Transgenic chickens producing human antibodies

Abstract

Transgenic chickens are provided having a genome comprising an engineered immunoglobulin heavy chain (IgH) locus, wherein the locus lacks the entire contiguous endogenous chicken VDJ region and contains a human VH segment, a human D cluster, a human J segment, and a human VH cluster. H The modified IgH locus contains multiple upstream pseudogenes based on the sequence of the gene. The modified IgH locus undergoes V(D)J recombination in chickens, allowing the chicken to produce antibodies with diverse immunoglobulin heavy chains.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 62 / 646,319, filed March 21, 2018, which is incorporated herein by reference. [Background technology]

[0002] As in all higher vertebrates, a critical checkpoint in chicken B cell development is in-frame V(D)J rearrangement, which leads to the expression of a functional B cell receptor complex on the cell surface (1-3). The chicken rearrangement process utilizes the same recombination signal sequences and enzymes as mammals to recombine V, D, and J genes into functional V regions (4-8). A key difference is that chickens have only one germline V gene and a single germline J gene at both the light and heavy chain loci, with a cluster of highly similar D segments in the heavy chain, rather than the numerous and diverse V, D, and J genes found in humans (5, 8). Therefore, the rearrangement process generates little sequence diversity in the initial B cell repertoire. Although incomplete joining and exonucleolytic chewing-back at VJ and VDJ junctions can generate some diversity, chicken B cells do not express TdT ( 9 ), there are no N additions in CDR-H3, and generally, the immunoglobulin diversity produced by the gene rearrangement process is minimal ( 5 , 10 , 11 ).

[0003] To generate a diverse repertoire, chickens employ a process of gene conversion, in which upstream pseudogenes of the light and heavy chain loci act as sequence donors, mutating expressed functional V(s) (8, 11-13). These pseudogenes lack promoters or recombination signal sequences, preventing their expression. Instead, their sequences are incorporated into a single functional V(s) in segments of varying lengths. Multiple rounds of overlapping gene conversion from different pseudogenes within the pool result in a highly diverse naive repertoire. In addition to gene conversion, non-template somatic hypermutation also contributes to repertoire diversity (14-16). Despite limited V(D)J rearrangement in chickens, CDR-H3s exhibit length and sequence diversity comparable to that in mammals (1, 17). The function of chicken D in V(D)J rearrangement may be more related to the realization of intra-CDR-H3 disulfide bridges for stabilization of antigen-binding loops, since most D encode a single cysteine ​​residue and the D-D bond therefore encodes a pair of cysteines (17). The diversity of chicken CDR-H3 is due to gene conversion / somatic hypermutation, rather than the rearrangement process itself. Summary of the Invention [Means for solving the problem]

[0004] The present disclosure provides transgenic chickens that produce human antibodies. This disclosure includes the following [1] to

[27] . [1] A transgenic chicken comprising a genome including a modified endogenous immunoglobulin heavy chain (IgH) locus, wherein the modified endogenous immunoglobulin heavy chain (IgH) locus is (a) lacking the entire adjacent endogenous chicken VDJ region; and (b) an operable link; (i) an immunoglobulin heavy chain gene promoter; (ii) a germline human V nucleotide containing a coding sequence for a variable domain including FR1, CDR1, FR2, CDR2, and FR3 sequences; H segment, (iii) human D cluster; (iv) a single human J segment; (v) a plurality of sequences upstream of the germline human VH segment of (b)(ii), encoding a constant region; (vi) multiple pseudogenes of the structure FR1-CDR1-FR2-CDR2-FR3, each pseudogene comprising substantially the same FR1, FR2, and FR3 sequences as the functional human VH segment of (b)(ii), and different CDR1 and CDR2 sequences for each pseudogene. Including, The modified IgH locus undergoes V(D)J recombination in the chicken, The above multiple germline human V H the pseudogene donates a nucleotide sequence to the germline human VH segment by gene conversion after V(D)J recombination; The chicken produces antibodies containing a variety of immunoglobulin heavy chains. Transgenic chickens. [2] A transgenic chicken as described in [1] above, wherein the CDR1 and CDR2 sequences of (b)(vi) encode the CDR1 and CDR2 of a different human VH segment in the same family as the functional human VH segment of (b)(ii). [3] The transgenic chicken according to either [1] or [2] above, wherein the total length of the adjacent endogenous chicken VDJ regions (a) is in the range of 10 to 12 kb. [4] The transgenic chicken according to any one of [1] to [3] above, wherein the promoter of (b)(i) is a chicken immunoglobulin heavy chain gene promoter. [5] (b) (ii) the germline human VH segment and (vi) the CDR1 and CDR2 sequences of the V H 3 families, above V H 1 family or above V H A transgenic chicken according to any one of [1] to [4] above, which is derived from one of four families. [6] A transgenic chicken according to any one of [1] to [5] above, wherein any codon for cysteine ​​in the D cluster is mutated so as to encode another amino acid. [7] The transgenic chicken according to [6] above, wherein any codon for cysteine ​​in the D cluster is mutated to encode tyrosine or tryptophan. [8] The transgenic chicken according to any one of [1] to [7] above, wherein the intervening sequence of the D cluster is derived from a chicken. [9] The transgenic chicken according to any one of [1] to [8] above, wherein the plurality of pseudogenes in (b)(v) comprises at least 10 of the pseudogenes.

[10] A transgenic chicken according to any one of [1] to [9] above, wherein the pseudogene in (b)(v) is in the reverse orientation relative to the germline human VH segment in (b)(ii).

[11] A transgenic chicken according to any one of [1] to

[10] above, wherein the plurality of sequences encoding the constant regions of (b)(v) are endogenous to the chicken.

[12] A transgenic chicken according to any one of [1] to

[11] above, wherein the transcription product of the modified immunoglobulin heavy chain (IgH) locus contains an intron joining the 3' end of the copy of the J coding sequence to the 5' end of the copy of the constant region coding sequence of (b)(v).

[13] The transgenic chicken according to any one of [1] to

[12] above, wherein the chicken is homozygous for the modified IgH locus.

[14] A transgenic chicken according to any one of [1] to

[13] above, wherein the chicken is heterozygous for the modified IgH locus and the IgH locus of the homologous chromosome is knocked out.

[15] A transgenic chicken according to any one of [1] to

[14] above, wherein the chicken is heterozygous for the modified IgH locus and the IgH locus of the homologous chromosome is wild-type.

[16] The transgenic chicken described in

[14] above, wherein the chicken is heterozygous for the modified IgH locus, and the IgH locus of the homologous chromosome lacks the entire adjacent endogenous chicken VDJ region.

[17] The transgenic chicken according to

[14] above, wherein the chicken is heterozygous for the modified IgH locus, and the IgH locus of the homologous chromosome lacks a J region.

[18] The transgenic chicken according to any one of [1] to

[17] above, wherein the antibody produced by the chicken is diversified in the heavy chain CDR1, CDR2 and CDR3 regions.

[19] A transgenic chicken lacking the entire adjacent endogenous chicken VDJ region on one or both of its homologous chromosomes.

[20] A B cell derived from the transgenic chicken described in any one of [1] to

[19] above.

[21] (a) immunizing the transgenic chicken according to any one of [1] to

[20] above with an antigen; and (b) obtaining an antibody that specifically binds to the antigen from the chicken. A method comprising:

[22] The method according to

[21] above, wherein the antibody is polyclonal.

[23] The method according to

[21] above, wherein the antibody is monoclonal.

[24] (c) preparing hybridomas using B cells of the transgenic chicken; and (d) screening the hybridomas to identify hybridomas that produce antibodies that specifically bind to the antigen. The method according to any one of

[21] to

[23] above, further comprising:

[25] The method according to any one of

[21] to

[24] above, further comprising the steps of using PCR to amplify nucleic acids encoding the heavy and light chain variable regions from B cells of the transgenic animal, and expressing a recombinant antibody using the amplified nucleic acids.

[26] An antibody produced by the transgenic chicken according to any one of [1] to

[19] above.

[27] A method (a) deleting the entire flanking endogenous chicken VDJ region from the immunoglobulin heavy chain (IgH) locus of the chicken; and (b) inserting a construct into the locus, wherein the construct comprises: (i) an immunoglobulin heavy chain gene promoter; (ii) a germline human VH segment comprising a coding sequence for a variable domain comprising FR1, CDR1, FR2, CDR2, and FR3 sequences; (iii) human D cluster; (iv) a human J segment, and (vi) multiple pseudogenes of the structure FR1-CDR1-FR2-CDR2-FR3, each pseudogene comprising substantially the same FR1, FR2, and FR3 sequences as the functional human VH segment of (b)(ii), and different CDR1 and CDR2 coding sequences for each pseudogene. Including, Steps (a) and (b) are performed in any order; method.

[0005] The present disclosure provides, inter alia, transgenic chickens having an altered immunoglobulin heavy chain immunoglobulin locus, wherein the altered locus lacks an endogenous VDJ region and instead contains a human VH segment, a human D cluster, a human J segment, and a human V H The modified IgH locus undergoes V(D)J recombination in chickens, resulting in gene conversion between the upstream pseudogenes and the human VH segments, allowing chickens to produce antibodies with diverse immunoglobulin heavy chains containing CDR3s of different lengths.

[0006] The transgenic chickens of the present invention may have certain advantages over other transgenic chickens designed to produce recombinant antibodies. For example, the IgH locus of the present transgenic chickens lacks an endogenous VDJ region, and therefore human sequences are not removed during V(D)J recombination (e.g., by recombination between the chicken D and human J). Furthermore, in mice, the VDJ region contains genes essential for fertility (i.e., the adam6a and adam6b genes; see, e.g., Marcello et al. J. Biol. Chem. 2011 286:13060-70 and U.S. Patent No. 8,697,940). The complete sequence of the endogenous VDJ region of the chicken genome is currently unknown. Therefore, it was unclear whether the endogenous VDJ region of the chicken genome contains essential genes or whether chickens containing an IgH locus lacking the entire adjacent endogenous chicken VDJ region could be prepared. Furthermore, transgenic chickens produce antibodies with diversified immunoglobulin heavy chains, where diversification is achieved through a combination of V(D)J recombination, gene conversion, and somatic hypermutation. Finally, because (a) a significant amount of heavy chain CDR3 diversity is achieved through V(D)J recombination (as opposed to gene conversion alone) and (b) the lack of terminal transferase in chickens limits the CDR length to those encoded by D genes, antibodies produced by chickens are shorter and can be considered more "human" than chicken antibodies (which typically have longer heavy chain CDR3s due to the D-D linkages selected in chickens).

[0007] In wild-type chickens, longer CDR-H3s are produced by tandem DD ligation and possibly by gene conversion. This can be used for sequence insertion, sequence deletion, and simple sequence modification. Therefore, even without terminal transferase, CDR-H3s can still be lengthened. In this chicken, the CDR-H3 is shorter than that of wild-type chicken and human CDR-H3s, shorter than the theoretical range of 16–23 amino acids that would result from simple ligation of V, D, and J without chewing back, suggesting the absence of DD ligation or other mechanisms for generating long CDRs in this chicken. When antibodies prepared from this chicken were compared with those obtained from humans, the CDR-H3 was shorter in this chicken (average length = 12 vs. 15–16 in humans).

[0008] Methods for making and using the transgenic chickens, as well as antibody compositions produced by the chickens, are also provided.

[0009] Certain aspects of the present invention may be best understood from the following detailed description when read in conjunction with the accompanying drawings. It is emphasized that, according to common practice, the various features of the drawings are not to scale. In fact, the dimensions of the various features have been arbitrarily increased or reduced for clarity. The drawings include the following figures: [Brief explanation of the drawings]

