximately 50%, approximately 60%, approximately 70%, approximately 80%, approximately 90%, approximately 91%, approximately 92%, approximately 93%, approximately 94%, approximately can be separated from 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% In some embodiments, the isolated agent is about 80%, about 85%, about 90%, about 9 1%, approximately 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, approximately 9 9%, or greater than about 99% pure. It is "pure" if it is substantially free of other components. Calculations of percent purity of isolated substances and / or entities include the exclusion of excipients (e.g., buffers, should not contain solvents, water, etc.

[0069] Local distribution or delivery: As used herein, the terms “local distribution,” “local delivery,” or The grammatical equivalents refer to tissue-specific delivery or distribution. For delivery, the mRNA encodes a protein (e.g., an enzyme) that is translated intracellularly. Translated and expressed or secreted to limit its entry into the patient's circulatory system It is necessary to do so.

[0070] Messenger RNA (mRNA): As used herein, the term "messenger RNA" refers to a "mRNA (mRNA)" means a polynucleotide that encodes at least one polypeptide. As used herein, mRNA includes both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. They can be purified from natural sources, produced using recombinant expression systems, and further purified as needed. Suitable chemically synthesized molecules include, for example, m RNA can be modified with nucleotides, such as analogs with chemically modified bases or sugars, backbone modifications, etc. Unless otherwise specified, the mRNA sequence is In some embodiments, the mRNA is presented in a 5' to 3' direction. nucleotides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs ( For example, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3- Methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl C5-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine , C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazagua adenosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); Intercalating bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'- deoxyribose, arabinose, and hexose sugars); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite bonds) or containing them nothing.

[0071] Muscle cell or muscle tissue: As used herein, the term "muscle cell" or "muscle tissue" refers to a "Tissue" in its broadest sense refers to a cell or group of cells derived from muscle, and is not necessarily limited to Cells and tissues derived from, but not limited to, skeletal muscle (e.g., striated muscle, voluntary muscle); This includes smooth muscle (e.g., visceral and involuntary muscles) derived from the gastrointestinal tract, bladder, and blood vessels; and cardiac muscle. The term refers to muscle cells in vivo and in vitro. Differentiated and undifferentiated myocytes, such as myotubes, myoblasts, cardiomyocytes, and cardiomyoblasts Cells are also included.

[0072] Nucleic Acid: As used herein, the term "nucleic acid" refers in its broadest sense to a polymer Any compound that is or can be incorporated into a oligonucleotide chain and / or In some embodiments, a nucleic acid is a polynucleotide linked via a phosphodiester bond. Compounds and / or substances that are or can be incorporated into nucleotide chains. In some embodiments, a "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and In some embodiments, "nucleic acid" refers to individual nucleic acid residues. In some embodiments, "nucleic acid" refers to a polynucleotide chain containing a nucleotide group. and single-stranded and / or double-stranded DNA and / or cDNA.

[0073] Patient: As used herein, the term "patient" or "subject" refers to a subject, e.g., in an experimental, diagnostic, Any organism to which the provided compositions can be administered for diagnostic, preventative, cosmetic, and / or therapeutic purposes. Common patients include animals (e.g., mice, rats, rabbits, non-human primates, and In some embodiments, the patient is a human. Humans include prenatal and postnatal forms.

[0074] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" means a compound that is Within the scope of medical judgment, the substance is suitable for use in contact with human and animal tissue. may result in excessive toxicity, irritation, allergic reactions, or other problems or complications. It refers to substances that are not harmful and have a reasonable risk-benefit ratio.

[0075] Pharmaceutically acceptable salts: Pharmaceutically acceptable salts are well known in the art. For example, , SM Berge et al., J. Pharmaceutical Sciences (1 977) 66:1-19 describes pharmaceutically acceptable salts in detail. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts include salts of inorganic acids such as: acids, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or organic acids such as acetic acid, Oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or lunaronic acid or other methods used in the art such as ion exchange. Other examples of pharmaceutically acceptable salts include salts of amino groups formed using the methods described above. Adipate, alginate, ascorbate, aspartate, benzenesulfonate Fonates, benzoates, hydrogen sulfates, borates, butyrates, camphorates, camphorsulfonates, Citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethane Sulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate Salt, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy- Tansulfonate, Lactobionate, Lactate, Laurate, Lauryl Sulfate, Apple acid salts, maleates, malonates, methanesulfonates, 2-naphthalenesulfonates, Nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectin Phosphate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalic acid Salt, propionate, stearate, succinate, sulfate, tartrate, thiocyanate , p-toluenesulfonate, undecanoate, valerate, etc. Suitable bases As salts derived from alkali metals, alkaline earth metals, ammonium and N + (C 1‐4 Representative alkali or alkaline earth metal salts include: , sodium, lithium, potassium, calcium, magnesium, etc. Further pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium salts, etc. monium, as well as halides, hydroxides, carboxylates, sulfates, phosphates, and nitrates Amine cationic groups formed with counterions such as arylsulfonates, sulfonates, and arylsulfonates. Further pharmaceutically acceptable salts include alkyl halides. A salt obtained by quaternizing an amine with a suitable electrophile to form a quaternary alkylated amino salt. Examples include:

[0076] Systemic distribution or delivery: As used herein, the terms "systemic distribution," "systemic delivery," or or grammatical equivalents, a mechanism of delivery or distribution that affects the whole body or organism Typically, systemic distribution or delivery refers to delivery via the body's circulatory system, e.g., the bloodstream. Compare with the definition of "local distribution or delivery."

[0077] Subject: As used herein, the term "subject" refers to a human or any non-human animal. Animals (e.g., mice, rats, rabbits, dogs, cats, cows, pigs, sheep, horses, or spirits) Humans include both prenatal and postnatal forms. In many embodiments, The subject is a human. The subject can be a patient, i.e., a person undergoing diagnosis or The term "subject" is used herein to refer to an individual who visits a healthcare provider for treatment. or "patient." A subject is a person who is suffering from or has a disease or disorder. likely to be susceptible, but may show symptoms of a disease or disorder, but It doesn't have to be there.

[0078] Substantially: As used herein, the term "substantially" means to describe a feature or A qualitative state indicating that a characteristic is present throughout or to a nearly entire extent or degree. Those skilled in the biological arts will understand that biological and chemical events are complete and Achieving perfection or achieving or avoiding absolute results is a It will be understood that even if such cases occur, they are extremely rare. "Qualitatively" to capture the potential lack of completeness inherent in many biological and chemical phenomena. It is used for this purpose.

[0079] Target tissue: As used herein, the term "target tissue" refers to the tissue that is the target of the disease being treated. In some embodiments, the target tissue includes any tissue affected by a disease. This includes tissues that exhibit signs, symptoms, or characteristics associated with

[0080] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent refers to a therapeutically effective amount of a therapeutic agent that is effective to treat a disease. , a disorder, and / or a condition. to treat, diagnose, prevent, and / or treat the symptom(s) of a disease, disorder, and / or condition, when or an amount sufficient to cause or delay the onset of a therapeutically effective amount. Administration via a dosing regimen comprising a single unit dose will be understood by those skilled in the art. There will be.

[0081] Treatment: As used herein, the term "treat" or "tre "Treatment" or "treating" refers to the treatment of a subject with a particular disease. partially or completely alleviate one or more symptoms or characteristics of a disease, disorder and / or condition , ameliorate, alleviate, inhibit, prevent, delay the onset, reduce the severity, and / or Refers to any method used to reduce the incidence of disease. To reduce the risk of death, treatment is recommended for patients who are not showing symptoms of the disease and / or who are showing only early symptoms of the disease. It may be administered to a subject.

[0082] Detailed Description The present invention provides, inter alia, methods and compositions for treating Pompe disease based on mRNA therapy. In particular, the present invention provides a method for administering acid alpha-glucosidase (GAA) to a subject in need of treatment. A composition containing the mRNA encoding the target gene is administered at an effective dose and at an effective interval, thereby Reduce the intensity, severity, or frequency of at least one symptom or characteristic of MPH The present invention also provides a method for treating Pompe disease by inhibiting or delaying the onset of the disease. Additionally, a subject in need of treatment is administered an mRNA encoding acid alpha-glucosidase (GAA). administering a therapeutically effective amount of a composition containing A, thereby treating hypertrophic cardiomyopathy in a subject. In some embodiments, the mRNA is administered to a subject in need thereof. As used herein, the term "liposome" means Generally, the term "lamellar, multi-layered, or solid nanoparticle vesicle" is used herein. The liposomes used may be prepared by mixing one or more lipids or by combining one or more lipids. It can be formed by blending one or more polymer(s). Thus, as used herein, the term "liposome" refers to both lipid-based and polymer-based nanoparticles. In some embodiments, liposomes suitable for the present invention include cationic or Non-cationic lipid(s), cholesterol-based lipid(s) and PEG-modified lipid(s). Contains several (possibly multiple).

[0083] Pompe disease The present invention can be used to treat subjects suffering from or susceptible to Pompe disease. Pompe disease is characterized by a mutation in the gene for the enzyme acid alpha-glucosidase (GAA). It is an autosomal recessive metabolic disorder characterized by the following enzymes: acid maltase, maltase maltase, maltase-glucoamylase, gluoinvertase e), glucoside sucrase, aglucosidase α, α-1,4-glucosidase, amino Glucosidase, glucoamylase, LYAG, LYAG_HUMAN, lysosomal alpha Also known as glucosidase and alpha-glucosidase, acid. Acid maltase, α-1,4-glucosidase and α-glucosidase Also known as GAA, GAA-like protein. Over 200 mutations that cause Pompe disease are found in the GAA gene. Most of these mutations involve single amino acid substitutions and Many of the mutations in the GAA gene involve small insertions or deletions. This may affect the structure of the protein and reduce its activity. Some of the mutations result in the production of abnormally truncated enzymes, which are It is unable to effectively perform its role in the hydrolysis of glycogen.

[0084] Deficiency of the acid α-glucosidase enzyme reduces the cell's ability to hydrolyze glycogen. This results in the accumulation of glycogen in cells and tissues, especially in the liver and muscles. Accumulation of ATP leads to cell death, which manifests as progressive muscle weakness, cardiomyopathy, and respiratory failure. .

[0085] The compositions and methods described herein treat at least one symptom or feature of Pompe disease. In particular, the compositions and methods described herein can be used to treat hypertrophic cardiomyopathy. It can be used to treat

[0086] Acid alpha-glucosidase (GAA) In some embodiments, the present invention provides a gene encoding GAA for the treatment of Pompe disease. The present invention provides methods and compositions for delivering mRNA suitable for GAA to a subject. can replace the activity of the natural GAA protein and / or are associated with Pompe disease GAA tanning can reduce the intensity, severity, and / or frequency of one or more symptoms. The protein may be encoded either as a full-length protein, a fragment, or a portion thereof.

[0087] In some embodiments, the suitable mRNA sequence encodes the human GAA protein. The naturally occurring human GAA mRNA coding sequence and the corresponding amino acid sequence are shown in Table 1. The amino acid sequence is shown in Table 1: [Table 1-1] [Table 1-2]

[0088] In some embodiments, a suitable mRNA is a wild-type human GAA mRNA of the sequence In some embodiments, a suitable mRNA has the sequence shown below: Alternatively, the codon-optimized hGAA sequence may be:

