Click-modified mRNA

Abstract

The present invention relates to alkyne and / or azide modified mRNAs, methods for producing such modified mRNAs, cells transfected to contain the modified mRNAs, pharmaceutical compositions comprising the modified mRNAs or cells containing the modified mRNAs, and the use of such mRNAs, cells or pharmaceutical compositions in mRNA-based therapeutic and / or prophylactic applications. [Selection diagram] None

Description

[Technical Field]

[0001] The present invention relates to alkyne- and / or azide-modified mRNAs, methods for producing such modified mRNAs, cells transfected to contain the modified mRNAs, pharmaceutical compositions comprising the modified mRNAs or cells containing the modified mRNAs, and the use of such mRNAs, cells, or pharmaceutical compositions in mRNA-based therapeutic and / or prophylactic applications. Finally, the present invention further relates to methods for stabilizing RNA by incorporating alkyne- and / or azide-modified nucleotides, and / or methods for delivering the modified mRNAs to target cells and / or for measuring the expression of protein products encoded by the modified mRNAs. [Background technology]

[0002] Messenger RNA (mRNA) is a template molecule that is transcribed from cellular DNA and translated into amino acid sequences, or proteins, by ribosomes within an organism's cells. To control the expression level of the encoded protein, mRNA contains untranslated regions (UTRs) adjacent to the actual open reading frame (ORF) containing the genetic information encoding the amino acid sequence. These UTRs, called the 5'-UTR and 3'-UTR, are sections of mRNA located before the start codon and after the stop codon, respectively. In addition, mRNA contains a poly(A) tail region, a long sequence of adenine nucleotides that facilitates transport of mRNA from the nucleus, facilitates translation, and, to some extent, protects mRNA from degradation.

[0003] Due to its chemical and biochemical properties, mRNA is usually degraded within minutes within cells, so the expression of a specific protein is usually a transient process. Furthermore, polyanionic mRNA molecules are not well suited to crossing cell membranes, making the external delivery of mRNA extremely difficult.

[0004] Despite these challenges associated with mRNA, recent scientific and technological advances have made mRNA a promising candidate for a novel drug class. Sahin U. et al., Nat.Publ.Gr. 13, 759-780 (2014) provides an overview of mRNA-based therapeutics and drug development. mRNA can be used to trigger the in vivo production of proteins, such as antibodies and enzymes, or to stimulate immune responses, for example, by expressing specific epitopes or by innate immune responses to structural mRNA segments. For example, RIG-1 binds to the 5'-triphosphate end of RNA and triggers a signaling cascade that results in the activation of transcription factors and the release of cytokines as part of an antiviral response. The application of mRNA to stimulate immune responses can be used in novel approaches to treat cancer, AIDS, and generate vaccines for almost any disease (see Pardi, N. et al., Nat.Publ.Gr. 543, 248-251 (2017) and Schlake T. et al., RNA Biol. 9, 1319-30 (2012)). The key to these exciting developments is the robust in vitro generation of stabilized mRNA with improved translation efficiency and its delivery into cells using specialized transfection formulations.

[0005] The stability and translation efficiency of mRNA depend on several factors, particularly the untranslated regions at both ends of mRNA. In eukaryotic protein expression, the 5'-end cap structure and the 3'-end poly(A) tail both enhance mRNA stability and protein expression. Furthermore, the 5'-UTR contains a ribosome binding site necessary for translation, and the 3'-UTR contains RNA sequences that adopt secondary structures to improve stability and affect translation. Furthermore, the incorporation of modified natural (e.g., N1-methylpseudouridine) and artificial nucleotides can improve mRNA stability and enhance mRNA translation (Svitkin YV et al., Nucleic Acids Research, Vol. 45, No. 10, 6023-6036 (2017)).

[0006] Delivery of mRNA into cells can be achieved by providing a mixture containing lipids for fusion with the cell membrane and cations to neutralize the negative charge of the oligonucleotide backbone. Special formulations have been created to optimize mRNA delivery and provide sufficient in vivo stability for clinical trials. Most intravenously administered mRNA formulations are taken up by and expressed in hepatocytes. This is due to the liver's key role in fatty acid metabolism, and the high lipid content of mRNA formulations results in organ-specific targeting. However, in most cases, the liver is not the desired target. Therefore, efforts have been made to modify lipid formulations to target organs involved in the immune response, such as the spleen (Kranz LM et al., Nature 534, 396-401 (2016)). Alternatively, immune system cells (e.g., lymphocytes) can be isolated from the patient's blood to enable targeting, and mRNA delivery can be performed ex vivo. More recently, tissue-specific targeting of mRNA using antibody fragment-modified lipid formulations has been disclosed (Moffett HF et al., Nat. Commun. 8, 389 (2017)). Summary of the Invention [Problem to be solved by the invention]

[0007] Despite recent advances and developments in the therapeutic applicability of mRNA, either directly or indirectly (i.e., by ex vivo transfection of cells and injecting such transfected cells back into patients), further improving the stability of mRNA and developing new options for its use as a therapeutic or pharmaceutical agent remains a goal of ongoing research. Furthermore, it would be desirable to provide methods that allow for the rational and efficient production of therapeutic mRNA. Furthermore, there remains a need for highly targeted delivery of mRNA for protein replacement and gene replacement therapy, particularly in the treatment of genetic diseases. It would also be highly desirable to enable monitoring of delivery and protein expression. Finally, exploring further options for exploiting the immune-stimulatory effects of mRNA, for example, in cancer therapy, is another goal of ongoing research. [Means for solving the problem]

[0008] The present invention aims to provide a solution to the above-mentioned objectives and relates, inter alia, to a new class of mRNA modifications that not only allow for the stabilization of the mRNA of interest for ex vivo application and subsequent administration to human patients, animals or plants, but also allow for the easy attachment of detectable labels or functional groups that allow, for example, targeted delivery of the modified mRNA to specific cells or tissues, and for monitoring such delivery.

[0009] In a first aspect, the present invention relates to a modified mRNA comprising a 5'-cap structure, a 5'-untranslated region (5'-UTR), an open reading frame region (ORF), a 3'-untranslated region (3'-UTR), and a poly(A) tail region, wherein the mRNA comprises at least one alkyne or azide modification in a nucleotide within at least one of the ORF, the 5'-UTR, the 3'-UTR, and the poly(A) tail region. In particularly preferred embodiments of this first aspect of the invention, the modified mRNA comprises one or more detectable labels and / or functional molecules introduced by click reaction of the modified mRNA with an appropriately modified, alkyne- or azide-containing detectable label or functional molecule.

[0010] In a second aspect, the present invention relates to a method for producing modified mRNA of the present invention, comprising in vitro transcription of mRNA from template DNA in the presence of a nucleotide mixture containing nucleotides necessary for RNA transcription and an RNA polymerase, wherein at least a portion of the nucleotides in the nucleotide mixture are modified to contain alkyne or azide modifications in the nucleotides. In another embodiment of this second aspect, the modified mRNA is produced by a fermentation process. In such a process, eukaryotic or prokaryotic cells are transformed to contain genetic information (e.g., a plasmid) for producing the desired mRNA, and the growth medium contains alkyne or azide-modified nucleosides, nucleotides, or nucleotide prodrugs. In another alternative embodiment of this second aspect, the mRNA of the present invention is produced synthetically by solid-phase or phosphoramidite synthesis.

[0011] A third aspect of the present invention relates to an enzymatic method for preparing site-specific modified mRNAs of the present invention, which contain alkyne or azide modifications only in a predetermined region of the mRNA, e.g., the poly(A) tail region. Such methods involve performing a poly(A) polymerase addition reaction on the mRNA in the presence of adenosine triphosphate (ATP), wherein the ATP is at least partially alkyne or azide-modified in the nucleotides.

[0012] In particularly preferred embodiments of the second and third aspects of the invention, one or more correspondingly alkyne or azide modified detectable labels and / or functional molecules are added under conditions for performing a Click reaction to produce modified mRNA comprising such detectable labels or functional molecules.

[0013] A fourth aspect of the invention relates to a cell preparation, in particular a preparation of cells of the immune system, which comprises the modified mRNA of the invention and which is obtained by ex vivo transfection.

[0014] A fifth aspect of the present invention relates to a pharmaceutical composition comprising, as an active agent or as an immunological adjuvant, a modified mRNA of the present invention, or a cell preparation obtained by ex vivo transfection to contain such an mRNA.

[0015] Yet another, sixth aspect of the invention is a modified mRNA of the invention, a cell preparation comprising such an mRNA, or a pharmaceutical composition of the invention for use in mRNA-based therapeutic and / or prophylactic applications in humans or animals.

[0016] A further seventh aspect of the invention is the use of the modified mRNA of the invention for transfecting a plant or plant cell.

[0017] An eighth aspect of the present invention relates to a diagnostic composition for in vitro or in vivo screening for the presence, delivery and / or distribution of an mRNA of the present invention in a cell, tissue or organ, such composition comprising a modified mRNA of the present invention which comprises or is subsequently modified by a detectable label, preferably a fluorophore or radionuclide.

[0018] A ninth aspect of the present invention relates to a kit of parts for preparing and / or delivering the modified mRNA of the present invention. In a particularly preferred embodiment, such a kit also comprises one or more correspondingly alkyne- or azide-modified detectable labels or functional molecules for performing a click reaction between the modified mRNA and the modified label / functional molecule to obtain a modified mRNA comprising such detectable label and / or functional molecule.

[0019] A tenth aspect of the present invention relates to a method for stabilizing RNA, particularly mRNA, wherein alkyne and / or azide modifications are introduced during RNA synthesis and / or during poly(A) polymerase addition reactions by including at least one of the four standard types of nucleotides (ATP, CTP, GTP, and UTP), and / or another compatible, partially or fully alkyne and / or azide-modified form of an alkyne- or azide-modified nucleotide or pseudonucleotide (i.e., a nucleotide with a false or unusual structure compared to standard nucleotides). Further stabilization can be obtained by conjugating the corresponding azide and / or alkyne-modifying molecule or group to the modified RNA via a click reaction.

[0020] An eleventh aspect of the present invention is a method for qualitatively and quantitatively measuring at least one of delivery and expression of mRNA of the present invention in transfected cells by fluorescence activated cell scanning (FACS).

[0021] Detailed Description of the Invention and Preferred Embodiments The present invention employs so-called "click chemistry" or elements thereof and applies this technology to the modification of mRNA molecules to confer improved stability and / or provide for the use of such modified mRNA molecules, inter alia, in mRNA-based therapeutics and mRNA vaccine technologies.

[0022] Click chemistry is a concept defined by the Sharpless and Meldal groups in 2001 / 2002 (Sharpless, K. B. et al., Angew. Chem. 2002, 114, 2708; Angew. Chem. Int. Ed. 2002, 41, 2596; Meldal, M. et al., J. Org. Chem. 2002, 67, 3057). Since then, the copper-catalyzed reaction of azides with alkynes to give 1,2,3-triazoles (a variation of the 1,3-dipolar Huisgen cycloaddition (R. Huisgen, 1,3-Dipolar Cycloaddition Chemistry (Ed.: A. Padwa), Wiley, New York, 1984)) has become a widely used method for performing click reactions. As a result of its mild conditions and high efficiency, this reaction has found numerous applications in biology and materials science, e.g., DNA labeling for various purposes (Gramlich, PMA et al., Angew. Chem. Int. Ed. 2008, 47, 8350).

[0023] In addition to copper-catalyzed click reactions, bioorthogonal methods that do not require copper have also been developed, and all of these methods are generally applicable to the present invention. For example, strain-promoted azide-alkyne cycloaddition (SPAAC) (I.S. Marks et al., Bioconjug Chem. 2011 22(7): 1259-1263) can be used in the present invention, either alone or in combination with copper-catalyzed click chemistry (CuAAC). In particular, when it is desired to perform labeling reactions in vivo, in cell culture or in vivo, it is preferable to perform such reactions using SPAAC, as this reaction does not require the use of toxic substances or external catalysts.

[0024] Click chemistry facilitates the attachment of reporter molecules or labels to biomolecules of interest, making it an extremely powerful tool for identifying, locating, and characterizing such biomolecules. For example, this method allows the inclusion and attachment of anchor molecules to enable the separation and purification of target biomolecules or fluorescent probes for spectroscopic quantification. Numerous applications have been developed using click chemistry as a fundamental principle. Next-generation sequencing is one such application that benefits from this technology, and the formation of so-called "backbone mimics" (i.e., non-natural substitutes for phosphodiester bonds that can be generated by copper-catalyzed azide-alkyne cycloaddition (CuACC)) is used, for example, to link DNA fragments to adapter sequences. Despite the presence of a triazole ring in place of a phosphodiester bond, such backbone mimics are acceptable substrates for polymerase-driven DNA or RNA preparation methods such as PCR or reverse transcription. Cell proliferation detection is a further application area for click chemistry. A commonly applied method involves adding either BrdU or a radioactive nucleoside analog to cells during replication and detecting their incorporation into DNA. However, radioactivity-related methods are rather slow, not suitable for rapid, high-throughput studies, and are inconvenient due to the radioactivity involved. Detecting BrdU requires the use of anti-BrdU antibodies and denaturing conditions, which can lead to structural degradation of the specimen. The development of the EdU-click assay overcomes these limitations by including the thymidine analog 5-ethynyl-2'-deoxyuridine in the DNA replication reaction. Detection by click chemistry instead of antibodies is selective, simple, bioorthogonal, and does not require DNA denaturation to detect incorporated nucleosides.