[0010] [Figure 1]A diagram of pre-rearranged and rearranged human VH segments in chicken is presented. Scaled representations of SynVH-C (pre-rearranged) and SynVH-SD (rearranged) transgenes and heavy chain knockout (IgH-J KO) are shown. Human sequences are shown in red, and chicken sequences in blue. The SynVH-C transgene in the top row consists of a pre-rearranged human V region (hVDJ) with an upstream array of human pseudogenes. The human V region splices to the chicken constant region downstream (only Cmu is shown). Chicken germline V and D genes and an array of pseudogenes are upstream of the human V gene. The exact mapping of the chicken pseudogenes is not shown (indicated in brackets), but the distance to the functional chicken V is accurate. The remaining loxP and attR sites from the insertion event are indicated. The SynVH-SD transgene in the middle row contains a single human germline VH3-23 gene, a single JH6 gene, and 24 unique human D genes. All intervening sequences and recombination sites are derived from the chicken heavy chain locus (shown in blue). Upstream of the human germline V genes is an array of human-based pseudogenes. The upstream chicken germline V and D genes have been deleted, but the chicken pseudogenes are still present. The bottom row shows the chicken heavy chain knockout construct (21). The genotypes of the transgenic chickens in this study were SynVH-C or SD "knock-in" / IgH knockout. The single chicken JH gene was replaced with a promoterless neo gene. The attP sites flanking the neo gene were used to remove the selectable marker and plasmid backbone sequences by Cre-lox recombination after insertion of the SynVH-C and SynVH-SD constructs. [Figure 2]Panels A–B show diagrams of signal peptide changes observed in transgenic chickens and alignments of germline signal peptide sequences. The signal peptide of SynVH-SD is less hydrophobic than SynVH-C and is altered to become more hydrophobic. (A) Diagram of signal peptide changes observed in transgenic chickens. The signal peptide can be altered to a chicken-type sequence by splicing the chicken signal peptide exon into a human V region exon or by gene conversion of a portion of the V region exon. Human signal peptides are shown in yellow, and chicken signal peptides in orange. The average hydrophobicity (Kyte-Doolittle, not normalized) of each type of signal peptide is shown. (B) Alignment of germline signal peptide sequences from WT chicken VH segments, SynVH-C, and SynVH-SD. The four amino acids encoded in the V region exons are shown in red. Lysine residues, which are often mutated to hydrophobic residues in SynVH-SD, are circled. The average hydrophobicity is shown on the right. [Figure 3] CDR-H3 lengths are shown. SynVH-SD exhibits a wider distribution of CDR-H3 lengths. CDR-H3 lengths from all sequences ("unselected," top two panels) were calculated based on IMGT positions 105–117 and plotted based on the frequency of each length among all sequences with distinct CDR-H3s (N = 3,099,355 for SynVH-C and N = 1,050,398 for SynVH-SD). Error bars indicate inter-bird variation. N = 6 for SynVH-C and N = 3 for SynVH-SD. Means and SDs are shown. The bottom two panels show the CDR-H3 lengths of PGRN-specific mAbs. [Figure 4]The amino acid frequencies of SynVH-C and SynVH-SD are presented. The amino acid frequencies of SynVH-C and SynVH-SD in CDR-H3 are similar for most amino acids. The frequency of each amino acid is from the total amino acid content of CDR-H3 at positions not contributed by the V or J genes (107-109 or 111). Frequencies were calculated using specific CDR-H3 lengths of 12, 13, 14, and 15 residues from the top 1000 unique sequences from each bird and then averaged. Error bars indicate variation between birds. N=6 for SynVH-C, N=3 for SynVH-SD. [Figure 5-1] The sequence diversity of CDR-H3 in SynVH-C and SynVH-SD is shown. The sequence diversity of CDR-H3 is similar between SynVH-C and SynVH-SD. Shannon entropy and amino acid distribution are shown for each of the IMGT positions 105–117 of CDR-H3 for specific lengths of 12 residues (top two panels) and 15 residues (bottom two panels) for SynVH-C and SynVH-SD. Sequences were extracted from the top 1000 sequences of each bird: six for SynVH-C and three for SynVH-SD. [Figure 5-2] The sequence diversity of CDR-H3 in SynVH-C and SynVH-SD is shown. The sequence diversity of CDR-H3 is similar between SynVH-C and SynVH-SD. Shannon entropy and amino acid distribution are shown for each of the IMGT positions 105–117 of CDR-H3 for specific lengths of 12 residues (top two panels) and 15 residues (bottom two panels) for SynVH-C and SynVH-SD. Sequences were extracted from the top 1000 sequences of each bird: six for SynVH-C and three for SynVH-SD. [Figure 5-3]The sequence diversity of CDR-H3 in SynVH-C and SynVH-SD is shown. The sequence diversity of CDR-H3 is similar between SynVH-C and SynVH-SD. Shannon entropy and amino acid distribution are shown for each of the IMGT positions 105–117 of CDR-H3 for specific lengths of 12 residues (top two panels) and 15 residues (bottom two panels) for SynVH-C and SynVH-SD. Sequences were extracted from the top 1000 sequences of each bird: six for SynVH-C and three for SynVH-SD. [Figure 5-4] The sequence diversity of CDR-H3 in SynVH-C and SynVH-SD is shown. The sequence diversity of CDR-H3 is similar between SynVH-C and SynVH-SD. Shannon entropy and amino acid distribution are shown for each of the IMGT positions 105–117 of CDR-H3 for specific lengths of 12 residues (top two panels) and 15 residues (bottom two panels) for SynVH-C and SynVH-SD. Sequences were extracted from the top 1000 sequences of each bird: six for SynVH-C and three for SynVH-SD. [Figure 6] The hydrophobicity of CDR-H3 in synVH-C and SynVH-SD is shown. The hydrophobicity of CDR-H3 is similar between SynVH-C and SynVH-SD. The average hydrophobicity based on the normalized Kyte-Doolittle scale (34, 35) for CDR-H3s of 12–15 residues in length (positions 105–117 of the IMGT) was calculated for the top 1000 sequences of each bird. The frequency values ​​of each hydrophobicity (grouped in increments of 0.1) are shown on the graph. [Figure 7]The frequency of mAb sequences in the NGS data is shown. The frequency of mAb sequences in the NGS data indicates that many mAbs identified by GEM screening are rare in the spleen population. The number of times each antigen-specific mAb sequence identified in the GEM screen was detected in all sequence data for each bird. mAbs are grouped by bird and transgene, either SynVH-C or SynVH-SD, as shown. The number of mAbs obtained from each bird is displayed below the plot. mAbs sequenced 5 or fewer times across the dataset are shown in red, indicating rare mAbs were found in the GEM screen. [Figure 8]Alignment of the human engineered pseudogenes with functional VH sequences in each construct is shown. For SynVH-C, diverse CDR-H1, 2, and 3 sequences were obtained from the NIH EST database queried with the human VH3-23 gene. Germline VH3-23 framework sequences were included in some of the pseudogenes, while others matched the functional VH sequence (HuVH, top row), a somatically derived sequence with nine changes relative to the germline. For SynVH-SD, CDR-H1 and 2 were derived from human VH3 family members and placed on the VH3-23 framework scaffold. No specific CDR-H3 sequence was included. The sequences shown are spacers placed between the pseudogenes.(HuVH is shown in SEQ ID NO:6; SynVH48 is shown in SEQ ID NO:7; SynVH49 is shown in SEQ ID NO:8; SynVH38 is shown in SEQ ID NO:9; SynVH39 is shown in SEQ ID NO:10; SynVH40 is shown in SEQ ID NO:11; SynVH41 is shown in SEQ ID NO:12; SynVH42 is shown in SEQ ID NO:13; SynVH43 is shown in SEQ ID NO:14; SynVH44 is shown in SEQ ID NO:15; SynVH45 is shown in SEQ ID NO:16; SynVH46 is shown in SEQ ID NO:17; SynVH47 is shown in SEQ ID NO:18; SynVH50 is shown in SEQ ID NO:19; SynVH51 is shown in SEQ ID NO:20; SynVH52 is shown in SEQ ID NO:21; SynVH53 is shown in SEQ ID NO:22; SynVH54 is shown in SEQ ID NO:23) 3; SynVH55 is shown in SEQ ID NO:24; SynVH56 is shown in SEQ ID NO:25; SynVH57 is shown in SEQ ID NO:26; HuVDJ is shown in SEQ ID NO:27; SynVH58 is shown in SEQ ID NO:28; SynVH59 is shown in SEQ ID NO:29; SynVH60 is shown in SEQ ID NO:30; SynVH61 is shown in SEQ ID NO:31; SynVH62 is shown in SEQ ID NO:32; SynVH63 is shown in SEQ ID NO:33; SynVH64 is shown in SEQ ID NO:34; SynVH65 is shown in SEQ ID NO:35; SynVH70 is shown in SEQ ID NO:36; SynVH71 is shown in SEQ ID NO:37; SynVH72 is shown in SEQ ID NO:38; SynVH73 is shown in SEQ ID NO:39; SynVH74 is shown in SEQ ID NO:40). [Figure 9] Shannon entropy for all aligned V-region sequences from SynVH-C and SynVH-SD is shown. The top 1000 sequences for each bird were included. CDR designations (IMGT) are indicated. [Figure 10]CRISPR targeting strategy. (A) Schematic of the chicken IgH locus present in PGC line 472-138 used for CRISPR targeting. The IgH locus contains a previously acquired knockout of the JH gene segment (JH-KO) between the D cluster and the constant region (only Cμ is shown), which was replaced with a selectable marker cassette. gRNAs 1–4 were designed to target the region upstream of the single functional VH region (indicated by the arrow), and gRNA5 was designed to target the EGFP gene. (B) PGCs from line 472-138 were transiently transfected with constructs containing Cas9 specific for EGFP or Cas9 / gRNA5. After 9 days of culture, cells were analyzed for loss of green fluorescence by flow cytometry. [Figure 11]CRISPR-mediated targeting of IgH KO6B in PGCs. (A) A detailed diagram of the IgH locus. The 122-bp sequence between the 5' and 3' homology regions of IgH KO6B, used to design the gRNAs, is shown at the top. The locations of gRNAs 1–4 are indicated by blue lines above the sequence, and the protospacer adjacent motif (PAM) is indicated by a red line. The repair vector IgH KO6B (bottom) contains the yellow 5' and 3' homology regions (HR), a single loxP site (blue arrow), and a hygromycin selection cassette (orange). The positions of the primer binding sites for the 5' and 3' targeting assays are indicated by black arrows. The selectable marker downstream of JH-KO consists of a loxP-transfected EGFP (green box) and puro gene (blue box), and a promoterless neo gene (pink box) in the opposite orientation. The loxP sites are indicated by blue arrows. (B) 5' targeting assays were performed on independent non-clonal cell populations obtained by co-transfecting four different gRNAs with Cas9 and IgH KO6B into 472-138 cells. For each gRNA transfection, three hygromycin-resistant populations were analyzed. The positive control (+) was a DT40 cell line containing a functional V region knockout

[22] , and the negative control (-) was the parental IgH KO6B plasmid. (C) 5' and 3' targeting assays were performed on nine independent clones obtained with gRNA2 (there were 12 clones, but clones 4, 7, and 12 grew more slowly and have not been validated at this time). Variation in band intensity is likely due to variations in the amount of template gDNA, as the number of cells harvested was not normalized. The negative control (-) was genomic DNA from a JH-KO transgenic bird, and the positive control (+) was a pool of cells (G2) from the gRNA2 experiment in (B). NT is a no-template control. D, Same 5' and 3' targeting assays performed on EGFP+ birds obtained from breeding cell line 1783-10 chimeras to wild type. [Figure 12]Cre recombination of the CRISPR-targeted loxP site. A. Diagram of the targeted IgH locus before and after Cre recombination. A forward primer upstream of the CRISPR-targeted loxP site was used with two different reverse primers downstream of the loxP sites in the JH-KO cassette. In the non-recombined allele, the forward and reverse primers are approximately 28 kb apart on the chromosome. After Cre recombination, a single loxP site and promoterless neo gene remain, and the primers are 1.6 or 2 kb apart, allowing for easy amplification. B. PCR of recombinant cells. gDNA template from 1783-9 cells transfected with Cre+:Cre. Cre-, parental 1783-9 cells. JH-KO, gDNA from a heterozygous JH-KO bird; NTC, no template control. DETAILED DESCRIPTION OF THE INVENTION

[0011] definition The term "transgenic chicken" refers to an animal containing cells that contain foreign nucleic acid (i.e., recombinant nucleic acid that is not native to the chicken). The foreign nucleic acid is intended to be present in all cells of the chicken, with the potential exception of some haploid germ cells. The foreign nucleic acid molecule is called a "transgene" and may include one or many genes that are not native to the chicken. Transgenic chickens are capable of stably transmitting the foreign nucleic acid in their germline.

[0012] The term "intron" refers to a sequence of DNA found in the middle of many gene sequences in most eukaryotes. These intron sequences are transcribed but removed from within the pre-mRNA transcript before the mRNA is translated into protein. This process of intron removal is accomplished by splicing together sequences (exons) on either side of the intron.

[0013] The term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment such that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence if it can affect the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). Similarly, if an intron is operably linked to a coding sequence, the intron is spliced ​​out of the mRNA, resulting in expression of the coding sequence. In the context of gene conversion, two nucleic acid sequences are operably linked if one sequence can "donate" a sequence to the other through gene conversion. If the two sequences are not linked and one can donate a sequence to the other through gene conversion, i.e., in the absence of any other intervening genes, the donating sequence can be upstream or downstream of the other, and the two sequences can be adjacent to each other. "Unlinked" means that the associated genetic elements are not closely related to each other, and the function of one does not affect the other.

[0014] The terms "upstream" and "downstream" are used in reference to the direction of transcription.

[0015] The term "pseudogene" is used to describe an untranscribed nucleic acid region that contains an open reading frame that may or may not include a start codon and / or a stop codon. An amino acid sequence may be "encoded" by a pseudogene in the sense that the nucleotide sequence of the open reading frame can be translated in silico to produce the amino acid sequence. In the context of heavy and light chain immunoglobulin loci, pseudogenes do not contain promoter regions, recombination signal sequences, or leader sequences.

[0016] The term "homozygous" indicates that identical alleles are present at the same locus on homologous chromosomes. In contrast, "heterozygous" indicates that different alleles are present at the same locus on homologous chromosomes. Transgenic animals can be homozygous or heterozygous for the transgene.

[0017] The term "endogenous" with respect to a gene indicates that the gene is native to the cell, i.e., the gene is present at a particular locus in the genome of an unmodified cell. An endogenous gene can be a wild-type gene present at that locus in a wild-type cell (as found in nature). An endogenous gene can be a modified endogenous gene if it is present at the same locus in the genome as a wild-type gene. An example of such a modified endogenous gene is a gene into which foreign nucleic acid is inserted. An endogenous gene can be present in the nuclear genome, mitochondrial genome, etc.

[0018] The term "construct" refers to a recombinant nucleic acid, generally recombinant DNA, generated for the purpose of expressing a particular nucleotide sequence or used in the construction of other recombinant nucleotide sequences. A construct can be present in a vector or a genome.

[0019] The term "recombinant" refers to a polynucleotide or polypeptide that does not naturally occur in a host cell. A recombinant molecule can contain two or more naturally occurring sequences linked together in a way that does not occur naturally. A recombinant cell contains a recombinant polynucleotide or polypeptide. When a cell receives a recombinant nucleic acid, the nucleic acid is "exogenous" to the cell.

[0020] The term "selectable marker" refers to a protein expressible in a host that allows for easy selection of hosts containing an introduced nucleic acid or vector. Examples of selectable markers include, but are not limited to, proteins that confer resistance to antibacterial agents (e.g., hygromycin, bleomycin, or chloramphenicol), proteins that confer a metabolic advantage, such as a nutritional advantage, to the host cell, and proteins that confer a functional or phenotypic advantage (e.g., cell division) to the cell.

[0021] As used herein, the term "expression" refers to the process by which a polypeptide is produced based on the nucleic acid sequence of a gene. This process includes both transcription and translation.

[0022] The term "introduced," with respect to inserting a nucleic acid sequence into a cell, means "transfection" or "transformation" or "transduction," and includes reference to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell. The nucleic acid sequence can be integrated into the cell's genome (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).

[0023] In the context of replacing one genetic locus with another, the term "replace" refers to a single-step protocol or a multi-step protocol.

[0024] The term "coding sequence" refers to a nucleic acid sequence that, when placed under the control of appropriate regulatory elements, encodes a portion of a protein. As used herein, a coding sequence may have a continuous ORF, a portion of an ORF, or an ORF interrupted by the presence of introns or non-coding sequences. A pseudogene may contain untranscribed coding sequences.

[0025] The term "inverse orientation to" refers to coding sequences that are on different strands. For example, if a transcribed region is described as being in reverse orientation relative to a pseudogene, the amino acid sequence encoded by the transcribed region is encoded by the top or bottom strand, and the amino acid sequence encoded by the pseudogene is encoded by the other strand relative to the transcribed region.

[0026] The terms "antibody" and "immunoglobulin" are used interchangeably herein. These terms are well understood by those skilled in the art and refer to a protein consisting of one or more polypeptides that specifically bind to an antigen. One form of antibody constitutes the basic structural unit of an antibody. This form is a tetramer, consisting of two identical pairs of antibody chains, each pair having one light chain and one heavy chain. In each pair, the variable regions of the light and heavy chains are both responsible for binding to the antigen, and the constant regions are responsible for the effector functions of the antibody.

[0027] Recognized immunoglobulin polypeptides include kappa and lambda light chains and alpha, gamma (IgG1, IgG2, IgG3, IgG4), delta, epsilon, and mu heavy chains, or equivalents from other species. A full-length immunoglobulin "light chain" (about 25 kDa or about 214 amino acids) contains a variable region of about 110 amino acids at the NH2-terminus and a kappa or lambda constant region at the COOH-terminus. A full-length immunoglobulin "heavy chain" (about 50 kDa or about 446 amino acids) similarly contains a variable region (about 116 amino acids) and one of the aforementioned heavy chain constant regions, e.g., gamma (about 330 amino acids).

