Muscle differentiation-promoting effects of ergothioneine, ascorbic acid 2-glucoside, ascorbic acid, and their combination

Abstract

The present invention provides a culture medium and culture medium additive for promoting muscle differentiation, each containing ergothioneine, ascorbic acid 2-glucoside, ascorbic acid, or a combination thereof, a kit, and a pharmaceutical composition, food, or drink for promoting muscle differentiation.

Description

[Technical Field]

[0001] The present invention relates to promoting cell differentiation. In particular, the present invention relates to a medium and medium additive for promoting muscle differentiation, which contain ergothioneine, as well as a pharmaceutical composition, food, drink, and the like for promoting muscle differentiation. [Background technology]

[0002] In recent years, as the aging of society progresses, various disorders associated with decreased muscle mass and strength, such as decreased motor function, increased risk of falls and fractures, and locomotive syndrome, have become problems. Muscle regeneration is important for treating and improving these disorders, and muscle regeneration requires muscle differentiation. Various studies on muscle differentiation have been conducted (see, for example, Non-Patent Document 1). [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Onitsuka Y. Investigation of an efficient culture condition for the differentiation of murine skeletal myoblasts. Jpn. J. Vet. Res . 2013. 61(1&2): 39. Summary of the Invention [Problem to be solved by the invention]

[0004] In order to treat and improve symptoms and conditions that require muscle regeneration, such as locomotive syndrome, it is necessary to find effective and safe drugs and methods that promote muscle differentiation. [Means for solving the problem]

[0005] The present inventors have conducted extensive research to solve the above problems and have discovered for the first time that ergothioneine promotes muscle differentiation, that the combined use of ergothioneine with ascorbic acid 2-glucoside and / or ascorbic acid significantly promotes muscle differentiation, that ascorbic acid 2-glucoside alone promotes muscle differentiation, and that ascorbic acid alone promotes muscle differentiation, thereby completing the present invention.

[0006] Thus, the present invention provides the following: (1) A medium containing ergothioneine for promoting muscle differentiation. (2) The medium according to (1), further comprising ascorbic acid 2-glucoside and / or ascorbic acid. (3) A medium additive containing ergothioneine to promote muscle differentiation. (4) The medium additive according to (3), further comprising ascorbic acid 2-glucoside and / or ascorbic acid. (5) A kit for promoting muscle differentiation containing ergothioneine. (6) The kit according to (5), further comprising ascorbic acid 2-glucoside and / or ascorbic acid. (7) A method for promoting muscle differentiation of cells, comprising culturing the cells in a medium containing ergothioneine. (8) The method according to (7), wherein the medium further contains ascorbic acid 2-glucoside and / or ascorbic acid. (9) A pharmaceutical composition for promoting muscle differentiation, comprising ergothioneine. (10) The pharmaceutical composition according to (9), further comprising ascorbic acid 2-glucoside and / or ascorbic acid. (11) The pharmaceutical composition according to (9) or (10) for promoting muscle regeneration. (12) Foods and drinks containing ergothioneine to promote muscle differentiation. (13) The food or drink according to (12), further comprising ascorbic acid 2-glucoside and / or ascorbic acid. (14) A food or drink according to (12) or (13) for promoting muscle regeneration. [Effects of the Invention]

[0007] The present invention provides a culture medium and medium additive for promoting muscle differentiation, as well as a pharmaceutical composition, food, beverage, etc., containing ergothioneine. The culture medium, medium additive, pharmaceutical composition, and food / beverage of the present invention have excellent muscle differentiation promoting properties. The pharmaceutical composition and food / beverage of the present invention are particularly beneficial for elderly people, people who have suffered trauma, and people who are ill or recovering from illness. These effects are significantly enhanced by the combined use of ergothioneine with ascorbic acid 2-glucoside and / or ascorbic acid. The above effects can also be achieved by using ascorbic acid 2-glucoside alone, ascorbic acid alone, or a combination of these. Ergothioneine is a substance found in vivo, ascorbic acid 2-glucoside is a substance approved as a food additive and quasi-drug, and ascorbic acid is widely found in nature, such as in fruits and vegetables. Therefore, the culture medium, medium additive, pharmaceutical composition, and food / beverage of the present invention are highly safe. [Brief explanation of the drawings]

