Muscle breakdown inhibitor

Abstract

[Problem] To provide a novel technique capable of inhibiting muscle breakdown. [Solution] A muscle breakdown inhibitor containing glycerol phosphoric acid, a salt thereof, and / or a polymer of these.

Description

[Technical Field]

[0001] The present invention relates to the inhibition of muscle degradation, and in particular to the inhibition of muscle degradation caused by the expression of Atrogin-1. [Background technology]

[0002] Aging is a well-known example of muscle breakdown in humans. Specifically, it is known that muscle mass loss with age begins around age 30, and the rate of loss accelerates after age 60. Loss of muscle mass not only reduces quality of life (QOL) and increases the risk of fractures due to falls, hospitalization, and becoming bedridden, but also contributes to the risk of poor prognosis after acute illness or surgery. Examples of diseases associated with muscle mass loss include sarcopenia. A certain level of loss of skeletal muscle mass and muscle strength is diagnosed as sarcopenia, with approximately 10% of people in their 60s and a whopping 35% of people aged 75 or older diagnosed with sarcopenia.

[0003] The main cause of this age-related loss of muscle mass is believed to be accelerated muscle breakdown. Specifically, muscle mass is formed through a balance of synthesis and breakdown, with muscle synthesis being promoted by exercise and nutrient intake, while muscle breakdown is promoted by aging, inactivity (bed rest, cast immobilization, etc.), nutrient starvation, disease, etc.

[0004] Aging, inactivity (bed rest, cast immobilization, etc.), nutrient starvation, disease, etc. increase the amount of inflammatory cytokines (e.g., IL-6), tumor necrosis factor-α (TNF-α), glucocorticoids, etc. produced in the body, and these are known to promote muscle breakdown.

[0005] Elderly people often have excessive secretion of these cytokines and hormones due to aging and other factors, which is thought to result in accelerated muscle breakdown.

[0006] Here, the technology disclosed in Patent Document 1 has been proposed as a technology capable of suppressing decline in QOL in elderly people. Patent Document 1 relates to a physical activity enhancer that supports an increase in muscle mass and activity level, and uses Lactobacillus gasseri, a type of lactic acid bacteria, as an active ingredient. However, while the physical activity enhancer disclosed in Patent Document 1 increases muscle mass when ingested, it does not suppress muscle breakdown.

[0007] Meanwhile, the applicant has previously disclosed Patent Documents 2 and 3 as techniques relating to muscle breakdown. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] Japanese Patent Application Laid-Open No. 2013-47192 [Patent Document 2] Japanese Patent Application Laid-Open No. 2016-216408 [Patent Document 3] Japanese Patent Application Publication No. 2018-083761 Summary of the Invention [Problem to be solved by the invention]

[0009] An object of the present invention is to provide a novel technique that can inhibit muscle breakdown. [Means for solving the problem]

[0010] To prevent and improve muscle loss, attention is being paid to promoting muscle synthesis through exercise and nutritional intake, but it is also possible to effectively prevent and improve muscle loss by improving the causes of muscle breakdown that occur in the internal environment. Muscle degradation is mediated by proteolytic enzymes, and the ubiquitin-proteasome system is known to be activated. Two muscle-specific ubiquitin ligase genes, MAFbx (muscle atrophy F-box) / Atrogin-1 and MuRF1 (muscle ring finger 1), are known to be involved in this process. It is known that the expression of these muscle-specific ubiquitin ligase genes is increased by inflammatory cytokines, TNF-α, glucocorticoids, etc., resulting in muscle degradation, and therefore the expression of these genes is one of the indicators of muscle degradation. As a result of extensive research, the present inventors have found that the expression of Atrogin-1 is suppressed by ingesting glycerol phosphate, a salt thereof, and / or a polymer thereof, and have completed the present invention.