[0028] The terms "antibody" and "immunoglobulin" include antibodies or immunoglobulins of any isotype, fragments of antibodies that retain specific binding to an antigen, including, but not limited to, Fab, Fv, scFv, and Fd fragments, chimeric antibodies, humanized antibodies, single-chain antibodies, and fusion proteins comprising the antigen-binding portion of an antibody and a non-antibody protein. Antibodies can be detectably labeled, for example, with radioisotopes, enzymes that produce a detectable product, fluorescent proteins, and the like. Antibodies may also be conjugated to other moieties, such as members of specific binding pairs, for example, biotin (a member of the biotin-avidin specific binding pair). Antibodies can also be bound to solid supports, including, but not limited to, polystyrene plates or beads. The terms also include Fab', Fv, F(ab')2, and other antibody fragments that retain specific binding to an antigen, as well as monoclonal and polyclonal antibodies.

[0029] Antibodies exist in a variety of other forms, such as Fv, Fab, (Fab')2, and bifunctional (i.e., bispecific) hybrid antibodies (e.g., Lanzavecchia et al., Eur. J. Immunol. 17, 105 (1987)) and single chains (e.g., Huston et al., Proc. Natl. Acad. Sci. USA, 85, 5879-5883 (1988) and Bird et al., Science, 242, 423-426 (1988), which are incorporated herein by reference). (See generally, Hood et al., "Immunology," Benjamin, NY, 2nd ed. (1984), and Hunkapiller and Hood, Nature, 323, 15-16 (1986)).

[0030] An immunoglobulin light or heavy chain variable region consists of a "framework" region (FR) interrupted by three hypervariable regions, also called "complementarity-determining regions" or "CDRs." The extent of the framework regions and CDRs has been precisely defined (see Lefranc et al., IMGT, the international ImMunoGeneTics information system. Nucleic Acids Res. 2009 vol. 37 (Publication in Database: D1006-12. Epub 2008 Oct 31; see imgt.org worldwide website, hereafter referred to as the "IMGT system"). All antibody amino acid sequence numbering discussed herein conforms to the IMGT system. The sequences of the framework regions of different light or heavy chains are relatively conserved within species. The framework region of an antibody, i.e., the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs. The CDRs are primarily responsible for binding to an antigen epitope.

[0031] Chimeric antibodies are antibodies whose light and heavy chain genes have been constructed, typically by genetic engineering, from variable and constant region genes of antibodies belonging to different species. For example, variable segments from genes of chicken or rabbit monoclonal antibodies can be linked to human constant segments such as gamma 1 and gamma 3. An example of a therapeutic chimeric antibody is a hybrid protein composed of variable or antigen-binding domains from a chicken or rabbit antibody and constant or effector domains from a human antibody (e.g., the anti-Tac chimeric antibody produced by cells under ATCC accession number CRL 9688). However, other mammalian species can also be used.

[0032] As used herein, the term "human framework" refers to a framework having an amino acid sequence that is at least 90% identical, e.g., at least 95%, at least 98%, or at least 99% identical, to the amino acid sequence of a human antibody, e.g., the human germline sequence of the antibody. In certain cases, the human framework can be a fully human framework, in which case the framework has an amino acid sequence identical to the amino acid sequence of a human antibody, e.g., a germline antibody.

[0033] As used herein, the term "humanized antibody" or "humanized immunoglobulin" refers to a non-human antibody that contains one or more amino acids (e.g., in a framework region, constant region, or CDR) substituted with an amino acid at the corresponding position from a human antibody. Generally, a humanized antibody is expected to elicit a reduced immune response in a human host compared to a non-human version of the same antibody.

[0034] It is understood that the humanized antibodies designed and produced by the methods of the present invention may have additional conservative amino acid substitutions that do not substantially affect antigen binding or other antibody functions. Conservative substitutions are intended combinations such as those from the following groups: gly, ala; val, ile, leu; asp, glu; asn, gln; ser, thr; lys, arg; and phe, tyr. Amino acids that are not in the same group are "substantially different" amino acids.

[0035] The term "specific binding" refers to the ability of an antibody to preferentially bind to a particular analyte present in a homogeneous mixture of different analytes. In certain embodiments, the specific binding interaction distinguishes between desired and undesired analytes in a sample, and in some embodiments, by more than about 10-100 fold or more (e.g., more than about 1000 fold or more than 10,000 fold).

[0036] In certain embodiments, the affinity between the antibody and the analyte for specifically binding to the antibody / analyte complex is greater than or equal to 10 -6 Under M, 10 -7 Under M, 10 -8 Under M, 10 -9 Under M, 10 -9 Under M, 10 -11 Less than M or about 10 -12 K less than or equal to M D It is characterized by a dissociation constant.

[0037] The "variable region" of an antibody heavy or light chain is the N-terminal mature domain of the chain, including CDR1, CDR2, and CDR3, as well as framework regions. Both heavy and light chains of antibodies contain variable domains. All domain, CDR, and residue numbers are assigned based on sequence alignment and structural knowledge. The identification and numbering of framework and CDR residues is defined by the IMGT system.

[0038] VH is the variable domain of the antibody heavy chain. VL is the variable domain of the antibody light chain.

[0039] As used herein, the term "isolated," when used in the context of an isolated antibody, refers to an antibody of interest that is at least 60% free, at least 75% free, at least 90% free, at least 95% free, at least 98% free, or even at least 99% free from other components with which the antibody is associated prior to purification.

[0040] The terms "treatment", "treating" and the like are used herein to refer to any treatment of any disease or condition in a mammal, e.g., particularly a human or mouse, and include a) preventing the disease, condition, or symptoms of the disease or condition from occurring in a subject who may be predisposed to the disease, but has not yet been diagnosed as having it; b) inhibiting the disease, condition, or symptoms of the disease or condition, e.g., halting its development and / or delaying its onset or manifestation in a patient; and / or c) alleviating the disease or condition, or symptoms of the disease or condition, e.g., causing regression of the condition or disease and / or its symptoms.

[0041] The terms "subject," "host," "patient," and "individual" are used interchangeably herein and refer to any mammalian subject for whom diagnosis or treatment is desired, particularly humans. Other subjects may include cows, dogs, cats, guinea pigs, rabbits, rats, mice, horses, etc.

[0042] A "native" antibody is one whose heavy and light immunoglobulin chains are naturally selected by the immune system of a multicellular organism, as opposed to its natural counterpart, which is produced, for example, by phage display. Therefore, the particular antibody does not contain sequences derived from any virus (such as bacteriophage M13). The spleen, lymph nodes, and bone marrow are examples of tissues that naturally produce antibodies in an animal.

[0043] The term "introduced," in the context of inserting a nucleic acid sequence into a cell, means "transfection" or "transformation" or "transduction," and includes reference to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell. The nucleic acid sequence may be transiently present in the cell or may be integrated into the cell's genome (e.g., chromosome, plasmid, plastid, mitochondrial DNA) and converted into an autonomous replicon.

[0044] The term "plurality" refers to at least 2, at least 5, at least 10, at least 20, at least 50, at least 100, at least 200, at least 500, at least 1000, at least 2000, at least 5000, or at least 10,000 or at least 50,000 or more. In certain cases, a plurality includes at least 10 to 50. In other embodiments, a plurality may be at least 50 to 1,000.

[0045] Additional definitions may be found elsewhere in this disclosure. Description of exemplary embodiments

[0046] Transgenic chickens are presented that have modified immunoglobulin heavy chain immunoglobulin loci. As described above and in more detail below, the modified loci lack endogenous VDJ regions and instead contain a human VH segment, a human D cluster, a human J segment, and a human VDJ region. H The modified IgH locus undergoes V(D)J recombination in chickens, resulting in gene conversion between the upstream pseudogenes and the human VH segments, allowing chickens to produce antibodies with diverse immunoglobulin heavy chains.

[0047] Before the subject invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0048] Where a range of values ​​is presented, unless the context clearly dictates otherwise, it is understood that each other stated or intervening value between the upper and lower limits of that range, and on any of that stated ranges, to one-tenth of the unit of the lower limit, is included within the scope of the invention.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0050] It should be noted that, as used herein and in the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, a reference to "cells" includes a plurality of cells, a reference to a "candidate agent" includes a reference to one or more candidate agents and equivalents thereof known to those skilled in the art, and so forth. It should be further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as a precedent for using exclusive language, such as "sole," "only," and the like, in connection with the recitation of claim elements or the use of "negative" limitations.

[0051] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the publication dates provided may be different from the actual publication dates which may need to be independently confirmed.

[0052] All publications and patents cited herein are incorporated by reference to the same extent as if each individual publication or patent was specifically and individually indicated to be incorporated by reference, and are incorporated by reference herein to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the publication dates provided may be different from the actual publication dates, which may need to be independently confirmed.

[0053] It will be apparent to those skilled in the art upon reading this disclosure that each of the individual embodiments described and illustrated herein has individual components and features which may be readily separated or combined with the features of any of the other embodiments without departing from the scope or spirit of the invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. Transgenic chickens and methods for their preparation

[0054] A transgenic chicken is presented, whose genome contains a modified endogenous immunoglobulin heavy chain (IgH) locus. This modified locus is shown schematically in Figure 1 as "SynVH-SD." As shown, the modified locus lacks the entire adjacent endogenous chicken VDJ region. The sequence of this locus is currently unknown but is believed to be in the range of 10-12 kb (e.g., approximately 11 kb) in length, or at least 15 kb (e.g., 15-25 kb in length, or approximately 20 kb in length). Based on the results described in the Examples section below, the wild-type locus does not contain any essential genes (other than the endogenous chicken VDJ sequence), unlike other animals (e.g., mice). Deletion of the endogenous chicken VDJ region prevents V(D)J recombination with the VDJ human sequence, as described below. Such recombination events remove much of the locus, thereby inactivating it. Deletion of the endogenous chicken VDJ region prevents these events from occurring.

[0055] In addition to lacking the entire flanking endogenous chicken VDJ region, the locus contains (i) an immunoglobulin heavy chain gene promoter, e.g., a chicken immunoglobulin heavy chain gene promoter; (ii) a germline human VDJ gene promoter; H Segment, in this case germline human V H The segment comprises, in operable linkage, a coding sequence for a variable domain comprising FR1, CDR1, FR2, CDR2, and FR3. H The segments are sometimes referred to in the art as "germline V H gene," "functional V H segment" or "germline V H Excluding pseudogenes, the haploid human genome contains over 40 germline V sequences. HIt is believed that there are several segments (see, e.g., Kohsaka et al., J. Clin. Invest. 1996 98:2794-800) and can be classified into at least seven families (see, e.g., Schroeder et al., International Immunology, 2:41-50 1989). In some embodiments, the human germline V H The segments are, for example, V H 3 Family, V H 1 Family or V H Such segments may be derived from family 4. Such segments lack heavy chain CDR3 and FR4 coding sequences.

[0056] As shown in Figure 1, germline human V H Downstream of the segment, the modified locus also includes (iii) a human D cluster (i.e., a series of, e.g., 10-27 human diversity (D) gene segments that can be separated from sequences (i.e., intervening sequences) from the chicken genome), as well as a single human joining (J) segment (e.g., one of the six J segments in the human germline; see, e.g., Li et al. Blood 2004 103:4602-4409). In some embodiments, any codon for cysteine ​​in the D segment can be mutated to encode another amino acid, e.g., tyrosine or tryptophan, to minimize disulfide bonds in antibodies produced by the chicken (particularly in the heavy chain CDR3 region). The recombination signal sequences (RSSs) flanking the variable (V), diversity (D), and joining (J) gene segments can be of chicken origin, but because the sequences are nearly identical, chicken recombinase should recognize the human RRSs.

[0057] Downstream of the J segment, the locus contains multiple sequences encoding constant regions that may be endogenous to the chicken. The locus includes an intron that connects the 3' end of the J segment transcript to the 5' end of a copy of the constant region-encoding sequence. As shown, the modified locus also contains germline human V Hand (i) the FR1, FR2, and FR3 segments of the pseudogenes (i.e., sequences that "encode" the heavy chain FR1, FR2, and FR3 sequences of the antibody) are identical to those of the germline human V H and (ii) the CDR1 and CDR2 sequences are substantially the same as (i.e., have at least 95% the same or identical sequence to) the FR1, FR2, and FR3 segments of the corresponding segments of the VGA fragments, respectively; and H Different human V segments in the same family H The CDR1 and CDR2 can be encoded by a segment, for example, a human germline V H Segment is V H If it is a member of the 3 family, the pseudogene contains the FR1, FR2, and FR3 sequences of the segment and the V H The CDR1 / CDR2 sequences of other human germline VH segments from the 3 families are included. H Segment is V H If it is a member of one family, the pseudogene contains the FR1, FR2, and FR3 sequences of that segment and the V H Other human germline V in family 1 H In some embodiments, the pseudogene comprises a germline human V H Inverted orientation relative to the segment. Germline human V HThe segments can be selected from the following sequences: VH1-18, VH1-2, VH1-24, VH1-3, VH1-45, VH1-46, VH1-58, VH1-69, VH1-8, VH2-26, VH2-5, VH2-70, VH3-11, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-3 VH3-3, VH3-35, VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-7, VH3-72, VH3-73, VH3-74, VH3-9, VH4-28, VH4-31, VH4-34, VH4-39, VH4-4, VH4-59, VH4-61, VH5-51, VH6-1, and VH7-81. For a description of different germline sequences, see PCT Publication No. WO 2005 / 005604.

[0058] As mentioned above, human germline V H The FW segments of the V and pseudogenes can be identical to each other, but the V segments of the human germline V H The CDR segments of the pseudogenes may differ, and thus gene conversion may occur between the CDR segments of the pseudogenes and germline sequences. Furthermore, the CDRs may vary in length. In certain embodiments, heavy chain CDR1 may range from 6 to 12 amino acid residues in length, heavy chain CDR2 may range from 4 to 12 amino acid residues in length, and heavy chain CDR3 may range from 3 to 25 amino acid residues in length, although antibodies with CDR lengths outside these ranges are contemplated.

[0059] As shown in the above configuration and in Figure 1, the modified IgH locus undergoes V(D)J recombination in chickens to generate multiple germline human V(D)J loci. H Pseudogenes are those that share nucleotide sequences with germline human V(D)J recombination by gene conversion. H segment (at least germline human V HThe CDR1 and CDR2 coding sequences of the heavy chains are provided by the heavy chains of chickens, and chickens produce antibodies containing diverse immunoglobulin heavy chains. Antibodies produced by chickens are diverse in the heavy chain CDR1, CDR2, and CDR3 regions, with the median length of the heavy chain CDR3 being 11-13, e.g., approximately 12, residues. The CDR3 region is diversified by D segments selected by V(D)J recombination and somatic hypermutation. The lack of TdT in chickens limits the length of the heavy chain CDR3 to that encoded by the D gene and / or that can be inserted by gene conversion. As a result, the heavy chain CDR3 is relatively short compared to wild-type chickens, and only a few D-D binding sites have been observed with human antibodies.