[0008] [Figure 1] Figure 1 shows microscopic photographs showing the effect of ergothioneine on muscle differentiation of C2C12 cells. The left photograph shows C2C12 cells before differentiation, the middle photograph shows C2C12 cells (control) differentiated in differentiation medium without EGT, and the right photograph shows C2C12 cells differentiated in differentiation medium with 0.5 mM EGT. [Figure 2] FIG. 2 is a graph showing the effect of ergothioneine on MyoD mRNA expression levels in C2C12 cells. [Figure 3] FIG. 3 is a graph showing the effect of ergothioneine on the expression levels of MyH2 mRNA and ACTA1 mRNA in C2C12 cells. [Figure 4] FIG. 4 is a graph showing that the antioxidant edaravone does not affect the MyH2 mRNA expression level in C2C12 cells. [Figure 5]Figure 5 shows the effects of the combined use of ergothioneine and ascorbic acid 2-glucoside, and ascorbic acid 2-glucoside alone, on the expression levels of MyH2 mRNA (upper panel) and ACTA1 mRNA (lower panel) in C2C12 cells. In the figure, EGT indicates ergothioneine-supplemented medium, AG indicates ascorbic acid 2-glucoside-supplemented medium, E+AG indicates medium supplemented with ergothioneine and ascorbic acid 2-glucoside, and NT indicates medium without ergothioneine and ascorbic acid 2-glucoside. [Figure 6] Figure 6 shows the effects of the combined use of ergothioneine and ascorbic acid, and ascorbic acid alone, on MyH2 mRNA expression levels (upper panel) and ACTA1 mRNA expression levels (lower panel) in C2C12 cells. In the figure, EGT indicates ergothioneine-supplemented medium, VC indicates ascorbic acid-supplemented medium, E+VC indicates medium supplemented with ergothioneine and ascorbic acid, and NT indicates medium without ergothioneine or ascorbic acid. DETAILED DESCRIPTION OF THE INVENTION

[0009] In a first aspect, the present invention provides a medium for promoting muscle differentiation, comprising ergothioneine.

[0010] The present inventors were the first to discover that ergothioneine promotes muscle differentiation.

[0011] Ergothioneine (hereinafter referred to as EGT) is a sulfur-containing amino acid known to possess a variety of physiological activities, including antioxidant capacity. Its antioxidant capacity has also been suggested to be higher than that of vitamin C, vitamin E, cysteine, and glutathione. EGT has also been shown to have UV-absorbing properties, inhibit melanin production, scavenge reactive oxygen species, inhibit elastase activity to prevent wrinkles and sagging, and inhibit tyrosinase activity to prevent age spots. Therefore, EGT is one of the compounds attracting particular attention in the beauty and food industries. However, the present inventors were the first to discover that EGT promotes muscle differentiation.

[0012] As used herein, muscle differentiation refers to the differentiation of stem cells or muscle precursor cells capable of differentiating into skeletal muscle into myotubes. The culture medium of the present invention is used to promote the differentiation of these cells. The stem cells are mesodermal stem cells. Mesodermal stem cells may be present in vivo or derived from iPS cells or ES cells. Muscle precursor cells for skeletal muscle are known, and examples include satellite cells and myoblasts. In a specific embodiment, muscle differentiation refers to the differentiation of satellite cells or myoblasts into myotubes. Satellite cells have properties similar to somatic stem cells and are precursor cells of muscle cells. Satellite cells differentiate into myoblasts upon activation. Myoblasts proliferate by cell division and then differentiate into muscle cells. Muscle cells fuse with each other to form multinucleated myotubes. Myotubes then mature into muscle fibers, forming muscle tissue. Satellite cells, myoblasts, muscle cells, myotubes, and the like are known to those skilled in the art.

[0013] The EGT used in the present invention may be in the free form or in the form of a salt. The salt of EGT may be formed between the negatively charged oxygen of the carboxyl group of EGT and, for example, a hydrogen ion or an alkali metal ion, or between the positively charged nitrogen of the trimethylamino group and, for example, a halide ion. The EGT used in the present invention may also be a hydrate.