[0025] In the context of the present invention, it has been discovered that alkyne and / or azide-modified nucleotides can be introduced during in vitro transcription of mRNA or during the fermentation process for producing mRNA to obtain correspondingly modified mRNA. Alkyne or azide modifications can be included in all or only some elements contained in the mRNA, and must be included in at least one region of the UTR, ORF, and poly(A) tail. Because alterations in the cap structure can interfere with the efficient binding of initiation factors such as eIF4E, eIF4F, and eIF4G, thereby dramatically reducing translation efficiency, the 5' cap structure preferably does not contain such alkyne or azide modifications. The presence of such modifications stabilizes the mRNA, on the one hand, and provides specific anchor sites for the attachment of tissue- or cell-specific ligands or targeting molecules via click chemistry or for post-enzymatic labeling. Thus, the present invention not only enables detection of the presence and location of mRNA after transfection or application, but also offers new options for targeted delivery of mRNA to specific organs or cell types for therapeutic applications. The correspondingly modified mRNA is a first subject of the present invention.

[0026] Depending on which type of nucleotide(s) is / are included in alkyne- or azide-modified form during in vitro transcription or mRNA production by fermentation in prokaryotes or eukaryotes, the resulting modified mRNA can include modifications in the 5'-UTR, 3'-UTR, ORF, and / or poly(A) tail region. As will be appreciated by those skilled in the art, for example, including one or more of modified CTP, GTP, and UTP results in modifications within the UTR and ORF, while additional inclusion of modified ATP also results in modifications in the poly(A) tail region. Including only alkyne- and / or azide-modified ATP during transcription results in modifications in the UTR, ORF, and poly(A) tail region.

[0027] No significant negative effects have been observed due to the presence of alkyne- or azide-modified nucleotides in the mRNA of the present invention. Depending on the amount of modified nucleotides included in the reaction, the efficiency of in vitro and in vivo transcription may be similar to or slightly reduced when only unmodified nucleotides are present in the reaction mixture. Furthermore, mRNA modification does not appear to impair mRNA translation during protein production in the ribosome. Depending on the situation, the amount of modified nucleotides to be included in the in vitro transcription reaction or fermentation process can be adjusted to provide either maximum mRNA yield or maximum modification. For example, if dyes are attached to mRNA as detectable labels via a click reaction, it may be desirable to include them in a moderately large amount to ensure easy detection, whereas, for targeting specific cellular receptors, it may be sufficient to include only one or a few of the respective ligand molecules to achieve the desired effect.

[0028] As will be explained in detail later, the inclusion of alkyne- or azide-modified nucleotides has an mRNA stabilizing effect. The stabilizing effect of the modifications of the present invention is expected to be most pronounced when such modifications are distributed throughout the full-length mRNA molecule. In such cases, subsequent binding of detectable labels and / or functional molecules by click chemistry can also occur uniformly throughout the entire mRNA molecule, even providing an enhanced stabilizing effect.

[0029] However, in some cases, it may be important to restrict the inclusion of a label or functional molecule to a portion of the mRNA molecule that is not involved in subsequent translation of the mRNA during protein expression. For such purposes, it may be desirable to include modified nucleotides only in the poly(A) tail region, particularly where it is certain that the presence of a long or bulky label or functional molecule (such as a ligand or targeting molecule) will not impair ribosomal activity.

[0030] Therefore, the present invention also provides modified mRNAs containing alkyne or azide modifications only in the poly(A) tail region. Instead of including alkyne or azide-modified nucleotides during the in vitro transcription or fermentation process of template DNA, modification only in the poly(A) tail region can be achieved for any desired mRNA by performing an addition reaction in the presence of poly(A) polymerase and alkyne or azide-modified ATP.

[0031] By controlling the amount and type of alkyne or azide modifications in the modified mRNA of the present invention, the resulting mRNA can be conveniently and easily adapted to provide the desired and feasible options and stabilization for post-enzymatic attachment of a molecule of interest for any intended application.

[0032] In the present invention, the azide or alkyne modification can be included in the 2'-position of the ribose unit or in the nucleobase of each nucleotide. In very specific cases, it is also possible to include a nucleotide containing this modification at the 3'-position of the ribose. In such cases, the enzymatic poly(A) addition reaction terminates after the inclusion of one modified nucleotide. In one preferred embodiment of this aspect of the present invention, the modified mRNA contains an alkyne and / or azide modification at the nucleobase or 2'-ribose position of at least one nucleotide in at least one of the UTR, ORF, and, optionally, the poly(A) tail region, and further contains a chain-terminating alkyne or azide modification at the 3'-position of the ribose in the poly(A) tail. In another preferred embodiment, the mRNA of the present invention does not contain a chain-terminating alkyne or azide modification at the 3'-ribose position in the poly(A) tail region.

[0033] The modified nucleotides contained in the mRNA of the present invention may be derived from natural nucleotides, in particular one of the standard nucleotides with adenine, cytosine, guanine or uracil bases, or may be a modification of another natural nucleotide (e.g., a pseudouridine derivative), or even a non-natural molecule (e.g., F. Eggert, S. Kath-Schorr, Chem. Commun., 2016, 52, 7284-7287) that does not negatively affect transcription and / or translation and the function of the resulting modified mRNA. Preferably, the modified nucleotide is derived from a natural nucleotide or a nucleotide naturally occurring in the mRNA.

[0034] Alkyne and azide groups suitable for Click reactions are known and available to those skilled in the art, and all such groups can be used to prepare the modified nucleotides and modified mRNAs of the present invention. The alkyne-modified nucleotide is preferably an ethynyl-modified nucleotide, more preferably 5-ethynyluridine phosphate or 7-ethynyl-7-deazaadenine phosphate. In principle, higher alkyne-modified nucleotides, particularly propynyl- or butynyl-modified nucleotides, and even ring systems containing a CC triple bond, can be employed; however, when selecting an appropriate alkyne molecule, consideration must be given to, for example, possible negative effects on transcription or poly(A) polymerase reaction efficiency and the further translation of mRNA into protein. Azide modifications to nucleotides useful in the present invention can also include, for example, azidoalkyl groups, in which the alkyl moiety is preferably a lower alkyl group, particularly a methyl, ethyl, or propyl group. It is contemplated that 5-(3-azidopropyl)-uridine phosphate or 8-azidoadenine phosphate may be preferably included in the mRNAs of the present invention. An example of an azido-modified nucleotide that causes termination of the poly(A) addition reaction is 3'-azido-2',3'-dideoxyadenine phosphate.

[0035] In principle, all nucleotides of at least one type of modified nucleotide may be alkyne or azide modified, or alternatively, only a portion of such nucleotides may be present in modified form. In a preferred embodiment of the present invention, depending on the desired modification and the rate of modification, the ratio of modified to unmodified forms of various nucleotides may range from 1:100 to 10:1, preferably 1:10 to 10:1, more preferably 1:4 to 4:1, and also preferably 1:2 to 2:1. Preferably, a 1:1, 1:4, or 1:10 combination of modified to unmodified nucleotides is contained in the mRNA of the present invention.

[0036] As described above, the presence of alkyne- or azide-modified nucleotides or nucleobases in the modified mRNA of the present invention confers a stabilizing effect. On the other hand, endoribonuclease attack is limited to some extent by internal modifications. Extension of the poly(A) tail region during poly(A) polymerase-based addition of modified ATP to the 3' end leads to a further stabilizing effect. Attack and degradation of mRNA molecules by exoribonucleases occurs at both ends of the RNA. The mRNA of the present invention contains a cap at the 5' end, providing protection from degradation on that side. Furthermore, the inclusion of a modified adenosine nucleotide at the 3' end confers further protection by preventing exoribonuclease attack from the 3' to 5' direction and delaying degradation from reaching the core mRNA, particularly the ORF.

[0037] In a preferred embodiment of the present invention, detectable labels and / or functional molecules can be introduced into modified mRNAs via a click reaction with a correspondingly modified alkyne- or azide-containing label or functional molecule. As with nucleotide modifications, suitable alkyne and azide groups are known to those skilled in the art, and preferred examples of such groups are applicable as described above. The reaction of an alkyne-modified nucleotide in a modified mRNA with an azide-containing label or functional molecule, or an azide-modified nucleotide in a modified mRNA of the present invention with an alkyne-containing label or functional molecule, is carried out under conditions conducive to a click reaction, resulting in the formation of a five-membered heterocyclic 1,2,3-triazole moiety that forms the link between the mRNA and the label or functional molecule. In the present invention, the term alkyne-containing label or functional molecule also encompasses ring systems containing a C-C triple bond, such as cyclooctyne, which have been particularly considered for in vivo labeling via SPAAC and bioorthogonal ligation reactions.

[0038] The types and sizes of the labels and functional molecules are not particularly limited and are again determined by the intended application. Preferred examples of detectable labels include labels that impart color or fluorescence, such as fluorescein derivatives such as FITC, Alexa Fluor dyes or DyLight Fluor dyes, cyanine dyes such as Cy5 and Cy3, or rhodamine dyes such as Texas Red and 5-TAMRA, or any other fluorescent dye. Non-colored small molecules (e.g., biotin) can also be used if they are substrates for enzymes or binding protein-enzyme complexes (e.g., antibody-enzyme complexes) that can generate colored or luminescent products through an enzymatic reaction cascade and a further substrate. Detectable labels may also include radionuclides, preferably positron-emitting nuclides that can be detected using positron emission tomography scanning. Short-lived radionuclides, such as 18For F, the ability to rapidly and robustly label mRNA using post-mRNA click labeling may be the only viable method to obtain material for mRNA biodistribution studies using PET. Depending on the intended application, C 13 or P 33 Heavy isotopes such as are also contemplated as detectable labels in the present invention.

[0039] The functional molecule included in the modified mRNA by the click reaction is not limited, but is preferably a cell- or tissue-specific ligand that mediates targeted uptake of the mRNA into specific tissues or cells, such as cancer cells, or at least enables the mRNA to bind or anchor to the cell surface. Such cell- or tissue-specific targeting can be achieved, for example, by using specific antibodies or antibody fragments, peptides, sugar moieties, small molecules (e.g., folic acid), or fatty acid moieties as cell- or tissue-specific ligands. Each of these substances has been described for numerous targeting applications and is available to those skilled in the art. Some preferred exemplary targeting molecules are antibodies or antibody fragments or receptor ligands that target cell-specific receptors (e.g., epidermal growth factor receptors), folic acid that targets folate receptors, apolipoproteins that target endogenous low-density lipoprotein receptors, or arachidonic acid that targets endocannabinoid receptors. The amino acid sequence RGD or similar sequences has also been found to mediate cell adhesion and is also considered a preferred ligand in the present invention.

[0040] The presence of a functional molecule that binds to mRNA can further increase the stability of the mRNA against nuclease degradation, and it has been shown that partial and complete substitution of at least one of the natural nucleotides in an mRNA with an alkyne- or azide-modified analogue, and binding of a functional molecule thereto, does not interfere with translation of the mRNA molecule.

[0041] In addition to containing either alkyne- or azide-modified nucleotides, the modified mRNA of the present invention can also contain at least one nucleotide partially or completely alkyne-modified and at least one other nucleotide partially or completely azide-modified. A further option is an mRNA containing at least one type of nucleotide partially or completely alkyne-modified and partially or completely azide-modified. Such an mRNA contains two different anchor modifications, which can be attached to different labels or functional molecules in a downstream enzymatic click reaction. For example, without being limited to this particular embodiment, an alkyne-modified cell-specific targeting group and an azide-modified detectable label can be subsequently attached, resulting in another preferred embodiment of the modified mRNA of the present invention.

[0042] It is also possible and preferred in the present invention to provide modified mRNAs containing at least one azide-modified nucleotide and one alkyne-modified nucleotide, where, for example, a detectable label or functional molecule is attached to the azide-modified nucleotide via a bioorthogonal reaction (e.g., in vitro SPAAC), while the alkyne-modified nucleotide is available for downstream in vitro labeling via the CuAAC reaction. Applying CuAAC reaction conditions to dual-labeled mRNA (containing alkyne and azide functional groups) allows for the cyclization of the mRNA, which is a valuable alternative to the use of, for example, self-splicing introns (DOI: 10.1038 / s41467-018-05096-6).

[0043] For example, modified mRNAs of the invention may contain one modification in the UTR and ORF and another modification only in the poly(A) tail. Such modifications can be achieved by first performing a transcription reaction that introduces one or more modified nucleotides of a first type, followed by a poly(A) polymerase reaction using ATP containing a second type of modification.