[0011] The gist of the present invention is as follows. [1] A muscle breakdown inhibitor containing glycerol phosphate, a salt thereof, and / or a polymer thereof. [2] The muscle degradation inhibitor according to [1], wherein the number of repeating units of the glycerol phosphate, its salt, and / or polymer thereof is 1 to 110. [3] A food or beverage for inhibiting muscle breakdown, containing glycerol phosphate, its salt, and / or a polymer thereof. [4] The muscle degradation inhibiting food or drink according to [3], wherein the number of repeating units of the glycerol phosphate, a salt thereof, and / or a polymer thereof is 1 to 110. [5] A method for inhibiting muscle breakdown (which may exclude medical treatment for humans) comprising ingesting glycerol phosphate, its salts, and / or polymers thereof. [6] The method for inhibiting muscle breakdown according to [5], wherein the number of repeating units of the glycerol phosphate, its salt, and / or polymer thereof is 1 to 110. [7] Glycerol phosphate, its salts, and / or polymers thereof for the prevention or treatment of diseases involving loss of muscle mass. In [1] to [7], glycerol phosphate, a salt thereof, and / or a polymer thereof exists as such. [Effects of the Invention]

[0012] According to the present invention, a novel technique capable of suppressing muscle breakdown can be provided. [Brief explanation of the drawings]

[0013] [Figure 1] This figure shows the results of a test on the suppression of Atrogin-1 expression by heat-killed bacteria. Error bars indicate SD (n=6). [Figure 2] This figure shows the results of a test on the inhibition of Atrogin-1 expression by heat-killed bacteria (Lactobacillus gasseri JCM 1131T), LTA, and PG. Error bars indicate SD (n=6). [Figure 3] 1 shows the results of a test on the suppression of Atrogin-1 expression by LTA. Error bars indicate SD (n=6). [Figure 4] 1 shows the results of a test on the inhibition of Atrogin-1 expression by LTA degradation products and glycerol phosphate salts. Error bars indicate SD (n=6). [Figure 5] 5B shows the results of a test on the suppression of Atrogin-1 expression in bacterial cells with reduced amounts of glycerol phosphate polymers. In FIG. 5B, error bars indicate SD (n=6). DETAILED DESCRIPTION OF THE INVENTION

[0014] One embodiment of the present invention will be described in detail below. The present embodiment relates to a muscle degradation inhibitor (hereinafter also simply referred to as a muscle degradation inhibitor), which contains glycerol phosphate, a salt thereof, and / or a polymer thereof.

[0015] Glycerol phosphate and its polymers can be represented, for example, as compounds having the following structure, and the glycerol phosphate is a monomer when the repeating unit (monomer unit) in the following structural formula is 1. Glycerol phosphate and its polymers may also be in the form of salts such as sodium salts, lithium salts, and magnesium salts. The number of repeating units contained in the glycerol phosphate, salts thereof, and polymers thereof according to this embodiment is not particularly limited, but is preferably 1 to 110 from the viewpoint of further suppressing muscle breakdown.

[0016] Incidentally, some of the hydroxyl groups of glycerol in the repeating units of glycerol phosphate, its salts, and polymers thereof may be substituted with amino acids such as alanine or sugars such as glucose. As described above, in the degradation inhibitor of this embodiment, glycerol phosphate, its salt, and / or its polymer exists as it is. Examples of glycerol phosphate, its salt, and / or its polymer include synthesized glycerol phosphate, and glycerol phosphate, its salt, and / or its polymer isolated from cells of lactic acid bacteria or compounds with larger molecular weights such as lipoteichoic acid (described later) through a process such as extraction or decomposition.

[0017] [ka]

[0018] In this embodiment, glycerol phosphate, a salt thereof, and / or a polymer thereof can be obtained from, for example, lactic acid bacteria, or commercially available products can also be used. In this embodiment, glycerol phosphate, its salts, and / or polymers thereof can be obtained from lactic acid bacteria or the like by known methods, such as extracting lipoteichoic acid from lactic acid bacteria and then decomposing it, based on Patent Document 3. Specifically, pulverized bacterial cells are first suspended in a solution such as water, and the supernatant is recovered by centrifugation. Next, an extract obtained from the supernatant using butanol or phenol is purified, and the resulting lipoteichoic acid (hereinafter also referred to as LTA) is subjected to a decomposition treatment using an acid or the like to obtain glycerol phosphate, its salts, and / or polymers thereof.