[0089] Codon-optimized human GAA coding sequence (SEQ ID NO: 3): AUGGGAGUCAGACACCCGCCGUGCUCGCACAGGCUUCUG GCCGUGUGCGCACUCGUGAGUCUGGCGACUGCUGCGUUGC UGGGGCACAUUCUUCUCCCACGACUUUCUCUUGGUGCCCCG AGAAUUGGCGGCUCGUCGCCGGUACUGGAAAACCCAC CCCGCACAUCAGCAGGCGCGUCGCGGCCUGGUCCGAGGG AUGCCCAGGCACAUCCCGGAAGGCCACGAGCCGUCCCGAC UCAAUGUGACGUACCUCCCAAUUCCCGGUUCGACUGUGCG CCAGACAAGGCAUACACGCAAGAGCAGUGCGAAGCCCCGUG GAUGCUGCUAUAUUCCGGCGAAGCAGGGACUUCAGGGAGC CCAGAUGGGGCAGCCCUGGGUUUCUCCCGCCUUCCUAU CCCUAUAUAAGCUGGAAUUGUCGUCCUCGGAAAUGG GGUAUACCGCUACUCUUACGAGAACCACCCCCAAUCUU UCCGAAGGACAUCCUUACUCUGCGGCUCGACGUGAUG GAGACAGAAAUAGGCUGCAUUUCACGAUCAAAGACCCGG CGAACCGGAGAAUAUGAGGUCCGCUUGAGACCCCCACGU UCACUCUCGUGCGCCUUCACCCCUUGUACUCCGUGGAGUUC UCGGAAGAACCGGUUCGGGGUGAUCGUCAGACGUCAACUUG AUGGUAGGGUAUUGCUGAACACAACGGUCGCCCCCUUGUU UUUCGCCGACCAGUUUCUGCAGCUUUCGACAUCGCUGCCG UCCCAGUAUAUACACAGGGCUCGCGGAGCAUCUUUCACCCCC UCAUGCUGAGCACGAGCUGGACACGGAUUCGCUCUGGAA CAGGGAUCUCGCGCCGACGCCCGGAGCGAAUUUGUAUGGG UCGCAUCCCUUCUACCUCGCAUUGGAAGACGGGGGUUCCG CGCACGGAGUAUUCCUUGCUUAAUUCUAAUGCGAUGGAGCGU UGUUGCAGCCCUCCCCUGCUUUGUCGUGGCGUUCCACG GGGGGCAUUUUGGACGUUUACACUUUUUGGGACCCGAGC CAAAGAGCGUAGUCCAGCAGUAUUUGGAUGGGCGUA CCCCUUCAUGCGCCUUAUUGGGGACUGGGGGUUCCAUCUC UGCCGCUGGGGGUACUCUUCGACCGCGAUCACCCGCCAGG UGGUCGAGAACAUGACCAGACCACAUUUCCCUUUGGACGU GCAGUGGAAUGAUUUGGAUUACAUGGAUAGCCGAGAGAC UUCACGUUCAAUAAGGACGGGUUUAGAGAUUUUCCCGCGA UGGUGCAAGAAUUGCACCAGGGUGGGCGCAGAUACAUGAU GAUCGUCGAUCCCGCCAUCAGCAGCUCGGGACCAGCGGGG AGUUACCGGCCUUACGAUGAGGGACUUAGGAGAGGCGUCU UUAUCACGAACGAAACAGGUCAGCCGCUCAUUGGUAAGU GUGGCCUGGAUCACGGCCUUUCCCGACUUCACGAAUCCC ACAGCCCUGCCCUGGUGGGAAGACAUGGUGGGCGGAGUUUC ACGACCAAGUACCGUUUGAUGGGAUGUGGAUUGAUAUGAA CGAACCCUCAAACUUUAUUCGCGGCUCGGAAGAUGGAUGC CCGAAUAAUGAGCUUGAGAAUCCCCCGUAUGUGCCAGGGG UGGUAGGUGGGACGCUCCAGGCCGCUACGAUCUGUGCGUC AUCACAUCAGUUCUUGUCAACGCACUACAACUUGCACAAU CUUUACGGUUUGACUGAAGCCAUCGCUUCGCAUCGCGCGC UGGUCAAAGCGCGUGGUACGCGACCCUUCGUUAUUUCUCG GUCCACAUUUGCCGGGCACGGUCGGUAUGCCGGACACUGG ACGGGAGAUGUCUGGUCUAGCUGGGAGCAGCUCGCGUCGA GCGUACCGGAGAUCCUCCAGUUCAAUCUUUUGGGAGUUCC GCUCGUCGGCGCUGACGUGUGCGGUUUUCUCGGAAACACA UCAGAAGAGCUUUGCGUACGCUGGACACAGCUCGGUGCGU UUUACCCCUUUAUGAGAAACCAUAACUCGUUGCUCUCACU CCCUCAAGAGCCGUACAGUUUUUCGGAGCCUGCGCAACAG GCGAUGCGGAAGGCAUUGACACUUCGCUAUGCACUGCUCC CGCAUCUCUAUACUCUGUUCCAUCAGGCCCAUGUGGCUGG AGAAACGGUGGCGAGGCCCCUGUUCUUGGAGUUCCCCAAA GAUAGUUCCACAUGGACCGUGGAUCACCAGUUGCUGUGGG GAGAGGCGCUUCUGAUCACUCCGGUACUUCAGGCGGGUAA AGGGAAGUCACUGGGUAUUUCCCGCUUGGGACCUGGUAC GACCUUCAGACUGUCCCAGUAGAAGCCCUCGGAAGCCUGC CACCUCCCCCUGCUGCACCCCGCGAGCCUGCAAUCCAUAG CGAGGGCCAGUGGGUAACGUUGCCAGCCCCACUGGAUACC AUCAAUGUCCACCUCAGGGCGGGUUACAUUAUCCCUCUCC AAGGCCCUGGGUUGACCACCACAGAGUCGCGCCAGCAGCC AAUGGCACUUGCGGUCGCAUUGACGAAAGGGGGUGAAGCC CGAGGGGAACUGUUUUGGGAUGACGGGGAAAGCCUUGAGG UGCUGGAACGGGGAGCGUACACACAAGUCAUUUUCUUGGC CAGGAACAACACUAUUGUCAACGAGUUGGUGCGCUGACC UCUGAGGGUGCCGGACUGCAACUGCAGAAGGUCACGGUCC UCGGAGUGGCGACAGCACCCCAACAGGUCCUUAGUAACGG AGUACCUGUCUCGAACUUUACAUACUCCCCGGACACGAAG GUGCUCGACAUCUGUGUGUCGCUGCUUAUGGGGGAACAGU UUCUCGUGAGCUGGUGCUAG

[0090] Further exemplary mRNA sequences are described in the Examples section below, e.g., SEQ ID NO: 11 and SEQ ID NO: 12 are the 5' and 3' untranslated sequences surrounding the codon-optimized GAA-encoding mRNA. Includes the area.

[0091] In some embodiments, suitable mRNA sequences include those homologous to the human GAA protein. For example, the mRNA sequence may be a homolog or analog of the mRNA sequence of the human GAA protein. A log or analog has a similar activity to the wild-type or naturally occurring human GAA protein. GAA protein, while containing one or more amino acid substitutions, deletions and / or insertions. It may also be a modified human GAA protein that substantially retains activity. In some embodiments, mRNA suitable for the present invention may be at least 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 2 0%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 9 Amino acids that are 6%, 97%, 98%, 99% or more homologous to SEQ ID NO:2 In some embodiments, mRNA suitable for the present invention encodes the human GAA gene. In some embodiments, the present invention provides a method for the preparation of a polypeptide comprising: Suitable mRNA should be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, %, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, 99% or more identical to SEQ ID NO:2. In some embodiments, mRNA suitable for the present invention is a fragment or fragments of the human GAA protein. In some embodiments, mRNA suitable for the present invention encodes a portion of human GAA and encoding a fragment or portion of a protein, wherein the fragment or portion of the protein is In some embodiments, the present invention provides a method for the production of a GAA-containing protein comprising the steps of: Suitable mRNA should be at least 50%, 55%, 60%, 65%, 70%, 75%, 8% or higher. 0%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 9 8%, 99% or more of the sequences are SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 11 or SEQ ID NO: It has the same nucleotide sequence as sequence number 12.

[0092] In some embodiments, the appropriate mRNA is fused to another protein (e.g., N- or C-terminal fusion) fusion proteins containing full-length, fragments, or portions of the GAA protein In some embodiments, the full-length, fragment, or portion of the GAA protein is encoded. The protein fused to the mRNA encoding it may contain a signal sequence or a cellular targeting sequence. Do it.

[0093] delivery vehicle In accordance with the present invention, the GAA proteins described herein (e.g., the entire GAA protein) can be used. mRNA that encodes a protein (whole, fragment, or part of it) is naked RNA (unpackaged) The compound may be delivered as a pharmaceutical or via a delivery vehicle. ", "transport vehicle", "nanoparticle" or grammatical equivalents are used interchangeably.

[0094] In some embodiments, the mRNA encoding the GAA protein is delivered in a single In some embodiments, the GAA protein is delivered via a vehicle. The mRNA may be delivered via one or more delivery vehicles, each of different composition. According to embodiments, suitable delivery vehicles include polymers such as polyethyleneimine (PEI). -based carriers, lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes , proteoliposomes, exosomes of both natural and synthetic origin, natural, synthetic and semi- Synthetic lamellar bodies, nanoparticles, calcium phosphate-silicate nanoparticles, calcium phosphate nanoparticles Particles, silicon dioxide nanoparticles, nanocrystalline particles, semiconductor nanoparticles, poly(D-arginine) ), sol-gel, nanodendrimers, starch-based delivery systems, micelles, emulsions, Niosomes, multi-domain block polymers (vinyl polymers, polypropyl acrylic acid polymer, dynamic polyconjugate), dry powder formulation, plasma Viruses, calcium phosphate nucleotides, aptamers, peptides and other vectors Examples of such tags include, but are not necessarily limited to, tags.

[0095] Liposomal Delivery Vehicles In some embodiments, a suitable delivery vehicle is a liposome delivery vehicle, such as a lipid nanoparticle. As used herein, a liposome delivery vehicle, such as a lipid nanoparticle, is A microorganism with an internal aqueous space usually separated from the external medium by one or more bilayer membranes Liposomes are characterized as small vesicles. The bilayer membrane of a liposome is usually composed of spatially separated hydrophilic and formed by amphiphilic molecules such as lipids of synthetic or natural origin that have hydrophobic domains. (Lasic, Trends Biotechnol., 16:307-321, 1998). The liposome bilayer membrane is composed of amphiphilic polymers and surfactants (e.g., poly(amphiphilic)). They can also be formed by merosomes (polymerosomes, niosomes, etc.). In the context of the present invention, liposome delivery vehicles generally target a desired mRNA. These molecules help transport the molecules to the target cells or tissues.

[0096] cationic lipids In some embodiments, the liposomes may include one or more cationic lipids. As used herein, the term "cationic lipid" refers to a lipid that is soluble in water at a selected pH, e.g., physiological pH. It refers to any of a number of lipid species that have a net positive charge. A variety of carboxylic lipids have been described in the literature, many of which are commercially available. Cationic lipids particularly suitable for use in the method of the present invention include those disclosed in International Patent Publication WO2010 / 0535 72 (in particular CI2-200 as set out in paragraph

[0225] ) and WO2012 / 170930, which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention are directed to the method disclosed in US Pat. No. 6,299,492, which was published on Mar. 29, 2012. No. 61 / 617,468, filed on Dec. 16, 2002, which is incorporated herein by reference. Ionizable cationic lipids according to the formula (1), such as (15Z,18Z)-N,N-dimethyl -6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15 ,18-dien-1-amine (HGT5000), (15Z,18Z)-N,N-dimethyl 6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa 4,15,18-trien-1-amine (HGT5001), and (15Z,18Z)- N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl ) Tetracosa-5,15,18-trien-1-amine (HGT5002) and other fats Uses high-quality nanoparticles.

[0097] In some embodiments, the provided liposomes are those described in WO2013 / 063468, and A concurrently filed U.S. patent application entitled "Lipid Formulations for Delivery of Messenger RNA" is also incorporated herein by reference. and the cationic lipids described in the U.S. Provisional Patent Application No. 2004 / 0109994, both of which are incorporated herein by reference. Reference is made to the detailed text.

[0098] In some embodiments, the cationic lipid has the formula I-c1-a: [ka] or a pharmaceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1‐3 is alkyl; each q is independently 2 to 6; Each R' is independently hydrogen or C 1‐3 is alkyl; And each R L is independently C 8‐12 It is alkyl.

[0099] In some embodiments, each R 2 are independently hydrogen, methyl or ethyl. In some embodiments, each R 2 is independently hydrogen or methyl. In some embodiments, , each R 2 is hydrogen.

[0100] In some embodiments, each q is independently 3 to 6. q is independently 3 to 5. In some embodiments, each q is 4.

[0101] In some embodiments, each R' is independently hydrogen, methyl, or ethyl. In some embodiments, each R' is independently hydrogen or methyl. , each R' is independently hydrogen.

[0102] In some embodiments, each R L is independently C 8‐12 It is an alkyl group. In the embodiment, each R L are independently n‐C 8‐12 In some embodiments, the aryl group is alkyl. , each R L is independently C 9‐11 In some embodiments, each R L is independent n-C 9‐11 In some embodiments, each R L is independently C 10 In some embodiments, each R L are independently n‐C 10 is alkyl .

[0103] In some embodiments, each R 2 is independently hydrogen or methyl; each q is independently each R' is independently hydrogen or methyl; L independently C 8‐12 It is alkyl.

[0104] In some embodiments, each R 2 is hydrogen; each q is independently 3 to 5; each R' is hydrogen; and each R L is independently C 8‐12 It is alkyl.

[0105] In some embodiments, each R 2 is hydrogen; each q is 4; each R' is hydrogen ;Each R L is independently C 8‐12 It is alkyl.

[0106] In some embodiments, the cationic lipid has the formula I-g: [ka] or a pharmaceutically acceptable salt thereof, wherein each R L is independently C 8‐12 In some embodiments, each R L are independently n‐C8‐12 With alkyl In some embodiments, each R L is independently C 9‐11 It is an alkyl. In embodiments, each R L are independently n‐C 9‐11 In some embodiments, the alkyl group is methyl. So, each R L is independently C 10 In some embodiments, each R L is n- C 10 It is alkyl.

[0107] In certain embodiments, the provided liposomes contain the cationic lipid cKK-E12, Namely, (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)pipera) The structure of cKK-E12 is shown below: [ka]

[0108] In some embodiments, the one or more cationic lipids are N-[1-(2,3-diphenyl 2-methylpropional]- ... (oleyloxy)propyl]-N,N,N-trimethylammonium chloride, i.e. It could be "DOTMA" (Feigner et al.(Proc.Nat'l A cad.Sci.84,7413(1987);USPat.No.4,897,3 55) DOTMA can be formulated alone or in combination with a neutral lipid, dioleoyl diphosphatidylethanolamine or "DOPE" or other cationic or are combined with non-cationic lipids and placed into liposome delivery vesicles or lipid nanoparticles. Such liposomes can be used to enhance the delivery of nucleic acids to target cells. Other suitable cationic lipids include, for example, 5-carboxyspermylglycine diol. 2,3-Dioleyloxy-N-[2(spelling] amine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium, i.e. "DOSPA" (Behr et al. Proc.Nat.'l Acad.Sci .86,6982(1989);USPat.No.5,171,678;US Pat. No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium 1,2-dioleoyl-3-trimethylammonium propane or "DODAP" Examples include, but are not necessarily limited to, tetrahydrofuran-propane or "DOTAP" isn't it.