[0044] It will be apparent to those skilled in the art that numerous modifications and combinations of modifications are possible in the present invention. Furthermore, different labels or functional groups can be included based on the presence of alkyne and / or azide modifications on the mRNA molecule, or even by sequentially adding different appropriately modified labels or functional molecules under click reaction conditions. Thus, the present invention provides a vast number of options and convenient modularity for optimally tailoring modified mRNA to the intended application.

[0045] Aside from the inclusion of alkyne- and / or azide-modified nucleotides, other modifications in nucleotides are generally permitted in the present invention to the extent that they would be unacceptable given the intended use (i.e., the modifications are compatible with the modified mRNA of the present invention), provided that such modifications do not adversely affect mRNA production or the intended use of the resulting mRNA. An example of such other modified nucleotides or nucleotide derivatives that can be included in mRNA is pseudouridine-5'-triphosphate (pseudo-UTP). Pseudouridine (or 5'-ribosyluracil) was the first modified ribonucleoside discovered. It is the most abundant naturally occurring modified RNA base and is often referred to as the "fifth nucleoside" in RNA. It can be found in structural RNAs such as transfer RNA, ribosomal RNA, and small nuclear RNA. Pseudouridine has been shown to enhance base stacking and translation. Furthermore, pseudouridine-5'-triphosphate can confer advantageous mRNA properties, such as increased nuclease stability and altered interaction between endogenous immune receptors and in vitro transcribed RNA. The incorporation of pseudo-UTP and further modified nucleotides (such as N1-methylpseudouridine and 5-methylcytidine-5'-triphosphate) into mRNA has been shown to reduce innate immune activation in culture and in vivo while simultaneously enhancing translation (B. Li et al., Bioconjugate Chemistry, 2016, 27, 849-853 and Y. Svitkin et al., Nucleic Acid Research, 2017, 45, 6023-6036). Therefore, as described herein above, the inclusion of these and other suitable and compatible nucleotides, nucleotide analogs, or non-natural molecules in alkyne- or azide-modified or unmodified forms is a further option and preferred embodiment of the present invention.

[0046] As is clear from the above description of the modified mRNA of the present invention, there are many different options for preparing or applying mRNA molecules that can be beneficially applied for various purposes. The present invention is not limited to a particular type of mRNA, but rather can be selected according to any intended use, particularly those described in the Background section above and generally or in detail below. The simple introduction of alkyne or azide modifications confers enhanced stability to mRNA molecules that can be administered to deliver genetic information for uses such as protein replacement therapy, or to deliver mRNA for immune stimulation or as an mRNA vaccine. Further modification of mRNA by downstream click coupling of modified labels or functional molecules, respectively, offers additional possibilities, particularly for screening the delivery of modified mRNA and / or for targeted delivery of mRNA to specific cells or tissues (e.g., in gene replacement therapy or to improve pharmacokinetics (e.g., slowing renal clearance by adding a PEG label)).

[0047] In the present invention, the modified mRNA of the present invention can encode a functional protein of interest. Furthermore, the modified mRNA of the present invention can encode a recombinant protein, such as a protein, peptide, or any further combination of peptides and proteins, or a chimeric protein, that can be advantageously used for a desired purpose. In particular, mRNA encoding a recombinant fusion protein (e.g., an mRNA comprising a sequence encoding a first protein or peptide linked in-frame with a sequence encoding a second protein or peptide) is considered within the context of the present invention. The second protein or peptide can be targeted to a specific location within a cell or tissue, for example. In particular, when considering monitoring the delivery and localization of the modified mRNA of the present invention or the protein encoded by that mRNA within target cells, a fusion protein of the protein of interest with a reporter protein such as green fluorescent protein (GFP) or enhanced green fluorescent protein (eGFP), or with a protein or peptide tag (e.g., a SNAP tag), is considered a further preferred embodiment of the present invention. For this purpose, the modified mRNA of the present invention can be engineered to express a fusion protein, preferably as a single protein comprising two or more distinct functions, as exemplarily outlined above. The production of two or more separate proteins by including linkers, spacers or protease cleavage sites is also contemplated.

[0048] In a preferred embodiment of the expression of a fusion protein of a protein of interest with GFP or eGFP, the localization of the fusion protein can be easily detected under a fluorescence microscope using appropriate filters. Furthermore, detection and quantification of transfected cells and protein production are also possible by other methods, preferably flow cytometry, in particular fluorescence-activated cell sorting (FACS). The above methods allow for the qualitative and quantitative screening of cells containing fluorescent molecules, either labels introduced by the click reaction or peptides or proteins (both) encoded by the mRNA itself.

[0049] In the present invention, the modified mRNA of the present invention can be used together with substances that are necessary or preferable for a specific application. For example, it is preferable to combine the mRNA with substances that facilitate cellular uptake of the mRNA, not only in ex vivo cell transfection but also in in vivo administration. Lipid formulations and nanocarriers (e.g., as described in Moffett et al. above) are preferably included in each composition and formulation of the present invention. Therefore, another subject of the present invention is a mixture of substances containing the modified mRNA and at least one of the other substances described above, or a kit of parts (kit of parts) in which the modified mRNA and at least one other suitable substance are provided in different containers for subsequent use together.

[0050] When combined with one or more other active substances, particularly one or more substances that induce an adaptive immune response, the modified mRNA of the present invention can also act as an adjuvant to enhance the innate immune response and thus the overall immunogenic effect. For example, the efficacy of substances such as protein- or peptide-based tumor vaccines can be greatly benefited by administering them with an RNA adjuvant (e.g., Ziegler et al., J. Immunol. January 11, 2107, 1601129; DOI: https: / / doi.org / 10.4049 / jimmunol.1601129, or Heidenreich et al., Int. J. Cancer. 2015 Jul 15; 137(2):372-84, DOI:10.1002 / ijc.29402). Along with improved molecular stability, the additional advantages inherent to the modified mRNA of the present invention detailed above ensure that the adjuvant properties of the modified mRNA of the present invention are comparable to or even more pronounced than unmodified RNA, and further options such as the inclusion of labels or targeted delivery by click reaction open up further perspectives.

[0051] For the above-mentioned adjuvant applications, the modified mRNA of the present invention can be combined or complexed with other substances known to those skilled in the art as optional or essential in this context, preferably cationic or polycationic compounds (see, for example, WO2010 / 037408). Complexation or combination with such other substances confers improved immunostimulatory properties, and in particular complexation with cationic elements provides a particularly strong adjuvant effect and is therefore considered a preferred embodiment of the present invention.

[0052] When intended as an adjuvant, the mRNA of the present invention does not necessarily have to encode a functional protein or peptide; rather, such non-coding RNAs that contain alkyne or azide modifications, and optionally further contain functional molecules or detectable labels introduced by a click reaction, are also included in the present invention for this purpose.

[0053] WO2010 / 037408 describes an immunostimulatory composition comprising an adjuvant component, preferably comprising at least one (m)RNA complexed with a cationic or polycationic compound, and at least one free (i.e., uncomplexed) mRNA encoding at least one therapeutically active protein, antigen, allergen and / or antibody.

[0054] In this context, the modified mRNA of the present invention can be included solely as an adjuvant component, or a combination of the modified (m)RNA of the present invention acting as an adjuvant with a further modified mRNA of the present invention that is translated into a protein, antigen, allergen and / or antibody can also be combined. For such uses, one can take advantage of the possibilities for specific targeting and delivery to cells offered by the present invention, as well as the stabilization conferred on the (m)RNA by the modifications as disclosed herein above.

[0055] Another subject of the present invention is a method for producing the modified mRNA of the present invention. According to the first method, mRNA is transcribed in vitro from a template DNA in the presence of a nucleotide mixture containing at least four standard nucleotides (ATP, CTP, GTP, UTP) necessary for mRNA transcription, and optionally a naturally occurring modified nucleotide, such as N1-methylpseudouridine triphosphate, or even a suitable artificial nucleotide, and an RNA polymerase (usually T3, T7, or SP6 RNA polymerase). Furthermore, to improve translation efficiency, it is important to generate a 5'-cap structure (e.g., 7-methylguanylate) in eukaryotes. At least a portion of at least one of the standard nucleotides, naturally occurring modified nucleotide analogs, or suitable artificial nucleotide analogs is modified to include an alkyne or azide modification in the nucleotide.

[0056] Depending on which type of nucleotide is used in the method, modifications are made either in the UTR and ORF only (with modified CTP, GTP, or UTP, or their analogs), or in all of the UTR, ORF, and poly(A) tail (with modified ATP, alone or in combination with one or more of modified CTP, GTP, or UTP, or their analogs).

[0057] Conditions and methods for performing in vitro mRNA transcription (IVT) and poly(A) polymerase addition reactions are well known to those skilled in the art (e.g., Cao, GJ et al., N. Proc. Natl. Acad. Sci. USA. 1992, 89, 10380-10384 and Krieg, PA et al., Nucl. Acids Res. 1984, 12, 7057-7070).

[0058] Such conditions and methods are not particularly important as long as a sufficient yield of modified mRNA is obtained. In this context, the type of template DNA used in the first-described method is also not particularly important. The DNA to be transcribed is usually contained in an appropriate plasmid, but may also be used in linear form. Furthermore, the template DNA usually contains a promoter sequence, particularly a T3, T7, or SP6 promoter sequence.

[0059] During the method for producing modified mRNA of the present invention, the resulting mRNA is preferably capped using well-known methods (Muthukrishnan, S., et al., Nature 1975, 255, 33-37). The reactants required for capping are commercially available, such as ARCA (P1-(5'-(3'-O-methyl)-7-methyl-guanosyl)P3-(5'-(guanosyl))triphosphate, a cap analog) (Peng, Z.-H. et al., Org. Lett. 2002, 4(2), 161-164). As the alkyne-modified nucleotide, an ethynyl-modified nucleotide is preferably used in this method, most preferably 5-ethynyl UTP or 7-ethynyl-7-deaza ATP. As the azido-modified nucleotide, preferably 5-(3-azidopropyl)UTP, 3'-azido-2',3'-dideoxyATP (only at the 3' end) or 8-azidoATP is used.

[0060] In the present invention, it is preferred to carry out the transcription process using T7 RNA polymerase to prepare template DNA in a suitable vector for efficient template generation using microorganisms and subsequent in vitro transcription after linearization of the vector.

[0061] As an alternative to in vitro transcription methods, fermentation processes in prokaryotic or eukaryotic systems to produce mRNA of the present invention are also included in the context of the present invention. For this purpose, a template DNA contained in an appropriate expression vector (preferably a plasmid containing the target DNA under the control of an RNA polymerase promoter) is usually introduced into a host cell or microorganism, and the respective nucleoside or nucleotide prodrugs described above are included in the culture medium (to ensure sufficient cellular uptake). Fermentative RNA production is known to those skilled in the art (see, for example, Hungaro et al. (J Food Sci Technol. 2013 Oct; 50(5): 958-964)).

[0062] For illustrative purposes, and not intended to be limited to such specific methods, the production of alkyne-, azide-, and click-modified mRNAs by fermentation will be described in more detail in a bacterial system. A template DNA encoding the desired mRNA under the control of an RNA polymerase promoter is introduced into bacterial cells. This is preferably accomplished by transfection of a plasmid. The sequence design is important and preferably includes all of the elements necessary for the production of the desired mRNA: an RNA polymerase promoter (e.g., a T7 or SP6 promoter); an open reading frame (ORF) of interest; and, preferably, a sequence encoding a poly(A) tract (preferably 100-120 nt in length). Furthermore, the plasmid contains an origin of replication and a selectable marker for controlled growth and amplification in cell culture. To selectively induce mRNA expression upon the addition of an external compound, it is preferable to include a genetic regulatory element (e.g., the lac operon) for the open reading frame. The poly(A) region is crucial and is necessary to distinguish the mRNA from all other RNAs (e.g., bacterial mRNA, tRNA, and rRNA) during purification and to provide sufficient stability and translation efficiency for the mRNA product. However, a poly(A) tail region may be introduced after fermentative production of the mRNA by polymerase A addition reaction as described within the context of the present invention, or a relatively short poly(A) tail can also be extended or modified.

[0063] Alkyne- or azide-modified nucleosides are added to the growth medium and taken up by bacterial cells via transporters or passive mechanisms (J. Ye, B. van den Berg, EMBO journal, 2004, 23, 3187-3195). Within the cell, these nucleosides are phosphorylated by kinases to the corresponding triphosphate, which can then be incorporated into mRNA. Because nucleoside monophosphorylation is a slow process, it is possible to increase intracellular nucleotide concentrations by providing a monophosphate prodrug of the nucleoside (as in the case of sofosbuvir).

[0064] In the case of azide-modified mRNA, click reactions using bioorthogonal chemistry, such as strain-promoted azide-alkyne cycloaddition (SPAAC), can be performed in cell culture. Therefore, it is preferable to add cyclooctyne-modified tags / labels or functional molecules to the culture medium.

[0065] The newly synthesized mRNA containing the modified nucleosides in its sequence is then purified, for example, by using poly(T) oligonucleotides bound to specific resins and / or beads (e.g., those in the Sigma Aldrich mRNA isolation kit (cat No: 000000011741985001)).