[0019] The degradation inhibitor of this embodiment may contain, in addition to glycerol phosphate, a salt thereof, and / or a polymer thereof, other components as long as the effects of the present invention can be obtained. The form of the degradation inhibitor of this embodiment is not particularly limited, and it can be produced as a pharmaceutical product, a quasi-drug, a food or drink, or the like. When used as a pharmaceutical, quasi-drug, or food or drink, glycerol phosphate, its salts, and / or polymers thereof are used as active ingredients and can be formulated in a conventional manner by appropriately mixing with, for example, excipients, binders, stabilizers, disintegrants, lubricants, flavorings, suspending agents, coating agents, and other optional ingredients. Dosage forms that can be used include tablets, pills, capsules, granules, powders, dusts, syrups, and the like, and these are preferably administered orally. Alternatively, when produced in the form of a food or drink, the food may be, without being particularly limited to, a normal food or drink, or a food for special dietary uses such as a food for specified health uses, a food with functional claims, a food with nutrient function claims, etc. Specific examples of foods and drinks include, for example, dietary supplements, soft drinks such as carbonated drinks, tea drinks, coffee drinks, fruit juice drinks, and sports drinks, dairy products such as milk, processed milk, lactic acid bacteria drinks, dairy drinks, fermented milk, yogurt, cheese, infant formula, powdered milk, foods for infants, and foods for nursing mothers, processed egg products such as jelly, candy, and mayonnaise, sweets and breads such as bread, biscuits, crackers, pizza crust, butter cake, ice cream, gummy candies, and chewing gum, liquid diets, and foods for the sick. Furthermore, the decomposition inhibitor of this embodiment may be used as feed for livestock, for example, by blending glycerol phosphate, a salt thereof, and / or a polymer thereof with a feed ingredient.

[0020] The daily intake of the muscle degradation inhibitor of this embodiment is not particularly limited, and for example, the amount of glycerol phosphate, its salt, and / or polymer thereof according to this embodiment may be adjusted so that an adult can ingest 0.1 to 10 g, preferably 0.5 to 5 g. The content of glycerol phosphate, its salt, and / or polymer thereof in the muscle degradation inhibitor of this embodiment is also not particularly limited, and may be adjusted as appropriate depending on ease of production, a preferred daily dosage, etc.

[0021] As described above, according to this embodiment, a novel technique that can suppress muscle breakdown can be provided. For example, glycerol phosphate, its salt, and / or a polymer thereof is ingested by a subject such as a patient in an amount necessary for prevention or treatment. Specifically, the glycerol phosphate, its salt, and / or a polymer thereof according to this embodiment may be ingested in the form of, but is not limited to, a pharmaceutical product, quasi-drug, food, or the like containing glycerol phosphate, its salt, and / or a polymer thereof. As a result, muscle breakdown can be suppressed in the subject. Specifically, the expression of Atrogin-1, a muscle-specific ubiquitin ligase gene involved in muscle breakdown, can be suppressed. Therefore, although the effects vary from person to person, they can be expected to suppress muscle breakdown due to aging and thus reduce muscle mass loss. Therefore, glycerol phosphate, its salts, and / or polymers thereof can be used for the prevention or treatment of diseases associated with muscle mass loss, such as sarcopenia. Furthermore, the glycerol phosphate, its salts, and / or polymers thereof according to this embodiment can be obtained, for example, from lactic acid bacteria strains, allowing for mass supply at relatively low cost and with a high level of safety. [Example]

[0022] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these. [Preparation of samples, etc., and test conditions] (1) Test strains and culture conditions The lactic acid bacteria strains used in the test are listed in Table 1. Lactobacilli were cultured overnight in Lactobacilli MRS Broth. The cultured bacterial cells were centrifuged at 200 × g for 10 minutes at 20°C, washed with sterile water, killed by heating at 90°C for 30 minutes, and lyophilized.