[0014] Differentiation into muscle can be confirmed by the level of expression of myosin, a muscle-specific protein. As used herein, promoting muscle differentiation refers to increasing the expression level of myosin genes in stem cells or muscle precursor cells. In particular embodiments, it refers to the transformation of satellite cells or myoblasts into cells that highly express myosin mRNA. For example, promoting muscle differentiation may be defined as increasing the gene expression level of myosin mRNA, a muscle marker, in satellite cells or myoblast-derived muscle cells by 1.5-fold or more, preferably 2-fold or more, and more preferably 3-fold or more. For example, promoting muscle differentiation refers to increasing MyoD mRNA expression in satellite cells or myoblasts by 1.5-fold or more, preferably 2-fold or more, compared to the level in the absence of EGT.

[0015] The medium of the present invention may be a known medium to which EGT has been added. Preferably, the medium of the present invention is a medium used for muscle differentiation to which EGT has been added. The amount of EGT to be added to the medium can be determined appropriately by those skilled in the art depending on the type of stem cells or muscle precursor cells (e.g., satellite cells or myoblasts), culture conditions such as culture temperature and culture time, and medium composition. For example, EGT may be added to a known low-serum medium for muscle differentiation at about 0.001 mM to about 1.0 mM, preferably about 0.1 mM to about 0.5 mM, but is not limited to these amounts.

[0016] The medium of the present invention may be in any form, such as liquid, semi-solid, or solid, and is not particularly limited. Typically, the medium of the present invention is a liquid medium. Alternatively, the medium of the present invention may be in the form of a composition. For example, it may be in the form of a liquid medium composition that can be used as is, or in the form of a composition such as a concentrated liquid, paste, powder, or pellet that can be diluted with a medium such as water to achieve a desired component concentration.

[0017] In a second aspect, the present invention provides a medium additive for promoting muscle differentiation, comprising EGT.

[0018] The additive of the present invention is added during medium preparation or to a prepared medium, or may be added to a medium during culture.

[0019] The amount of EGT in the additive of the present invention is an amount that will result in a desired EGT concentration when added to a culture medium. The EGT concentration in the culture medium is as explained above. The additive of the present invention may contain one or more components in addition to EGT, such as nutrients necessary for cell growth, or components that promote muscle differentiation, such as fibroblast growth factor (FGF), hepatic growth factor (HGF), insulin, or insulin growth factor (IGF).

[0020] The additive of the present invention may be in any form, including a solid such as a powder, granules, or tablet, a semi-solid such as a paste, or a liquid such as a concentrated liquid.

[0021] In a third aspect, the present invention provides a kit for promoting muscle differentiation, comprising EGT.

[0022] Typically, the EGT contained in the kit of the present invention is placed in a container. The shape and material of the container are not particularly limited. The container may contain components other than EGT. In addition to the container containing EGT, the kit of the present invention may also contain one or more containers containing, for example, nutrients necessary for cell proliferation or components that promote muscle differentiation. The kit of the present invention may also contain the above-mentioned medium or medium additives. Typically, the kit of the present invention comes with an instruction manual.

[0023] In a fourth aspect, the present invention provides a method for promoting muscle differentiation of cells, comprising culturing cells in a medium containing EGT. In the method of the present invention, satellite cells or myoblasts are cultured. Culture conditions such as medium composition, culture temperature, and culture time are known to those skilled in the art.

[0024] In a fifth aspect, the present invention provides a pharmaceutical composition for promoting muscle differentiation, comprising EGT. The animal species to which the pharmaceutical composition of the present invention is administered is not particularly limited, as long as it is an animal that will benefit from muscle regeneration. The animal to which the pharmaceutical composition of the present invention is administered is preferably a human, but may also be a non-human animal such as a dog, cat, horse, or cow.

[0025] Promoting muscle differentiation can promote muscle regeneration. As used herein, muscle regeneration refers to restoring muscle mass that has been reduced due to some factor to its original level, or restoring muscle strength that has been reduced due to some factor to its original level. Specific uses of the pharmaceutical composition of the present invention include, but are not limited to, the suppression of sarcopenia and the promotion of muscle regeneration after injury. Satellite cells exist between the cell membrane and basement membrane of muscle fibers. When muscles are stimulated by injury or other factors, satellite cells are activated and differentiate into myoblasts. Myoblasts differentiate into muscle cells and form myotubes. Myotubes form or fuse with muscle fibers to regenerate skeletal muscle. Because EGT promotes muscle differentiation of satellite cells or myoblasts into muscle cells, the pharmaceutical composition of the present invention may be used to promote muscle regeneration, particularly skeletal muscle regeneration. The muscle to be regenerated may be located in any area.