[0060] The chicken can be homozygous for the modified IgH locus or heterozygous for the modified IgH locus.When the chicken is heterozygous for the modified IgH locus, the endogenous IgH locus of the homologous chromosome may be knocked out.For example, in some embodiments, the endogenous IgH locus of the homologous chromosome may lack its J region or the entire adjacent endogenous chicken VDJ region.The chicken can also be heterozygous for the wild-type IgH locus.

[0061] In certain embodiments, the transgenic chicken can also express an immunoglobulin light chain V region linked to a chicken light chain constant region, or a human light chain constant region, e.g., a human V region linked to a human immunoglobulin light chain, such that the antibodies produced by the chicken will have fully human or chimeric light chains with a human V region and a chicken constant region.

[0062] In certain embodiments, antibodies produced by the subject transgenic animals may contain chicken constant domains and human variable domains. Because endogenous constant regions can be used in these embodiments, the antibodies can still undergo class switching and affinity maturation, allowing the animal to develop a normal immune system and mount a normal immune response. In certain embodiments, transgenic chickens have three endogenous constant regions at the heavy chain locus, encoding IgM, IgY, and IgA. During early B cell development, B cells express IgM. As affinity maturation progresses, class switching converts the constant regions to IgY or IgA. IgY provides humoral immunity in both adults and newborn chicks, which receive approximately 200 mg of IgY through reserves stored in the egg yolk. IgA is found primarily in lymphoid tissues (e.g., spleen, Peyer's patches, Harderian glands) and the oviduct, but small amounts migrate to eggs and are subsequently taken up by the developing embryo.

[0063] Also provided are transgenic chickens lacking the entire flanking endogenous chicken VDJ region on one or both of their homologous chromosomes, as described above. Also provided are B cells derived from the transgenic chickens.

[0064] Methods for preparing a transgenic chicken are provided. In certain embodiments, the methods include (a) deleting the entire contiguous endogenous chicken VDJ region from the chicken immunoglobulin heavy chain (IgH) locus, and (b) generating a germline human VDJ region comprising (i) an immunoglobulin heavy chain gene promoter, (ii) a coding sequence for a variable domain comprising FR1, CDR1, FR2, CDR2, and FR3. H segment, (iii) a human D cluster, (iv) a human J segment, and (vi) a functional human V segment, each of which is (b)(ii). Hand inserting into the locus a construct containing multiple pseudogenes containing substantially the same FR1, FR2, and FR3 coding sequences and CDR1 and CDR2 coding sequences as the segment. Steps (a) and (b) can be performed in any order. However, non-coding sequences (introns) can be retained in their endogenous configuration to preserve endogenous regulatory elements that may be contained within.

[0065] Once a transgenic animal of interest has been prepared, antibodies against the antigen can be readily obtained by immunizing the animal with the antigen. A variety of antigens can be used to immunize the transgenic host animal. Such antigens include microorganisms, such as viruses and single-celled organisms (such as bacteria and fungi), live, attenuated, or dead microorganisms, fragments of microorganisms, or antigenic molecules isolated from microorganisms.

[0066] In some embodiments, the method may include (a) immunizing the transgenic chicken with an antigen and (b) obtaining from the transgenic chicken an antibody, e.g., a polyclonal or monoclonal antibody, that specifically binds to the antigen. In some embodiments, the method may include (c) preparing hybridomas using B cells from the transgenic chicken and (d) screening the hybridomas to identify hybridomas that produce antibodies that specifically bind to the antigen. The method may further include using PCR to amplify nucleic acids encoding heavy and light chain variable regions from B cells of the transgenic animal and expressing recombinant antibodies using the amplified nucleic acids. Monoclonal antibodies may also be recovered from the transgenic chicken by deep sequencing or any other B cell interrogation technique (see, for example, the Abcellera website) using a GEM assay (U.S. Patent Nos. 8,030,095 and 8,415,173; Izquierdo et al., 2014).

[0067] In certain embodiments, the transgenic chickens are transgenic for GD2, EGF-R, CEA, CD52, CD20, Lym-1, CD6, complement activation receptor (CAR), EGP40, VEGF, tumor-associated glycoprotein TAG-72 AFP (alpha-fetoprotein), BLyS (TNF and APOL-related ligand), CA125 (cancer antigen 125), CEA (carcinoembryonic antigen), CD2 (T cell surface antigen), CD3 (TCR-associated heteromultimer), CD4, CD11a (integrin alpha-L), CD14 (monocyte differentiation antigen), CD20, CD22 (B cell receptor), CD23 (low affinity IgE receptor), CD25 (IL-2 receptor alpha chain), CD30 (cytokine receptor), CD33 (myeloid cell surface antigen), CD40 (tumor necrosis factor receptor), CD44v6 (mediates leukocyte adhesion), CD52 (CAMPATH-1), CD80 (costimulator of CD28 and CTLA-4), complement component C5, CTLA, EGFR, eotaxin (cytokine A11), HER2 / neu, HER3, HLA-DR, HLA-DR10, HLA Immunization may be performed with Class II, IgE, GPiib / iiia (integrin), integrin aVβ3, integrin a4β1 and a4β7, integrin β2, IFN-γ, IL-1β, IL-4, IL-5, IL-6R (IL6 receptor), IL-12, IL-15, KDR (VEGFR-2), Louisi, mesothelin, MUC1, MUC18, NCAM (neural cell adhesion molecule), oncofetal fibronectin, PDGFβR (beta platelet-derived growth factor receptor), PMSA, renal carcinoma antigen G250, RSV, E-selectin, TGFβ1, TGFβ2, TNFα, DR4, DR5, DR6, VAP-1 (vascular adhesion protein 1), or VEGF, etc., to produce therapeutic antibodies.

[0068] The antigen, with or without an adjuvant, can be administered to the transgenic chickens in any convenient manner and can be administered according to a predetermined schedule.

[0069] Following immunization, serum from immunized transgenic animals can be fractionated to purify pharmaceutical-grade polyclonal antibodies specific to the antigen. In the case of transgenic birds, antibodies can also be prepared by fractionating egg yolk. Enriched purified immunoglobulin fractions can be obtained by chromatography (e.g., affinity, ion exchange, gel filtration), selective precipitation with salts such as ammonium sulfate, organic solvents such as ethanol, or polymers such as polyethylene glycol.

[0070] To prepare monoclonal antibodies, antibody-producing cells, such as spleen cells or other cells, can be isolated from immunized transgenic animals and used for cell fusion with transformed cell lines to produce hybridomas, or antibody-encoding cDNAs can be cloned and expressed in transfected cells using standard molecular biology techniques. Procedures for preparing monoclonal antibodies are well established in the art. See, for example, European Patent Application No. 0 583 980 A1, U.S. Patent No. 4,977,081, WO 97 / 16537, and European Patent No. 0 491 057 B1, the disclosures of which are incorporated herein by reference. In vitro production of monoclonal antibodies from cloned cDNA molecules is described by Andris-Widhopf et al., J Immunol Methods 242:159 (2000) and Burton, Immunotechnology 1:87 (1995), the disclosures of which are incorporated herein by reference.

[0071] Antibody Compositions and Screening Methods Provided is antibody composition.As mentioned above, the heavy and light chain variable domains of antibody are naturally paired by the immune system of animals.In certain cases, such antibody can be post-translationally modified (for example, glycosylated) by host cells, and can have the glycosylation pattern and composition characteristic of the species of transgenic chicken.

[0072] The antibodies produced by the subject transgenic chickens can be screened to identify the antibody of interest. Generally, this method involves producing a plurality of hybrid cells that produce monoclonal antibodies using the methods described above, and screening the plurality of monoclonal antibodies using one or various combinations of assays. Generally, these assays are functional assays and can be grouped as follows: assays that detect the binding affinity or specificity of an antibody, and assays that detect the ability of an antibody to inhibit a process.

[0073] A monoclonal antibody identified as having specific binding activity or inhibitory activity with an antigen is called a monoclonal antibody of interest.

[0074] Binding assay These assays verify the ability of antibodies to specifically bind to a substrate. The term "specifically" in the context of antibody binding refers to the high avidity and / or high affinity binding of an antibody to a particular antigen, i.e., polypeptide, or epitope. In many embodiments, the specific antigen is the antigen (or a fragment or subfraction of the antigen) used to immunize the animal host from which the antibody-producing cells were isolated. An antibody that specifically binds to an antigen or a fragment thereof exhibits stronger binding than the binding of the same antibody to other antigens. An antibody that specifically binds to a polypeptide may be able to bind to other polypeptides at a weak but detectable level (e.g., 10% or less of the binding exhibited by the polypeptide of interest). Such weak binding, or background binding, is readily distinguishable from specific antibody binding to the polypeptide of interest, for example, by using appropriate controls. Generally, a specific antibody exhibits stronger binding than 10% of the binding exhibited by the polypeptide of interest. -7 M or more, e.g., 10 -8 M or more (e.g., 10 -9 M, 10 -10 , 10 -11 Generally, the binding affinity of the antibody is 10 -6Antibodies with binding affinities below M are not useful in that they do not bind to antigens at detectable levels using conventional methodologies currently in use.

[0075] Typically, in performing a screening assay, antibody samples produced by a library of antibody-producing host cells are deposited on a solid support in such a way that each antibody can be identified, for example, by plate number and position on the plate, or by another identifier that allows identification of the host cell culture that produced the antibody.

[0076] The antibodies of the present invention can be screened for immunospecific binding by any method known in the art. Immunoassays that can be used include, but are not limited to, competitive and non-competitive assay systems using techniques such as Western blot, radioimmunoassay, ELISA (enzyme-linked immunosorbent assay), "sandwich" immunoassay, immunoprecipitation assay, precipitin reaction, gel diffusion precipitin reaction, immunodiffusion assay, agglutination assay, complement fixation assay, immunoradiometric assay, fluorescent immunoassay, and protein A immunoassay, to name a few. Such assays are routine and well known in the art (see, e.g., Ausubel et al., eds., 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated herein by reference in its entirety). Exemplary immunoassays are briefly described below (but are not intended to be limiting).

[0077] Immunoprecipitation protocols generally involve lysing a population of cells in a lysis buffer, such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol), supplemented with protein phosphatase and / or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to the cell lysate and incubating at 4°C for a period of time (e.g., 1-4 hours), adding Protein A and / or Protein G Sepharose beads to the cell lysate and incubating at 4°C for approximately 1 hour or longer, washing the beads with lysis buffer, and resuspending the beads in SDS / sample buffer. The ability of the antibody of interest to immunoprecipitate a specific antigen can be assessed, for example, by Western blot analysis. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase antibody binding to an antigen and decrease background (e.g., pre-clearing the cell lysate with Sepharose beads).

[0078] Western blot analysis generally involves the preparation of protein samples, followed by electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%–20% SDS-PAGE, depending on the molecular weight of the antigen), and transfer of the isolated protein samples from the polyacrylamide gel to a membrane, such as nitrocellulose, PVDF, or nylon. After transfer, the membrane is blocked with a blocking solution (e.g., PBS or nonfat milk containing 3% BSA), washed with a wash buffer (e.g., PBS-Tween 20), and incubated with a primary antibody (antibody of interest) diluted in blocking buffer. After this incubation, the membrane is washed with a wash buffer and incubated with a secondary antibody (recognizing the primary antibody, e.g., an anti-human antibody) conjugated to an enzyme substrate (e.g., horseradish peroxidase or alkaline phosphatase) or a radioactive molecule (e.g., 32P or 125I). After further washing, the presence of the antigen can be detected. Those skilled in the art will be familiar with the parameters that can be modified to increase the detected signal and reduce background noise.

[0079] ELISA involves preparing an antigen, coating the wells of a 96-well microtiter plate with the antigen, adding an antibody of interest conjugated to a detectable compound such as an enzyme substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the wells, incubating for a certain period of time, and detecting the presence of the antigen. In ELISA, the antibody of interest does not need to be conjugated to a detectable compound; instead, a secondary antibody (that recognizes the antibody of interest) conjugated to a detectable compound can be added to the well. Furthermore, instead of coating the wells with the antigen, an antibody can be coated to the well. In this case, the antigen of interest can be added to the coated well, followed by the addition of a secondary antibody conjugated to a detectable compound. Those skilled in the art will be familiar with parameters that can be modified to increase the signal detected, as well as other variations of ELISA known in the art.

[0080] The binding affinity of an antibody to an antigen and the off-rate of antibody-antigen interaction can be determined by competitive binding assay. One example of competitive binding assay is radioimmunoassay, which involves incubating a labeled antigen (such as 3H or 125I) with an antibody of interest in the presence of increasing amounts of unlabeled antigen, and detecting the antibody bound to the labeled antigen. The affinity of an antibody of interest to a specific antigen and the binding off-rate can be determined from the data by Scatchard plot analysis. Competition with a secondary antibody can also be determined using radioimmunoassay. In this case, an antigen is incubated with the antibody of interest conjugated to a labeled compound (e.g., 3H or 125I) in the presence of increasing amounts of unlabeled secondary antibody.

[0081] Antibodies of the present invention can be screened using immunocytochemistry on cells (e.g., mammalian cells such as CHO cells) transfected with a vector capable of expressing the antigen, or with the vector alone, using techniques commonly known in the art. Antibodies that bind to antigen-transfected cells but not to cells transfected with the vector alone are antigen-specific.

[0082] However, in certain embodiments, the assay is an antigen capture assay, and an array or microarray of antibodies can be used for this purpose. Methods for preparing and using microarrays of polypeptides are known in the art (see, e.g., U.S. Patent Nos. 6,372,483, 6,352,842, 6,346,416, and 6,242,266).

[0083] Inhibitor assay In certain embodiments, the assay measures the antibody's specific inhibition of an interaction between a first compound and a second compound (e.g., two biopolymers) or specifically inhibits a reaction (e.g., an enzymatic reaction). In an interaction inhibition assay, one interaction substrate, typically a biopolymer, e.g., a protein, e.g., a receptor, can be attached to a solid support in a reaction vessel. The antibody is added to the reaction vessel, followed by the addition of a detectable binding partner of the substrate, typically a biopolymer, e.g., a protein, e.g., a radiolabeled ligand of the receptor. After washing the vessel, inhibition of the interaction can be measured by determining the amount of detectable binding partner present in the vessel. Inhibition of the interaction occurs when binding of the binding partner is reduced by more than about 20%, more than about 50%, more than about 70%, more than about 80%, or more than about 90%, or more than 95% or more compared to a control assay without the antibody.