[0066] It is well known that prokaryotic mRNAs do not contain poly(A) tails, or if they do, are no longer than 20 nt, which are not long enough to allow efficient separation of the desired mRNA from prokaryotic mRNAs, as they are incorporated into poly(T) oligonucleotides bound to resins and / or beads. Therefore, fermentatively produced mRNAs that do not contain poly(A) tails or that do not contain sufficiently long poly(A) tails must be purified by other known methods, such as by chloroform-phenol extraction, precipitation, and subsequent purification of crude cellular RNA by ion-exchange chromatography.

[0067] A bacterial strain (e.g., E. coli BL21(DE)) must integrate an RNA polymerase (e.g., T7 RNA polymerase) into its genomic DNA (e.g., DE3 strain). A plasmid containing a T7 promoter is then transformed, allowing the production of mRNA if alkyne- or azide-modified nucleosides can be incorporated during in vivo transcription within the bacterial cell.

[0068] It is well known that prokaryotic mRNAs lack a 5' CAP structure. This important element of the modified mRNA of the present invention can be introduced after purification of the mRNA or can be introduced simultaneously by co-transforming the bacterial cell with another plasmid expressing a eukaryotic capping enzyme.

[0069] As a further alternative, the modified mRNA of the present invention can be produced by solid-phase or phosphoramidite synthesis, and can contain modified nucleotides as described above. Synthetic preparation can be convenient and efficient, especially when the (m)RNA is intended for use as an adjuvant, and shorter molecules or non-coding sequences are considered for such purposes. Respective methods are available to those skilled in the art and are described, for example, in Marshall, WS et al. Curr. Opin. Chem. Biol. 2004, Vol. 8, No. 3, 222-229.

[0070] In the second method of the present invention, first, a target mRNA is prepared by any suitable method, and then a modified alkyne or azide-modified ATP (or analog) is added in a poly(A) polymerase addition reaction, thereby enabling modification of only the poly(A) tail region. Such poly(A) polymerase addition reactions and suitable conditions are well known to those skilled in the art, and reaction kits for the respective reactions are commercially available.

[0071] While the first and second methods described above can be used separately to provide modified mRNAs of the present invention, a combination of in vitro transcription or synthetic mRNA generation and poly(A) polymerase addition reactions can also be used to include modified alkyne and / or azide nucleotides in the UTR, ORF, and poly(A) tail during the mRNA transcription step. Further extension of the poly(A) tail can be achieved by the second method, i.e., an additional poly(A) polymerase addition reaction, in which ATP is included, at least in part, in an alkyne- or azide-modified form (optionally in a modified form different from the modification introduced by the first method).

[0072] In the case of fermentative production of mRNA in prokaryotes, with or without a poly(A) tail region, it is also possible to include a poly(A) polymerase addition reaction to provide such a poly(A) tail or to extend an existing poly(A) tail region. In such embodiments, including a modified adenine nucleoside or adenine nucleotide prodrug for the reaction in the nutrient medium is a preferred option. Alternatively, modified nucleoside triphosphates for the mRNA fermentation process can be directly internalized using the expression of nucleotide transporter proteins (DA Malyshev, K. Dhami, T. Lavergne, T. Chen, N. Dai, JM Foster, IR Correa, Jr., FE Romesberg, Nature 2014, 509, 385-388.) or by adding artificial molecular transporters to the feed medium (Zbigniew Zawada et al., Angew. Chem. Int. Ed. 2018, 57, 9891-9895).

[0073] The mRNA production method of the present invention can be carried out using only one type of modified nucleotide, or by including one or more nucleotides containing the desired alkyne or azide modifications. In the present invention, it is preferred to include one or two types of similarly modified nucleotides, most preferably alkyne- or azide-modified uracil or adenine. As for alkyne modifications, the inclusion of an ethynyl group is most preferred, as its size is the least likely to negatively affect the transcription reaction.

[0074] In another preferred embodiment of the invention, two differently modified nucleotides are included during transcription along with a mixture of nucleotides, such a process resulting in a modified mRNA molecule containing an alkyne and an azide modification.

[0075] No particular limitations have been observed regarding the amount of modified nucleotides incorporated during transcription or fermentation or by the poly(A) polymerase reaction. In theory, all nucleotides employed in in vitro transcription methods can be modified to contain alkyne- or azide-modified nucleobases. However, it is also preferable to use one or two types of modified nucleotides and to include such nucleotides in modified and unmodified forms. Depending on the desired modification ratio, modified to unmodified forms of various nucleotides are preferably included in ratios of 1:100 to 10:1, preferably 1:10 to 10:1, and more preferably 1:4 to 4:1 or 1:2 to 2:1. Most preferably, modified nucleotides that can exist only in modified form are employed alone or in combination with unmodified forms in the above-mentioned ratios. Preferably, modified nucleotides are provided in a 1:1, 1:2, or 1:10 ratio.

[0076] The ratio of modified nucleotides introduced corresponds to the number of modifications present in the mRNA of the present invention. Thus, the ratio of modified to unmodified nucleosides within the mRNA or within various portions thereof (i.e., UTR and ORF, or UTR, ORF and poly(A) tail, or poly(A) tail alone) is also preferably 1:100 to 10:1, more preferably 1:10 to 10:1, even more preferably 1:4 to 4:1, or 1:2 or 2:1, and most preferably 1:1, 1:2, or 1:10.

[0077] To improve mRNA stability and enhance translation of the resulting mRNA, it may further be possible and desirable to include differently modified natural nucleotides (e.g., pseudouridine or N1-methyl-pseudouridine) and / or artificial nucleotides or nucleotide derivatives. Further information on differently modified nucleotides and their incorporation into mRNA during in vitro transcription can be found in Svitkin, YV et al., Nucleic Acids Research 2017, Vol. 45, No. 10, 6023-6036.

[0078] Modified mRNAs of the present invention containing at least one alkyne or azide modification, whether produced by in vitro mRNA transcription, by poly(A) polymerase addition on existing mRNAs of interest, by fermentation, or entirely synthetically, can be further modified by a click reaction to incorporate other molecules of interest, particularly labels and / or functional molecules as already described above. For example, non-colored molecules, as described above, or detectable labels, such as fluorescent or colored molecules, can be introduced. Also, as described above, providing modified mRNAs for the production of fusion proteins, including, for example, GFP or eGFP, is another preferred option for incorporating a detectable signal. As a result, for example, delivery and / or expression of the produced mRNA can be monitored using a fluorescent microscope, FACS, or other detection methods, particularly in cell culture experiments. Surprisingly, it has been observed that even relatively large modifications of bases within the ORF are tolerated during translation of the mRNA by the ribosome. For example, cyanine 5 (Cy5)-modified eGFP (enhanced green fluorescent protein) mRNA containing Cy5-modified uridine is commercially available (TRILINK biotechnologies, product code LL7701). Such mRNA is easily translated into functional protein in cell culture.

[0079] When azide- or alkyne-modified ATP or ATP derivatives are added to mRNA by poly(A) polymerase, selective modification of only the poly(A) tail region is achieved, as described above. Subsequent click-labeling of this modified poly(A) tail has minimal effect on translation (because this sequence is not translated) and can be used, for example, for tissue-specific ligands that mediate targeted uptake of mRNA or increase mRNA stability against nuclease degradation, as described above. Conjugation via the poly(A) tail may be a preferred or even essential approach, particularly when very large molecules or molecules that otherwise impair translation are to be bound.

[0080] The click reaction is well known to those skilled in the art and is generally referred to in Sharpless et al. and Meldal et al., supra. The overall conditions for the click reaction are described in these documents, and further reference is made to the disclosure in Himo F. ​​et al., J. Am. Chem. Soc., 2005, 127, 210-216, which relates to the preferred copper-catalyzed azide-alkyne cycloaddition (CuAAC). Regarding the click reaction conditions and reactants, reference is also made to EP 2 416 878 B1 and EP 17 194 093, which describe preferred methods for conjugating a first molecule to a second molecule in a click coupling reaction. In this context, the copper-catalyzed click reaction is preferably carried out in the presence of a divalent metal cation in the reaction mixture, most preferably Mg. 2+ It is preferable to carry out the reaction in the presence of

[0081] The above-mentioned documents describe click reactions for the binding of DNA molecules, and the same conditions can generally be applied to the present invention. Therefore, the click reaction is preferably carried out in the presence of a heterogeneous Cu(I) catalyst. Furthermore, it is preferable to include a stabilizing ligand for Cu(I) and / or an organic solvent, especially DMSO, and / or a divalent cation to improve the efficiency of the click reaction (e.g., as disclosed in PCT / EP2018 / 076495).

[0082] In a further preferred embodiment, the click reaction is carried out as a strain-promoted azide-alkyne cycloaddition (SPAAC), as described above in connection with the modified mRNA of the present invention. The exact conditions for the CuAAC or SPAAC reaction can be adapted to individual circumstances, as long as the basic requirements known to those skilled in the art are observed. As described above, SPAAC can also be carried out inside cells. Introducing an alkyne- or azide-modified label into such cells can be useful, for example, to monitor the location of the mRNA within the cell after transfection of the modified mRNA into the cell.

[0083] The present invention allows for the modular and highly efficient generation of modified mRNA molecules containing modifications that confer a stabilizing effect on the mRNA. The modifications are also useful as anchor molecules to which other substances and molecules can be attached via a click reaction. Such click reactions are preferably performed separately from and downstream of the transcription reaction, which is particularly advantageous when attaching large, bulky molecules of interest to the mRNA that would otherwise completely disrupt the transcription reaction.

[0084] In the present invention, the incorporation of only a small set of alkyne- and / or azide-modified nucleotides during in vitro mRNA production may be sufficient to enable the synthesis of a full range of highly modified mRNAs. This allows for the rapid preparation and screening of many modifications. Furthermore, the mRNAs and methods for their production of the present invention allow the incorporation of functional groups that are not readily or not at all accepted by RNA polymerase during mRNA production, but are easily attached by a click reaction after transcription. The incorporation of such functional groups cannot be achieved by conventional methods.

[0085] Thus, the mRNAs of the present invention and methods for their production provide for the first time an easy and reliable method for generating stabilized, customarily modified mRNAs that can be labeled to track their uptake, for example, in ex vivo cell transfection, and that can be modified to provide improved cell- or tissue-specific targeting for specific uses in therapeutic or vaccine preparations.

[0086] One of the preferred uses of the mRNA of the present invention is ex vivo transfection of target cells. As mentioned in the background section, mRNA preparations administered systemically, especially intravenously, are mainly taken up by hepatocytes, but cells of the immune system are often the preferred target for producing immunostimulatory effects or when mRNA is used for direct vaccination. When it is desired to incorporate the modified mRNA of the present invention into a specific cell type, such cells can be isolated from a patient, especially from the patient's blood, and transfected with mRNA ex vivo.

[0087] Thus, a further subject of the present invention is a cell preparation, and in particular a preparation of cells of the immune system, which comprises a modified mRNA of the present invention and is obtained by ex vivo transfection of cells. In principle, the modified mRNA of the present invention can be used to transfect any type of cell, including human, animal or plant cells. In one embodiment of the present invention, the cells of the cell preparation are of animal or human origin.

[0088] This aspect of the present invention relates, inter alia, to adoptive cell transfer (ACT) and its diverse applications and uses that have been developed within the past few decades. Autologous and non-autologous cells can be treated, for example, to improve immune functionality and other characteristics. Preferably, cells of the immune system are obtained from a patient and engineered to generate autologous immune cells that have proven useful in treating various diseases, including cancer (e.g., B-cell lymphoma). CAR-T cell-based therapy is one such approach, in which T cells are genetically engineered to produce chimeric antibody receptors on their surface that recognize and bind to specific proteins or antigens on tumor cells.

[0089] The cell preparation of the present invention can be used in the same context. Depending on the modified mRNA introduced into the cells, the subsequent protein expression can provide a variety of effects of such cells after (re)administration to a patient. Therefore, the cell preparation is not limited to a few uses, but can instead be considered as a vehicle for the expression of mRNA in vivo after (re)administration of cells, which then produce the protein of interest and / or exert a certain (e.g., immunostimulatory or tolerogenic) effect in the patient due to the expression of the protein.

[0090] Methods for cell transfection are known to those skilled in the art and can be adapted to the particular cell type of interest. Examples of such methods are mentioned in Moffett et al., supra. For ex vivo transfection, immune cells are particularly susceptible to damage by some of these transfection agent components, so it is particularly preferred to use mRNAs of the present invention that are modified by the click reaction to include cell-specific targeting groups that facilitate uptake of the mRNA into cells without a transfection agent.

[0091] In addition to ex vivo transfection of cells and administering such transfected cells to patients, the modified mRNA of the present invention can also be applied directly to patients. Both cases are considered therapeutic (or prophylactic) treatments. Therefore, a further subject of the present invention is a pharmaceutical composition comprising the modified mRNA or cell preparation of the present invention as an active agent. As already mentioned, mRNA-based therapeutics have recently become an important research topic. Numerous uses of mRNA as therapeutic agents have been described (e.g., Sahin et al., Schlake et al., and Kranz et al., all cited above), and the modified mRNA of the present invention can be used for all of these uses and even provide advantages and improvements thereto. Based on the enhanced stability of the modified mRNA, and also based on the optional functional groups present, various problems can be solved. Due to the enhanced stability, for example, translation into protein is prolonged compared to unmodified mRNA. Furthermore, the presence of tissue or cell targeting groups allows for highly specific and targeted administration of therapeutic or immunogenic treatments.