[0026] Methods for measuring muscle mass, particularly skeletal muscle mass, include, but are not limited to, BIA, CT or MRI, DXA, ultrasound echography, and visual observation. Methods for measuring muscle strength, particularly skeletal muscle strength, include, but are not limited to, grip strength, back strength, leg extension strength, walking speed, sit-ups, standing long jump, ball throwing, etc.

[0027] The pharmaceutical composition of the present invention can be produced using known means and methods, such as mixing, kneading, stirring, drying, pulverizing, tableting, solubilization, etc. The pharmaceutical composition of the present invention usually contains a carrier or excipient. Carriers and excipients are known to those skilled in the art and can be selected depending on the administration site, administration route, amount of EGT contained, etc.

[0028] The dosage form of the pharmaceutical composition of the present invention is not particularly limited and may be any dosage form, such as a liquid such as an injection, infusion, oral liquid, or lotion, a semisolid such as a cream, paste, or ointment, a solid such as a tablet, powder, granule, lozenge, or suppository, or a freeze-dried powder that can be prepared immediately before use.

[0029] The pharmaceutical composition of the present invention may be administered by any route, including, but not limited to, intramuscular injection, subcutaneous injection, intradermal injection, intravenous injection, infusion, transdermal administration, administration via the buccal mucosa, transanal administration, oral administration, etc. In the case of skeletal muscle regeneration, the pharmaceutical composition of the present invention is preferably administered intramuscularly.

[0030] The dosage of EGT administered by the pharmaceutical composition of the present invention is an amount capable of promoting muscle differentiation in vivo or regenerating muscle. The dosage of EGT administered by the pharmaceutical composition of the present invention varies depending on the desired degree of muscle regeneration, the administration site, the administration route, etc., but is not limited to, for example, 1 mg to 5000 mg, preferably 10 mg to 1000 mg per day when administered orally to an adult. The dosage of EGT can be appropriately determined by a physician, for example, based on the size and mass of the muscle.

[0031] The pharmaceutical composition of the present invention may be administered once to several times a day. The pharmaceutical composition of the present invention may be administered daily or once or every few days. Administration of the pharmaceutical composition of the present invention may be continued until the desired muscle regeneration effect is achieved.

[0032] In a sixth aspect, the present invention provides a food or beverage for promoting muscle differentiation. The food or beverage of the present invention is administered to an animal that will benefit from muscle regeneration. The animal species is not particularly limited, but is preferably a human. The animal species may also be a non-human animal, such as a dog, cat, or horse.

[0033] The foods and drinks of the present invention include not only general foods but also health foods, specified health foods, foods with nutrient functions, foods with functional claims, and the like.

[0034] The food or drink of the present invention may be provided as a supplement. The form of the supplement may be any form and is not particularly limited.

[0035] The form of the food or beverage of the present invention may be any form and is not particularly limited. For example, the food or beverage of the present invention may be, for example, an existing food or beverage to which EGT has been added. It may also be in the form of, for example, tablets, powder, granules, lozenges, candy, juice, nectar, drinks, seasonings, etc. The supplement can be produced by a method similar to the known method for producing pharmaceutical compositions or a method similar to the known method for producing food or beverage.

[0036] As explained above, EGT promotes muscle differentiation of satellite cells or myoblasts into muscle cells, so the food and drink of the present invention may be used to promote muscle regeneration, particularly skeletal muscle regeneration. Specific uses of the food and drink of the present invention include, but are not limited to, suppressing sarcopenia and promoting muscle regeneration after injury. The regenerated muscle may be located in any part of the body.

[0037] The intake amount of EGT from the food and drink of the present invention is an amount that can promote muscle differentiation in the body or an amount that can regenerate muscle. The intake amount of EGT from the food and drink of the present invention varies depending on the desired level of muscle regeneration, the site of muscle regeneration, etc., but for example, when orally administered to an adult, it may usually be 1 mg to 5000 mg, preferably 10 mg to 1000 mg per day, but is not limited to these amounts.

[0038] The food and drink of the present invention may be ingested once to several times a day. The food and drink of the present invention may be ingested daily or every one to several days. Administration of the food and drink of the present invention may be continued until the desired muscle regeneration effect is achieved.