[0023] [Table 1]

[0024] (2) Preparation of peptidoglycan (hereinafter also referred to as PG) The cells (Lactobacillus gasseri JCM 1131T, dry weight 6.4 g) were suspended in 80 ml of sterile water and disrupted using a wet micronizer, Starburst Mini (Sugino Machine). After cooling to room temperature, the disrupted cell suspension was centrifuged at 4,200 × g for 50 minutes at 4°C. The resulting pellet was washed several times with sterile water and lyophilized. It was then treated with 10% (v / v) trichloroacetic acid (TCA) at 100°C for 20 minutes, washed several times with chloroform and sterile water, and centrifuged at 5,900 × g for 20 minutes at 20°C to remove the TCA. After successive washings with ethanol and diethyl ether, the pellet was lyophilized and used as PG.

[0025] (3) Preparation of Lipoteichoic Acid An equal volume of 1-butanol was added to the supernatant of the disrupted cell suspension obtained in (2) with water. The mixture was stirred at room temperature for 30 minutes and then centrifuged at 5900 × g for 20 minutes at 20°C. The lower aqueous layer was collected, lyophilized, and dissolved in 15% (v / v) 1-propanol in 100 mM sodium acetate buffer (pH 4.7). The solution was passed through a 0.45 μm filter and then applied to an Octyl Sepharose 4 Fast Flow column (GE Healthcare). Stepwise elution was performed with 15, 25, 35, and 45% (v / v) 1-propanol in 100 mM sodium acetate buffer (pH 4.7). LTA was eluted with sodium acetate buffer containing 25 and 35% (v / v) 1-propanol. The eluted LTA fraction was concentrated, dialyzed against sterile water, and lyophilized. Similar procedures were carried out for the other four strains shown in Table 1, and LTA was obtained from each of them.

[0026] (4) Preparation of glycerol phosphate salts and glycerol phosphate polymers Glycerol phosphate polymers (hereinafter referred to as Poly-GroP) were prepared from LTA derived from each of the five strains. The phosphodiester bonds of the glycerol phosphate polymers of LTA were cleaved by adding 98% (v / v) acetic acid and treating at 100°C for 3 hours. After removing the acetic acid by centrifugal evaporation, the product was partitioned with chloroform / methanol / water (1:1:0.9, v / v). The organic layer was used as the glycolipid anchor fraction, and the aqueous layer was used as the glycerol phosphate polymer fraction. Sodium sn-glycerol-1-phosphate was purchased from Sigma-Aldrich.

[0027] (5) Dot blotting A polyvinylidene fluoride membrane (GE Healthcare) was prewetted with methanol and immersed in phosphate-buffered saline (PBS). Samples were spotted onto the wet membrane. The blotted membrane was blocked with 5% (w / v) skim milk in PBS containing 0.1% (v / v) polysorbate 20 for 60 minutes at room temperature. The blocked membrane was immersed in a 1:500 dilution of mouse anti-LTA monoclonal antibody clone 55 (Hycult Biotech) and incubated for 60 minutes at room temperature. It was then reacted with a 1:1000 dilution of horseradish peroxidase-conjugated goat anti-mouse immunoglobulin antibody (Cell Signaling Technology) for 60 minutes at room temperature. Specific binding was detected using ECL Prime Western Blotting Detection Reagent (GE Healthcare).

[0028] (6) Cellular test (test for suppression of Atrogin-1 expression) Mouse striated C2C12 cells (KAC) were used. C2C12 cells were grown in high-glucose Dulbecco's modified Eagle's medium (Sigma-Aldrich) containing 10% fetal bovine serum and 1% penicillin-streptomaycin. ) The cells were suspended in 1 ml of 12-well plate at a concentration of 2.0 × 104 cells / ml, and then cultured at 37°C and 5% CO2 with medium changes every 2 to 3 days until the cells reached 90% confluence. The medium was then replaced with low-glucose Dulbecco's modified medium containing 2% horse serum and 1% penicillin-streptomaycin. The cells were cultured for 6 days, changing the medium every 2–3 days, to differentiate the C2C12 cells. Then, high-glucose Dulbecco's modified medium containing 1% penicillin-streptomaycin was added. The test sample was added to the medium, and dexamethasone (DEX), known to increase Atoragin-1 expression in skeletal muscle, was added to the medium at a concentration of 1 μM. In Reference Test Example 1, Reference Test Example 3, Test Example 1, and Test Example 2, the test sample was added to a concentration of 100 μg / ml. In Reference Test Example 2, the test sample was added to a concentration of 100 μg / ml or 1000 μg / ml. RNA was then extracted from the cells using RNeasy Plus Mini (QIAGEN). The RNA was diluted to 100 ng / ml with sterile distilled water, and cDNA was prepared using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Expression levels of GAPDH and Atrogin-1 were measured using QuantStudio3 (Applied Biosystems) to determine the Atrogin-1 / GAPDH ratio. Measurements were performed using Fast SYBR Green Master Mix (Applied Biosystems). Primers for Atrogin-1 expression were Atrogin-1F (5' ATCCCAGCACACGACAACAC 3') and Atrogin-1R (5' CGGCAACTGCATCTCTTC 3'). Primers for GAPDH expression were GAPDH F (5' ATGGCCTTCCGTGTTCCTAC 3') and GAPDH R (5' TGCCTGCTTCACCACCTTC 3'). Measurements were performed in 6 replicates.