[0084] In a reaction inhibition assay, an enzyme can be bound to a solid support in a reaction vessel. Typically, an antibody is added to the reaction vessel, followed by the addition of a substrate for the enzyme. In many embodiments, the product of the reaction between the enzyme and the substrate is detectable, and the reaction is usually stopped after a certain period of time. After the reaction is stopped, reaction inhibition can be measured by measuring the level of detectable reaction product present in the vessel. Reaction inhibition occurs when the rate of the reaction is reduced by more than about 20%, more than about 50%, more than about 70%, more than about 80%, more than about 90%, or more than 95% or more compared to a control assay without antibody.

[0085] In vivo assays In certain embodiments, the monoclonal antibody is validated in vivo. Generally, the method involves administering the subject monoclonal antibody to an animal model for a disease or condition, and determining the effect of the monoclonal antibody on the disease or condition of the model animal. The in vivo assay of the present invention includes a control, and in this case, a suitable control includes a sample in the absence of the monoclonal antibody. Generally, multiple assay mixtures are run in parallel at different antibody concentrations to obtain different responses to various concentrations. Typically, one of these concentrations serves as a negative control, i.e., the concentration is zero or below the detection level.

[0086] The subject monoclonal antibodies are those that modulate the symptoms of a disease or condition in an animal model, i.e., increase or decrease the symptoms by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 80%, at least about 90%, or more, compared to a control in the absence of the antibody. Generally, the subject monoclonal antibodies make the subject animal more similar to a comparable animal that is not afflicted with the disease or condition. Monoclonal antibodies with therapeutic value identified using the methods and compositions of the present invention are referred to as "therapeutic" antibodies.

[0087] Since the hybrid cells expressing the antibody of interest contain nucleic acids encoding immunoglobulin heavy and light chains, once the host cells expressing the monoclonal antibody of interest have been identified, the nucleic acid encoding the monoclonal antibody of interest can be identified. Thus, the nucleic acid of interest can be identified by various methods known to those skilled in the art. Similar methods are used to identify host cell cultures in the production of monoclonal antibodies using hybridoma technology (Harlow et al., Antibodies: A Laboratory Manual, First Edition (1988) Cold Spring Harbor, NY).

[0088] For example, once a monoclonal antibody of interest has been identified, the host cells expressing the antibody of interest can be identified using a "look-up" table that lists the corresponding host cell cultures for all antibody samples. In certain other embodiments, a look-up table containing antibody library sample identifiers, corresponding expression cassette library sample identifiers, and / or host cell identifiers can be used to identify nucleic acids of interest.

[0089] Once identified, nucleic acids encoding the monoclonal antibody of interest can be recovered, characterized, and manipulated using techniques well known to those of skill in the art (Ausubel, et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons, (1995), and Sambrook, et al., Molecular Cloning: A Laboratory Manual, Third Edition, (2001) Cold Spring Harbor, NY).

[0090] Antibody expression Also provided are several methods for producing the monoclonal antibodies of interest. Generally, these methods involve incubating host cells containing nucleic acid encoding the monoclonal antibody of interest under conditions sufficient for antibody production.

[0091] In some embodiments, methods for producing a monoclonal antibody of interest include transferring a specified expression cassette for the monoclonal antibody of interest into an appropriate vector and transferring the recombinant vector to a host cell, resulting in expression of the monoclonal antibody. In some embodiments, the subject methods also include transferring sequences encoding at least the variable domains from the specified heavy and light chains into vectors suitable for their expression in immunoglobulin heavy and light chains. At this point, sequences encoding appropriate constant domains and / or other antibody domains can be added to the sequences encoding the variable domains. These nucleic acid modifications can also allow for humanization of the antibody of interest.

[0092] The subject monoclonal antibodies can be produced by any method known in the art for the synthesis of antibodies, in particular by recombinant expression techniques.

[0093] Recombinant expression of a subject monoclonal antibody, or a fragment, derivative, or analog thereof, typically requires the construction of an expression vector containing a polynucleotide encoding the antibody. Methods well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA and synthetic techniques. Thus, the present invention provides vectors containing a nucleotide sequence encoding the antibody molecule of the present invention.

[0094] The expression vector is transferred into a host cell by conventional techniques, and the transfected cells are then cultured to produce the antibody of interest. In most embodiments, vectors encoding both the heavy and light chains are co-expressed in the host cell, resulting in expression of the entire immunoglobulin molecule.

[0095] A variety of host-expression vector systems can be utilized to express the subject monoclonal antibodies, including, but not limited to, microorganisms such as bacteria (E. coli, Bacillus subtilis, etc.) transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant viral expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant viral expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells, etc.) harboring recombinant expression constructs containing promoters derived from the genomes of mammalian cells (e.g., metallothionein promoter) or mammalian viruses (e.g., adenovirus late promoter; vaccinia virus 7.5K promoter). In many embodiments, bacterial cells, such as Escherichia coli, and eukaryotic cells are used for expression of whole recombinant antibody molecules. For example, mammalian cells, such as Chinese hamster ovary cells (CHO), in combination with vectors such as the human cytomegalovirus major intermediate-early gene promoter element, are effective expression systems for antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio / Technology 8:2 (1990)).

[0096] In bacterial systems, several expression vectors can be selected depending on the intended use of the expressed antibody molecule. For example, when large quantities of such proteins are produced, to generate pharmaceutical compositions of the antibody molecule, vectors directing the expression of high levels of fusion protein products that are easily purified may be desirable. Such vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody coding sequence can be individually ligated into the vector in-frame with the lac Z coding region to produce a fusion protein; pIN vectors (Inouye & Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem. 24:5503-5509 (1989)); and the like. pGEX vectors can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can be easily purified from lysed cells by adsorption and binding to a matrix of glutathione-agarose beads, followed by elution in the presence of free glutathione. The pGEX vectors are designed to contain thrombin or factor Xa protease cleavage sites, allowing the cloned target gene product to be released from the GST moiety.

[0097] In an insect system, Autographa califomica nuclear polyhedrosis virus (AcNPV) is used as a vector to express antibodies. The virus is grown in Spodoptera frugiperda cells. The antibody coding sequence can be cloned individually into non-essential regions of the virus (e.g., the polyhedrin gene) or placed under control of an AcNPV promoter (e.g., the polyhedrin promoter).

[0098] Several virus-based expression systems can be used to express the antibody of interest in mammalian host cells. When adenovirus is used as an expression vector, the antibody coding sequence of interest can be ligated to an adenovirus transcription / translation control complex, such as the late promoter and tripartite leader sequence. This chimeric gene can then be inserted into the adenovirus genome by in vitro or in vivo recombination. Insertion into a non-essential region of the viral genome (e.g., region E1 or E3) results in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts. (See, e.g., Logan & Shenk, Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Expression efficiency can be improved by including appropriate transcription enhancer elements, transcription terminators, etc. (See, e.g., Bittner et al., Methods in Enzymol. 153:51-544 (1987)).

[0099] Stable expression can be used for long-term, high-yield production of recombinant antibodies. For example, cell lines that stably express antibody molecules can be engineered. Rather than using expression vectors containing viral origins of replication, host cells can be transformed with an immunoglobulin expression cassette and a selectable marker. Following introduction of the foreign DNA, engineered cells can be grown in an enriched medium for 1–2 days and then switched to a selective medium. The selectable marker on the recombinant plasmid confers resistance to selection, allowing the cells to stably integrate the plasmid into their chromosomes and grow to form foci that can then be cloned and expanded into cell lines. Such engineered cell lines can be particularly useful in screening and evaluating compounds that interact directly or indirectly with antibody molecules.

[0100] Several selection systems can be used, including, but not limited to, the genes for herpes simplex virus thymidine kinase (Wigler et al., Cell 11:223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) can be used in tk, hgprt, or aprt cells, respectively. Additionally, antimetabolite resistance can be used as the basis for selection of the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); and neo, which confers resistance to the aminoglycoside G-418 (Clinical Pharmacy 12:488-505; Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); TIB TECH 11(5):155-215 (1993)); and hygro, which confers resistance to hygromycin (Santerre et al., Gene 30:147 (1984)).Methods generally known in the field of recombinant DNA technology can be routinely applied to select the desired recombinant clones, and such methods are described, for example, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981).

[0101] A host cell can be simultaneously transfected with two expression vectors of the present invention, one encoding a heavy chain-derived polypeptide and the other encoding a light chain-derived polypeptide. The two vectors can contain different selectable markers and origins of replication that allow for equal expression of heavy and light chain polypeptides. Alternatively, a single vector can be used that encodes and expresses both heavy and light chain polypeptides.

[0102] Once produced, the antibody molecules of the invention can be purified by any method known in the art for the purification of immunoglobulin molecules, such as chromatography (e.g., ion exchange, affinity, particularly for a specific antigen following Protein A, and sizing column chromatography), centrifugation, differential solubility, or any other standard technique for the purification of proteins. In many embodiments, the antibodies are secreted from the cells into the culture medium and harvested from the culture medium.

[0103] usefulness Also provided are methods for altering or treating at least one antigen-associated disease in a cell, tissue, organ, animal, or patient, using at least one antibody of the present invention, as known in the art or as described herein, for example, by administering or contacting a therapeutically effective amount of the antibody to the cell, tissue, organ, animal, or patient. The present invention also provides methods for altering or treating at least one antigen-associated disease in a cell, tissue, organ, animal, or patient, including, but not limited to, at least one of obesity, immune-related disease, cardiovascular disease, infectious disease, malignant disease, or neurological disease.

[0104] Typically, treatment of a pathological condition is achieved by administering an effective amount or dosage of at least one antibody composition, averaging at least about 0.01 to 500 milligrams of antibody per kilogram of patient per dose, and preferably at least about 0.1 to 100 milligrams of antibody per kilogram of patient per single or multiple doses, depending on the specific activity of the active agent contained in the composition. Alternatively, an effective serum concentration can include a serum concentration of 0.1 to 5000 ng / ml per single or multiple doses. Appropriate dosages are known to physicians and, of course, depend on the particular pathology, the specific activity of the administered composition, and the particular patient receiving treatment. In some cases, achieving the desired therapeutic dose may require repeated administration, i.e., repeated individual administrations of a specific monitored or metered dose, with the individual administrations being repeated until the desired daily dose or effect is achieved.

[0105] In certain embodiments, the subject antibodies can also be used in diagnostics where the antibody is conjugated to a detectable marker, or as a primary antibody in conjunction with a secondary antibody conjugated to a detectable marker. Detectable markers include radioactive and non-radioactive labels and are well known to those skilled in the art. Common non-radioactive labels include detectable enzymes such as horseradish peroxidase, alkaline phosphatase, and fluorescent molecules. Fluorescent molecules absorb light at one wavelength and emit at another, allowing visualization, for example, by fluorescence microscopy. Spectrophotometers, fluorescence microscopes, fluorescent plate readers, and flow sorters are well known and are often used to detect specific molecules that fluoresce when covalently bound to a fluorescent dye. Fluorescent dyes such as green fluorescent protein, red-shifted variants of green fluorescent protein, aminocoumarin acetic acid (AMCA), fluorescein isothiocyanate (FITC), tetramethylcodamine isothiocyanate (TRITC), Texas Red, Cy3.0, and Cy5.0 are examples of useful labels.

[0106] When a fluorescent marker is used, the molecule can be used in cell isolation strategies such as fluorescence-activated cell sorting (FACS). In fluorescence-activated cell sorting, cells tagged with a fluorescent molecule are electronically sorted in a flow cytometer, such as a Becton-Dickinson (San Jose, CA) FACS IV cytometer or equivalent instrument. The fluorescent molecule is an antibody that recognizes a specific cell surface antigen. The antibody is conjugated to a fluorescent marker, such as fluorescein isothiocyanate (FITC) or phycoerythrin (PE).

[0107] Embodiment Embodiment 1. A transgenic chicken, comprising: (a) The entire adjacent endogenous chicken VDJ region is absent, and (b) an operable link; (i) an immunoglobulin heavy chain gene promoter; (ii) a germline human V nucleotide containing a coding sequence for a variable domain including FR1, CDR1, FR2, CDR2, and FR3 sequences; H segment, (iii) human D cluster; (iv) a single human J segment; (v) multiple sequences upstream of the germline human VH segment of (b)(ii) encoding a constant region; (vi) each (b) FR1, FR2, and FR3 sequences substantially the same as a functional human VH segment of (ii); Each pseudogene has different CDR1 and CDR2 sequences. Multiple pseudogenes of the structure FR1-CDR1-FR2-CDR2-FR3 containing Contains a genome comprising an altered endogenous immunoglobulin heavy chain (IgH) locus, The modified IgH locus undergoes V(D)J recombination in chickens, Multiple germline human V H The pseudogene donates nucleotide sequences to germline human VH segments by gene conversion after V(D)J recombination, Chickens produce antibodies containing a variety of immunoglobulin heavy chains. Transgenic chickens.

[0108] Embodiment 2. The transgenic chicken of embodiment 1, wherein the CDR1 and CDR2 sequences of (b)(vi) encode the CDR1 and CDR2 of a different human VH segment in the same family as the functional human VH segment of (b)(ii).

[0109] Embodiment 3. The transgenic chicken of any one of embodiments 1 to 2, wherein the entire length of the contiguous endogenous chicken VDJ regions of (a) is at least 15 kb.

[0110] Embodiment 4. The transgenic chicken of any of embodiments 1 to 3, wherein the promoter of (b)(i) is a chicken immunoglobulin heavy chain gene promoter.

[0111] Embodiment 5. The germline human VH segment of (b)(ii) and the CDR1 and CDR2 sequences of (vi) are V H 3 Family, V H 1 Family or V H 5. The transgenic chicken of any of embodiments 1 to 4, which is derived from four families.

[0112] Embodiment 6. The transgenic chicken of any of embodiments 1 to 5, wherein in cluster D, any codon for cysteine ​​is mutated to encode another amino acid.

[0113] Embodiment 7. The transgenic chicken of embodiment 6, wherein in cluster D any codon for cysteine ​​is mutated to encode tyrosine or tryptophan.

[0114] Embodiment 8. The transgenic chicken of any of embodiments 1 to 7, wherein the intervening sequence of the D cluster is of chicken origin.

[0115] Embodiment 9. The transgenic chicken of any of embodiments 1 to 8, wherein the plurality of pseudogenes of (b)(v) comprises at least 10 pseudogenes.

[0116] Embodiment 10. The transgenic chicken of any of embodiments 1 to 9, wherein the pseudogene of (b)(v) is in the reverse orientation relative to the germline human VH segment of (b)(ii).

[0117] Embodiment 11. A transgenic chicken according to any one of 1 to 10, wherein a plurality of sequences encoding the constant region of (b)(v) are endogenous to the chicken.