[0092] Among the suitable applications of modified mRNA, cell preparations and pharmaceutical compositions comprising such mRNA or cell preparations are gene or protein replacement therapy, targeted transient gene delivery and genome engineering / gene editing (e.g., mRNA and guide RNA encoding targeted endonucleases, such as in the CRISPR / Cas9 system or its analogs), infectious disease vaccination, cancer immunotherapy, and cell-specific gene expression for the treatment of genetic diseases.

[0093] Gene replacement therapy is considered for the treatment of numerous diseases. In many diseases where the deficiency or dysfunction of a protein or enzyme is the primary cause or consequence, administration of the necessary active protein to the patient is essential to avoid immediate or consequential damage. However, continuous administration of the protein may cause intolerance or other negative side effects.

[0094] Furthermore, providing a patient with sufficient amounts of a specific protein requires administering high concentrations of such proteins, sometimes as high as 100 mg / ml, amounting to up to 20 g of protein per day per patient. A further problem in protein replacement therapy is the difficulty of administering proteins intracellularly. On the other hand, for some mRNAs, providing 50-100 μg per dose may be sufficient to achieve sufficiently high intracellular protein levels in patients. Thus, the present invention, and in particular the possibility of targeting specific cells or tissues, provides a convenient solution to the problems faced with current protein replacement therapy approaches. While current protein replacement therapies typically require intravenous infusions, which are time-consuming and physically demanding for patients, using the modified mRNA of the present invention in protein replacement therapy, for example, infusion of mRNA is sufficient in many cases.

[0095] Examples of diseases that require protein supplementation or at least regular protein supplementation include protein deficiency diseases, many metabolic diseases such as type 1 diabetes, and also genetic diseases, particularly lysosomal storage diseases (such as Morbus Gaucher or Morbus Hunter).

[0096] In gene replacement therapy, it is possible to envision the inclusion of modified mRNA in cells ex vivo as well as in vivo. In particular, when a cell- or tissue-specific targeting group is included together with the mRNA of the present invention, even the in vivo insertion of modified mRNA into target cells is expected to be highly efficient. The present invention allows endogenous translation of mRNA into protein, thus avoiding the adverse effects mentioned above. Nevertheless, ex vivo insertion of mRNA into target cells and (re)administration of such target cells to patients is also a further option in the present invention, as mentioned above.

[0097] The pharmaceutical composition of the present invention can also be used as an mRNA vaccine. Vaccination is achieved based on in situ protein expression to induce an immune response. Because any protein can be expressed from the modified mRNA of the present invention, the pharmaceutical composition offers maximum flexibility in determining the desired immune response. Furthermore, the use of modified mRNA provides a very rapid alternative to conventional methods, which require the production of various protein components or even inactivated virus particles. While conventional methods typically require different production methods, the present invention allows the production of various mRNAs encoding different proteins or protein portions related to infectious agents using the same preparation method. Immunization via mRNA vaccination can be achieved even with a single vaccination and only a low dose of mRNA. In contrast to DNA vaccines, RNA vaccines do not need to cross the nuclear membrane; rather, they only need to cross the cell membrane and reach the cytoplasm. Further information regarding the development of mRNA vaccines is disclosed, for example, in Schlake et al., supra, and is also applicable to the present invention. Pharmaceutical compositions containing the modified mRNA of the present invention can be employed as prophylactic and therapeutic vaccines. The vaccine can be directed against any type of pathogen, including viruses such as the Zika virus that has recently attracted attention (Pardi et al., supra).

[0098] In addition to vaccination against exogenous pathogens, the pharmaceutical compositions of the present invention can also be used to stimulate the immune system in cancer immunotherapy or as antitumor vaccines. In particular, systemic RNA delivery to dendritic cells or macrophages offers the possibility of exploiting antiviral defense mechanisms for cancer immunotherapy, as described in Kranz et al. (see above). For example, targeting macrophages or dendritic cells with mRNAs expressing proteins specific to or in specific types of cancer leads to the presentation of portions of such proteins by MHC molecules, eliciting a strong and specific immune response. Therefore, the modified mRNAs of the present invention can also be used in the pharmacology of antigen-encoding mRNAs.

[0099] In RNA-based immunotherapy and vaccination, it is particularly preferred to include an (m)RNA adjuvant as described above in the immunostimulatory pharmaceutical composition. The adjuvant stimulates the innate immune response, thus further enhancing the immunotherapeutic effect. In this context, the modified mRNA of the present invention and the (m)RNA adjuvant of the present invention can have the same or similar sequences and even encode the same protein. Meanwhile, non-coding (m)RNA adjuvants or (m)RNA adjuvants encoding different proteins or peptides can also be combined to achieve the desired adjuvant effect.

[0100] Targeted gene editing using specific endonucleases and guide RNAs is a further application of the modified mRNA or pharmaceutical composition of the present invention. The recently developed, revolutionary CRISPR / Cas9 technology allows for specific gene editing, allowing genes to be introduced, deleted, or silenced, and even nucleotide exchange within a gene. The method described by Charpentier and Doudna involves a ribonucleoprotein, the Cas protein, and an endonuclease that binds to specific chemically synthesized CRISPR RNA (crRNA) sequences and cleaves DNA in the vicinity of such RNA sequences. To direct the endonuclease activity to a desired target DNA sequence, a so-called guide RNA, complementary to the target DNA sequence, is used. The guide RNA can take two forms: a complex of a chemically synthesized long trans-activating CRISPR RNA (tracrRNA) and crRNA, or a synthesized or expressed single guide RNA (sgRNA) consisting of both tracrRNA and crRNA as a single construct. In this context, the modified mRNA of the present invention can be used to encode one or both of an endonuclease and a guide RNA, preferably as an sgRNA complementary to a specific DNA sequence of interest.

[0101] A major advantage of transient expression of gene-editing endonucleases and guide RNAs from mRNA compared to current technologies is that gene expression of these genetic tools from mRNA is limited to a short period of time (a few days) and is not constantly expressed from integrated genomic elements, reducing the risk of non-specific gene editing.

[0102] The application of gene editing is of great importance and can be applied in a variety of therapeutic applications, such as gene replacement therapy, cancer therapy, and treatment of genetic diseases, and the use of the modified mRNA of the invention in all such applications is within the scope of the present invention.

[0103] Furthermore, for other potential therapeutic applications described for mRNA in the prior art or developed in the future, the use of the respective mRNA containing the modifications described herein is advantageous due to its improved stability. Furthermore, the inclusion of tissue- or cell-specific targeting molecules in the mRNA via a downstream click reaction allows for more specific and therefore more effective therapeutic use. In particular, any desired protein expression, or any immunization reaction, can be precisely targeted to the location within the patient requiring the therapeutic or immunization effect.

[0104] A preferred embodiment of the pharmaceutical composition of the present invention comprises the modified mRNA together with a pharmaceutically acceptable carrier, excipient, and / or adjuvant, preferably a modified (m)RNA adjuvant as described above, which contains the same modifications as the modified mRNA and is complexed with a cationic or polycationic compound. In a further preferred embodiment, the pharmaceutical composition comprises a complexing agent that further protects the mRNA from degradation. The complexing agent may improve and enhance cellular uptake and concurrent translation into protein. A lipid or polymer may be included in the pharmaceutical composition as a complexing agent. In a further preferred embodiment, the pharmaceutical composition may comprise the modified mRNA encapsulated in a liposome.

[0105] In a more preferred embodiment, the pharmaceutical composition comprises a cationic lipid.Agents that further improve the delivery of nucleic acids to the cytosol can also preferably be included in the pharmaceutical composition of the present invention.Such agents can be tailored to specific delivery routes.In summary, the pharmaceutical composition of the present invention comprises the modified mRNA of the present invention as an active agent, and can also contain any additional substances to further improve the stability of the active substance, enhance delivery to the cytoplasm of target cells, and provide other complementary or synergistic effects.

[0106] The present invention includes pharmaceutical compositions containing as active agents cell preparations, particularly preparations of cells of the immune system, obtained by ex vivo transfection of cells with modified mRNA of the present invention. The transfected cells can be returned to the patient to benefit from the effects of the modified RNA contained in the cells. This preferred embodiment of the pharmaceutical composition of the present invention can also include pharmaceutically acceptable adjuvants, excipients, or carriers, as outlined above.

[0107] A further subject of the present invention is a diagnostic composition comprising a modified mRNA of the present invention or cells transformed with the modified mRNA of the present invention for in vitro or in vivo screening of the presence, delivery, and / or distribution of the mRNA of the present invention in cells, tissues, or organs. For such purposes, the modified mRNA preferably already contains a detectable label introduced by a click reaction. Preferably, such a label is a fluorophore or a radionuclide, preferably a positron-emitting radionuclide. By detecting and optionally quantifying the detectable label, delivery and distribution of the modified mRNA to cells, tissues, or organs can be monitored and detected, or the readministration of cells to a patient can be monitored. Thus, the diagnostic composition of the present invention comprises a modified mRNA of the present invention, preferably an mRNA comprising at least one detectable label. In this context, the inclusion of a modified mRNA that produces a detectable protein upon expression (e.g., a fusion protein comprising a fluorescent protein) is a further preferred embodiment.

[0108] In a further embodiment of the present invention, and as mentioned above, plant cells can also be transfected with the modified mRNA of the present invention. Such transfected plant cells are also encompassed within the scope of the present invention. The modified mRNA can be included, for example, to introduce genetic information, in particular to transiently express a specific protein in such plant cells, or for analytical or diagnostic purposes (e.g., as a labeled probe). Conferring disease or pest resistance or tolerance are just some examples of the possible uses and beneficial effects of introducing the mRNA of the present invention into plant cells or plants. Therefore, the use of the modified mRNA of the present invention for transfection of plant cells or plants is also a subject of the present invention.

[0109] A further subject of the present invention is a kit for preparing the modified mRNA of the present invention. Such a kit comprises various materials necessary for preparing the modified mRNA by in vitro transcription, fermentation, or poly(A) polymerase addition reaction, namely, RNA polymerase and / or poly(A) polymerase, alkyne- or azide-modified and unmodified nucleotides, and, optionally, additional buffer substances and solvents or other materials necessary for this process. In a preferred embodiment, the kit also comprises an alkyne- and / or azide-modified detectable label or functional molecule, as well as materials necessary for performing a click reaction between the modified mRNA and the label or functional molecule. A further subject of the present invention is a kit for completely synthetically producing the modified mRNA of the present invention. The necessary materials may be provided in separate containers or may be mixed together, provided that no adverse reactions occur between the mixed materials. The various materials contained in such a kit of parts have been mentioned above in connection with the modified mRNA of the present invention and the method for preparing such modified mRNA. As far as the preparation of modified (m)RNA adjuvants is concerned, such kits preferably also contain cationic or polycationic compounds that are used to complex with the (m)RNA according to preferred embodiments. Kits of the invention may also contain additional substances that facilitate the delivery of modified mRNA of the invention to cells, ex vivo or in vivo.

[0110] In a preferred embodiment, the kit comprises at least one modified mRNA of the invention, preferably comprising a detectable label or functional molecule introduced by a Click reaction, or the modified mRNA and the alkyne or azide modified label and / or functional molecule, and optionally other Click reagents, are provided in separate containers.

[0111] In a further embodiment of the present invention, a kit for delivering modified mRNA to a patient comprises mRNA and preferably also an (m)RNA adjuvant, both modified according to the present invention. The modified mRNA and the modified (m)RNA adjuvant can be contained in one single container or in separate containers, both of which may optionally contain an alkyne- or azide-modified label or functional molecule already attached by a click reaction or present in a separate container for subsequent click reaction. The kit may further comprise other pharmaceutically acceptable carriers and adjuvants, also in separate containers or mixed with at least one other component of the kit.

[0112] It will be apparent to one skilled in the art that the kits can contain many different combinations of materials that facilitate the preparation or use of the modified mRNA of the present invention. All of the embodiments and variations thereof described above in the present invention are also applicable to the kits described herein. For purposes of the present invention, all suitable combinations of materials are included.

[0113] A further subject of the present invention relates to a method for stabilizing RNA, particularly mRNA, which comprises introducing alkyne and / or azide modifications during RNA synthesis and / or during poly(A) polymerase addition reactions by partially or completely including at least one of the four standard nucleotides (ATP, CTP, GTP, and UTP) in alkyne and / or azide-modified form to produce modified (mRNA). As described above, the modification of RNA, particularly mRNA, by including alkyne and / or azide-modified nucleotides, and in particular by optionally including one or more detectable labels and functional molecules via a click reaction, has a stabilizing effect on the RNA molecule. Therefore, the corresponding method is considered a further important aspect of the present invention.