[0109] Further examples of cationic lipids include 1,2-distearyloxy-N,N-dimethyl -3-aminopropane or "DSDMA", 1,2-dioleyloxy-N,N-di Methyl-3-aminopropane or "DODMA", 1,2-dilinoleyloxy-N, N-dimethyl-3-aminopropane or "DLinDMA", 1,2-dilinolenyl Oxy-N,N-dimethyl-3-aminopropane or "DLenDMA", N-di- Dimethylammonium chloride (DODAC), N,N-di- Stearyl-N,N-dimethylammonium bromide or "DDAB", N-(1 ,2-Dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl Dimethylammonium bromide or "DMRIE", 3-dimethylamino-2-(cholesterol) cis-5-en-3-β-oxybutane-4-oxy)-1-(cis,cis-9,12 -octadecadienooxy)propane or "CLinDMA", 2-[5'-(cholesterol St-5-en-3-β-oxy)-3'-oxapentoxy)-3-dimethyl-1-(1-methyl-2-methyl-3-hydroxybenzoate) -(cis,cis-9',1-2'-octadecadienooxy)propane or "Cp LinDMA”, N,N-dimethyl-3,4-dioleyloxybenzylamine, i.e. "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropanol DOcarbDAP, 2,3-dilinoleoyloxy-N,N-dimethyl Propylamine or "DLinDAP", 1,2-N,N'-dilinoleylcarbamate DLincarbDAP, 1,2-diamino-3-dimethylaminopropane Leoylcarbamyl-3-dimethylaminopropane, or "DLinCDAP," 2, 2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane, or "D Lin-DMA, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]- Dioxolane, i.e., "DLin-K-XTC2-DMA", and 2-(2,2-di(( 9Z,12Z)-Octadeca-9,11-dien-1-yl)-1,3-dioxolane 4-yl)-N,N-dimethylethanamine (DLin-KC2-DMA) (WO20 10 / 042877;Semple et al.,Nature Biotech.2 8:172-176 (2010)), or a mixture thereof. es,J.,et al.,J Controlled Release 107:27 6‐287(2005);Morrissey,DV.,et al.,Nat.Bio technol.23(8):1003‐1007(2005);PCT Public In some embodiments, the cation One or more of the carboxylic lipids may contain an imidazole, dialkylamino, or guanidinium moiety. Including at least one of them.

[0110] In some embodiments, the one or more cationic lipids are XTC (2,2-dilinoleyl (Dilinoley) 1-4-dimethylaminoethyl-1-[1,3]-dioxolane ), MC3(((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28, 31-tetraen-19-yl 4-(dimethylamino)butanoate), ALNY-1 00((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)- Octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3 ]dioxol-5-amine)), NC98-5 (4,7,13-tris(3-oxo- 3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,1 3-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioyl- 3-dimethylammonium propane), HGT4003 (WO2012 / 170889, The contents of this document are incorporated herein by reference in their entirety), ICE (WO2011 / 068810, the contents of which are incorporated herein by reference in their entirety), HG T5000 (U.S. Provisional Patent Application No. 61 / 617,468, the contents of which are incorporated herein by reference in their entirety) incorporated herein by reference) or HGT5001 (cis or trans) (provisional) Patent application No. 61 / 617,468, and WO2010 / 053572. Such an amino alcohol lipidoid, DOTAP (1,2-dioleyl-3-trimethyl alcohol), ammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethyl ammonium propane), DLinDMA (Heyes, J.; Palmer, L.; B remner, K.; MacLachlan, I. “Cationic lipid s aturation influences intracellular deliv ery of encapsulated nucleic acids”J.Cont r.Rel.2005,107,276‐287), DLin‐KC2‐DMA(Sem ple,SCet al.“Rational Design of Cation ic Lipids for siRNA Delivery”Nature Biot ech.2010,28,172-176), C12-200(Love, KTet al.“Lipid‐like materials for low‐dose i n vivo gene silencing”PNAS 2010,107,1864 -1869).

[0111] In some embodiments, the percentage of cationic lipid in the liposome is greater than 10%, 20% It may be more than 30%, more than 40%, more than 50%, more than 60%, or more than 70%. In some embodiments, the cationic lipid(s) comprise about 30-50% of the liposome by weight. (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or In some embodiments, the cationic lipid (e.g., cKK -E12) is about 30%, about 35%, about 40%, about 45% of the liposomes in molar ratio, or It accounts for approximately 50%.

[0112] Non-cationic / Helper Lipids In some embodiments, the provided liposomes comprise one or more non-cationic ("heterocyclic" or "heterocyclic" liposomes). As used herein, the term "non-cationic lipid" refers to a , refers to any neutral, zwitterionic or anionic lipid. The term "anionic lipid" refers to an anionic lipid that has a net negative charge at a selected pH, e.g., physiological pH. Refers to any of a number of charged lipid species. Non-cationic lipids include distearoyl Phosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), Dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerin dipalmitoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), dioleyl Oil phosphatidylethanolamine (DOPE), palmitoyloleoyl phosphatidyl Phosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl) Dipalmitoyl)-cyclohexane-1-carboxylate (DOPE-mal), Phosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16‐O -monomethyl PE, 16-O-dimethyl PE, 18-1-trans-PE, 1-stearyl 2-oleoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or The examples include, but are not necessarily limited to, mixtures of

[0113] In some embodiments, such non-cationic lipids may be used alone, but are preferred. In some embodiments, the lipids are used in combination with other excipients, such as cationic lipids. The non-cationic lipids comprise about 5% to about 90%, or about 10%, of the total lipids present in the liposome. In some embodiments, the non-cationic lipid may comprise a molar ratio of from 10% to about 70%. Neutral lipids, i.e., lipids that have no net charge under the conditions in which the composition is formulated and / or administered, In some embodiments, the proportion of non-cationic lipids in the liposome is 5 %, more than 10%, more than 20%, more than 30%, or more than 40%.

[0114] Cholesterol-based lipids In some embodiments, provided liposomes contain one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include DC-Choi ( N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3- N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys.Res.Comm.179,280(1991);Wolf et a l. BioTechniques 23,139(1997);USPat.No 5,744,335), or ICE. The steroid lipids account for about 2% to about 30%, or about 5% to about 10%, of the total lipids present in the liposome. In some embodiments, the cholesterol in the lipid nanoparticles may comprise a molar ratio of about 20%. The percentage of roe-based lipids was greater than 5%, 10%, 20%, 30%, or 40%. That's fine.

[0115] PEGylated lipids In some embodiments, provided liposomes comprise one or more PEGylated lipids. For example, N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene Polyethylene glycol)-2000 (C8 PEG-2000 ceramide) Polyethylene glycol (PEG)-modified phospholipids and derivatized ceramides (PEG-CER) The derivatized lipid may be one or more cationic lipids, and in some embodiments, The present invention also contemplates the use of other lipids in combination to form liposomes. The expected PEG-modified lipids are those with chain lengths of C6 to C 20 and having alkyl chain(s) of Examples include polyethylene glycol chains of up to 5 kDa covalently attached to lipids, but In some embodiments, the present invention includes, but is not limited to, PEG-modified or PEGylated. The lipid is PEGylated cholesterol or PEG-2K. The addition of such components It may prevent complex aggregation, prolong circulation life, and improve delivery of lipid-nucleic acid complexes to target cells. Although this may provide a means of enhancing the delivery of compounds (Klibanov et al. (1990) FEBS Letters, 268(1):235‐237), or in vivo Ingredients may be selected to be readily exchanged from the formulation (see U.S. Pat. No. 5,885,616). (See No. 3).

[0116] In some embodiments, particularly useful exchangeable lipids are those with shorter acyl chains (e.g., C 14 or C 18 The PEG-modified phospholipids and The amount of the derivatized lipids is about 0% to about 15%, about 0.5% to about 15%, and about 0.5% to about 15%, of the total lipids present in the liposome. The molar ratio may be 15%, about 1% to about 15%, about 4% to about 10%, or about 2%.

[0117] According to various embodiments, lipid nanoparticles comprise cationic lipids, non-cationic lipids, and The selection of and / or PEG-modified lipids and the relative molar ratios of these lipids to each other depend on the selected lipids. Depending on the characteristics of the mRNA(s), the nature of the intended target cell, and the characteristics of the mRNA to be delivered Further considerations include, for example, the degree of saturation of the alkyl chain, as well as the selected lipid. These include the size, charge, pH, pKa, membrane fusogenicity, and toxicity of the protein(s). The molar ratio may be adjusted accordingly.

[0118] polymer In some embodiments, the polymer is used as a carrier alone or in combination with other polymers described herein. Suitable delivery vehicles are formulated using a variety of lipid-containing combinations with other carriers. Thus, in some embodiments, the liposome delivery vehicles used herein contain polymers. Suitable polymers include, for example, polyacrylates, poly Alkyl cyanoacrylate, polylactide, polylactide-polyglycolide copolymer , polycaprolactone, dextran, albumin, gelatin, alginate, collagen , chitosan, cyclodextrin, protamine, PEGylated protamine, PLL, PEGylated PLL and polyethyleneimine (PEI) may also be mentioned. When PEI is present, Branched PEI with a molecular weight in the range of 10 to 40 kDa, e.g., 25 kDa branched PEI (Sigma) #408727) etc.

[0119] Liposomes suitable for the present invention include those containing cationic lipids, non-cationic lipids, etc., as described herein. , cholesterol lipids, PEGylated lipids and / or polymers. As a non-limiting example, suitable liposome formulations may include cKK-E12 , DOPE, cholesterol and DMG-PEG2K; C12-200, DOPE, cholesterol Sterols and DMG-PEG2K; HGT4003, DOPE, cholesterol and D MG-PEG2K; or ICE, DOPE, cholesterol and DMG-PEG2K The invention may include a combination selected from the following:

[0120] In various embodiments, cationic lipids (e.g., cKK-E12, C12-200 , ICE, and / or HGT4003) constitute about 30 to 60% of the liposome (e.g., about 30-55%, approximately 30-50%, approximately 30-approximately 45%, approximately 30-40%, approximately 35-50%, In some embodiments, the molar ratio is about 35-45%, or about 35-40%. Cationic lipids (e.g., cKK-E12, C12-200, ICE, and / or HG T4003) is approximately 30%, approximately 35%, approximately 40%, approximately 45%, and approximately 50% of the liposomes. %, about 55%, or about 60% or more molar ratio.

[0121] In some embodiments, a cationic lipid(s) and a non-cationic lipid(s) and the ratio of cholesterol-based lipid(s) to PEGylated lipid(s) is about In some embodiments, the ratio may be 30-60:25-35:20-30:1-15. cationic lipid(s), non-cationic lipid(s), and cholesterol-based lipid The ratio of the lipid(s) to the PEGylated lipid(s) was approximately 40:30:20, respectively. In some embodiments, the cationic lipid(s) and the non-cationic lipid may be Cholesterol-based lipid(s), PEGylated lipid(s), and may be approximately 40:30:25:5, respectively. , cationic lipid(s), non-cationic lipid(s), and cholesterol-based lipid The ratio of (s) to PEGylated lipid(s) is approximately 40:32:25:3, respectively. In some embodiments, the cationic lipid(s) and the non-cationic lipid Ratio of lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s) may be approximately 50:25:20:5 respectively.

[0122] mRNA synthesis The mRNA according to the present invention may be synthesized according to any of a variety of known methods. For example, the mRNA according to the present invention may be synthesized by in vitro transcription (IVT). Briefly, IVT typically involves the transfection of a linear or circular DNA template containing a promoter, A pool of ribonucleotide triphosphates, DTT, and a buffer that may contain magnesium ions system, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase). polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitors The exact conditions will vary depending on the particular application.

[0123] In some embodiments, for the preparation of mRNA according to the present invention, a DNA template is prepared in A suitable DNA template is usually a promoter for in vitro transcription. For example, a T3, T7, or SP6 promoter is provided downstream of which the desired mRNA is expressed. The desired nucleotide sequence and termination signal.

[0124] The desired mRNA sequence(s) according to the present invention are determined using standard methods and analyzed by DNA sequencing. For example, starting with a desired amino acid sequence (e.g., an enzyme sequence), , a virtual back-translation is performed based on the degenerate genetic code. Then, an optimization algorithm is used to Appropriate codons may be selected, generally optimizing the G / C content while minimizing the possible On the other hand, the frequency of tRNAs is adjusted according to the codon usage frequency. The optimized RNA sequence can be displayed, for example, using a suitable display device. The secondary structure can be established and displayed using the By using this method, we can calculate the stabilizing and destabilizing properties of RNA, or the regions that correspond to each. It can also be done as follows.

[0125] modified mRNA In some embodiments, the mRNA according to the present invention is an unmodified mRNA or a modified mRNA. A can also be synthesized. Generally, mRNA is modified to increase stability. Modifications can include, for example, modifications of the nucleotides of the RNA. The modified mRNA may include, for example, backbone modifications, sugar modifications, or base modifications. In this state, mRNA is composed of natural nucleotides and / or nucleotide analogs (modified nucleotides). Examples of these include purines (adenine (A), guanine (G), and thiazolinone (TH). G) or pyrimidine (thymine (T), cytosine (C), uracil (U)), and modified nucleotide analogs or derivatives of purines and pyrimidines, e.g., 1 -methyladenine, 2-methyladenine, 2-methylthio-N-6-isopentenyladenylidene N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine , 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-di Aminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5 -uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5- carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl )-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethyl Aminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N -Uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5- Methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil uracil-5-oxyacetic acid methyl ester, uracil-5 -oxyacetic acid (v), 1-methyl-pseudouracil, queosine ), β-D-mannosylqueosine, Ibutoxocin, phosphoramidates, thiophosphates, peptides, and nucleotides , methylphosphonic acid, 7-deazaguanosine, 5-methylcytosine and inosine. The preparation of such analogs can be carried out by, for example, but not necessarily limited to, For example, U.S. Patent No. 4,373,071, U.S. Patent No. 4,401,796, U.S. Patent No. 4 ,415,732, U.S. Patent No. 4,458,066, U.S. Patent No. 4,500,707 No. 4,668,777, U.S. Patent No. 4,973,679, U.S. Patent No. 5 ,047,524, U.S. Patent No. 5,132,418, U.S. Patent No. 5,153,319 No. 5,262,530 and U.S. Pat. No. 5,700,642, those skilled in the art will appreciate No. 6,239,999, the disclosures of which are incorporated herein by reference in their entireties.