[0118] Embodiment 12. The transgenic chicken of any of embodiments 1 to 11, wherein the transcript of the modified immunoglobulin heavy chain (IgH) locus comprises an intron joining the 3' end of the copy of the J coding sequence to the 5' end of the copy of the constant region coding sequence of (b)(v).

[0119] Embodiment 13 The transgenic chicken of any of embodiments 1 to 12, wherein the chicken is homozygous for the modified IgH locus.

[0120] Embodiment 14 The transgenic chicken of any of embodiments 1 to 13, wherein the chicken is heterozygous for the modified IgH locus and the IgH locus on the homologous chromosome is knocked out.

[0121] Embodiment 15. The transgenic chicken of any of embodiments 1 to 14, wherein the chicken is heterozygous for the modified IgH locus and the IgH locus on the homologous chromosome is wild type.

[0122] Embodiment 16. The transgenic chicken of embodiment 14, wherein the chicken is heterozygous for the modified IgH locus, and the IgH locus on the homologous chromosome lacks the entire adjacent endogenous chicken VDJ region.

[0123] Embodiment 17 The transgenic chicken of embodiment 14, wherein the chicken is heterozygous for the modified IgH locus, and the IgH locus of the homologous chromosome lacks a J region.

[0124] Embodiment 18 The transgenic chicken of any of embodiments 1 to 17, wherein the antibodies produced by the chicken are diversified in the heavy chain CDR1, CDR2 and CDR3 regions.

[0125] Embodiment 19. A transgenic chicken lacking the entire adjacent endogenous chicken VDJ region on one or both of its homologous chromosomes.

[0126] Embodiment 20. A B cell derived from a transgenic chicken according to any one of embodiments 1 to 19.

[0127] Embodiment 21. (a) immunizing the transgenic chicken of any of embodiments 1 to 20 with an antigen; and (b) obtaining from the chicken an antibody that specifically binds to the antigen; A method comprising:

[0128] Embodiment 22: The method of embodiment 21, wherein the antibody is polyclonal.

[0129] Embodiment 23 The method of embodiment 21, wherein the antibody is monoclonal.

[0130] Embodiment 24. (c) preparing hybridomas using B cells from the transgenic chicken; and (d) screening the hybridomas to identify hybridomas that produce antibodies that specifically bind to the antigen. 24. The method of any of embodiments 21 to 23, further comprising:

[0131] Embodiment 25. The method of any one of embodiments 21 to 24, further comprising using PCR to amplify nucleic acids encoding the heavy and light chain variable regions from B cells of the transgenic animal, and using the amplified nucleic acids to express the recombinant antibody.

[0132] Embodiment 26. An antibody produced by the transgenic chicken of any of embodiments 1 to 19.

[0133] Embodiment 27. A method comprising: (a) Deleting the entire adjacent endogenous chicken VDJ region from the chicken immunoglobulin heavy chain (IgH) locus; and (b)(i) an immunoglobulin heavy chain gene promoter; (ii) a germline human VH segment comprising a coding sequence for a variable domain comprising FR1, CDR1, FR2, CDR2, and FR3 sequences; (iii) human D cluster; (iv) a human J segment, and (vi) each (b) FR1, FR2, and FR3 sequences substantially the same as a functional human VH segment of (ii); Each pseudogene has different CDR1 and CDR2 coding sequences. Multiple pseudogenes of the structure FR1-CDR1-FR2-CDR2-FR3 containing inserting into the locus a construct comprising Including, Steps (a) and (b) are performed in any order; method. [Example]

[0134] The following examples are provided to demonstrate and further illustrate certain embodiments and aspects of the present invention and should not be construed as limiting its scope.

[0135] Example 1 Preparation of SynVH-SD chickens In this study, transgenic chickens were genetically engineered to produce a human variable region antibody repertoire. From a pharmaceutical perspective, using a single V framework in chickens is advantageous because it allows for the selection of a preferred framework with optimal manufacturing and developability characteristics. The transgene can be designed to concentrate diversity in the CDRs while maintaining germline or near-germline framework sequences. The strategy preserves the advantages of the chicken B cell system for incorporating diversity by using a single human framework with an upstream human-based pseudogene instead of inserting a large human genomic fragment (harboring multiple human V, D, and J genes), which may not be properly regulated in chickens. For a single human framework to deliver therapeutic candidates to any potential target, the level of diversity produced by the transgene must be sufficient. Two lines of transgenic chickens were produced. One carried a pre-rearranged functional VH region that relied entirely on gene conversion / somatic hypermutation to generate diversity, and the other first underwent V(D)J rearrangement to generate a functional VH region, thereby potentially increasing the level of CDR-H3 diversity, followed by gene conversion / somatic hypermutation.

[0136] material and method The pre-rearranged VH region construct, SynVH-C, was previously described (18). The V(D)J rearranged construct, SynVH-SD, was prepared by gene synthesis of several parts followed by ligation. The V, D, and J regions were assembled as follows: the human germline VH3-23*01 gene was used as the single V gene, and the JH6 gene was used as the single J gene. Twenty-four nonredundant human Ds were flanked by recombination signal sequences and intervening regions from the chicken D locus (each of these spacers was approximately 100–200 bp). Cysteine ​​codons in the human D2 family were mutated to encode tyrosine (7 instances) or tryptophan (2 instances). The rearranged elements were cloned into a chicken VH promoter to drive heavy chain expression, and a short section of the chicken JC intron was included for splicing to the endogenous constant region. The human pseudogenes contained FRs derived from the human germline VH3-23 gene and CDRs 1 and 2 derived from the VH3 germline gene family. Thirteen pseudogenes were designed. The spacer sequences between each pseudogene were derived from the chicken pseudogene region, but the chicken V sequences themselves were not included. An attB site was included for targeted insertion of the chicken heavy chain locus into the attP site (21, 22), and a loxP site was included for subsequent recombination with loxP sites in the target genome. The SynVH-SD constructs were transfected into heavy chain attP-containing cells. In these cells, a loxP site had previously been inserted upstream of the chicken VH segment by CRISPR-mediated targeting (22). After insertion of the SynVH-SD transgene, a second loxP site was introduced by the SynVH-SD transgene, immediately upstream of the human pseudogene array, in the same orientation as the first loxP site. By breeding to Cre hens, all DNA between the loxP sites was deleted, including the chicken VH and D genes and the selectable marker used during transfection, resulting in the construct shown in Figure 1 For the light chain, all transgenic chickens used in this study expressed the human V-kappa light chain obtained from the construct SynVK-CK ( 18 ).The light and heavy chains of these birds consisted of human variable regions and chicken constant regions. At the heavy chain locus, the transgene was heterozygous in all cases, with the other allele knocked out, resulting in genotype IgH. SynVH / IgH JH-KO At the light chain locus, the genotype was always IgL. SynVK-CK / IgL VJC-KO It was.

[0137] Chickens carrying SynVH-C were immunized as described ( 18 ). SynVH-SD birds were immunized with either PGRN protein or a combination of DNA and PGRN protein using the same schedule as the SynVH-C birds.

[0138] Splenic lymphocytes were prepared by Ficoll density centrifugation. Splenic lymphocytes (approximately 10 7 Total RNA from 100 individuals was extracted using RNeasy (Qiagen). 10-15 ng of total RNA was used in a OneStep Ahead (Qiagen) calibrated polymerase reaction using primers chVH-F9 (5'-CACCAGTCGGCTCCGCAACCATG-3' (SEQ ID NO: 1)) and cIgY-NGS-R (5'-GGGCGATGTGGGGCTCGC-3' (SEQ ID NO: 2)). Approximately 450 bp amplicons were obtained and sequenced by ABM (Richmond, BC, Canada). ABM performed paired-end merging, cluster analysis, sequence matching to previously identified mAb sequences, and CDR-H3 length determination.

[0139] Sequences were aligned and analyzed using DNAstar software. An Excel macro was downloaded from the website of Annemarie Honegger (University of Zurich) and used to calculate amino acid frequencies.

[0140] Animal experiments were performed in accordance with Ligand Pharmaceuticals' IACUC-approved protocols and under the supervision of the IACUC committee.

[0141] result We analyzed human VH sequences from chickens carrying two different human heavy chain transgenes. One of these transgenes, SynVH-C, contained a pre-rearranged functional V region (18), while the other, SynVH-SD, contained germline V, D, and J segments that rearrange in B cells (Figure 1). The V region of SynVH-C was obtained from a human library screen and contained a rearranged VH3-23 / D1 / JH4 region, which included nine framework (FR) changes relative to the germline VH3-23 gene. The SynVH-SD construct contained a single germline V gene, VH3-23, all human D elements, and a single JH6 gene. The D elements were separated by intervening sequences from the chicken D locus, including a highly conserved recombination signal sequence. All other noncoding sequences (promoters and introns) in both constructs were derived from the chicken heavy chain locus for optimal transcriptional and post-transcriptional regulation. The transgene constructs were inserted into the endogenous heavy chain locus via a combination of gene targeting and integrase-mediated insertion ( 18 , 22 ), with the human V regions of both transgenes spliced ​​to the endogenous downstream chicken constant region.

[0142] Both transgenes contained upstream human-based pseudogenes capable of catalyzing gene conversion into functional human V (8, 11). The pseudogenes were designed to incorporate diversity primarily in the CDRs (Figure 8), although some of the SynVH-C pseudogenes also contained framework modifications. These pseudogenes were designed de novo and were unrelated to V pseudogenes present in the human genome. Two different approaches were used to design the pseudogene CDRs. For SynVH-C, the CDRs were derived from naturally occurring CDR sequences found in databases of human expressed sequence transcripts (ESTs). All three CDRs were contained within the pseudogenes, and the 3' end of each pseudogene contained CDR3 but did not extend into FR4 or contain the invariant Trp-118 residue that marks the boundary of CDR3. A 100-bp spacer sequence was placed between the CDR3 of one pseudogene and the start of the next pseudogene (FR1). In SynVH-SD, the CDRs were derived from CDR1 and 2, members of the germline human VH3 family. Because germline V genes do not contain CDR3, the pseudogene lacked a specific CDR3 sequence. A spacer sequence was placed downstream of FR3. Spacer sequences are diverse sequences that may be used for gene conversion even if they are not derived from human CDR3 (Figure 8). After insertion, the chicken pseudogene array remained upstream in both cases. In the case of SynVH-C, the single chicken germline VH and D clusters, which normally undergo VDJ rearrangement, were still present. However, due to the absence of the germline JH region, these could not recombine into functional V regions, and the downstream human V region was completely rearranged. In the SynVH-SD transgene, the chicken V and D genes were deleted (22), eliminating the possibility of direct recombination of the chicken genes with the human JH gene to replace the human V and D genes. The only JH region present in the genomes of both lineages of birds was the human JH of the SynVH transgene (Fig. 1 ).

[0143] Heavy chain V regions were sequenced en bloc by NGS amplicon sequencing from splenic lymphocyte populations of nine immunized birds (see below for details of immunization). Using a forward primer for the 5' UTR and a reverse primer for the IgY constant region CH1 domain, VH regions were amplified from lymphocyte RNA after reverse transcription and sequenced on a MiSeq (Applied Biological Materials, Canada). Primers used to amplify VH regions were selected so that they would amplify either human or chicken V regions when expressed. In the human transgene, the only sequence that was human was the coding sequence for the V region. All non-coding sequences (5' UTR, introns, etc.) and constant region coding sequences were chicken sequences in both SynVH constructs. Paired-end reads were assembled and translated to obtain theoretical protein sequences. The number of reads, unique nucleotides, and protein sequences obtained from each bird are presented in Table 1. The most common sequences for each bird ranged in the number of times they were found, from approximately 6700 to 89,000. For some analyses, the top 1000 most common unique sequences from each sample were used, representing 34–62% of the total sequence data from each sample.

[0144] Table 1. Sequence data summary Samples from six SynVH-C and three SynVH-SD birds are listed in bird number order. The number of unique nucleotide and protein sequences and the number of unique peptide sequences sequenced more than once (2x depth) are shown. The final column presents the percentage of total sequence reads represented by the top 1000 sequences. [Table 1]

[0145] V region and signal peptide usage Analysis of the VH regions from the nine birds began with determining whether the expressed sequences were fully human, as expected, or contained any chicken sequences (Table 2). All of the V regions from SynVH-SD were human sequences. This was due to the deletion of the endogenous chicken V region upstream of the insertion of SynVH-SD. Surprisingly, approximately 5% of the sequences from the SynVH-C transgene were chicken VH regions. These sequences consisted of chicken CDRs 1-2 and FRs 1-3 fused to CDR3 and human J sequences. This was the only possible alternative, since the only JH sequence present in the genome of the transgenic chicken was the human J from the SynVH transgene. CDR-H3 appears to be human because it lacks the noncanonical cysteine ​​predicted to be present in chicken CDR-H3 (17). Two potential sources of chicken VH sequences were present in the expressed antibody repertoire of SynVH. These include gene conversion from a chicken pseudogene, which still resides upstream of the human pseudogene; or gene replacement of a functional human V region with a functional chicken V region by a secondary rearrangement mechanism, in which the chicken V gene rearranged with a human V gene via a potential recombination signal sequence at the 3' end of the V gene (23-26). These chicken V regions most likely originated from a secondary rearrangement that resulted in an in-frame fusion at the human FR3-CDR3 junction of the transgene, thereby deleting the human V gene. The main evidence supporting gene replacement over gene conversion is that although the signal peptide sequence was also chicken, the pseudogene did not contain a signal peptide sequence, and therefore, the human signal peptide could not be mutated to a chicken signal peptide sequence. Furthermore, if gene conversion can replace an expressed V region with a chicken V region, one might expect the same to occur with a SynVH-SD sequence that also contains an upstream pseudogene. However, V replacement was not observed with SynVH-SD. Functional chicken V and D clusters were deleted upstream of the SynVH-SD transgene, thus eliminating the possibility of gene replacement.