[0114] Another subject of the present invention is an in vitro method for qualitatively or quantitatively measuring the presence and / or expression of an mRNA of the present invention in target cells. In this context, transfection efficiency, mRNA delivery, and expression quantification can be measured with single-cell resolution by FACS analysis. Fluorescence-activated cell sorting / scanning (FACS) is well known to those skilled in the art. Fluorescent labels that can be introduced into modified mRNAs of the present invention by click reactions can be measured based on this method. Furthermore, mRNA delivery and expression of the encoded protein can be detected using fluorescent proteins (e.g., GFP or eGFP), which, as described above, can be coexpressed with the protein of interest in a preferred embodiment, either as a fusion protein or as two separate proteins.

[0115] Therefore, the expression level of the protein encoded by the modified mRNA of the present invention and the effect of the modification on cell transfection can be easily determined using FACS analysis. Also, the effect of different labels on the expression level can be studied by FACS analysis.

[0116] In such FACS analysis, for example, a fluorescent signal can be detected by comparing non-transfected cells with transfected cells, where the fluorescent signal may be due to a fluorescent label contained in the modified mRNA of the invention or to a fluorescent protein expressed by translation of the modified mRNA of the invention. Also, by comparing transfection reactions of the same target cells with modified mRNA of the invention and unmodified mRNA having the same nucleotide sequence, it can be ensured that the modification itself does not negatively affect transfection efficiency.

[0117] All information disclosed above in relation to one subject of the present invention is considered to be equally applicable, even if not explicitly repeated, in the context of other subjects to which this information has perceptible relevance within the context of the invention. The present invention encompasses, for example, the following embodiments: [Embodiment 1] A modified messenger RNA (mRNA) comprising a 5'-cap structure, a 5'-untranslated region (5'-UTR), an open reading frame region (ORF), a 3'-untranslated region (3'-UTR), and a poly(A) tail region, characterized in that it contains at least one alkyne or azide modification in at least one nucleotide within at least one of the ORF, 5'-UTR, 3'-UTR, and poly(A) tail region. [Embodiment 2] The modified mRNA of embodiment 1, comprising modified nucleotides in the following region: a) ORFs and UTRs, b) ORF, UTR and poly(A) tail, or c) Poly(A) tail only. [Embodiment 3] A modified mRNA according to embodiment 1 or 2, in which at least one of the four standard types of nucleotides (AMP, CMP, GMP, UMP) is partially or completely modified, preferably uracil or adenine is ethynyl or azide modified. [Embodiment 4] A modified mRNA according to any one of embodiments 1 to 3, wherein at least one nucleotide is alkyne-modified and at least one nucleotide is azide-modified. [Embodiment 5] A modified mRNA described in any of embodiments 1 to 4, wherein at least one of the four standard types of nucleotides is present in a modified form at a ratio of 1:100 to 10:1, preferably 1:10 to 1:10 or 1:1, compared to the unmodified form. [Embodiment 6] A modified mRNA according to any one of embodiments 1 to 5, characterized in that it contains a natural or artificial nucleotide modified by another method, preferably pseudouridine or N1-methylpseudouridine. [Embodiment 7] The modified mRNA described in any one of embodiments 1 to 6, wherein the modified mRNA comprises one or more detectable labels and functional molecules introduced by a click reaction between the modified mRNA and a correspondingly modified detectable label or functional molecule containing an alkyne or azide. [Embodiment 8] The modified mRNA described in embodiment 7, wherein the detectable label is a colored or fluorescent molecule and / or the functional molecule is a tissue- or cell-specific targeting group or ligand, preferably a sugar moiety or a fatty acid moiety. [Embodiment 9] A modified RNA comprising at least one alkyne or azide modification in at least one nucleotide, or a modified mRNA according to any one of embodiments 1 to 8, wherein the modified RNA is complexed with a cationic or polycationic compound. [Embodiment 10] A method for producing modified mRNA according to any one of embodiments 1 to 9, comprising in vitro transcription of mRNA from template DNA, or alternatively, a fermentation process using a prokaryotic or eukaryotic host cell to express template DNA contained in an expression vector, wherein the method is carried out in the presence of an RNA polymerase and a nucleotide mixture containing the four standard nucleotide types required for mRNA transcription, and wherein at least a portion of at least one of the four types of nucleotides in the nucleotide mixture has been modified to include an alkyne or azide modification. [Embodiment 11] A method for producing a modified mRNA containing an alkyne or azide modification in the poly(A) tail, the method comprising performing a poly(A) polymerase addition reaction at the poly(A) tail on the mRNA in the presence of ATP, wherein the ATP is at least partially alkyne or azide modified at adenosines. [Embodiment 12] The method described in embodiment 10 or 11, further comprising adding an appropriately alkyne- or azide-modified detectable label and / or functional molecule under conditions for performing a click reaction to produce the modified mRNA described in embodiment 7 or 8. [Embodiment 13] Cells obtained by ex vivo transfection of a corresponding human, animal, or plant parent cell with the modified mRNA described in any one of Embodiments 1 to 9. [Embodiment 14] The cell described in embodiment 13, wherein the cell is a cell of the immune system of a human or animal. [Embodiment 15] A pharmaceutical composition comprising as an active agent a modified mRNA described in any one of embodiments 1 to 9 or a cell described in embodiment 13 or 14, optionally in combination with a pharmaceutically acceptable adjuvant or excipient and / or contained in a pharmaceutically acceptable carrier. [Embodiment 16] A modified mRNA according to any one of embodiments 1 to 9 or a pharmaceutical composition according to embodiment 15 for use in mRNA-based therapeutic and / or prophylactic applications. [Embodiment 17] The modified mRNA according to any one of embodiments 1 to 9 or the pharmaceutical composition according to embodiment 15, particularly for use in the therapeutic and / or prophylactic applications described in embodiment 16, wherein the therapeutic and / or prophylactic applications include use as targeted delivery or an immunological adjuvant in targeted gene therapy in combination with a specific endonuclease (e.g., CRISPR / Cas9) encoded by the mRNA, in gene replacement therapy, in vaccination, in cancer treatment, and for cell-specific gene expression or gene editing for the treatment of (genetic) diseases and genetic abnormalities. [Embodiment 18] A modified mRNA according to any one of embodiments 1 to 9 or a pharmaceutical composition according to embodiment 15, for use in humans or animals, particularly for therapeutic and / or prophylactic purposes as described in embodiment 16 or 17. [Embodiment 19] Use of a modified mRNA described in any one of embodiments 1 to 9 for transfection into plants and plant cells. [Embodiment 20] A kit for producing and / or delivering a modified mRNA according to any one of embodiments 1 to 9. [Embodiment 21] A diagnostic composition for in vitro screening for the presence, delivery and / or distribution of a modified mRNA described in any of embodiments 1 to 9 in a cell, tissue or organ, the composition comprising an mRNA comprising a detectable label, preferably a fluorophore label or a radionuclide label. [Embodiment 22] A diagnostic composition for use in in vivo screening for the presence, delivery and / or distribution of modified mRNA described in any of embodiments 1 to 9, or for in vivo monitoring upon re-administration of cells described in embodiment 13 or 14, wherein the composition comprises modified mRNA comprising a fluorophore label or a radionuclide label, or the cells are transfected with modified mRNA comprising a fluorophore label or a radionuclide label. [Embodiment 23] A method for stabilizing RNA, particularly mRNA, comprising introducing alkyne and / or azide modifications in a poly(A) polymerase addition reaction and / or during RNA synthesis by including at least one of the four standard types of nucleotides (ATP, CTP, GTP, and UTP) in partially or completely alkyne and / or azide modified form to produce modified (m)RNA, and optionally introducing one or more detectable labels and functional molecules by click reaction of the modified (m)RNA with an appropriately modified, alkyne- or azide-containing detectable label or functional molecule. [Embodiment 24] An in vitro method for qualitatively or quantitatively measuring the delivery and transfection of a modified mRNA described in any of embodiments 1 to 9 into a target cell by fluorescence-activated cell scanning analysis, wherein the modified mRNA comprises one or more fluorogenic molecules introduced into the modified mRNA by a click reaction with a correspondingly modified fluorogenic molecule containing an alkyne or azide, and / or the modified mRNA encodes a fluorescent protein. [Embodiment 25] An in vitro method described in embodiment 24, in which the fluorescent signal emitted by the fluorogenic molecule or fluorescent protein is measured for target cells transfected with the modified mRNA and compared with untransfected target cells. [Brief explanation of the drawings]

[0118] [Figure 1]Figure 1 shows a general scheme for the generation and use of modified mRNA. For example, 5-ethynyl UTP (EUTP) can be used to insert an alkyne group that can be used for click reactions with the 5'-UTR, 3'-UTR, and ORF. Selective labeling of the poly(A) tail is possible using, for example, 7-ethynyl 7-deazaATP and poly(A) polymerase. [Figure 2] FIG. 2 shows a general scheme for producing alkyne-modified mRNA using, for example, T7 RNA polymerase and mixed nucleotides including EUTP (structural formula). [Figure 3] FIG. 3 shows the results of transfection of non-alkyne (A), alkyne (B), and dye (C) modified mRNAs encoding eGFP into HeLa cells. [Figure 4] FIG. 4 shows a general scheme for producing alkyne-modified mRNA, for example, using poly(A) polymerase and the alkyne-modified nucleotide EATP (structural formula). [Figure 5] FIG. 5 shows the results of transfection of Eterneon red 645-modified mRNA (alkyne modification only in the poly(A) tail) encoding eGFP into HeLa cells. [Figure 6] 6 shows the map and complete sequence (from the T7 promoter to the poly(A) tail) of the plasmid used in linearized form as template DNA in the T7 RNA polymerase reaction in the examples. This sequence is also referred to as SEQ ID NO:2. [Figure 7] FIG. 7 shows the results of experiments to demonstrate EATP incorporation into the poly(A) tail of RNA, as described in Example 3. [Figure 8] FIG. 8 shows a general scheme for generating site-specific azide-modified mRNA (a single azide only at the end of the poly(A) tail) using yeast poly(A) polymerase and the azide-modified nucleotide AzddATP, as described in Example 4. [Figure 9]Figure 9 shows the transfection of 3'-poly(A)-tailed Cy3-modified mRNA encoding eGFP into HeLa cells. After 24 hours of incubation at 37°C, green fluorescence of eGFP was observed (eGFP filter). For Cy3-labeled mRNA, the localization of mRNA was observed using a Cy3 filter setting. [Figure 10] FIG. 10 shows a general scheme for generating dual-labeled azide / alkyne-modified mRNA (an internal alkyne group using T7 RNA polymerase and EUTP, and one terminal azide at the 3′ end using AzddATP and yeast poly(A) polymerase), as in Example 5. [Figure 11] Figure 11 shows the transfection of eGFP-encoding Cy3-modified mRNA with internal Eterneon Red modification and a 3'-poly(A) tail into HeLa cells. After 24 hours of incubation at 37°C, green fluorescence of eGFP was observed (eGFP filter). For Cy3-labeled mRNA, the localization of mRNA was observed using the Cy3 filter setting, and for Eterneon Red-labeled mRNA, the localization of mRNA was observed using the Cy5 filter setting. [Figure 12] FIG. 12 shows the results of FACS analysis on untransfected HeLa cells. [Figure 13] FIG. 13 shows the results of FACS analysis on HeLa cells transfected with unmodified mRNA encoding eGFP. [Figure 14] FIG. 14 shows the results of FACS analysis of HeLa cells transfected with alkyne-modified mRNA encoding eGFP. [Figure 15] Figure 15 shows the results of FACS analysis of HeLa cells transfected with Eterneon Red / alkyne-modified mRNA encoding eGFP, allowing quantification of protein expression dependent on modification and uptake of dye-labeled mRNA. [Figure 16]Figure 16 shows the results of FACS analysis of HeLa cells transfected with Eterneon Red / alkyne-modified mRNA encoding eGFP, allowing quantification of protein expression dependent on modification and uptake of dye-labeled mRNA. [Figure 17] Figure 17 shows a schematic diagram of one embodiment of the present invention: bacterial cells are fed, for example, with 5-ethynyluridine, and transformed with a plasmid containing the sequences necessary for the production of mRNA. The newly synthesized mRNA containing EU is then purified by poly(T) resin and / or beads coupled to poly(T) oligonucleotides. DETAILED DESCRIPTION OF THE INVENTION

[0119] The following examples further illustrate the present invention: [Example]

[0120] Example 1 Alkyne-modified mRNA encoding enhanced green fluorescent protein (eGFP) was generated from template DNA by in vitro transcription (IVT) using T7 RNA polymerase and mixed nucleotides. For transfection into Henrietta Lacks immortalized cells (HeLa cells), 5-ethynyluridine-5'-triphosphate (EUTP) was included in the mixed nucleotides to generate alkyne-modified mRNA, as shown in Figure 2. The generated mRNA contained a 5' cap, untranslated region (UTR), protein-coding portion (open reading frame, ORF), and poly(A) tail.

[0121] (mRNA generation) In a 50 μL reaction, 20 units of T7 RNA polymerase, 1 μg of template DNA, and an appropriate amount of nucleotides were mixed in a transcription reaction buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 4 mM spermidine, 10 mM DTT).