[0126] In some embodiments, the mRNA (e.g., the mRNA encoding GAA) In general, backbone modifications are modifications of the nucleosides contained in the RNA. The most common backbone modifications are as follows: Although not limited thereto, methylphosphonic acid group, methylphosphoramidic acid group, phosphoramidic acid group, acid group, phosphorothioate group (e.g., cytidine 5'-O-(1-thiophosphate) Modifications from the group consisting of boranophosphate, positively charged guanidinium groups, etc. This is because the phosphodiester bond can be substituted with other anionic, cationic or neutral groups. It means to replace.

[0127] In some embodiments, the mRNA (e.g., the mRNA encoding GAA) Sugar modifications may also be included. A typical sugar modification is a chemical modification of the sugar of a nucleotide, as follows: including, but not limited to, 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-de Oxyuridine 5'-triphosphate, 2'-deoxy-2'-deamine -Oligoribonucleotide (2'-amino-2'-deoxycytidine 5'-triphosphate, 2 '-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyl oligoribonucleotide Nucleotides, 2'-deoxy-2'-C-alkyl oligoribonucleotides (2'-O -methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C- Alkyl oligoribonucleotides and their isomers (2'-aracytidine 5'-triphosphates) phosphate, 2'-aruridine 5'-triphosphate), or triphosphate azide (2'-azido-2 '-Deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate and a sugar modification selected from the group consisting of:

[0128] In some embodiments, the mRNA (e.g., the mRNA encoding GAA) contains a nucleic acid sequence that encodes a nucleotide sequence. Modified nucleotides containing base modifications may also be included. are also called base-modified nucleotides. Examples of such base-modified nucleotides include: 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate Phosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thio Uridine 5'-triphosphate, 5-aminoallyl cytidine 5'-triphosphate, 5-aminoallyl Uridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5' -triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacytidine 6-azauridine 5'-triphosphate, 6-azauridine 5'-triphosphate, 6-chloropurine riboside 5' -triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate Acid, 8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzo Imidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1- Methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methyl Guanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5' Examples of suitable phosphates include, but are not necessarily limited to, xanthosine 5'-triphosphate or xanthosine 5'-triphosphate. It is not something that can be done.

[0129] Generally, mRNA synthesis involves the addition of a "cap" to the N-terminus (5') and a C-terminus (3'). The presence of a cap is a key feature of many eukaryotic cells. The presence of the "tail" is important in conferring resistance to exonuclease. It helps protect against degradation by sononuclease.

[0130] Thus, in some embodiments, mRNA (e.g., mRNA encoding GAA) A) contains a 5'-end cap structure. The 5'-end cap is generally added as follows: First, RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide. one is removed, leaving two terminal phosphate groups; then guanylyltransferase Guanosine triphosphate (GTP) is added to the terminal phosphate group to form a 5'5'5 triphosphate bond. and the nitrogen at position 7 of guanine is methylated by a methyltransferase. An example of a cap structure is m7G(5')ppp(5'(A,G(5')ppp(5 Examples include, but are not limited to, G(5')ppp(5')A and G(5')ppp(5')G. isn't it.

[0131] In some embodiments, the mRNA (e.g., the mRNA encoding GAA) is 3' The poly(A) tail at the 3' end of the mRNA generally contains approximately 10 to 300 adenosine nucleotides (SEQ ID NO: 4) (e.g., about 10 to 200 adenosines) adenosine nucleotides, approximately 10 to 150 adenosine nucleotides, approximately 10 to 100 adenosine nucleotides nucleotides, about 20 to 70 adenosine nucleotides, or about 20 to 60 adenosine nucleotides In some embodiments, the mRNA comprises a 3' poly(C) tail structure. A suitable poly-C tail at the 3' end of an mRNA generally contains about 10 to 200 cytosines. Nucleotide (SEQ ID NO: 5) (e.g., about 10 to 150 cytosine nucleotides ... 100 cytosine nucleotides, approximately 20-70 cytosine nucleotides, approximately 20-60 cytosine nucleotides The poly-C tail contains about 10 to 40 cytosine nucleotides. It may be added to or replace the polyA tail.

[0132] In some embodiments, the mRNA includes 5' and / or 3' untranslated regions. In some embodiments, the 5' untranslated region comprises a nucleotide sequence that affects mRNA stability or translation. In some embodiments, the 5 or more elements include iron-responsive elements. The untranslated region may be about 50 to 500 nucleotides in length.

[0133] In some embodiments, the 3' untranslated region contains one or more polyadenylation signals, m Binding sites for proteins that affect the intracellular stability of the RNA, or one or more mi In some embodiments, the 3' untranslated region comprises an RNA binding site. The chain length may be longer than that of leutide.

[0134] Cap Structure In some embodiments, the mRNA comprises a 5' end cap structure. The phosphatase is generally added as follows: first, an RNA terminal phosphatase amplifies the 5' nucleotide. One of the terminal phosphate groups is removed from the nucleotide, leaving two terminal phosphate groups; Nitrile transferase adds guanosine triphosphate (GTP) to the terminal phosphate group, 5'5'5 triphosphate bond; and methylation of the nitrogen at position 7 of guanine. An example of a cap structure is m7G(5')ppp( 5'(A, G(5')ppp(5')A and G(5')ppp(5')G However, the present invention is not necessarily limited to these.

[0135] The natural cap structure is attached to the 5' end of the primary transcribed nucleotide by a triphosphate bridge. It contains 7-methylguanosine, which is 7 G(5')ppp(5')N (N is arbitrary) In vivo, the enzyme caps The cap is added in the cell nucleus by the enzyme guanylyltransferase The addition of a cap to the 5' end of RNA occurs immediately after transcription initiation. The terminal nucleoside is usually guanosine and is reversed relative to all other nucleotides, i.e. That is, G(5')ppp(5')GpNpNp.

[0136] The general mRNA cap produced by in vitro transcription is m 7 G(5')ppp (5')G, which is the cleavage site of the T7 or SP6 RNA polymerase in vitro. In the transcription by enzyme, dinucleotides are synthesized to obtain RNA with a cap structure at the 5' end. The capped mRNA has been synthesized in vitro. The most common method for forming the methyl methyl acrylate is to use a preformed m 7 G(5')ppp(5')G("m 7 G pppG) type dinucleotides are used as transcription initiation factors.

[0137] To date, the typical synthetic dinucleotide caps used in in vitro translation experiments are , anti-reverse cap analogs ("ARCAs") or modified ARCAs, commonly and modified cap analogs in which the OH group at the 2' or 3' position is replaced with -OCH3. be.

[0138] As a further cap analogue, m 7 GpppG, m 7 GpppA, m 7 GpppC a chemical structure selected from the group consisting of: a non-methylated cap analog (e.g., GpppG ); dimethylated cap analogs (e.g., m 2,7 GpppG), trimethylated capsid analog (e.g., m 2,2,7 GpppG), a symmetrically dimethylated cap analog (e.g., m 7 Gpppm 7 G), or anti-reverse cap analogs (e.g., A RCA;m 7,2’Ome GpppG, m 72’d GpppG, m 7,3’Ome Gpp pG, m 7,3’d GpppG and their tetraphosphate derivatives) (e.g., Jemieli ty, J. et al., “Novel 'anti‐reverse' cap an alogs with superior translational proper ties”, RNA, 9:1108-1122 (2003) are examples of However, the present invention is not limited to these.

[0139] In some embodiments, a suitable cap comprises a triplylamine cap at the 5' end of the primary transcribed nucleotide. 7-methylguanylic acid ("m") is linked by a phosphate bridge. 7 G"), which is m 7 In an embodiment of the present invention, the nucleoside is G(5')ppp(5')N (N is any nucleoside). Used in conjunction with m 7 The preferred embodiment of the G-cap is m 7 G(5')ppp(5')G .

[0140] In some embodiments, the cap is a Cap0 structure. The Cap0 structure includes base 1 and there is no 2'-O-methyl residue of the ribose attached to 2. The cap is a Cap1 structure. The Cap1 structure has a 2'-O-methyl residue at base 2. In some embodiments, the cap is a Cap2 structure. Both 2 and 3 have 2'-O-methyl residues attached.

[0141] A wide variety of m 7 G-cap analogs are known in the art, many of which are commercially available. These include the above m 7 GpppG and ARCA3'-OCH3 and 2 '-OCH3 cap analogues (Jemielity, J. et al., R NA, 9:1108-1122 (2003)). As a dinucleoside analog, N7-benzylated dinucleoside tetraphosphate analog (Grudzi en, E. et al., RNA, 10: 1479-1487 (2004)), Phosphate cap analogs (Grudzien-Nogalska, E., et al., RNA, 13:1745-1755 (2007)), and U.S. Pat. Cap analogs (biotins) described in US Pat. Nos. 8,093,367 and 8,304,529 and substituted cap analogs), the disclosures of which are incorporated herein by reference. do.

[0142] Tail Structure In general, the presence of a "tail" protects the mRNA from exonucleolytic degradation. The poly(A) tail stabilizes natural messenger and synthetic sense RNA. Therefore, in one embodiment, a long polyA tail is added to the mRNA fragment. The poly(A) tail can be added to the molecule, thereby making the RNA more stable. These can be added using a wide variety of techniques recognized in the art. For example, synthetic R A long poly(A) fragment is generated using poly(A) polymerase on RNA or in vitro transcribed RNA. A tail can be added (Yokoe, et al. Nature Biotech 1996;14:1252-1256). Additionally, the polyA tail can be directly transcribed from the PCR product. The polyA can be added to the sense RNA using RNA ligase. It may be linked to the 3' end (e.g., Molecular Cloning A Lab oratory Manual,2nd Ed.,ed.by Sambrook,Fr. itsch and Maniatis(Cold Spring Harbor La (See International Journal of Clinical Nursing, Vol. 1, No. 1, pp. 1991-1992).

[0143] In some embodiments, the mRNA comprises a 3' poly(A) tail structure. The length of the poly-A tail may be at least about 10, 50, 100, 200, 300, 400, or less. In some embodiments, the mR The poly(A) tail at the 3' end of the nucleic acid is generally about 10 to 300 adenosine nucleotides. 4) (e.g., about 10 to 200 adenosine nucleotides, about 10 to 150 adenosine nucleotides) adenosine nucleotides, approximately 10-100 adenosine nucleotides, approximately 20-70 adenosine nucleotides adenosine nucleotides, or about 20 to 60 adenosine nucleotides). In this form, mRNA contains a 3' poly(C) tail structure. A suitable poly-C tail generally contains about 10 to 200 cytosine nucleotides (SEQ ID NO: 5) For example, about 10 to 150 cytosine nucleotides, about 10 to 100 cytosine nucleotides, about 20 to 70 cytosine nucleotides, about 20 to 60 cytosine nucleotides, or about 10 A poly-C tail may be added to the poly-A tail. , or may be replaced with a polyA tail.

[0144] In some embodiments, the length of the polyA tail or polyC tail is adjusted to achieve the desired results. Modification of the sense mRNA molecule regulates its stability, thereby regulating protein transcription. For example, the length of the poly(A) tail affects the half-life of the sense mRNA molecule. The length of the A-tail can be adjusted to alter the nuclease resistance of the mRNA, thereby enhancing its ability to target cells. The present invention provides a method for controlling the time course of polynucleotide expression and / or polypeptide production in cells. This can be done.

[0145] 5' and 3' untranslated regions In some embodiments, the mRNA includes 5' and / or 3' untranslated regions. In some embodiments, the 5' untranslated region affects mRNA stability or translation. In some embodiments, the nucleic acid sequence includes one or more elements, such as an iron-responsive element. The 5' untranslated region may be approximately 50 to 500 nucleotides in length.

[0146] In some embodiments, the 3' untranslated region contains one or more polyadenylation signals, m Binding sites for proteins that affect the intracellular stability of the RNA, or one or more mi In some embodiments, the 3' untranslated region comprises an RNA binding site. The chain length may be longer than that of leutide.

[0147] Exemplary 3' and / or 5' UTR sequences are suitable for translating stable mRNA molecules (e.g., globin , actin, GAPDH, tubulin, histones, or enzymes of the citric acid cycle) This can increase the stability of the sense mRNA molecule. For example, it can increase nuclease resistance. and / or to improve the half-life of the polynucleotide, the 5'UTR sequence may be modified to include the CMV first It is also contemplated that the present invention may include a partial sequence of the IE1 gene, or a fragment thereof. For further stabilization of the polynucleotide, a polynucleotide encoding human growth hormone (hGH) is used. The sequence, or a fragment thereof, may be attached to the 3' end or non-end of a polynucleotide (e.g., mRNA). In general, these modifications improve the stability of the polynucleotide. The activity and / or pharmacokinetic properties (e.g., half-life) of the modified polynucleotide are improved compared to unmodified polynucleotides. However, these modifications may also occur, for example, in vivo nucleic acid sequences of such polynucleotides. This includes modifications made to improve resistance to digestion by enzymes.

[0148] Liposome formation Liposomal delivery vehicles for use in the compositions of the present invention are those currently known in the art. Liposomes for use in the provided compositions can be prepared by a variety of techniques. These can be prepared by a variety of techniques currently known in the art. the lipid to adhere to the interior walls of a suitable container or vessel, and then The solution is evaporated to dryness, leaving a thin film on the inside of the container, or spray-dried according to conventional techniques. Multilamellar liposomes (MLVs) may be prepared by vortexing the container. An aqueous phase may be added to both, thereby forming MLVs. Form unilamellar liposomes (ULV) by homogenization, sonication, or extrusion. Furthermore, it is possible to form unilamellar liposomes by the surfactant removal method. Cut.

[0149] In some embodiments, the provided compositions comprise liposomes, wherein the mRNA is encapsulated in the liposomes. The liposomes of the present invention are encapsulated in the same liposome. During preparation of the composition, cationic liposomes are associated with mRNA through electrostatic interactions. For example, during the preparation of the compositions of the present invention, cationic liposomes may be subjected to electrostatic interactions. Therefore, it may be associated with mRNA.