[0146] The signal peptide did not always match the sequence introduced into the transgene construct. Although 80–90% of the SynVH-C and SynVH-SD transgene sequences contained a human signal peptide fused to the human V region sequence, sequence variation was found in the signal peptide. Three patterns of signal peptide alteration were observed. In the first pattern, an intact chicken signal peptide exon was spliced ​​in-frame directly to the human V region exon. This was found in approximately 20% of SynVH-SD and 5% of SynVH-C sequences (Figure 2 and Table 2). The high frequency of signal peptide alterations in SynVH-SD suggests that there is selection for such alterations. Comparison of the signal peptide sequences of SynVH-C, SynVH-SD, and chicken VH revealed that SynVH-SD contains a Lys residue in the central hydrophobic domain, whereas SynVH-C contains an Ile residue, making it less hydrophobic and resulting in a less efficient signal peptide than either the SynVH-C signal peptide or the chicken VH signal peptide (27) (Figure 2). The SynVH-SD signal peptide is identical to the human germline VH3-23 gene, whereas the SynVH-C signal peptide contains an Ile mutation compared to the germline. In a second pattern of signal peptide variation, the portion of the signal peptide encoded in the first exon was human, while the four amino acids of the signal peptide encoded in the V exon were chicken (Figure 2). This pattern was observed in approximately 15% of SynVH-SD sequences but not in SynVH-C. Because this region is present in some chicken pseudogenes (8), gene conversion may have caused this region of the signal peptide to be mutated in chicken. In these examples, the chicken-derived sequence in this region extends slightly to the third amino acid of the mature VH region (see below). In a third pattern of signal peptide variation, SynVH-SD sequences retained the entire human signal peptide but introduced a point mutation in the Lys residue (Figure 2), changing it to a hydrophobic residue (Val, Ile, or Met). This pattern occurred in approximately 40% of SynVH-SD sequences.All three of these changes increased the hydrophobicity of the signal peptide. The high occurrence of these different types of changes in the SynVH-SD signal peptide strongly indicates positive selection for these changes. [Table 2]

[0147] Table 2 SynVH-C but not SynVH-SD showed gene replacement with chicken VH, whereas both had altered signal peptides. The number of chicken and human VH regions (and the percentage of total sequences for each transgene) are shown. Data from six SynVH-C and three SynVH-SD samples were combined (a total of 6,000 sequences from SynVH-C birds and 3,000 sequences from SynVH-SD birds). The first set of columns shows sequences containing chicken VH, divided into those containing chicken signal peptide (Ch sig pep) or human signal peptide (Hu sig pep). The second set of columns has sequences with human VH, similarly divided by the sequence of the signal peptide. All sequences had a human JH (right column). The total number of VH regions is slightly less than the total number of sequences because some sequences had VH deletions.

[0148] Gene conversion in SynVH-C and SynVH-SD by chicken pseudogenes is rare The chicken pseudogene array is still present upstream of both the SynVH-C and SynVH-SD transgenes (Figure 1). In SynVH-SD, the chicken pseudogene is very close to the functional human V and is immediately upstream of the human pseudogene, whereas in SynVH-C, the chicken V and D genes are located between the two pseudogene arrays. As mentioned above, the signal peptide sequence adjacent to FR1 underwent gene conversion in SynVH-SD, so it was of interest to know whether further gene conversion of the human framework with the chicken pseudogene had occurred. At the DNA level, the chicken germline VH segment is approximately 65% ​​identical overall to the transgene V genes. The longest stretch of homology is 11 bp, with 1- to 6-bp mismatches spread throughout the V region. It is unclear whether this level and pattern of homology is sufficient to allow gene conversion. To determine the functionally relevant level of gene conversion leading to protein sequence changes, FR1 and FR3 were analyzed at the protein level for evidence of long stretches of chicken residue substitutions (FR2 is too conserved between chicken and humans to unambiguously detect gene conversion events). We observed very low levels of gene conversion of human FR1 and FR3 in SynVH-C (0.07% for FR1, 0.3% for FR3, 5652 sequences) and very low levels of gene conversion of human FR1 and FR3 in SynVH-SD (2% for FR1, none for FR3) (Table 3). The most common example of gene conversion was a change in the signal peptide of SynVH-SD, which occurred in approximately 15% of sequences. This suggests that gene conversion may be observed at a higher frequency if sequence changes are selected. The low frequency of gene conversion events by chicken pseudogenes in human FRs suggests that they are rare, unselected events. The slightly higher frequency in FR1 of SynVH-SD (2%) may be the result of gene conversion events that begin in the signal peptide region at the 5′ end of the gene and continue through FR1.Another potential contributing factor could be the physical proximity of the human functional V to the chicken pseudogene in SynVH-SD because the chicken V and D clusters were deleted in the transgene (Fig. 1). In the antigen-specific mAb sequences derived from these birds (see below), no chicken-derived FR residues were found in any of the sequences, supporting the idea that sequences derived from these rare gene conversions were not selected or required to produce antigen-binding factors. [Table 3]

[0149] Table 3. Gene conversion of human FRs by chicken pseudogenes is rare. The number of gene conversion events observed in the humanized sequences from each bird is presented. Gene conversions are defined as sequences of long regions (i.e., the entire FR1) that are chicken sequences. Protein sequences, not nucleotide sequences, were analyzed. The number of humanized sequences analyzed is shown on the right. ND: Not determined. Chicken FR2 differed from the human transgene by only one (SynVH-SD) or two (SynVH-C) amino acids, so gene conversion could not be assessed unambiguously. *The part of the signal peptide encoded in the V region exon and the first three amino acids of FR1, but not the part encoded in the first exon.

[0150] CDR3 length diversity CDR3 length variation was analyzed across two genotypes at positions 105–117 of the IMGT. For SynVH-C sequences, the range was 3–22 amino acids, with a mean of 11.56 ± 2.06 (Figure 3). The germline CDR-H3 length of SynVH-C is a fixed length of 11 codons due to its pre-rearrangement. Any variation in length could be the result of gene conversion or somatic hypermutation, where sequences are deleted or inserted. While 55% are longer than 11 residues, only 27% of sequences are less than 11, making these mechanisms more likely to increase CDR length. For the transgene SynVH-SD rearrangement, the mean CDR-H3 length was slightly longer and had a wider distribution (11.89 ± 2.68 amino acids, range 3–21; neither set of length data conforms to a normal distribution) (Figure 3). Longer CDR-H3s were more frequent in SynVH-SDs, with 23% of CDRs longer than 15 residues compared to 3.6% in SynVH-Cs. If a single D is used, the hypothetical length range for SynVH-SDs would be 16–23 codons, assuming no chewing-back of the coding sequence. This indicates that most sequences decrease in length due to chewing-back during V(D)J recombination or gene conversion / somatic hypermutation. Although the mAb sequence is restricted and directed only to one antigen, CDR-H3 length is biased toward longer lengths for SynVH-SDs, while the frequency of SynVH-Cs appears consistent with the bulk sequence (Figure 3).

[0151] Chicken B cells lack TdT activity (9), and therefore cannot add nucleotides during V(D)J rearrangement. In wild-type human and chicken repertoires, CDR-H3s tend to be longer than those shown here, with an average CDR-H3 length of 15–16 residues and a normal distribution (17, 28, 29). In wild-type chickens, a wide range of CDR-H3 lengths is produced by a combination of single D (with a single D, the hypothetical length range without chewing-back is 20–22 codons), tandem D-D ligation, exonuclease trimming, and gene conversion (6, 8, 29). In transgene rearrangements of SynVH-SD antibodies, these mechanisms did not appear to produce human V regions of the same length as wild-type chicken antibodies. It is possible that the chicken D ligation was selected to favor tandem D-D ligation during development. This mechanism is common in chickens and incorporates paired noncanonical cysteines to form intra-CDR3 disulfide bridges (see below). In contrast, DD linkages are not typically found in the human repertoire (29-31). Although analysis of D usage was not performed, the more limited CDR-H3 lengths found in human sequences suggests that DD linkages either do not occur or, if they do occur, there is selection for longer CDR-H3s brought about by DD linkages in human genes in chickens.

[0152] Amino acid content of SynVH-C and SynVH-SD The amino acid content of the CDRs was analyzed in the SynVH-C and SynVH-SD datasets (Table 4). Chicken V-region sequences were removed, and only human sequences were analyzed. Because these datasets are based on immunized birds, they do not represent the naive repertoire; however, the characteristics of the repertoires produced by the two transgenes can be compared to each other because the immunogen, human progranulin (PGRN), was the same in all birds. For CDR-H1 and H2 (the IMGT definition was used), all sequences were included, regardless of length.

[0153] In CDR-H1, most amino acids were represented at similar frequencies in the two transgene sequences. One exception was Trp, which was absent from SynVH-C but found in 3.3% of SynVH-SD sequences, all at position 38 in IMGT. A possible explanation is that Trp is present in three SynVH-SD pseudogenes at position 38 but not in any SynVH-C pseudogenes. Similarly, Ala was more common in SynVH-C sequences, reflected by its presence in 15 of 20 SynVH-C pseudogenes at position 38 in IMGT. Asp was more frequent in SynVH-SD, again most likely the result of gene conversion from an Asp-containing pseudogene (7 of 16 have at least one Asp in CDR1). Although clonal selection may alter the frequency of relevant amino acids by increasing the frequency of residues involved in antigen binding to PGRN or affecting attributes such as expression levels, at least some of the frequency differences must be due to differences in the rate of mutation generation in the first place.

[0154] In CDR-H2, the distribution of amino acids is also very similar between the two genotypes, and again, the bias can usually be traced to residues found in the pseudogene pool. Trp is more frequent in SynVH-SD, and two of the SynVH-SD pseudogenes contain Trp at position 58 of the IMGT, whereas the SynVH-C pseudogene does not contain Trp. If Trp is present in the SynVH-C sequence, it can only be caused by somatic hypermutation.

[0155] To compare the CDR-H3s from the SynVH-C and SynVH-SD transgenes, we had to focus our analysis on regions not contributed by the JH segment because each transgene has a different JH germline gene. The JH6 gene used in SynVH-SD contains a string of five Tyr residues, which biases the amino acid frequency in the data toward Tyr. Consequently, when the entire CDR is included, the frequency of other amino acids is reduced (regardless of whether the boundary is IMGT positions 105-117 or 107-114). The J gene in SynVH-C is JH4, which is short and contains only two Tyr residues. Therefore, we focused on CDR-H3s of specific lengths and calculated the amino acid content of positions typically contributed by the D region (positions 107-109 for lengths of 12-14 residues and positions 107-111 for lengths of 15 residues). The average frequency of each amino acid at these positions in CDR-H3s of those lengths is shown in Figure 4 and Table 4. In the analyzed CDR-H3 portion, the amino acid content differed significantly between SynVH-C and SynVH-SD sequences (χ 2The mean mean (value 2047, 19 degrees of freedom, p<0.0001) appeared to be more evenly distributed among the 20 amino acids in the SynVH-SD sequence compared to SynVH-C (Figure 4). (The standard deviation was 4-fold higher in SynVH-C than in SynVH-SD.) Many residues were found at similar frequencies in the two transgenes, with a few notable exceptions. The most notable differences were serine (17.6% in SynVH-C compared to 2.9% in SynVH-SD) and glutamine (0.5% in SynVH-C compared to 6.3% in SynVH-SD). Tyrosine (32, 33), a key component of antigen contact sites, was somewhat more frequently found in SynVH-SD (3.8%) than in SynVH-C (2.0%). Cys codons found in human D2 family members were mutated in SynVH-SD to encode primarily Tyr, which may have increased the frequency of Tyr in the repertoire. Additionally, the cysteine ​​content is higher in SynVH-SD (see below for details). The frequency of histidine was much higher in SynVH-SD (5.8%) compared to SynVH-C (0.26%), but the overall frequency of positively charged amino acids (K, R, H) was similar (13.0% for SynVH-SD and 11.7% for SynVH-C). In CDR-H3, we were unable to trace any of these differences in amino acid frequency to differences in residues available in the pseudogene pool (Figure 8). Ser, Gln, and His residues can be found in the CDR-H3 region of both pseudogene arrays.

[0156] To measure amino acid variation in the CDR-H3 of the two transgenes, Shannon's entropy was calculated for each position of a subset of CDR3s with lengths of 12 to 15 codons. The results for lengths of 12 and 15 residues are shown in Figure 5. The results for lengths of 13 and 14 residues were similar. In the CDR-H3 loop, which is primarily contributed by the D segment (positions 107-109 for the 12-residue CDR and positions 107-111 for the 15-residue CDR), the diversity of the two transgenes was similar. Therefore, gene rearrangements and gene conversions alone may result in similar levels of diversity in regions not encoded by the JH. The CDR-H3 of SynVH-SD had less diversity in the JH-encoded region, particularly at positions 5-7 residues from Trp-118 (e.g., positions 110, 112, and 113 in the CDR-H3 of the 12-residue CDR in Figure 5A). These positions are within a tandem stretch of tyrosines encoded by JH6, and tyrosine content was high at these positions in the sequence data. However, other positions in the JH6 gene encoding tyrosines were found to be somatically mutated in SynVH-SD birds and may be highly variable, such as positions 113 and 114. The lack of diversity at positions 112 and 112A may reflect a reduced involvement of these positions in antigen binding, potentially resulting in lower selection pressure for somatic mutations. The lack of specific CDR3 sequences in the SynVH-SD pseudogenes may also be a contributing factor, although the variability at positions 108-111 and 113-114 was not reduced compared to SynVH-C, despite the lack of pseudogene donors at these positions.

[0157] To determine the level of diversity in the FR region, Shannon's entropy was calculated over the entire length of the V region (Figure 9). There was little diversity in the FRs, especially FR2. FR variability was somewhat lower in SynVH-SD than in SynVH-C. This is expected because the SynVH-C pseudogene contains some FR changes, whereas the SynVH-SD pseudogene does not. Any changes in the FRs in SynVH-SD must be due to non-templated hypermutation or chicken pseudogenes. Although the FR1 variation observed in SynVH-SD was partially due to the chicken pseudogene (as described above), the overall level of variation was significantly lower than that of SynVH-C in FR1. FR2 was essentially unvariable.

[0158] The functional V region of SynVH-C contains the motif RLF (positions 90-92 of IMGT) in FR3, which represents a somatic mutation compared to the germline residues QMN found in the VH3-23 gene. Some of the SynVH-C pseudogenes contain QMN residues at these positions, allowing reversion to the germline FR3 sequence upon gene conversion. This reversion was observed in 94% of sequences, strongly suggesting that the RLF motif is structurally unfavorable and that the QMN residues were selected for in the repertoire. [Table 4] Table 4. Amino acid distribution of CDR1-3 IMGT CDR designations were used. For CDR-H3, amino acid frequencies for CDR lengths of 12–15 residues were calculated and averaged, and residues encoded by the V and J genes were removed. Only human sequences from six SynVH-C birds (n = 5652) and three SynVH-SD birds (n = 3000) were analyzed.

[0159] CDR3 hydrophobicity The average hydrophobicity of each CDR-H3 (IMGT positions 105–117) from SynVH-C and SynVH-SD was calculated based on the normalized Kyte-Doolittle scale of amino acid hydrophobicity (34, 35). Data from CDR-H3s of 12–15 residues in length were combined (Figure 6). The average of these values ​​is on the hydrophilic side of the scale for both SynVH-C and SynVH-SD, with the range appearing similar to that previously reported for human and mouse repertoires (36–38). The average value of the CDR-H3 in SynVH-SD is slightly shifted toward hydrophobicity compared to SynVH-C (the difference in average hydrophobicity values ​​was significant between the two groups (unpaired Kolmogorov-Smirnov test, p<0.0001)).