[0122] A) Final nucleotide concentrations for non-alkyne-modified mRNA production were: 1.0 mM GTP, 4.0 mM ARCA (P1-(5'-(3'-O-methyl)-7-methyl-guanosyl)P3-(5'-(guanosyl)) triphosphate, cap analog), 1.25 mM CTP, 1.25 mM UTP, 1.25 mM ΨUTP (pseudouridine triphosphate), 1.5 mM ATP.

[0123] B) Final nucleotide concentrations for alkyne-modified mRNA production were: 1.0 mM GTP, 4.0 mM ARCA (P1-(5'-(3'-O-methyl)-7-methyl-guanosyl)P3-(5'-(guanosyl)) triphosphate, cap analog), 1.25 mM CTP, 1.25 mM EUTP (5-ethynyluridine triphosphate), 1.25 mM ΨUTP (pseudouridine triphosphate), 1.5 mM ATP.

[0124] C) Final nucleotide concentrations for alkyne-modified mRNA generation and subsequent click labeling were: 1.0 mM GTP, 4.0 mM ARCA (P1-(5'-(3'-O-methyl)-7-methyl-guanosyl)P3-(5'-(guanosyl)) triphosphate, cap analog), 1.25 mM CTP, 0.625 mM EUTP (5-ethynyluridine triphosphate), 0.625 mM ΨUTP (pseudouridine triphosphate), 0.625 mM UTP, 1.5 mM ATP.

[0125] The mixture was incubated at 37°C for 2 hours, after which 2 units of DNAse I was added and incubated at 37°C for 15 minutes. The mRNA was purified by spin column method according to the manufacturer's instructions for PCR products (PCR purification kit, Qiagen). The resulting mRNA amounts were 13.3 μg from A, 12.3 μg from B, and 14.3 μg from C. These were used directly for transfection when click labeling was not required (A and B). When click labeling was performed (C), 2 μg RNA, 1 nmol Eterneon Red 645 Azide (baseclick GmbH), one reactor pellet, and 0.7 μL 10x Activator were used. 2 (baseclick GmbH, Oligo 2 The reaction mixture was incubated at 45°C for 30 minutes and purified using a spin column according to the manufacturer's instructions for PCR products (Qiagen PCR purification kit).

[0126] Transfection was performed using a commercially available kit (jetMESSENGER) according to the manufacturer's instructions. TM The experiment was carried out using POLYPLUS TRANSFECTION®, 0.5 μg of mRNA, and 25,000 confluent HeLa cells (CLS GmbH). The cells were incubated at 37°C for 24 hours before analysis by fluorescence microscopy. A GFP filter (470 / 22 excitation; 510 / 42 emission) and a Cy5 filter (628 / 40 excitation; 692 / 40 emission) were used for the analysis.

[0127] Figure 3 shows the results of transfection of HeLa cells with mRNA encoding eGFP modified with non-alkyne (A), alkyne (B), and dye (C). After 24 hours of incubation at 37°C, green fluorescence of eGFP was observed (GFP filter). In the case of Eterneon Red-labeled mRNA (C), mRNA localization was observed using a Cy5 filter setting.

[0128] Brightfield images of HeLa cells showed healthy cell morphology (Figure 3, A-C). Using a GFP filter, eGFP protein expression was visualized (A-B: 120 ms exposure time, C: 250 ms exposure time). Click-labeled mRNA (Figure 3, C) also showed mRNA localization using the Cy5 filter setting on the microscope.

[0129] (Supplementary information) Structures of modified nucleotides used during the T7 RNA polymerase reaction described above. [ka]

[0130] The map and complete sequence (from the T7 promoter to the poly(A) tail) of the plasmid used in linearized form as template DNA in the T7 RNA polymerase reaction described above is shown in Figure 6. The sequence is also referred to as SEQ ID NO:2.

[0131] Example 2 Alkyne-modified mRNA encoding enhanced green fluorescent protein (eGFP) was generated by in vitro transcription (IVT) using T7 RNA polymerase and a nucleotide mixture from template DNA (Figure 6). For subsequent click modification and transfection into Henrietta Lacks immortalized cells (HeLa cells), 7-ethynyladenine-5'-triphosphate (EATP) was incorporated into the IVT mRNA after the T7 RNA polymerase reaction with poly(A) polymerase to generate the alkyne-modified mRNA, as shown in Figure 4. The generated mRNA contains a 5' cap, untranslated region (UTR), protein-coding portion (open reading frame, ORF), and an alkyne-labeled poly(A) tail.

[0132] (mRNA generation) In a 50 μL reaction volume, 20 units of T7 RNA polymerase, 1 μg of linearized template DNA, and an appropriate amount of nucleotides were mixed in a transcription reaction buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 4 mM spermidine, 10 mM DTT).

[0133] The final nucleotide concentrations for non-alkyne-modified mRNA production were: 1.0 mM GTP, 4.0 mM ARCA (P1-(5'-(3'-O-methyl)-7-methyl-guanosyl)P3-(5'-(guanosyl)) triphosphate, cap analog), 1.25 mM CTP, 1.25 mM UTP, 1.25 mM ΨUTP (pseudouridine triphosphate), 1.5 mM ATP.

[0134] The mixture was incubated at 37°C for 2 hours, followed by the addition of 2 units of DNAse I and incubation at 37°C for 15 minutes. The mRNA was purified by spin column chromatography according to the manufacturer's instructions for PCR products (Qiagen PCR purification kit). The resulting mRNA (12.3 μg) was used directly in a poly(A) polymerase reaction with EATP.

[0135] In a reaction volume of 20 μL, a solution of 5 units of E. coli poly(A) polymerase, 4.2 μg of the previously prepared mRNA, and 1 mM EATP was combined in reaction buffer (250 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl, pH 7.9).

[0136] The mixture was incubated at 37°C for 1 hour. The mRNA was purified by spin column method according to the manufacturer's instructions for PCR products (PCR purification kit, Qiagen). The obtained mRNA was 4 μg.

[0137] For click labeling, 1.1 μg RNA, 1 nmol Eterneon Red 645 Azide (baseclick GmbH), one reactor pellet, and 0.7 μL 10x Activator 2 (baseclick GmbH, Oligo 2 The reaction mixture was incubated at 45°C for 30 minutes and purified using a spin column according to the manufacturer's instructions for PCR products (Qiagen PCR purification kit).

[0138] Transfection was performed using a commercially available kit (jetMESSENGER) according to the manufacturer's instructions. TM The experiment was carried out using POLYPLUS TRANSFECTION®, 0.5 μg of mRNA, and 25,000 confluent HeLa cells (CLS GmbH). The cells were incubated at 37°C for 24 hours before analysis by fluorescence microscopy. A GFP filter (470 / 22 excitation; 510 / 42 emission) and a Cy5 filter (628 / 40 excitation; 692 / 40 emission) were used for the analysis.

[0139] Figure 5 shows the results of transfection of HeLa cells with mRNA encoding eGFP modified with Eterneon Red. After 24 hours of incubation at 37°C, green fluorescence of eGFP was observed (GFP filter). For Eterneon Red-labeled mRNA, mRNA localization was observed using a Cy5 filter setting.

[0140] Brightfield images of HeLa cells showed healthy cell morphology (Figure 5). Using a GFP filter, eGFP protein expression was visualized (exposure time 120 ms). Et-Red-labeled mRNA localization was observed using the Cy5 filter setting on the microscope.

[0141] Example 3 To demonstrate the incorporation of EATP (ethynyl adenosine-5'-triphosphate) into the poly(A) tail, a short RNA oligonucleotide (31 mer, CUAGUGCAGUACAUGUAAUCGACCAGAUCAA, SEQ ID NO: 2) was used as a template in a poly(A) polymerase reaction with: A) 1mM ATP B) 1 mM EATP C) 0.5 mM ATP and 0.5 mM EATP. In a 20 μL reaction volume, 5 units of E. coli poly(A) polymerase, 2 μg of RNA (31-mer), and nucleotides (final concentrations A–C) were combined in reaction buffer (250 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl, pH 7.9). The mixture was incubated at 37°C for 30 minutes or 16 hours.

[0142] The results were analyzed by denaturing polyacrylamide gel electrophoresis (7 M urea, 1x TBE, 7% polyacrylamide gel, constant voltage 100 V, 1 hour). Compared to the template RNA oligonucleotide (Figure 7, lane 2), all samples incubated with different nucleotides in the presence of poly(A) polymerase for different incubation times (Figure 7, lanes 3-7) showed bands or smears at high molecular weights. This indicates successful incorporation of ATP or its alkyne analog, EATP. When incubation was within 30 minutes, incorporation of ATP (Figure 7, lane 3) was more efficient than EATP (Figure 7, lane 4) or a mixture of EATP and ATP (Figure 7, lane 5). Extending the incubation time for EATP incorporation to 16 hours increased the length of the poly(EA) adduct (Figure 7, lane 6) compared to 30 minutes of incubation (Figure 7, lane 4). Interestingly, for the nucleotide mixture containing ATP and EATP, no change was observed after 16 h compared to 30 min (Fig. 7, lane 7).

[0143] Figure 7 shows an ethidium bromide-stained 7% denaturing polyacrylamide gel of the different polyadenylation reactions, as described above. 500 ng of RNA was loaded per lane. Lane 1: low molecular weight DNA ladder (New England Biolabs); Lane 2: 31-mer RNA oligonucleotide template; Lane 3: 30-minute polyadenylation reaction using 1 mM ATP; Lane 4: same as 3 but with 1 mM EATP; Lane 5: same as 3 but with 0.5 mM EATP and 0.5 mM ATP; Lane 6: same as 4 but with a 16-hour incubation; Lane 7: same as 5 but with a 16-hour incubation.

[0144] Example 4 Azide-modified mRNA encoding enhanced green fluorescent protein (eGFP) was synthesized from template DNA by in vitro transcription (IVT) using T7 RNA polymerase and a nucleotide mixture. Following the T7 RNA polymerase reaction using yeast poly(A) polymerase, 3'-azido-2',3'-dideoxyadenosine (AzddATP) was incorporated into the IVT mRNA, thereby terminating elongation and generating a site-specific single-azide-modified mRNA. This mRNA was then transfected into Henrietta Lacks immortalized cells (HeLa cells), as shown in Figure 8. The resulting mRNA contained a 5' cap, untranslated region (UTR), protein-coding portion (open reading frame, ORF), and a poly(A) tail with a single azide at the end.

[0145] (mRNA generation) In a 50 μL reaction, 20 units of T7 RNA polymerase, 1 μg of template DNA, and several nucleotides were mixed in a transcription reaction buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 4 mM spermidine, 10 mM DTT). The final concentrations of the nucleotides were as follows: 1.0 mM GTP, 4.0 mM ARCA (P1-(5'-(3'-O-methyl)-7-methyl-guanosyl)P3-(5'-(guanosyl)) triphosphate, cap analog), 1.25 mM CTP, 1.25 mM UTP, 1.25 mM ΨUTP (pseudouridine triphosphate), 1.5 mM ATP.

[0146] The mixture was incubated at 37°C for 2 hours, followed by the addition of 2 units of DNAse I and incubation at 37°C for 15 minutes. The mRNA was purified by spin column chromatography according to the manufacturer's instructions for PCR products (Qiagen PCR purification kit). The resulting mRNA (13.7 μg) was used directly for yeast poly(A) addition with AzddATP, an azide-containing ATP analog.

[0147] In a 25 μL reaction volume, 600 units of yeast poly(A) polymerase, 5.8 μg of purified IVT mRNA, and 0.5 mM AzddATP were mixed in reaction buffer (10% (v / v) glycerol, 20 mM Tris-HCl, 0.6 mM MnCl, 20 μM EDTA, 0.2 mM DTT, 100 μg / mL acetylated BSA, pH 7.0) and incubated at 37°C for 20 minutes. The modified mRNA was purified by spin column purification according to the manufacturer's instructions for PCR products (Qiagen PCR purification kit). The resulting mRNA yield was 4.8 μg.

[0148] Click labeling was performed using a 30 μL reaction volume consisting of 4.8 μg of RNA and 2 nmol of DBCO-sulfo-Cy3 (Jena Bioscience cat. no. CLK-A140-1). The reaction mixture was incubated overnight at room temperature and purified using a spin column according to the manufacturer's instructions for PCR products (Qiagen PCR purification kit). The resulting mRNA yield was 4.0 μg.

[0149] For transfection of modified mRNA, a commercial kit (jetMESSENGER) was used according to the manufacturer's instructions. TM POLYPLUS TRANSFECTION®), 0.5 μg of Cy3-labeled mRNA, and 25,000 confluent HeLa cells (CLS GmbH) were used. Cells were incubated at 37°C for 24 hours and then analyzed by fluorescence microscopy. A GFP filter (470 / 22 excitation; 510 / 42 emission) and a Cy3 filter (531 / 40 excitation; 593 / 40 emission) were used for the analysis.

[0150] Brightfield images showed healthy HeLa cell morphology (Figure 9). Using a GFP filter, eGFP protein expression was visualized (exposure time 120 ms). Cy3-labeled mRNA localization was observed using the microscope's Cy3 filter setting.