[0039] As described above, the present inventors have discovered for the first time that muscle differentiation is significantly promoted by the combined use of EGT with ascorbic acid 2-glucoside (hereinafter referred to as AG) and / or ascorbic acid (hereinafter referred to as VC). Therefore, the media, media additives, kits, pharmaceutical compositions, and foods and beverages of the present invention described above may contain AG and / or VC in addition to EGT. Furthermore, EGT may be used in combination with AG and / or VC in the method of promoting muscle differentiation of cells described above. The combined use of EGT with AG and / or VC can further promote muscle differentiation and muscle regeneration.

[0040] AG is a vitamin C derivative in which glucose is bound in an α-coordinate to the hydroxyl group at the 2-position of ascorbic acid. AG is highly stable and safe for living organisms. AG has been recognized as an active ingredient in food additives and quasi-drugs, and is used, for example, as the main ingredient in whitening cosmetics or as a nutritional fortifier in foods. VC, also known as vitamin C, is a substance with antioxidant properties widely found in nature. VC is used as an antioxidant and nutritional fortifier in foods, pharmaceuticals, quasi-drugs, cosmetics, and other products. Therefore, the culture medium, medium additive, kit, pharmaceutical composition, and food and beverage of the present invention containing AG and / or VC, as well as the method of promoting muscle differentiation of cells using AG and / or VC of the present invention, are highly safe for cells and living organisms. The VC used in the present invention may be in the free form or in the form of a salt. Examples of VC salts include, but are not limited to, sodium salt, potassium salt, and calcium salt.

[0041] Furthermore, as mentioned above, the present inventors have found for the first time that AG alone promotes muscle differentiation, VC alone promotes muscle differentiation, and the combined use of AG and VC also promotes muscle differentiation.

[0042] (a) Medium containing AG and / or VC for promoting muscle differentiation. (b) Medium additives for promoting myogenic differentiation, including AG and / or VC. (c) A kit for promoting muscle differentiation containing AG and / or VC. (d) A method for promoting muscle differentiation of cells, comprising culturing the cells in a medium containing AG and / or VC. (e) A pharmaceutical composition for promoting muscle differentiation, comprising AG and / or VC. (f) A pharmaceutical composition according to (e) for promoting muscle regeneration. (g) Food and drink containing AG and / or VC for promoting muscle differentiation. (h) A food or drink as described in (g) for promoting muscle regeneration.

[0043] The amount of AG to be added to the medium of the present invention can be appropriately determined by those skilled in the art depending on the type of stem cells or muscle precursor cells (e.g., satellite cells or myoblasts) to be cultured, culture conditions such as culture temperature and culture time, medium composition, etc. For example, about 0.05 mM to about 5 mM, preferably about 0.2 mM to about 2 mM, of AG may be added to a known low-serum medium for muscle differentiation. The amount of VC to be added to the medium of the present invention is the same as the amount of AG.

[0044] The dosage of AG in the pharmaceutical composition of the present invention varies depending on the desired degree of muscle regeneration, the administration site, and the administration route, but for example, when administered orally to an adult, it may usually be about 10 mg to about 10,000 mg per day, preferably about 100 mg to about 1,000 mg. The dosage of AG can be appropriately determined by a physician, for example, based on the size and volume of the muscle. The dosage of VC in the pharmaceutical composition of the present invention is the same as the dosage of AG.

[0045] The intake of AG from the food and drink of the present invention varies depending on the desired level of muscle regeneration, the site of muscle regeneration, etc., but for example, when taken by an adult, it may usually be about 1 mg to about 10,000 mg per day, preferably about 10 mg to about 1,000 mg. The intake of VC from the food and drink of the present invention is the same as the intake of AG.

[0046] The present invention further provides the following: (i) A method for producing a medium for promoting muscle differentiation, comprising adding EGT. (j) A method for producing a medium additive for promoting muscle differentiation, comprising adding EGT. (k) A method for producing a kit for promoting muscle differentiation, comprising adding EGT. (l) A method for promoting muscle differentiation of cells, comprising culturing the cells in a medium containing EGT. (m) A method for promoting muscle differentiation in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising EGT. (n) A method described in (n) for regenerating muscle. (o) A method for promoting muscle differentiation, comprising ingesting a food or drink containing EGT. (p) A method described in (o) for regenerating muscle.

[0047] In each of the above methods, EGT may be used in combination with AG and / or VC.