[0150] In some embodiments, the compositions and methods of the present invention involve encapsulating mRNA within liposomes. In some embodiments, more than one mRNA species may be encapsulated within the same liposome. In some embodiments, one or more mRNAs may be present in different liposomes. In some embodiments, the lipid composition, the molar ratio of lipid components, the size, One or more liposomes differing in charge (zeta potential), targeting ligand, and / or combination thereof. In some embodiments, the one or more liposomes contain mRNA. The compositions of thioic lipids, neutral lipids, PEG-modified lipids and / or their combinations are different. In some embodiments, one or more liposomes may be prepared using the same or similar method as used to prepare the liposomes. The molar ratios of cationic lipids, neutral lipids, cholesterol, and PEG-modified lipids were varied. It's fine.

[0151] The process of incorporating the desired mRNA into liposomes is often called "loading." See, for example, Lasic, et al., FEBS Lett., 312:255-258, 1 992, which is incorporated herein by reference. The incorporated nucleic acid may be located completely or partially in the interior space of the liposome or may be embedded in the liposome bilayer. The nucleic acid may be located within the liposome membrane or associated with the outer surface of the liposome membrane. Incorporation into a liposome is also referred to herein as "encapsulation," where the nucleic acid is incorporated in its entirety into a liposome. The mRNA is contained within the internal space of the membrane. The target is enzymes or chemicals that degrade nucleic acids, and / or systems that rapidly excrete nucleic acids. Or, it is often to protect the nucleic acid from an environment that may contain receptors. In some embodiments, a suitable delivery vehicle may enhance the stability of the mRNA it carries. and / or can facilitate delivery of mRNA to target cells or tissues.

[0152] Liposome size Suitable liposomes of the present invention may be produced in a variety of sizes. The provided liposomes may be smaller than previously known mRNA-encapsulating liposomes. In some embodiments, reduced liposome size is associated with higher efficiency of mRNA delivery. The selection of the appropriate size of liposomes depends on the location of the target cell or tissue, and To some extent, the use for which the liposomes are produced may also be taken into consideration.

[0153] In some embodiments, liposomes of appropriate size are selected to allow for the formation of the mRNA encoding In some embodiments, the targeting of mRNA to specific cells or tissues is facilitated by the systemic distribution of the antibody. It may be desirable to limit transfection of NAs, e.g., to target hepatocytes. The liposomes are then mixed so that their size is smaller than the pores in the endothelial cell layer of the liver sinusoidal lining. In such cases, the liposomes may be sized to penetrate into such endothelial cells. It is believed that the vesicles can easily pass through the small holes in the liver and reach the target liver cells.

[0154] Alternatively or additionally, liposomes can be engineered to restrict or limit delivery to specific cells or tissues. or to have a liposome large enough in diameter to clearly avoid For example, the size of the liposome may be made larger than the pores of the endothelial cell layer of the liver sinusoidal lining. The liposomes may be sized to limit their distribution to hepatocytes.

[0155] In some embodiments, the size of the liposome is determined by the longest diameter of the liposome particle. In some embodiments, suitable liposomes are about 250 nm or less in size (e.g., For example, approximately 225 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, In some embodiments, suitable liposomes are The size ranges from about 10 to 250 nm (e.g., about 10 to 225 nm, 10 to 200 nm) , 10~175nm, 10~150nm, 10~125nm, 10~100nm, 10~ In some embodiments, a suitable liposome is The size of the spherosomes ranges from about 100 to 250 nm (e.g., about 100 to 225 nm, 10 0-200nm, 100-175nm, 100-150nm range). In embodiments, suitable liposome sizes range from about 10 to 100 nm (e.g., about 1 0~90nm, 10~80nm, 10~70nm, 10~60nm, or 10~50nm In certain embodiments, suitable liposomes have a size of less than about 100 nm. It has the capabilities.

[0156] A variety of alternative methods known in the art are available for controlling the size of the liposome population. Such size control methods are described in U.S. Pat. No. 4,737,323 and previously The above-mentioned documents are incorporated herein by reference. When sonicated, the particles are gradually reduced in size to small particles less than about 0.05 μm in diameter. The homogenization method uses shear energy to break down large liposomes into smaller ones. A typical homogenization procedure involves mixing MLVs with standard emulsions. Pass the liposomes through a homogenizer to separate them into the desired size, typically about 0.1-0.5 μm. The liposomes are recycled until they are obtained. The size of the liposomes is determined by the method of Bloomfield, A nn.Rev.Biophys.Bioeng.,10:421‐150(1981) It may be measured by quasi-elastic light scattering (QELS) as described in, see above. The average liposome size was determined by sonicating the formed liposomes. The diameter of the tube can be small. Intermittent sonication cycles are alternated with QELS assessment to determine the effectiveness of the Liposomes may also be synthesized efficiently.

[0157] Pharmaceutical Composition To promote mRNA expression in vivo, delivery vehicles such as liposomes are used. In combination with or as appropriate one or more additional nucleic acids, carriers, targeting ligands or stabilizing agents. The drug can be formulated into a pharmaceutical composition mixed with appropriate excipients. The method of administration is described in "Remington's Pharmaceuticals Sciences,” Mack Publishing Co., Easton, Pa. .,latest edition.

[0158] The provided liposome-encapsulated or -associated mRNA and compositions containing the same are The clinical condition of the subject, the administration site and method, the administration schedule, and the subject's age, sex, weight, etc. The dosage may be administered and taken in accordance with current medical practice, taking into account factors relevant to the clinical practice. For purposes of this specification, an "effective amount" is defined as an amount determined by pilot clinical studies, pharmacological, clinical, and medical experts. The dosage may be determined taking into account relevant factors well known to those skilled in the art. Symptoms and other indicators selected by one of skill in the art as appropriate measures of disease progression, regression, or improvement. are effective in achieving at least some stabilization, improvement, or elimination of Suitable amounts and administration regimens are those that produce a protein (e.g., an enzyme) at least transiently. This is a regimen that

[0159] Suitable routes of administration include, for example, oral, enteral, vaginal, transmucosal, intratracheal, or inhalation. administration by pulmonary or enteral route; non-administration by intradermal, transdermal (topical), intramuscular, subcutaneous, or intramedullary injection Oral delivery, as well as parenteral delivery, including intrathecal, direct intraventricular, intravenous, intraperitoneal, or intranasal. In certain embodiments, intramuscular administration includes delivery to muscles including skeletal, smooth, and cardiac muscles. In some embodiments, the administration is to a muscle selected from the group consisting of muscle cells. In some embodiments, the administration results in delivery of mRNA to hepatocytes (i.e., In certain embodiments, intramuscular administration results in delivery of mRNA to muscle cells. This results in delivery of mRNA to the vesicle.

[0160] Alternatively or additionally, liposome-encapsulated mRNA and compositions of the invention can be administered systemically. The pharmaceutical composition is administered locally, for example, by direct injection into the target tissue, preferably in a sustained release formulation. Local delivery can be achieved in a variety of ways depending on the target tissue. For example, aerosols containing the compositions of the present invention can be inhaled (intranasally). , transtracheal, or transbronchial delivery); the compositions of the present invention can be delivered to, for example, the site of injury, the site of disease manifestation, The composition may be administered orally, tracheally, or esophageally. For administration to the stomach or intestines, the composition may be provided as a liquid. , which can be supplied in tablet or capsule form, and in suppository form for rectal or vaginal application. or the composition can even be delivered to the eye, in which case the It can also be delivered by the use of a steroid, eye drops, or injection. Formulations containing the complexed compositions provided can also be administered via surgical procedures, e.g., A polymer or other structure that allows the composition to diffuse from the implantation site to surrounding tissue. They can be administered in association with a polymer or substance. It can be applied in a surgical procedure with or without a support.

[0161] The methods provided herein include administering a therapeutic agent described herein (e.g., a compound that encodes a GAA protein). Therapeutic efficacy is anticipated through single and multiple administrations of therapeutically effective amounts of the mRNA encoding the therapeutic agent. Therapeutic drugs may be administered for a period of time depending on the nature, severity, and extent of the subject's condition (e.g., Pompe disease). In some embodiments, the therapeutic agents of the present invention (e.g., GAA protein) can be administered at intervals. A therapeutically effective amount of mRNA encoding the protein is administered intrathecally at regular intervals. may be used (e.g., once a year, once every six months, once every five months, once every three months, every other month (2 or Once a month), every month (once a month), every other week (once every two weeks), twice a month, once on the 30th, on the 28th once every 14 days, once every 10 days, once every 7 days, weekly, twice a week, consecutive days or continuously) .

[0162] In some embodiments, the liposomes and / or compositions provided herein are The mRNA is formulated to provide a sustained release. Such sustained release compositions are administered at intervals of 10 minutes. For example, in one embodiment, the present invention The composition is administered to the subject twice daily, either on consecutive days or on alternate days. Ming's composition is administered twice a week, once a week, once every 7 days, once every 10 days, once every 14 days, once every 28 days. once every 30 days, once every two weeks, once every three weeks, or more preferably, once every four weeks. Once a month, twice a month, once every 6 weeks, once every 8 weeks, once every 2 months, once every 3 months, 4 Administered to subjects once a month, once every six months, once every eight months, once every nine months, or annually Depot administration (e.g., intramuscular injection) is used to deliver or release mRNA over a long period of time. Also contemplated are compositions and liposomes formulated for intramuscular administration (intramuscular, subcutaneous, intravitreal). The sustained release means used is combined with modifications made to enhance mRNA stability.

[0163] As used herein, the term "therapeutically effective amount" refers primarily to the amount of a pharmaceutical composition of the present invention that is The therapeutically effective amount is determined based on the total amount of the therapeutic agent contained. Generally, a therapeutically effective amount is determined based on the total amount of the therapeutic agent contained. achieve a meaningful benefit (e.g., treatment, modulation, cure, prevention, and / or amelioration of Pompe disease) For example, a therapeutically effective amount is sufficient to achieve the desired therapeutic and / or prophylactic effect. Generally, the therapeutic agent administered to a subject in need of treatment is The amount of GAA (e.g., mRNA encoding the GAA protein) varies depending on the characteristics of the subject. Such characteristics may vary depending on the subject's condition, severity of the disease, general health, age, Those skilled in the art will be able to determine the appropriate dosage depending on these and other relevant factors. Furthermore, objective and subjective assessment methods may be used as an option. The optimal dosage range may be identified by the above method.

[0164] A therapeutically effective amount is generally administered in a dosing regimen that may include multiple unit doses. For any particular therapeutic protein, the therapeutically effective amount (and / or effective dosing regimen) is The appropriate unit dose (within the range) varies depending on, for example, the route of administration and the combination with other pharmaceutical preparations. Also, the specific therapeutically effective amount (and / or The unit dose will depend on the disorder being treated and the severity of that disorder; the activity of the particular formulation being used; the particular composition of the patient; the patient's age, weight, general health, sex and diet; the particular type of time of administration, route of administration, and / or rate of excretion or metabolism of the protein; duration of treatment; etc. and will depend on a variety of factors, including similar factors well known in the medical field.

[0165] In some embodiments, the therapeutically effective amount is from about 0.005 mg / kg body weight to 500 mg / kg body weight. kg body weight range, e.g., about 0.005 mg / kg body weight to 400 mg / kg body weight, about 0. 005mg / kg body weight~300mg / kg body weight, about 0.005mg / kg body weight~200m g / kg body weight, about 0.005mg / kg body weight~100mg / kg body weight, about 0.005mg / kg body weight ~ 90mg / kg body weight, approximately 0.005mg / kg body weight ~ 80mg / kg body weight, About 0.005mg / kg body weight~70mg / kg body weight, about 0.005mg / kg body weight~60 mg / kg body weight, about 0.005mg / kg body weight~50mg / kg body weight, about 0.005mg / kg body weight ~ 40mg / kg body weight, approximately 0.005mg / kg body weight ~ 30mg / kg body weight, About 0.005mg / kg body weight~25mg / kg body weight, about 0.005mg / kg body weight~20 mg / kg body weight, about 0.005mg / kg body weight~15mg / kg body weight, about 0.005mg / kg body weight to 10mg / kg body weight.

[0166] In some embodiments, the therapeutically effective amount is greater than about 0.1 mg / kg body weight, greater than about 0.5 mg / kg body weight, >kg body weight, approximately 1.0 mg / kg body weight, approximately 3 mg / kg body weight, approximately 5 mg / kg body weight , more than about 10 mg / kg body weight, more than about 15 mg / kg body weight, more than about 20 mg / kg body weight, about 30 More than mg / kg body weight, about 40 mg / kg body weight, about 50 mg / kg body weight, about 60 mg / k More than g body weight, more than about 70 mg / kg body weight, more than about 80 mg / kg body weight, more than about 90 mg / kg body weight , more than about 100 mg / kg body weight, more than about 150 mg / kg body weight, more than about 200 mg / kg body weight, More than about 250 mg / kg body weight, more than about 300 mg / kg body weight, more than about 350 mg / kg body weight, about More than 400 mg / kg body weight, more than about 450 mg / kg body weight, and more than about 500 mg / kg body weight In certain embodiments, the therapeutically effective amount is 1.0 mg / kg. A therapeutically effective amount of 1.0 mg / kg is administered intramuscularly or intravenously.