[0029] (7) Statistical analysis Data analysis was performed using the Dunnett test with BellCurve (SSRI). Values ​​of P<0.1 or P<0.05 were considered statistically significant.

[0030] [Test Results] Reference Test Example 1: Confirmation of suppression of Atrogin-1 expression in heat-killed bacteria (hereinafter referred to as HK) The results are shown in Figure 1. All five strains tested suppressed the DEX-promoted Atrogin-1 expression.

[0031] Reference Test Example 2: Confirmation of the suppression of Atrogin-1 expression by heat-killed bacteria and their derived LTA and PG The results are shown in Figure 2. Heat-killed Lactobacillus gasseri JCM 1131T cells and LTA derived from the heat-killed cells suppressed the expression of Atrogin-1 promoted by DEX.

[0032] Reference Test Example 3: Confirmation of LTA's suppression of Atrogin-1 expression The results are shown in Figure 3. All of the LTA extracts from the five strains tested suppressed the DEX-promoted Atrogin-1 expression.

[0033] Test Example 1: Confirmation of the suppression of Atrogin-1 expression by LTA degradation products The results are shown in Figure 4. Among the LTA degradation products, glycerol phosphate polymer significantly suppressed DEX-stimulated Atrogin-1 expression (Fig. 4A). Furthermore, sn-glycerol-1-phosphate, a common component of glycerol phosphate polymers in the tested bacterial strains, also significantly suppressed Atrogin-1 expression (Fig. 4B).

[0034] Test Example 2: Confirmation of suppression of Atrogin-1 expression in bacteria with reduced amounts of glycerol phosphate polymer Lactobacillus gasseri JCM 1131T was cultured and treated under the same conditions as in (1), except that Lactobacillus MRS Broth without MnSO4 4H2O was used, and heat-killed cells with reduced amounts of glycerol phosphate polymers were obtained. The reduction in glycerol phosphate polymers was confirmed by dot blotting (Fig. 5A). The resulting heat-killed cells were subjected to a cell assay to confirm the suppression of Atrogin-1 expression. Normal cells suppressed the DEX-promoted Atrogin-1 expression, whereas cells with reduced amounts of glycerol phosphate polymers did not suppress Atrogin-1 expression (Fig. 5B).

Claims

1. A muscle breakdown inhibitor containing glycerol phosphate, a salt thereof, and / or a polymer thereof.

2. The muscle degradation inhibitor according to claim 1, wherein the number of repeating units of the glycerol phosphate, its salt, and / or polymer thereof is 1 to 110.

3. A food or drink for inhibiting muscle breakdown, comprising glycerol phosphate, its salt, and / or a polymer thereof.

4. The muscle breakdown inhibiting food or beverage according to claim 3, wherein the number of repeating units of the glycerol phosphate, its salt, and / or polymer thereof is 1 to 110.

5. A method for inhibiting muscle breakdown (excluding medical procedures for humans) comprising ingesting glycerol phosphate, its salts, and / or polymers thereof.

6. The method for inhibiting muscle degradation according to claim 5, wherein the number of repeating units of the glycerol phosphate, a salt thereof, and / or a polymer thereof is 1 to 110.

Images