[0151] Example 5 Azide / alkyne-modified mRNA encoding enhanced green fluorescent protein (eGFP) was generated from template DNA by in vitro transcription (IVT) using T7 RNA polymerase, a nucleotide mixture, and yeast poly(A) polymerase. Here, 5-ethynyluridine-5'-triphosphate (EUTP) was included in the nucleotide mixture to generate alkyne-modified mRNA, followed by the incorporation of 3'-azido-2',3'-dideoxyadenosine (AzddATP) to terminate elongation and introduce a single azide. This is the first example of dual-labeling of mRNA.

[0152] (mRNA generation) In a 50 μL reaction, 20 units of T7 RNA polymerase, 1 μg of template DNA, and several nucleotides were mixed in transcription reaction buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl, 4 mM spermidine, 10 mM dithiothreitol). The final concentrations of the nucleotides were as follows: 1.0 mM GTP, 4.0 mM ARCA (P1-(5'-(3'-O-methyl)-7-methyl-guanosyl)P3-(5'-(guanosyl)) triphosphate, cap analog), 1.25 mM CTP, 0.625 mM EUTP (5-ethynyluridine triphosphate), 0.625 mM ΨUTP (pseudouridine triphosphate), 0.625 mM UTP, 1.5 mM ATP.

[0153] The mixture was incubated at 37°C for 2 hours, followed by the addition of 2 units of DNAse I and incubation at 37°C for 15 minutes. The mRNA was purified by spin column chromatography according to the manufacturer's instructions for PCR products (Qiagen PCR purification kit). The resulting mRNA (13.9 μg) was used directly for yeast poly(A) addition with AzddATP, an azide-containing ATP analog.

[0154] In a 25 μL reaction volume, 600 units of yeast poly(A) polymerase, 5.8 μg of purified IVT mRNA, and 0.5 mM AzddATP were mixed in reaction buffer (10% (v / v) glycerol, 20 mM Tris-HCl, 0.6 mM MnCl, 20 μM EDTA, 0.2 mM DTT, 100 μg / mL acetylated BSA, pH 7.0) and incubated at 37°C for 20 minutes. The modified mRNA was purified by spin column purification according to the manufacturer's instructions for PCR products (Qiagen PCR purification kit). The resulting mRNA yield was 4.35 μg.

[0155] The initial click labeling (strain-promoted azide-alkyne cycloaddition, SPAAC) was performed using 4.35 μg of RNA and 2 nmol of DBCO-sulfo-Cy3 (Jena Bioscience cat. no. CLK-A140-1) in a total reaction volume of 30 μL. The reaction mixture was incubated overnight at room temperature and then purified using a spin column method according to the manufacturer's instructions for PCR products (PCR purification kit, Qiagen). The resulting mRNA yield was 2.55 μg.

[0156] The second click labeling (copper-catalyzed azide-alkyne cycloaddition, CuAAC) was performed using 2 μg of RNA and 1 nmol Eterneon Red 645 Azide (baseclick GmbH), one reactor pellet, and 0.7 μL 10x Activator. 2 (baseclick GmbH, Oligo 2 The PCR products were purified using a spin column method according to the manufacturer's instructions (Qiagen PCR purification kit).

[0157] For transfection, a commercial kit (jetMESSENGER) was used according to the manufacturer's instructions. TM POLYPLUS TRANSFECTION®), 0.5 μg of mRNA, and 25,000 confluent HeLa cells (CLS GmbH) were used. Cells were incubated at 37°C for 24 hours and then analyzed under a fluorescence microscope using a GFP filter (470 / 22 excitation; 510 / 42 emission), a Cy5 filter (628 / 40 excitation; 692 / 40 emission), and a Cy3 filter (531 / 40 excitation; 593 / 40 emission).

[0158] Brightfield images showed the cellular morphology of healthy HeLa cells (Figure 11). Using a GFP filter, eGFP protein expression was also visualized (exposure time 120 ms). Using the Cy3 and Cy5 filter settings on the microscope, the localization of Cy3- and Eterneon Red-labeled mRNA was observed, indicating dual labeling by two different molecules.

[0159] Example 6 Relative quantification of mRNA expression by fluorescence-activated cell sorting / scanning (FACS) This experiment aims to assess the expression level of in vitro transcribed (IVT) eGFP mRNA in cells using a FACS device. eGFP expression is directly monitored via fluorescence emission at 509 nm when excited at 475 nm, which can indicate whether the introduction of functional groups, such as terminal alkynes or dye molecules, into RNA alters expression levels. Furthermore, the uptake of dye-modified mRNA can be monitored in a second fluorescence channel. This allows for the detection of variations in expression levels within a cultured cell population and the assessment of the uniformity of mRNA preparations.

[0160] Three different IVT mRNAs were prepared using template DNA, T7 RNA polymerase, and different nucleotide mixtures as listed below, and then subjected to the click reaction as needed. A) Unmodified nucleotide mixture (=unlabeled eGFP mRNA) B) 5-ethynyluridine 5'-triphosphate-containing nucleotide mixture (= alkyne-modified eGFP mRNA) C) As in B, but followed by a click reaction in the presence of Eterneon Red 645 azide (Cy5 analogue, baseclick GmbH) (=Eterneon Red eGFP mRNA).

[0161] Henrietta Lacks immortalized cells (HeLa) were transfected with 2 μg of each mRNA preparation or with buffer containing no mRNA as a negative control. The cells were incubated at 37°C for 24 hours, then detached and fixed. At least 10,000 cells were analyzed using a FACS (FACS Canto II, Becton Dickinson).

[0162] All samples were analyzed using two channels: eGFP fluorescence to assess protein expression and Eterneon Red fluorescence to assess the presence of dye-labeled mRNA. This resulted in histograms and scatter plots, as shown below, for each experiment and fluorescence channel. The histograms show the number of cells counted per fluorescence intensity, and the scatter plots show the subcellular composition (SSC) as a function of fluorescence intensity (eGFP or Eterneon Red). Data from 10,000 counts (= 10,000 cells) were collected for each sample.

[0163] a) HeLa cells that were not transfected with mRNA were analyzed as a negative control to determine the endogenous fluorescence level. This allowed us to set a gate (P1) that defined the level at which cells were considered to be expressing eGFP protein when creating a scatter plot. All points within the P1 gate were considered eGFP-expressing cells with a specific fluorescence intensity. The results are shown in Figure 12.

[0164] b) When transfected with unmodified eGFP mRNA (A), almost all cells expressed fluorescent protein (red population), with a P1 equal to 96.5%. The results are shown in Figure 13. On the other hand, when HeLa cells were transfected with alkyne-modified eGFP mRNA (B), very similar results were obtained, with a P1 value of 96.4%. The results of this experiment are shown in Figure 14.

[0165] c) When HeLa cells were transfected with Eterneon Red eGFP mRNA (C), a 75% P1 population was observed. This means that even when eGFP mRNA is tethered with a bulky dye molecule, ribosomes are still able to translate functional protein at a relative expression level of approximately 78% compared to unmodified eGFP mRNA. The results are shown in Figure 15.

[0166] d) Furthermore, because the mRNA was labeled with Eterneon Red dye, we were able to observe the relative amount of mRNA per cell. When we analyzed cells that were determined not to express eGFP (light gray, gate P2), we observed that all of them corresponded to cells that had internalized only small amounts of Eterneon Red-labeled mRNA. This inference was derived from the Eterneon Red channel, where P2 (light gray) corresponds to the lowest fluorescence intensity. The results are shown in Figure 16.

Claims

1. A modified messenger RNA (mRNA) characterized in that it contains the following alkyne or azide modifications: a) a modification in at least one nucleotide in the ORF and at least one nucleotide in the UTR; or b) modification of at least one nucleotide in the ORF, at least one nucleotide in the UTR, and at least one nucleotide in the poly(A) tail; as an active agent, optionally in combination with a pharmaceutically acceptable adjuvant or excipient and / or in a pharmaceutically acceptable carrier, wherein the modified mRNA does not comprise an alkyne or azide modification of chain termination at the 3' ribose position in the poly(A) tail region.

2. 2. The pharmaceutical composition of claim 1, wherein the modified mRNA encodes a protein, a peptide, a recombinant fusion protein, or a combination of proteins, peptides, or proteins and peptides.

3. 3. The pharmaceutical composition according to claim 1 or 2, wherein in the modified mRNA at least one of the four standard types of nucleotides (AMP, CMP, GMP, UMP) is partially or completely modified, preferably uracil or adenine is ethynyl or azide modified.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein in the modified mRNA, at least one nucleotide is alkyne-modified and at least one nucleotide is azide-modified.

5. 5. The pharmaceutical composition according to any one of claims 1 to 4, wherein in the modified mRNA at least one of the four standard types of nucleotides is present in modified form in a ratio of 1:100 to 10:1, preferably 1:10 to 10:1, 1:4 to 4:1 or 1:1 compared to unmodified form.

6. 6. The pharmaceutical composition according to any one of claims 1 to 5, wherein the modified mRNA comprises alternatively modified natural or artificial nucleotides, preferably pseudouridine or N1-methylpseudouridine, and / or is complexed with a cationic or polycationic compound.

7. 7. The pharmaceutical composition of claim 1, wherein the modified mRNA comprises one or more detectable labels and functional molecules introduced by click reaction of the modified mRNA with correspondingly modified alkyne- or azide-containing detectable labels or functional molecules.

8. 8. The pharmaceutical composition of claim 7, wherein the detectable label is a colored or fluorogenic molecule and / or the functional molecule is a tissue- or cell-specific targeting group or ligand, preferably a sugar moiety or a fatty acid moiety.

9. 9. The pharmaceutical composition according to any one of claims 1 to 8, comprising a cell preparation obtained by ex vivo transfection of the modified mRNA into a corresponding human, animal or plant parent cell.

10. 10. The pharmaceutical composition of claim 9, wherein the cells are cells of the human or animal immune system.

11. A pharmaceutical composition according to any one of claims 1 to 10 for use in mRNA-based therapeutic and / or prophylactic applications.

12. 12. The pharmaceutical composition according to claim 11, wherein the therapeutic and / or prophylactic use comprises use as a targeted delivery or immunological adjuvant in targeted gene therapy in combination with a specific endonuclease (e.g. CRISPR / Cas9) encoded by the mRNA, in gene replacement therapy, in vaccination, in cancer treatment, and for cell-specific gene expression or gene editing for the treatment of (inherited) diseases and genetic abnormalities.

13. Use of modified mRNA for transfection into plants and plant cells, characterized in that the modified mRNA comprises the following alkyne or azide modifications: a) a modification in at least one nucleotide in the ORF and at least one nucleotide in the UTR; or b) Modification of at least one nucleotide in the ORF, at least one nucleotide in the UTR, and at least one nucleotide in the poly(A) tail.

14. 1. An in vitro method for qualitatively or quantitatively measuring delivery and transfection of modified mRNA into target cells by fluorescence activated cell scanning analysis, comprising: The modified mRNA is characterized in that it contains the following alkyne or azide modifications: a) a modification in at least one nucleotide in the ORF and at least one nucleotide in the UTR; or b) a modification of at least one nucleotide in the ORF, at least one nucleotide in the UTR, and at least one nucleotide in the poly(A) tail; The method, wherein the modified mRNA comprises one or more fluorogenic molecules introduced into the modified mRNA by a click reaction with a correspondingly modified fluorogenic molecule containing an alkyne or azide, and / or the modified mRNA encodes a fluorescent protein.

15. 15. The in vitro method of claim 14, wherein the fluorescent signal emitted by the fluorogenic molecule or fluorescent protein is measured for target cells transfected with the modified mRNA and compared to untransfected target cells.

16. A modified messenger RNA (mRNA) characterized in that at least one nucleotide in an ORF and at least one nucleotide in a UTR are modified with an alkyne or azide, (i) at least one of the four standard types of nucleotides is present in modified form in a ratio of 1:4 to 4:1 compared to the unmodified form; (ii) the modified mRNA comprises a functional molecule introduced by click reaction of the modified mRNA with a correspondingly modified alkyne- or azide-containing functional molecule, wherein the functional molecule is a tissue- or cell-specific targeting group or ligand; or (iii) in the ORF and UTR, at least one nucleotide is alkyne-modified and at least one nucleotide is azide-modified; The modified mRNA.

17. 17. The modified mRNA of claim 16, wherein at least one of the four standard types of nucleotides (AMP, CMP, GMP, UMP) is partially or fully modified, preferably uracil or adenine is ethynyl or azide modified.

18. 18. The modified mRNA of claim 16 or 17, wherein at least one nucleotide is alkyne-modified and at least one nucleotide is azide-modified.

19. Modified mRNA according to any one of claims 16 to 18, comprising alternatively modified natural or artificial nucleotides, preferably pseudouridine or N1-methylpseudouridine.

20. 20. The modified mRNA of any one of claims 16 to 19, wherein the modified mRNA comprises one or more detectable labels introduced by click reaction of the modified mRNA with an accordingly modified, alkyne- or azide-containing detectable label.

21. 21. The modified mRNA of claim 20, wherein the detectable label is a colored or fluorogenic molecule.

Images