[0167] Provided herein are lyophilized pharmaceutical compositions comprising one or more liposomes disclosed herein, and, for example, U.S. Provisional Application No. 2004 / 002999 filed June 8, 2011, relating to the use of such compositions. The method disclosed in application Ser. No. 61 / 494,882 is also contemplated, and the description of said document is incorporated herein by reference. The lyophilized pharmaceutical compositions of the present invention are described in, for example, US Pat. The formulation may be reconstituted prior to administration or may be reconstituted in vivo. For example, the lyophilized pharmaceutical composition can be applied to an appropriate dosage form (e.g., intradermal, such as a disk, rod, or membrane). The individual's body fluids determine the dosage form in vivo over time. can be rehydrated to

[0168] The provided liposomes and compositions may be administered to any desired tissue. In embodiments, the GAA mRNA delivered in the provided liposomes or compositions is In some embodiments, the IL-17 domain is expressed in the tissue to which the IL-17 domain and / or composition is administered. The delivered mRNA is expressed in a tissue different from the tissue to which the liposome and / or composition was administered. Exemplary tissues to which the delivered mRNA may be delivered and / or expressed include the liver. These include liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid. However, the present invention is not limited to these.

[0169] In some embodiments, administration of a provided composition results in a detection of G in a biological sample from a subject. AA mRNA expression levels are elevated compared to baseline expression levels before treatment. Baseline levels are usually measured immediately before treatment. Examples of biological samples include whole blood, serum, Examples include plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administration of a provided composition results in a significant increase in GAA mRNA expression levels immediately after treatment. At least approximately 10%, 20%, 30%, or 40% compared to the previous baseline expression level , 50%, 60%, 70%, 80%, 90%, or 95% increase. In some embodiments, administration of a provided composition results in a GAA mRNA expression level that is higher than that of an untreated subject. It is elevated compared to GAA mRNA expression levels.

[0170] According to the present invention, when a therapeutically effective amount of the provided composition is administered periodically, the liver GAA of a subject is reduced. Protein levels were elevated compared to baseline liver GAA protein levels before treatment. In some embodiments, when a therapeutically effective amount of a provided composition is administered periodically, the subject Muscle GAA protein levels were significantly higher than baseline muscle GAA protein levels before treatment. In some embodiments, the muscle is a skeletal muscle (e.g., striated muscle, voluntary muscle), In some embodiments, the muscle is smooth muscle (e.g., visceral muscle, involuntary muscle) or cardiac muscle. When a therapeutically effective amount of the composition is administered regularly, the subject's serum creatine kinase level creatine kinase levels compared to pre-treatment baseline levels. In one embodiment, when a therapeutically effective amount of the provided composition is administered periodically, the urinary glucose concentration in a subject is reduced. Glycosylation (Glcα1‐6Glcα1‐4Glcα1‐4Glc or Glc4) levels were measured In some embodiments, the Glc4 levels are reduced compared to baseline Glc4 levels before treatment. When a therapeutically effective amount of the composition is administered periodically, the serum aspartate transaminase level in the subject is increased. Enzymes (e.g., AST, aspartate aminotransferase, serum, glutamine AST levels were compared with baseline AST levels before treatment. In some embodiments, the therapeutically effective amount of a provided composition is administered periodically. If so, the subject's serum alanine transaminase (e.g., ALT, alanine aminotransferase) Serum glutamic pyruvic transaminase (GPT) levels were In some embodiments, the ALT level of a provided composition is reduced relative to baseline ALT levels. When administered regularly, a therapeutically effective amount can reduce a subject's serum lactate dehydrogenase (e.g., LD Lactate dehydrogenase (LDH) levels were lower than baseline LDH levels before treatment. In some embodiments, when a therapeutically effective amount of a provided composition is administered periodically, the patient GAA enzyme activity levels in subject-derived biological samples were compared to baseline GAA enzyme activity levels before treatment. Increased compared to the basic activity level.

[0171] In some embodiments, administration of a provided composition results in an increase in liver GAA protein levels in a subject. The level of steroids increases compared to the baseline level before treatment. In some embodiments, administration of a provided composition results in liver GAA protein levels. Protein levels should be increased by at least approximately 10%, 20%, or 3% compared to pre-treatment baseline levels. Increase by 0%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, administration of provided compositions results in hepatic GAA protein levels that are higher than those of untreated elevated relative to the subject's liver GAA protein levels.

[0172] In some embodiments, administration of a provided composition results in an increase in skeletal muscle GAA protein in a subject. Levels are elevated compared to baseline levels before treatment. Baseline levels are usually In some embodiments, administration of a provided composition results in an increase in skeletal muscle GA. A protein level is increased by at least about 10%, 2% or more compared to pre-treatment baseline levels. Increase by 0%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% In some embodiments, administration of a provided composition results in an increase in skeletal muscle GAA protein levels. is elevated compared to skeletal muscle GAA protein levels in untreated subjects.

[0173] In some embodiments, administration of a provided composition results in an increase in myocardial GAA protein levels in a subject. The level is elevated compared to the baseline level before treatment. In some embodiments, administration of a provided composition results in myocardial GAA titers. Protein levels are at least approximately 10% to 20% higher than pre-treatment baseline levels , 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% increase. In some embodiments, administration of provided compositions results in myocardial GAA protein levels increasing to levels below those of untreated controls. Increased relative to myocardial GAA protein levels in treated subjects.

[0174] In some embodiments, administration of a provided composition results in an increase in smooth muscle GAA protein in a subject. levels increase compared to baseline levels before treatment. is measured immediately prior to treatment. In some embodiments, administration of provided compositions results in smooth muscle G AA protein levels increased by at least approximately 10% compared to pretreatment baseline levels; 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% increase In some embodiments, administration of a provided composition results in an increase in smooth muscle GAA protein levels. The level of smooth muscle GAA protein is elevated compared to that of untreated subjects.

[0175] In some embodiments, administration of a provided composition results in intramuscular GAA protein expression in a subject. Increased protein levels compared to baseline levels before treatment. In some embodiments, the muscle cells are myocytes, myotubes, myoblasts, or the like. In some embodiments, the administration of a provided composition comprises administering a As a result, intracellular GAA protein levels were significantly reduced compared to baseline levels before treatment. At least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% In some embodiments, administration of a provided composition results in an increase in muscle cell Intramuscular GAA protein levels are compared to intramuscular GAA protein levels in untreated subjects. All of them will rise.

[0176] In some embodiments, administration of a provided composition results in the proliferation of liver cells (e.g., hepatocytes) in a subject. Intracellular GAA protein levels are elevated compared to baseline levels before treatment. In some embodiments, the baseline level is measured immediately prior to treatment. As a result of treatment, GAA protein levels in liver cells increased compared to baseline levels before treatment. ,at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 9 In some embodiments, administration of a provided composition results in a liver Intracellular GAA protein levels are compared to liver intracellular GAA protein levels in untreated subjects. rises compared to

[0177] In some embodiments, administration of a provided composition results in a decrease in GA in the plasma or serum of a subject. Protein A levels increase compared to baseline levels before treatment. In some embodiments, the level of IL-1 is measured immediately prior to treatment. , plasma or serum GAA protein levels compared to baseline levels before treatment ,at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 9 In some embodiments, administration of a provided composition results in a plasma or serum GAA protein levels are higher than those of untreated subjects in plasma or serum GAA elevated relative to protein levels.

[0178] In some embodiments, administration of a provided composition results in an increase in serum creatine kinase in a subject. levels decrease compared to baseline levels before treatment. Baseline levels are usually In some embodiments, administration of a provided composition results in serum clearance. Creatine kinase levels were significantly higher than baseline serum creatine kinase levels immediately before treatment. and at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, In some embodiments, administration of a provided composition results in a decrease in blood cholesterol levels by 90%, or 95%. Serum creatine kinase levels were approximately 2000 IU / L, 1500 IU / L, and 1000 IU. / L, 750IU / L, 500IU / L, 250IU / L, 100IU / L, 90IU / 1, 80 IU / L, 70 IU / L, or even to less than 60 IU / L. In embodiments, administration of provided compositions results in serum creatine kinase levels that are higher than those of untreated subjects. The subject's serum creatine kinase level is decreased relative to the level of the creatine kinase.

[0179] In some embodiments, administration of a provided composition results in a subject's urinary Glc4 level: Decreased compared to pre-treatment baseline levels. Baseline levels are usually measured immediately before treatment. In some embodiments, administration of a provided composition results in urinary Glc4 levels , at least about 10%, 20%, 30%, 40% or more compared to the baseline level immediately before treatment %, 50%, 60%, 70%, 80%, 90%, or 95% reduction. In some embodiments, administration of the provided compositions results in urinary Glc4 levels of about 100 mmol Glc 4 / mol creatinine, 90mmol Glc4 / mol creatinine, 80mmol Glc4 / mol creatinine, 70mmol Glc4 / mol creatinine, 60 mmol Glc4 / mol creatinine, 50mmol Glc4 / mol creatinine 40mmol Glc4 / mol creatinine, 30mmol Glc4 / mol creatinine or to less than 20 mmol Glc4 / mol creatinine. In some embodiments, administration of provided compositions results in urinary Glc4 levels that are higher than those of untreated subjects. The body's urinary Glc4 levels are reduced compared to

[0180] In some embodiments, administration of a provided composition results in muscle glycogen levels in a subject. , which is reduced compared to the baseline level before treatment. In some embodiments, muscle glycogen levels are measured as a result of administration of provided compositions. The level of serotonin levels is at least approximately 10%, 20%, 30%, or 40% higher than the baseline level immediately before treatment. 40%, 50%, 60%, 70%, 80%, 90%, or 95% decrease. In embodiments, administration of provided compositions results in muscle glycogen levels greater than or equal to those of an untreated subject. In certain embodiments, the muscle is a skeletal muscle, a smooth muscle, or or cardiac muscle.

[0181] In some embodiments, administration of a provided composition results in liver glycogen levels in a subject The baseline level is usually lower than the baseline level immediately after treatment. In some embodiments, liver glycogen levels are measured prior to administration of a provided composition. The level of serotonin levels is at least approximately 10%, 20%, 30%, or 40% higher than the baseline level immediately before treatment. 40%, 50%, 60%, 70%, 80%, 90%, or 95% decrease. In embodiments, administration of a provided composition results in liver glycogen levels that are higher than those of an untreated subject. It decreases relative to glycogen levels.

[0182] In some embodiments, administration of provided compositions results in an increase in serum aspartate levels in a subject. AST levels are reduced compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. As a result of administration of AST, serum AST levels increased by at least 10% compared to baseline levels immediately before treatment. Also about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, In some embodiments, administration of provided compositions results in a 95% reduction in serum AST levels. The levels are approximately 600IU / L, 500IU / L, 400IU / L, 300IU / L, and 200IU / L. U / L, 100IU / L, 50IU / L, 25IU / L, 20IU / L or 10IU / In some embodiments, administration of a provided composition results in a decrease in serum AST to less than 1 L. The levels are reduced relative to serum AST levels in untreated subjects.

[0183] In some embodiments, administration of a provided composition results in an increase in serum alanine transamination in a subject. ALT levels decrease compared to baseline levels before treatment. The baseline level is measured immediately prior to treatment. In some embodiments, administration of a provided composition As a result, serum ALT levels increased by at least approximately 1% compared to baseline levels immediately before treatment. 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95 In some embodiments, administration of a provided composition results in a decrease in serum ALT levels of: Approximately 1000IU / L, 900IU / L, 800IU / L, 700IU / L, 600IU / L, 500IU / L, 400IU / L, 300IU / L, 200IU / L, 100IU / to <10 IU / L, 50 IU / L, 25 IU / L, 20 IU / L, or <10 IU / L In some embodiments, administration of provided compositions results in serum ALT levels that are higher than those of untreated subjects. The serum ALT level of the subject is decreased relative to the serum ALT level.

[0184] In some embodiments, administration of a provided composition results in an increase in serum lactate dehydrogenase levels in a subject. LDH levels decrease compared to baseline levels before treatment. In some embodiments, the level of IL-1 is measured immediately prior to treatment. , serum lactate dehydrogenase (LDH) levels compared to baseline levels immediately before treatment At least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 %, or 95% reduction. In some embodiments, administration of a provided composition results in a serum L DH levels are approximately 2000 IU / L, 1500 IU / L, 1000 IU / L, and 900 IU. / L, 800IU / L, 700IU / L, 600IU / L, 500IU / L, 400IU / L, 300 IU / L, 200 IU / L, or less than 100 IU / L. In some embodiments, administration of provided compositions results in serum LDH levels that are higher than those of an untreated subject. It is decreased compared to serum LDH levels.

[0185] In some embodiments, administration of a provided composition results in a detection of G in a biological sample from a subject. AA enzyme activity is elevated compared to pre-treatment baseline levels. The level is measured immediately before treatment. Examples of biological samples include whole blood, serum, plasma, and urine. and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administration of a provided composition results in an increase in GAA enzyme activity to a baseline level immediately prior to treatment. Compared to at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% %, 90%, or 95% increase in the level of IL-16, IL-16, or IL-16, respectively. In some embodiments, administration of a provided composition results in an increase in IL-16, IL-16, or ... , GAA enzyme activity is elevated compared to GAA enzyme activity in untreated subjects.