[0048] The present invention further provides the following: (q) Use of EGT for the preparation of a medium for promoting muscle differentiation. (r) Use of EGT for the manufacture of a medium additive for promoting muscle differentiation. (s) Use of EGT for the production of a kit for promoting muscle differentiation. (t) Use of EGT to promote myogenic differentiation of cells in culture. (u) Use of EGT for the manufacture of a medicament for promoting muscle differentiation in a subject. (v) The above use, wherein the medicament is for regenerating muscles in a subject. (w) Use of ergoneine for the manufacture of a food or beverage to promote muscle differentiation in a subject. (x) The use described in (w), wherein the food or drink is for regenerating muscles in a subject. (y) Use of EGT to promote muscle differentiation in a subject. (z) The use described in (y) for regenerating muscle in a subject.

[0049] In each of the above uses, EGT may be used in combination with AG and / or VC.

[0050] The present invention further provides the following: (aa) A method for producing a medium for promoting muscle differentiation, comprising adding AG and / or VC. (bb) A method for producing a medium additive for promoting muscle differentiation, comprising adding AG and / or VC. (cc) A method for producing a kit for promoting muscle differentiation, comprising adding AG and / or VC. (dd) A method for promoting muscle differentiation of cells, comprising culturing the cells in a medium containing AG and / or VC. (ee) A method for promoting muscle differentiation in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising AG and / or VC. (ff) A method according to (ee) for regenerating muscle. (gg) A method for promoting muscle differentiation, comprising ingesting a food or drink containing AG and / or VC. (hh) A method described in (gg) for regenerating muscle.

[0051] The present invention further provides the following: (ii) Use of AG and / or VC for the preparation of a medium for promoting muscle differentiation. (jj) Use of AG and / or VC for the manufacture of a medium additive for promoting muscle differentiation. (kk) Use of AG and / or VC for the manufacture of a kit for promoting muscle differentiation. (ll) Use of AG and / or VC to promote myogenic differentiation of cells in culture. (mm) Use of AG and / or VC for the manufacture of a medicament for promoting muscle differentiation in a subject. (nn) The above use, wherein the medicament is for regenerating muscles in a subject. (oo) Use of AG and / or VC for the manufacture of food or beverages for promoting muscle differentiation in a subject. (pp) The use described in (oo), wherein the food or drink is for regenerating muscles in a subject. (qq) Use of AG and / or VC to promote muscle differentiation in a subject. (rr) The use described in (qq) for regenerating muscle in a subject.

[0052] The present invention will be described in more detail and specifically below with reference to examples, which are provided for illustrative purposes only and are not intended to limit the scope of the present invention. [Example]

[0053] C2C12 cells were suspended in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum (hereinafter referred to as growth medium) and cultured at 65x10 4 The cell density was adjusted to 1 / ml. 1.5 ml of the cell suspension was added to a 6-well plate and cultured for 24 hours in a 5% CO2 incubator. After removing the growth medium, 2 ml of Dulbecco's modified Eagle's medium containing 2% horse serum and 0.5 mM EGT (hereafter referred to as differentiation medium) was added to each well. The differentiation medium was replaced with fresh medium every other day, and the culture continued. The control group underwent the same procedure except that the medium did not contain EGT. After the change to differentiation medium, cell morphology was observed and photographed under a microscope (Nikon Eclipse Ts2) on day 6. The results are shown in Figure 1. The addition of EGT promoted the differentiation of C2C12 cells into muscle cells, resulting in the formation of more myotubes. [Example]

[0054] C2C12 cells were suspended in growth medium and 65x10 4The cells were adjusted to a cell density of 1000 / ml. 1.5 ml of the cell suspension was added to a 6-well plate and cultured for 24 hours in a 5% CO2 incubator. After removing the growth medium, 2 ml of differentiation medium containing 0.1 mM or 0.5 mM EGT was added to each well. The control group (hereafter referred to as NT) underwent the same procedure except that EGT was not added. After 2 days, the medium was removed and 1 ml of TRIzol (Invitrogen) was added to each well to lyse the cells. The cell lysate was collected in an Eppendorf tube and RNA was extracted according to the TRIzol protocol. The recovered RNA was used to obtain complementary DNA to mRNA using a reverse transcription kit (Takara Bio). TB Green TM Premix Ex Taq TM II (Takara Bio) according to the protocol, the obtained complementary strand DNA was ligated with the following primer DNAs (MyoD [NM_010866]: forward 5'AGTGAATGAGGCCTTCGAGA3' (SEQ ID NO: 1), reverse 5'GCATCTGAGTCGCCACTGTA3' (SEQ ID NO: 2), P PIA[NM_008907]: forward 5'GTCTCCTTCGAGCTGTTTGC3' (SEQ ID NO: 3) and reverse 5'GATGCCAGGACCTGTATGCT3' (SEQ ID NO: 4) were added to CFX96 Touch TM The gene expression levels of MyoD and PPIA were measured using a real-time PCR analysis system (Bio-Rad). MyoD is known as a master regulator that induces muscle differentiation. PPIA is known as a housekeeping gene, and PPIA gene expression level was used as an internal standard. MyoD mRNA expression level was calculated by dividing the MyoD mRNA expression level by the PPIA mRNA expression level. Figure 2 shows the gene expression level (relative value) upon EGT addition, with the MyoD mRNA expression level in NT set to 1. MyoD mRNA expression level increased depending on the EGT concentration. [Example]

[0055] C2C12 cells were suspended in growth medium and 65x10 4The cells were adjusted to a cell density of 1000 cells / ml. 1.5 ml of the cell suspension was added to a 6-well plate and cultured for 24 hours in a 5% CO2 incubator. After removing the growth medium, 2 ml of differentiation medium containing 0.5 mM EGT was added. The control group (NT) underwent the same procedure except that EGT was not added. After 2 days, the medium was removed, and 1 ml of TRIzol (Invitrogen) was added to each well, and RNA was recovered according to the TRIzol protocol. The recovered RNA was converted to complementary DNA using a reverse transcription kit (Takara Bio). TB Green TM Premix Ex Taq TM The resulting complementary strand DNA was added to the following primer DNAs (MyH2 [NM_001039545]: forward 5'GAGCAAAGATGCAGGGAAAG 3' (SEQ ID NO: 5), reverse 5'TAAGGGTTGACGGTGACACA 3' (SEQ ID NO: 6); ACTA1 [NM_001272041]: forward 5'CGACATCAGGAAGGACCTGT 3' (SEQ ID NO: 7); PPIA [NM_008907]: forward 5'GTCTCCTTCGAGCTGTTTGC 3' (SEQ ID NO: 3), reverse 5'GATGCCAGGACCTGTATGCT 3' (SEQ ID NO: 4)) using a PCR product manufactured by Takara Bio, according to its protocol. The PCR product was then purified using a CFX96 Touch PCR primer set. TM The gene expression levels of MyH2, ACTA1, and PPIA were measured using a real-time PCR analysis system (Bio-Rad). The mRNA expression levels of myosin heavy chain 2 (MyH2) and α-actin (ACTA1) were divided by the mRNA expression level of PPIA to calculate the MyH2 and ACTA1 mRNA expression levels. Figure 3 shows the gene expression levels (relative values) upon EGT addition, with the NT mRNA expression level set at 1. The addition of EGT increased the expression levels of MyH2 mRNA and ACTA1 mRNA.

[0056] (Comparative Example) C2C12 cells were suspended in growth medium and 65x10 4The cell density was adjusted to 1 / ml. 1.5 ml of the cell suspension was added to a 6-well plate and cultured for 24 hours in a 5% CO2 incubator. After removing the growth medium, 2 ml of differentiation medium containing 0.5 mM EGT or 25 μM edaravone (hereinafter referred to as Edv) or 50 μM Edv was added. Edv is a potent synthetic antioxidant. The medium was replaced with fresh medium every other day and culture continued. The control group (NT) underwent the same procedure except that it did not contain EGT. After 4 days, the medium was removed, 1 ml of TRIzol (Invitrogen) was added to each well, and RNA was recovered according to the TRIzol protocol. The recovered RNA was used to obtain complementary DNA to mRNA using a reverse transcription kit (Takara Bio). TB Green TM Premix Ex Taq TM The resulting complementary strand DNA was added to the following primer DNAs (MyH2 [NM_001039545]: forward 5'GAGCAAAGATGCAGGGAAAG3' (SEQ ID NO: 5), reverse 5'TAAGGGTTGACGGTGACACA3' (SEQ ID NO: 6); PPIA [NM_008907]: forward 5'GTCTCCTTCGAGCTGTTTGC3' (SEQ ID NO: 3), reverse 5'GATGCCAGGACCTGTATGCT3' (SEQ ID NO: 4)) using a Takara Bio Inc. (Takara Bio) kit according to the protocol. TM The gene expression levels of MyH2 and PPIA were measured using a real-time PCR analysis system (Bio-Rad). The MyH2 mRNA expression level was calculated by dividing the MyH2 mRNA expression level by the PPIA mRNA expression level. Figure 4 shows the gene expression levels (relative values) after EGT or Edv addition, with the MyH2 mRNA expression level in NT set at 1. The antioxidant Edv did not affect the MyH2 expression level in C2C12, indicating that the MyH2 expression level was not elevated solely by the antioxidant effect. [Example]