[0186] According to various embodiments, the timing of expression of the delivered mRNA can be determined based on a particular medical need. In some embodiments, the provided MR Expression of the protein encoded by the NA is dependent on the administration of the provided liposomes and / or compositions. Detectable after 1, 2, 3, 6, 12, 24, 48, 72, and / or 96 hours. In some embodiments, expression of the protein encoded by the delivered mRNA is observed within one week of administration. The disease may be detectable after 1 hour, 2 weeks, and / or 1 month. [Example]

[0187] Certain compounds, compositions and methods of the present invention are specifically described according to specific embodiments. However, the following examples serve only to illustrate the compounds of the present invention and not to limit them. It is not intended to

[0188] Example 1. Exemplary liposome formulations for delivery and expression of GAA mRNA This example demonstrates the effectiveness of GAA mRNA delivery and expression in vivo. Representative liposomal formulations are presented. lipid material The formulations described herein are designed to encapsulate mRNA encoding the GAA protein. and one or more cationic lipids, helper lipids (e.g., non-cationic lipids and Multicomponent lipid blends using various ratios of PEGylated lipids (and / or cholesterol-based lipids) The cationic lipid contains DOTAP (1,2-dioleyl-3-trimethylammonium bromide). Dimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium ammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium nium propane), DLinDMA (Heyes, J.; Palmer, L.; Brem ner, K.; MacLachlan, I. “Cationic lipid satu ration influences intracellular delivery of encapsulated nucleic acids”J.Contr.R el.2005,107,276-287), DLin-KC2-DMA(Semple ,SCet al.“Rational Design of Cationic Lipids for siRNA Delivery”Nature Biotech .2010,28,172‐176),C12‐200(Love,KTet al .“Lipid‐like materials for low‐dose in v. ivo gene silencing”PNAS 2010,107,1864-18 69), cKK-E12 (3,6-bis(4-(bis(2-hydroxydodecyl)amino) )Butyl)piperazine-2,5-dione), HGT5000, HGT5001, HGT4 003, ICE, dialkylamino, imidazole, guanidinium, etc. The helper lipids include (but are not limited to) DSP. C (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2 -dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl 1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl- sn-glycero-3-phosphotidylcholine )) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine) DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine) 2-dioleoyl-sn-glycero-3-phospho-(1'-rac- Examples include (but are not limited to) glycerol, cholesterol, etc. (This does not mean that the PEGylated lipids are of a chain length of C6 to C6.) 20 having alkyl chain(s) of Examples include poly(ethylene) glycol chains of up to 5 kDa in length covalently attached to lipids. It can be (but is not limited to)

[0189] Codon rearrangement by in vitro transcription from a gene-encoding plasmid DNA template Optimized human acid α-glucosidase (GAA) messenger RNA was synthesized, followed by 5' carboxylase. Cap structure (Cap1) (Fechter, P.; Brownlee, GG "Rec ognition of mRNA cap structures by viral and cellular proteins”J.Gen.Virology 20 05,86,1239-1249), and the chain length determined by gel electrophoresis is approximately 250 A 3' poly(A) tail (SEQ ID NO: 7) of nucleotides was added to each mRNA product. The 5' and 3' untranslated regions are designated as X and Y, respectively, and are defined as indicated. (see below). Exemplary codon-optimized human acid alpha-glucosidase (GAA) mRNA Structure Design: X - SEQ ID NO:3 - Y 5' and 3' UTR sequences X(5'UTR sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGAC CUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCC GGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAG UGACUCACCGUCCUUGACACG [SEQ ID NO: 8] Y(3'UTR sequence)= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCU GGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUC CUAAUAAAAUUAAGUUGCAUCAAGCU [SEQ ID NO: 9] or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUG GCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCC UAAUAAAAUUAAGUUGCAUCAAAGCU [SEQ ID NO: 10]

[0190] An exemplary codon-optimized human GAA mRNA sequence is shown in SEQ ID NO: 1 in the Detailed Description section. It has No. 3.

[0191] An exemplary full-length codon-optimized human acid alpha-glucosidase (GAA) messenger RNA The A sequence is shown below: GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGAC CUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCC GGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAG UGACUCACCGUCCUUGACACGAUGGGAGUCACGACACCCGC CGUGCUCGCACAGGCUUCUGGCCGUGUGCGCACUCGUGAG UCUGGCGACUGCUGCGUUGCUGGGGGCACAUUCUUCUCCAC GACUUUCUCUUGGUGCCCCGAGAAUUGUCGGGCUCGUCGC CGGUACUGGAAGAAACCCACCCCGCACAUCAGCAGGGCGC GUCGCGGCCUGGUCCGAGGGAUGCCCAGGCACAUCCCGGA AGGCCACGAGCCGUCCCGACUCAAUGUGACGUACCUCCCA AUUCCCGGUUCGACUGUGCGCCAGACAAGGCAAUCACGCA AGAGCAGUGCGAAGCCCGUGGAUGCUGCUAUAUUCCGGCG AAGCAGGGACUUCAGGGAGCCCAGAUGGGGCAGCCUGGU GUUUCUUCCCGCCUUCCUAUCCCUCAUAUAAGCUGGAGAA UUUGUCGUCCUCGGAAUGGGGUAUACCGCUACUCUUACG AGAACCACCCCCACAUUCUUUCCGAAGGACAUCCUUACUC UGCGGCUCGACGUGAUGGAGACAGAAAAUAGGCUGCA UUUCACGAUCAAAGACCCGGCGAACCGGAGAUAUGAGGGUU CCGCUUGAGACUCCCCACGUUCACUCUCGUGCGCCUUCAC CCUUGUACUCCGUGGAGUUCUCGGAAGAACCGUUCGGGU GAUCGUCAGACGUCAACUUGGUAGGGGUAUUGCUGAAC ACAACGGUCGCCCCCUUGUUUUUGCCCGACCAGUUUCUGC AGCUUUCGACAUCGCUGCCGUCCCAGUAUAUACACAGGGCU CGCGGAGCAUCUUCACCCCUCAUGCUGAGCACGAGCUGG ACACGGAUUACGCUCUGGAACAGGGAUCUCGCGCCGACGC CCGGAGCGAAUUUGUAUGGGUCGCAUCCCUUCUACCUCGC AUUGGAAGACGGGGGUUCCGCGCACGGAGUAUUCCUGCUU AAUUCUAAUGCGAUGGAGCGUUGCUUGCAGCCCUCCCCUG CUUUGUCGUGGCGUUCCACGGGGGGCAUUUUGGACGUUUA CAUCUUUUUGGGACCCGAGCCAAAGACGUAGGCGUAGCAGCAG UAUUUGGAUGUAGUGGGCUACCCCUUCAUGCCGCCUUAUU GGGGACUGGGGUUCCAUCUCUGCCGCUGGGGGUACUCUUC GACCGCGAUCACCCGCCAGGUGGUCGAGAACAUGACCAGA GCACAUUUCCCUUUGGACGUGCAGUGGAAUGAUUGGAUU ACAUGGAUAGCCGAAGAGACUUCACGUUCAAUAAGGACGG GUUUAGAGAUUUUCCCGCGAUGGUGCAAGAAUUGCACCAG GGUGGGCGCAGAUACAUGAUGAUCGUCGAUCCCGCCAUCA GCAGCUCGGGACCAGCGGGAGUUACCGGCCUUACGAUGA GGGACUUAGGAGAGGCGUCUUUAUCACGAACGAAACAGGU CAGCCGCUCAUUGGUAAAGUGUGGCCUGGAUCAACGGCCU UUCCCGACUUCACGAAUCCCCACAGCCCUCGCCUGGUGGGA AGACAUGGUGGCGGAGUUUCACGACCAAGUACCGUUUGAU GGGAUGGGAUUGAUAUAGGAACCCCUCAAACUUUAUUC GCGGCUCGGAAGAUGGAUGCCCGAAAUAUAGCUUGAGAA UCCCCCGUAUGUGCCAGGGGUGGUAGGUGGGACGCUCCAG GCCGCUACGAUCUGUGCGUCAUCACAUCAGUUUUUUGUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU out out out out CGCACUACAACUUGCACAAUCUUACGGUUUGACUGAAGC CAUCGCUUCGCAUCGCGCGCUGGUCAAAGCGCGUGGUACG CGACCCUUCGUUAUUUCUCGGUCCACAUUUGCCGGGCACG GUCGGUAUGCCCGGACACUGGACGGGAGAGUGUCUGGUCUAG CUGGGAGCAGCUCGCGUCGAGCGUACCGGAGAUCCUCCAG UUCAAUCUUUUGGAGUUCCGCUCGUCGGCGCUGACGUGU GCGGUUUUCUCGGAAACACAUGAAGACCUUUGCGUACG CUGGACACAGCUCGGUGCGUUUUACCCUUUAUGAGAAAC CAUAACUCGUUGCUCUCACUCCCUCAAAGAGCCGUACAGUU UUUCGGAGCCUGCGCAACAGGCGAUGCGGGAAGGCAUUGAC ACUUCGCUAUGCACUGCUCCCGCAUCUCUAUACUCUGUUC CAUCAGGCCCAUGUGGCUGGAGAAACGGUGGCGAGGCCCC UGUUCUUGGAGUUCCCCAAAGAUAGUUCCACAUGGACCGU GGAUCACCAGUUGCUGUGGGGGAGAGGCGCUUCUGAUCACU CCGGUACUUCAGGCGGUAAAGCGGGAAGUCACUGGGGUAUU UCCCGCUUGGGACCUGGUACGACCUUCAGACUGUCCCCAGU AGAAGCCCUCGGAAGCCUGCCACCUCCCCCUGCUGCACCC CGCGAGCCUGCAAUCCAUAGCGAGGGCCAGUGGGUAACGU UGCCAGCCCCACUGGAUACCAUCAAUGUCCACCUCAGGGC GGGUUACAUAAUCCCCUCUCCAAGGCCCUGGGUUGACCACC ACAGAGUCGCGCCAGCAGCCAAUGGCACUUGCGGUCGCAU UGACGAAAGGGGGUGAAGCCCGAGGGGAACUGUUUUGGGA UGACGGGGAAAGCCUUGAGGUGCUGGAACGGGAGCGUAC ACACAAGUCAUUUUCUUGGCCAGGAACAACACUAUUGUCA ACGAGUUGGUGCGCUGAGACCUCUGAGGGUGCCGGACUGCA ACUGCAGAAGGUCACGGUCCUCGGAGUGGCGACAGCACCC CAACAGGUCCUUAGUAACGGAGUACCUGUCUCGAACUUUA CAUACUCCCCGGACACGAAGGUGCUCGACAUCUGUGUGUC GCUGCUUAUGGGGGAACAGUUUCUCGUGAGCUGGUGCUAG CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUG GCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCC UAAUAAAAUUAAGUUGCAUCAAGCU [SEQ ID NO: 11]

[0192] In another embodiment, the full-length codon-optimized human acid alpha glucosidase (GAA) message The ribosomal RNA sequence is shown below: GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGAC CUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCC GGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAG UGACUCACCGUCCUUGACACGAUGGGAGUCACGACACCCGC CGUGCUCGCACAGGCUUCUGGCCGUGUGCGCACUCGUGAG UCUGGCGACUGCUGCGUUGCUGGGGGCACAUUCUUCUCCAC GACUUUCUCUUGGUGCCCCGAGAAUUGUCGGGCUCGUCGC CGGUACUGGAAGAAACCCACCCCGCACAUCAGCAGGGCGC GUCGCGGCCUGGUCCGAGGGAUGCCCAGGCACAUCCCGGA AGGCCACGAGCCGUCCCGACUCAAUGUGACGUACCUCCCA AUUCCCGGUUCGACUGUGCGCCAGACAAGGCAUACACGCA AGAGCAGUGCGAAGCCCGUGGAUGCUGCUAUAUUCCGGCG AAGCAGGGACUUCAGGGAGCCCAGAUGGGCAGCCCUGGU GUUUCCCGCCUUCCUAUCCCCUCAUAUAAGCUGGAAA UUUGUCGUCCUCGGAAUGGGGUAUACCGCUACUCUUACG AGAACCACCCCCACAUUCUUUCCGAAGGACAUCCUUACUC UGCGGCUCGACGUGAUGGAGACAGAAAAUAGGCUGCA UUUCACGAUCAAAGACCCGGCGAACCGGAGAUAUGAGGGUU CCGCUUGAGACUCCCCACGUUCACUCUCGUGCGCCUUCAC CCUUGUACUCCGUGGAGUUCUCGGAAGAACCGUUCGGGU GAUCGUCAGACGUCAACUUGGUAGGGGUAUUGCUGAAC ACAACGGUCGCCCCCUUGUUUUUGCCCGACCAGUUUCUGC AGCUUUCGACAUCGCUGCCGUCCCAGUAUAUACACAGGGCU CGCGGAGCAUCUUCACCCCUCAUGCUGAGCACGAGCUGG ACACGGAUUACGCUCUGGAACAGGGAUCUCGCGCCGACGC CCGGAGCGAAUUUGUAUGGGUCGCAUCCCUUCUACCUCGC AUUGGAAGACGGGGGUUCCGCGCACGGAGUAUUCCUGCUU AAUUCUAAUGCGAUGGAGCGUUGCUUGCAGCCCUCCCCUG CUUUGUCGUGGCGUUCCACGGGGGGCAUUUUGGACGUUUA CAUCUUUUUGGGACCCGAGCCAAAGACGUAGGCGUAGCAGCAG UAUUUGGAUGUAGUGGGCUACCCCUUCAUGCCGCCUUAUU GGGGACUGGGGUUCCAUCUCUGCCGCUGGGGGUACUCUUC GACCGCGAUCACCCGCCAGGUGGUCGAGAACAUGACCAGA GCACAUUUCCCUUUGGACGUGCAGUGGAAUGAUUGGAUU ACAUGGAUAGCCGAAGAGACUUCACGUUCAAUAAGGACGG GUUUAGAGAUUUUCCCGCGAUGGUGCAAGAAUUGCACCAG GGUGGGCGCAGAUACAUGAUGAUCGUCGAUCCCGCCAUCA GCAGCUCGGGACCAGCGGGAGUUACCGGCCUUACGAUGA GGGACUUAGGAGAGGCGUCUUUAUCACGAACGAAACAGGU CAGCCGCUCAUUGGUAAAGUGUGGCCUGGAUCAACGGCCU UUCCCGACUUCACGAAUCCCCACAGCCCUCGCCUGGUGGGA AGACAUGGUGGCGGAGUUUCACGACCAAGUACCGUUUGAU GGGAUGGGAUUGAUAUAGGAACCCCUCAAACUUUAUUC GCGGCUCGGAAGAUGGAUGCCCGAAAUAUAGCUUGAGAA UCCCCCGUAUGUGCCAGGGGUGGUAGGUGGGACGCUCCAG GCCGCUACGAUCUGUGCGUCAUCACAUCAGUUUUUUGUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU out out out out CGCACUACAACUUGCACAAUCUUUACGGUUUGACUGAAGC CAUCGCUUCGCAUCGCGCGCUGGUCAAAGCGCGUGGUACG CGACCCUUCGUUAUUUCUCGGUCCACAUUUGCCGGGCACG GUCGGUAUGCCGGACACUGGACGGGAGAUGUCUGGUCUAG CUGGGAGCAGCUCGCGUCGAGCGUACCGGAGAUCCUCCAG UUCAAUCUUUUGGGAGUUCCGCUCGUCGGCGCUGACGUGU GCGGUUUUCUCGGAAACACAUCAGAAGAGCUUUGCGUACG CUGGACACAGCUCGGUGCGUUUUACCCCUUUAUGAGAAAC CAUAACUCGUUGCUCUCACUCCCUCAAGAGCCGUACAGUU UUUCGGAGCCUGCGCAACAGGCGAUGCGGAAGGCAUUGAC ACUUCGCUAUGCACUGCUCCCGCAUCUCUAUACUCUGUUC CAUCAGGCCCAUGUGGCUGGAGAAACGGUGGCGAGGCCCC UGUUCUUGGAGUUCCCCAAAGAUAGUUCCACAUGGACCGU GGAUCACCAGUUGCUGUGGGGAGAGGCGCUUCUGAUCACU CCGGUACUUCAGGCGGGUAAAGCGGAAGUCACUGGGUAUU UCCCGCUUGGGACCUGGUACGACCUUCAGACUGUCCCAGU AGAAGCCCUCGGAAGCCUGCCACCUCCCCCUGCUGCACCC CGCGAGCCUGCAAUCCAUAGCGAGGGCCAGUGGGUAACGU UGCCAGCCCCACUGGAUACCAUCAAUGUCCACCUCAGGGC GGGUUACAUUAUCCCUCUCCAAGGCCCUGGGUUGACCACC ACAGAGUCGCGCCAGCAGCCAAUGGCACUUGCGGUCGCAU UGACGAAAGGGGGUGAAGCCCGAGGGGAACUGUUUUGGGA UGACGGGGAAAGCCUUGAGGUGCUGGAACGGGAGCGUAC ACACAAGUCAUUUUCUUGGCCAGGAACAACACUAUUGUCA ACGAGUUGGUGCGCUGAGACCUCUGAGGGUGCCGGACUGCA ACUGCAGAAGGUCACGGUCCUCGGAGUGGCGACAGCACCC CAACAGGUCCUUAGUAACGGAGUACCUGUCUCGAACUUUA CAUACUCCCCGGACACGAAGGUGCUCGACAUCUGUGUGUC GCUGCUUAUGGGGGAACAGUUUCUCGUGAGCUGGUGCUAG GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGG CCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCU AAUAAAAUUAAGUUGCAUCAAAGCU [SEQ ID NO: 12]

[0193] Exemplary Formulation Protocol A. cKK‐E12 50 mg / mL of cKK-E12, DOPE, cholesterol, and DMG-PEG2K Aliquots of the ethanol solution were mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, The lipid solution was rapidly added to the mRNA solution (pH 4.5) and prepared from a 1 mg / mL stock. The nanoparticle suspension was poured into a glass tube and shaken to obtain a final suspension in 20% ethanol. Filter, diafilter with 1x PBS (pH 7.4), concentrate, and store at 2-8°C. The final concentration was 0.64 mg / mL GAA mRNA (encapsulated). Z ave = 80 nm; PDI = 0.17; Encapsulation rate = 85%; Yield = 89%. Ta.

[0194] B. C12‐200 50 mg / mL of C12-200, DOPE, cholesterol, and DMG-PEG2K Mix the aliquots of ethanol solution and dilute with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, Prepare a 1 mg / mL stock of lipid (pH 4.5). Rapidly add the lipid solution to the mRNA solution. The resulting nanoparticle suspension is poured into a 20% ethanol solution and shaken to obtain a final suspension in 20% ethanol. Filter, diafilter with 1x PBS (pH 7.4), concentrate, and store at 2-8°C. Save the final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (9 0) Measure.

[0195] C. HGT4003 50 mg / mL of HGT4003, DOPE, cholesterol, and DMG-PEG2K Mix the aliquots of ethanol solution and dilute with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, Prepare a 1 mg / mL stock of lipid (pH 4.5). Rapidly add the lipid solution to the mRNA solution. The resulting nanoparticle suspension is poured into a 20% ethanol solution and shaken to obtain a final suspension in 20% ethanol. Filter, diafilter with 1x PBS (pH 7.4), concentrate, and store at 2-8°C. Save the final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (9 0) Measure.

[0196] D.ICE ICE, DOPE, cholesterol, and DMG-PEG2K in 50 mg / mL ethanol Mix the aliquots of the solution and dilute with ethanol to a final volume of 3 mL. , GAA mRNA in a buffered aqueous solution (10 mM citric acid / 150 mM NaCl, pH 4. 5) Prepare from a 1 mg / mL stock. Rapidly inject the lipid solution into the aqueous mRNA solution. , and shake to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension is filtered. Diafilter with 1x PBS (pH 7.4), concentrate, and store at 2-8°C. Final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure Determine.

[0197] E. HGT5001 50 mg / mL of HGT5001, DOPE, cholesterol, and DMG-PEG2K Mix the aliquots of ethanol solution and dilute with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, Prepare a 1 mg / mL stock of lipid (pH 4.5). Rapidly add the lipid solution to the mRNA solution. The resulting nanoparticle suspension is poured into a 20% ethanol solution and shaken to obtain a final suspension in 20% ethanol. Filter, diafilter with 1x PBS (pH 7.4), concentrate, and store at 2-8°C. Save the final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (9 0) Measure.

[0198] F. HGT5000 50 mg / mL of HGT5000, DOPE, cholesterol, and DMG-PEG2K Mix the aliquots of ethanol solution and dilute with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, Prepare a 1 mg / mL stock of lipid (pH 4.5). Rapidly add the lipid solution to the mRNA solution. The resulting nanoparticle suspension is poured into a 20% ethanol solution and shaken to obtain a final suspension in 20% ethanol. Filter, diafilter with 1x PBS (pH 7.4), concentrate, and store at 2-8°C. Save the final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (9 0) Measure.

[0199] G. DLinKC2DMA 50 mg of DLinKC2DMA, DOPE, cholesterol, and DMG-PEG2K Mix the aliquots of 1 mL ethanol solution and dilute with ethanol to a final volume of 3 mL. Separately, a buffered solution of GAA mRNA (10 mM citric acid / 150 mM Na Prepare the lipid solution from a 1 mg / mL stock in HCl, pH 4.5. The resulting nanoparticle suspension is rapidly injected into the flask and shaken to obtain a final suspension in 20% ethanol. The suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and Store at 8°C. Final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and D v (90) Measure.

[0200] H. DODAP 50 mg / mL ethanol of DODAP, DOPE, cholesterol, and DMG-PEG2K Mix the aliquots of ethanol solution and dilute with ethanol to a final volume of 3 mL. Separately, a buffered solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) Prepare from a 1 mg / mL stock. Rapidly inject the lipid solution into the aqueous mRNA solution. Add the nanoparticles and shake to obtain a final suspension in 20% ethanol. Filter the resulting nanoparticle suspension. Diafilter with 1x PBS (pH 7.4), concentrate, and store at 2-8°C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure.

[0201] I. DODMA 50 mg / mL ethanol of DODMA, DOPE, cholesterol, and DMG-PEG2K Mix the aliquots of ethanol solution and dilute with ethanol to a final volume of 3 mL. Separately, a buffered solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) Prepare from a 1 mg / mL stock. Rapidly inject the lipid solution into the aqueous mRNA solution. Add the nanoparticles and shake to obtain a final suspension in 20% ethanol. Filter the resulting nanoparticle suspension. Diafilter with 1x PBS (pH 7.4), concentrate, and store at 2-8°C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure.

[0202] Example 2. Intravenous administration of liposomal nanoparticles loaded with GAA mRNA This example provides an exemplary method for administering liposomal nanoparticles loaded with GAA mRNA. and in vivo analysis of GAA mRNA and glycogen in various target tissues. This explains how to do this.

[0203] All studies were performed using GAA knockout mice. Mice were treated with 1.0 mg / kg cKK-E1 loaded with human GAA mRNA by a single bolus tail vein injection of 1000 mg dose Mice were sacrificed and treated with lipid nanoparticles based on 2. The mice were then cultured for 30 minutes, 3 hours, 6 hours, and 12 hours. The mice were perfused with saline at 1 h, 24 h, 48 h, 72 h, and 7 days.

[0204] Tissues such as liver and muscle from each mouse were collected and divided into separate portions. The samples were stored in chloramin or flash frozen and kept at −80°C for analysis.

[0205] Direct detection of the active pharmaceutical ingredient (GAA mRNA) in the muscle of treated mice was performed in This was achieved using an in situ hybridization (ISH)-based method. As shown in 1B, exogenous human GAA messenger RNA was administered at 6 and 12 hours. Detected.

[0206] After administration of GAA mRNA lipid nanoparticles, liver glycogen levels (Figure 2A) were significantly higher than those of untreated controls. This was reduced compared with liver glycogen levels in GAA knockout mice (Fig. 2B).

[0207] Example 3. Intramuscular administration of GAA mRNA-loaded liposomal nanoparticles This example provides an exemplary method for administering liposomal nanoparticles loaded with GAA mRNA. , and GAA mRNA and glycogen in various target tissues in vivo The analytical method will be exemplified.

[0208] All studies were performed using GAA knockout mice. Mice were treated with 1.0 mg / kg A single intramuscular injection of 1000 mg of cKK-E12-based IgG4-dependent GABA mRNA was administered. Mice were treated with lipid nanoparticles based on PEG-1000. Mice were sacrificed and perfused with saline at 24 hours.

[0209] Tissues such as liver and muscle from each mouse were collected and divided into separate portions. olmarin or flash-frozen and stored at −80°C for analysis.

[0210] Direct detection of the active pharmaceutical ingredient (GAA mRNA) in the muscle of treated mice was performed in This was achieved using an in situ hybridization (ISH)-based method, as shown in Figure 3. As expected, high levels of exogenous human GAA messenger RNA were detected at 24 hours.

[0211] After administration of GAA mRNA lipid nanoparticles, quadriceps muscle glycogen levels (Figures 4A and 4B) B) The quadriceps glycogen levels of untreated GAA knockout mice (Fig. 4C and 4 D) was lower than that of

[0212] equivalent Those skilled in the art will recognize many equivalents to the specific embodiments of the invention described herein. Those skilled in the art will recognize, or be able to ascertain using routine experimentation, that the scope of the present invention is not to be limited by the foregoing description. No limitation is intended, and this is set forth in the appended claims.

Claims

1. A composition for reducing glycogen levels in vivo, comprising mRNA encoding acid alpha glucosidase (GAA), the composition is administered to a subject in need of treatment in an amount and at an interval effective to reduce glycogen levels in the quadriceps muscle of the subject compared to a baseline glycogen level prior to administration; the RNA comprises a codon-optimized nucleotide sequence encoding GAA that is at least 90% identical to SEQ ID NO:3; the mRNA is encapsulated in a liposome; and The composition, wherein the liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids.

2. 2. The composition of claim 1, wherein the G / C content of the mRNA is optimized to achieve the highest possible G / C content.

3. 2. The composition of claim 1, wherein the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinKC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.

4. The composition of claim 1, wherein the composition is administered intramuscularly.

5. 5. The composition of claim 4, wherein the intramuscular administration is to a muscle selected from the group consisting of skeletal muscle, smooth muscle, cardiac muscle, and combinations thereof.

6. 2. The composition of claim 1, wherein the composition is administered so that the mRNA is administered at an effective dose in the range of about 0.1 to 5.0 mg / kg body weight.

7. The composition of claim 1 , wherein the mRNA further comprises a 5′UTR sequence of SEQ ID NO:

8.

8. The composition of claim 1, wherein the mRNA further comprises a 3'UTR sequence of SEQ ID NO: 9 or SEQ ID NO:

10.

9. The composition of claim 1 , wherein the mRNA comprises SEQ ID NO: 11 or SEQ ID NO:

12.

10. 1. A composition for treating Pompe disease, comprising mRNA encoding acid alpha-glucosidase (GAA), the composition is administered to a subject in need of treatment in an amount and at an interval effective to reduce the intensity, severity, or frequency of, or delay the onset of, at least one symptom or characteristic of Pompe disease; the mRNA is at least 90% identical to SEQ ID NO:3; the mRNA is encapsulated in a liposome; and The liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids. The composition.

11. 11. The composition of claim 10, wherein the G / C content of the mRNA is optimized to achieve the highest possible G / C content.

12. 11. The composition of claim 10, wherein the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinKC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.

13. The composition of claim 10, wherein administration of the composition treats hypertrophic cardiomyopathy in a subject.

14. The one or more PEG-modified lipids are 6 ~C 20 11. The composition of claim 10, comprising a poly(ethylene) glycol chain up to 5 kDa in length covalently attached to a lipid having a long alkyl chain.

15. 11. The composition of claim 10, wherein the cationic lipid comprises about 30-50% by weight of the liposome.

16. The composition of claim 10, wherein the composition is administered so that the mRNA is administered at an effective dose in the range of about 0.1 to 5.0 mg / kg body weight.

17. The composition of claim 10, wherein the composition is administered intravenously.

18. The composition of claim 10, wherein the composition is administered intramuscularly.

19. Administration of the composition results in expression of GAA protein in the liver. The composition according to claim 10 ,

20. 11. The composition of claim 10, wherein administration of the composition results in GAA protein expression in serum.

21. The composition of claim 10, wherein the mRNA is codon-optimized.

22. The composition of claim 10, wherein the mRNA comprises one or more modified nucleotides.

23. The composition of claim 10, wherein the mRNA is unmodified.

Images