[0057] The expression levels of MyH2 and ACTA1 mRNA in C2C12 cells were examined when differentiation medium containing only EGT, EGT and AG, and AG alone was used. AA2G (registered trademark) manufactured by Hayashibara was used as AG. The EGT concentration in the differentiation medium was 0.5 mM, and the AG concentration was 1.0 mM. The experimental procedure was the same as in Example 3. The control group (NT) underwent the same procedure except that EGT and AG were not added. The results are shown in Figure 5. Addition of EGT and AG to the medium significantly increased the expression of MyH2 mRNA and ACTA1 mRNA. These results demonstrate that the combined use of EGT and AG significantly promotes muscle differentiation. Furthermore, addition of AG alone to the medium also significantly increased the expression of MyH2 mRNA and ACTA1 mRNA. These results demonstrate that the use of AG alone promotes muscle differentiation. [Example]

[0058] We examined the expression levels of MyH2 and ACTA1 mRNA in C2C12 cells cultured in a differentiation medium containing only EGT, EGT and VC, or VC alone. The EGT concentration in the differentiation medium was 0.5 mM, and the VC concentration was 0.5 mM. The experimental procedure was the same as in Example 3. The control group (NT) was treated identically except that it did not contain EGT or VC. The results are shown in Figure 6. Addition of EGT and VC to the medium significantly increased the expression of MyH2 mRNA and ACTA1 mRNA. These results demonstrate that the combined use of EGT and VC significantly promotes muscle differentiation. Furthermore, addition of VC alone to the medium also significantly increased the expression of MyH2 mRNA and ACTA1 mRNA. These results demonstrate that the use of VC alone also promotes muscle differentiation. [Industrial Applicability]

[0059] The present invention can be used in the fields of medicines, foods, research reagents, and the like. [Sequence List Free Text]

[0060] SEQ ID NO: 1 shows the nucleotide sequence of the forward primer for amplifying the MyoD gene. SEQ ID NO: 2 shows the nucleotide sequence of the reverse primer for amplifying the MyoD gene. SEQ ID NO: 3 shows the nucleotide sequence of the forward primer for amplifying the PPIA gene. SEQ ID NO: 4 shows the nucleotide sequence of the reverse primer for amplifying the PPIA gene. SEQ ID NO: 5 shows the nucleotide sequence of the forward primer for amplifying the MyH2 gene. SEQ ID NO: 6 shows the nucleotide sequence of the reverse primer for amplifying the MyH2 gene. SEQ ID NO: 7 shows the nucleotide sequence of the forward primer for amplifying the ACTA1 gene.

Claims

1. A medium containing ergothioneine for promoting muscle differentiation.

2. Claim 1 further comprising ascorbic acid 2-glucoside and / or ascorbic acid. The medium described.

3. A culture medium additive containing ergothioneine to promote muscle differentiation.

4. The medium additive according to claim 3, further comprising ascorbic acid 2-glucoside and / or ascorbic acid.

5. A kit containing ergothioneine to promote muscle differentiation.

6. The kit according to claim 5, further comprising ascorbic acid 2-glucoside and / or ascorbic acid.

7. A method for promoting muscle differentiation of myoblasts, comprising culturing myoblasts in a medium containing ergothioneine.

8. The method according to claim 7, wherein the medium further contains ascorbic acid 2-glucoside and / or ascorbic acid.

9. A pharmaceutical composition for promoting muscle differentiation, comprising ergothioneine.

10. The pharmaceutical composition according to claim 9, further comprising ascorbic acid 2-glucoside and / or ascorbic acid.

11. Foods and drinks containing ergothioneine to promote muscle differentiation.

12. The food or drink according to claim 11, further comprising ascorbic acid 2-glucoside and / or ascorbic acid.

Images