[0160] Cysteine ​​content of FR and CDR Low-frequency noncanonical cysteine ​​residues were found scattered throughout the V regions of SynVH-C and SynVH-SD sequences, either as single unpaired cysteines or as pairs of cysteines with the potential to form disulfide bridges (Table 5). A total of 123 unpaired individual cysteines were found in 8652 VH sequences from the two transgenes (Table 5). These residues were found in all FRs and CDRs of both SynVH-C and SynVH-SD, including CDR-H3, except for FR1 of SynVH-C. The frequency of unpaired cysteines was lower than that observed in WT chicken (0.08%, 0.13%, and 0.17% vs. 2.1%, 0.8%, and 2.4% in CDR1, FR2, and CDR2 of SynVH and WT, respectively (17)).

[0161] In CDR-H3, the total cysteine ​​content of SynVH-C sequences was 0.01% and that of SynVH-SD was 2.05% (Table 4), compared with the 1.21% reported for humans (28). Thus, the occurrence of cysteines in CDR-H3 is similar between human sequences derived from chicken or human. In addition to unpaired cysteines, a small number of paired cysteines capable of forming disulfide bridges were also observed within the CDR-H3 of both transgenes (3 sequences in SynVH-C and 110 sequences in SynVH-SD) (Tables 4 and 5). SynVH-C also had six instances of paired cysteines in CDR-H2, whereas SynVH-SD had none. These paired cysteines form potential disulfide-stabilized loops, but there is little sequence diversity in the loops themselves. Only two unique sequences were found from SynVH-C and SynVH-SD, respectively. These paired cysteines occur rarely, indicating that they subsequently spread by clonal expansion within the lineage. It was striking that SynVH-SD contained more instances of potential disulfide loops in CDR-H3 than SynVH-C (3.7% of SynVH-SD sequences contained potential disulfide loops in CDR3 compared with 0.05% of SynVH-C sequences). Although the SynVH-SD transgene possessed a D cluster that could, in principle, provide a higher cysteine ​​content, the transgene was designed so that all Cys codons normally found in germline human D2 family members were mutated to encode Tyr or Trp. The sequence of the SynVH-SD pseudogene contained several Cys codons in the region downstream of FR3, potentially resulting in additional cysteines through gene conversion (and somatic hypermutation). The design of SynVH-SD pseudogenes was based on the CDRs of the germline VH3 family. Because germline V genes do not contain CDR3, the regions downstream of the FR3 of the pseudogenes were simply spacer sequences between the pseudogenes. These spacers could provide a potential source of diversity when used for gene conversion.

[0162] Similar to human sequences, chicken-derived human sequences have a low cysteine ​​content, which is in stark contrast to the cysteine ​​content of normal chicken antibodies (17). In wild-type chickens, 53% of unselected VH clones contained two non-canonical cysteines in CDR-H3, compared with 1.3% of chicken-derived human sequences. These paired cysteines can form small loops that stabilize the antigen-binding structure of chicken CDR-H3. In the human sequences presented here, the cysteines are separated by two to four amino acids, whereas in some cases, the loops in chicken antibodies can be longer (17). Chicken VH sequences often contain a single cysteine ​​in CDR3 and a second cysteine ​​elsewhere in the VH region, forming potential disulfide bridges from CDR3 to other parts of the VH region (types 3–6 in Wu et al.). Such paired cysteines were not observed in chicken-derived human sequences. Only one of the 8652 sequences from both transgenes had a single SynVH-C sequence with two noncanonical cysteines in different parts of the V region, cysteines in FR2 and FR3, a particular pattern not seen in the chicken form ( 17 ). [Table 5]

[0163] Table 5. SynVH-C and SynVH-SD birds have low non-canonical cysteine ​​content. Numbers indicate the number of unique sequences containing a single unpaired Cys residue or two potentially paired Cys residues among the top 1000 unique sequences from each bird (only human V regions were analyzed; total n = 5652 for SynVH-C, n = 3000 for SynVH-SD). Potential loop sequences are shown in parentheses. The only other potential disulfide loop was a single SynVH-C sequence containing Cys residues in FR2 and FR3. In FR2 and FR4, all instances of non-canonical Cys were cases of Trp->Cys changes, which could arise from single nucleotide substitutions. No instances of more than two non-canonical cysteines were observed.

[0164] Comparing mAb and NGS data The source of NGS data, splenic lymphocytes, originated from immunized birds used to generate antigen-specific antibodies. Six SynVH-C and three SynVH-SD birds were immunized with the testing immunogen, human progranulin (PGRN). A panel of antigen-specific mAbs was identified from each bird by screening splenic cells with the GEM assay (18, 39). mAbs were confirmed for binding to PGRN by ELISA, and heavy and light chain V region sequences were obtained. The light chains in all these birds were driven by a human V-kappa transgene (18). The birds had light and heavy chain knockouts on the other allele, and were heterozygous for both the heavy and light chain transgenes. Therefore, only human V region antibodies were produced in the birds.

[0165] The unique VH sequences of antigen-specific mAbs from individual birds were compared with NGS data from the same birds (177 mAbs total). Figure 7 shows the number of times each mAb was sequenced in the NGS data. All 177 mAb sequences were found in the NGS data, with varying degrees of match. 79 (45%) of the mAbs were sequenced five or fewer times in the NGS data, and 37 were sequenced only once, demonstrating the ease with which rare mAbs can be identified in the GEM screen. Selecting mAbs based solely on sequence data can easily miss these rare mAbs. Others were found multiple times, up to approximately 7,000 times. Approximately one-third (63 / 177) of the mAb sequences were exact matches to unique peptide sequences in the NGS data, while the remainder had some variation compared to their closest match. These variations may be due to the fact that the NGS data is a snapshot of the spleen, up to approximately 10 6 This likely reflects the fact that the number of B cells represented represents, on average, the total number of sequences obtained from each bird obtained, whereas the mAbs were derived from the GEM screen, which had a larger sample size of approximately 7 x 10 B cells. It is possible that sequences from single cells featured in the GEM screen are related to genealogical sequences from the NGS data, even if the exact sequence was not found in the NGS data. Sequence errors introduced by reverse transcription or library preparation may also be a factor.

[0166] Consideration The chicken gene conversion / somatic hypermutation system has evolved to generate a diverse repertoire capable of conferring protective immunity to the host. The lack of diversity resulting from the combined mechanism does not appear to limit the CDR-H3 repertoire. When two transgenes encoding humanized variable regions were introduced, one unable to rearrange but forced to generate its sequence diversity purely through gene conversion and / or somatic hypermutation, and the other underwent rearrangement to select all human Ds and generate combinatorial diversity, the levels of amino acid diversity were similar. Because the dataset was from immunized birds, there may be some bias toward specific residues from immunization, but the two transgenes behaved similarly despite the different modes of diversity generation. For CDR1 and 2 and FR, we were able to correlate amino acid frequencies with residues found in the human pseudogenes of both transgenes, but not for CDR3.

[0167] The range and average CDR-H3 lengths were also very similar for both pre-rearranged and rearranged transgenes. It is striking that the average CDR-H3 lengths were so similar for the two transgenes, given that rearranged transgenes could, in principle, generate a much wider range through variability in D usage. Due to the lack of TdT in chicken, lengths are limited to those encoded by D genes or those that can be inserted by gene conversion. This may explain the shorter lengths observed here compared to the normal human repertoire. Gene conversion alone may not be able to generate as wide a range of CDR-H3 lengths as rearrangements with TdT activity (e.g., in humans) or rearrangements with DD ligation (e.g., in wild-type chicken). SynVH-SD did not generate the theoretically possible range of lengths through DD ligation or even a single D rearrangement. Constraints on CDR-H3 length may stem from pairing with specific V-kappa light chains in transgenic chickens, potentially unfavorable structural attributes of such human DD sequences, or unknown cis-acting sequences promoting DD binding in chickens that were not included in the human SynVH-SD constructs. Although the range and average CDR-H3 length were similar, SynVH-SDs contained a significant proportion of longer CDR-H3s (15 or more residues), which may represent an advantage for antibody discovery programs because of potential opportunities for added functionality, such as broad epitope coverage, agonistic or antagonistic function, and kinetics. Bovine antibodies with exceptionally long (approximately 60 amino acids) H3 domains have recently been shown to be potent neutralizers across many clades of HIV, likely due to their ability to bind conserved but occluded epitopes in the virus (40).

[0168] Structures commonly found in chickens, such as noncanonical disulfide bridges, were extremely rare in human sequences. Because the human germline and pseudogenes available during repertoire development do not encode such structures, there is no clear mechanism for their production. These structures are not required to obtain high-affinity human antibodies in chickens, because the mAbs compared in this study had affinities ranging up to 0.11 nM and epitope coverage similar to that of wild-type chickens (18). These data are supported by the observation that mAbs from wild-type chickens that recognize novel epitopes, although frequently present, do not require disulfide bridges (41).

[0169] Functional sequence selection was clearly effective for the germline VH3-23 signal peptide of SynVH-SD and the QMN motif in FR3 of SynVH-C. The germline VH3-23 gene contains a lysine residue in the signal peptide, which was mutated (to Ile) in the human somatically derived SynVH-C signal peptide. Multiple mechanisms were used to mutate the signal peptide sequence of SynVH-SD in chicken, including gene conversion at the 5' end of the V gene. These results indicate that gene conversion of chicken pseudogenes can serve a useful purpose, if it can be used to generate functional human V regions. Despite the potential for gene conversion from chicken pseudogenes to generate human V regions, little gene conversion of human FRs was observed in bulk sequences, and no gene conversion was observed in chicken mAb sequences. From the perspective of gene conversion mechanisms, chicken pseudogenes may be at a disadvantage due to their physical distance from the human functional V region and reduced level of homology (5, 11, 13). This may explain the lack of gene conversion by chicken pseudogenes. From a functional standpoint, the diversity achievable by human pseudogenes and somatic hypermutation is sufficiently extensive to allow antibodies capable of binding antigens, so there is generally no selective pressure to drive further mutations by chicken pseudogenes.

[0170] Example 2 Preparation of VDJ knockout Guide RNA design: A 159-bp region upstream of the functional chicken heavy chain V was analyzed on the MIT server for guide RNA design. Four guide RNAs were selected, synthesized, and individually cloned into the GE6 vector containing the wild-type Cas9 nuclease (Horizon): gRNA1, AAATCATTAATCAACCCGAC (SEQ ID NO: 43); gRNA2, AACACGACTCCGGGCCTAGA (SEQ ID NO: 44); gRNA3, TGATTAATTGGGCGCCCGTC (SEQ ID NO: 45); gRNA4, ATTTAATGGCCGTCTAGGCC (SEQ ID NO: 46). These gRNAs had few predicted off-target sites. None were present in known coding sequences. A control construct containing gRNA5 specific for EGFP (AAGTTCGAGGGCGACACCC (SEQ ID NO: 47)) was also prepared.

[0171] Design of the targeting vector IgH KO6B: 1133-bp and 1011-bp homologous regions were PCR-amplified and cloned from homozygous knockout chickens carrying the original JH-KO (Schusser et al., Proc Natl Acad Sci USA. 2013 110:20170-20175). The 5'HR was amplified with primers 5'-GCCCCTAATAAGTGGTTTAATTATG-3' (SEQ ID NO: 48) and 5'-TCTGCGCTGAGTTCTTTGAT-3' (SEQ ID NO: 49). The 3'HR was amplified with primers 5'-AAGTCGAGGCTGACGAGAAA-3' (SEQ ID NO: 50) and 5'-CTTTTCCCCACCAAATTTCA-3' (SEQ ID NO: 51). Homozygous DNA was used to ensure that the homologous region was homozygous for the JH-KO-carrying allele 472-138 in cells used for targeting, which were heterozygous for the JH-KO. The two alleles may be polymorphic because the chickens used to derive these PGCs are outbred. At the IgH locus, the homologous region is separated by a 122-bp stretch containing the gRNA targeting sequence, ensuring that the gRNA, when cotransfected into cells, targets only the genome and not the targeting vector itself. The homologous region is flanked by loxP sites designed to recombine with the loxP site downstream of the β-globin HS4-insulated hygromycin resistance gene for selection in PGCs and the JH-KO selectable marker cassette.

[0172] Cells used for targeting: PGC line 472-138 contains the previously targeted heavy chain locus, in which the JH region (Schusser et al. Proc Natl Acad Sci USA. 2013 110:20170-20175) has been replaced with a loxP-transfected selectable marker cassette. The cell line was derived by mating germline chimeric roosters injected with JH-KO PGCs to wild-type hens and culturing cells from the germinal crescents of EGFP-positive embryos at stages 4-8 (Hamburger and Hamilton). PGCs were cultured as described [6]. Briefly, PGCs were grown in KO-DMEM (Life Technologies), 40% of which was pretreated with buffalo rat hepatocytes (BRL, ATCC), supplemented with 7.5% fetal bovine serum (Hyclone), 2.5% irradiated chicken serum, 1X non-essential amino acids, 2 mM glutamine, 1 mM sodium pyruvate, 0.1 mM β-mercaptoethanol (all from Life Technologies), 4 ng / ml recombinant human fibroblast growth factor, and 6 ng / ml recombinant mouse stem cell factor (both from R&D Systems), and propagated on irradiated feeder layers of BRL cells. Cells were passaged three times a week onto new feeder layers.

[0173] Transfection and Injection: To verify inactivation of the EGFP locus, 15 μg of EGFP-specific gRNA5 / Cas9 or Cas9 alone was added to 3 x 10 cells and brought to a volume of 100 μl with V buffer (Lonza, Walkersville). The cell suspension was transferred to a 2 mm cuvette and subjected to eight square-wave pulses of 350 volts / 100 μsec (BTX 830 electroporator). After electroporation, cells were resuspended in medium and cultured for 9 days to dilute any remaining EGFP in the cells. Cells were analyzed for loss of green fluorescence using an Attune flow cytometer (Life Technologies). For stable transfectants targeting the IgH locus, 15 μg of circular gRNA1, 2, 3, or 4 / Cas9 and 2.5, 5, or 15 μg of circular IgH KO6B were added to 5 × 10 cells, transfected as described above, and plated in hygromycin-resistant irradiated BRL at a density of 10 cells per well in 48-well plates. A control transfection with 5 μg of IgH KO6B without gRNA / Cas9 was also performed. After 3 days, 40 μg / ml hygromycin was added to select for cells with stable integration of IgH KO6B. After stable clones were identified, the cells were expanded and integration of IgH KO6B was confirmed by PCR. Confirmed clones were injected into recipient chick embryos at stages 14–16 (H&H). Injected embryos were transferred to surrogate shells and incubated at 37°C until hatching. The sex of the chicks was determined after hatching by PCR of the W chromosome.

[0174] Screening for IgH KO6B targeting: Hygromycin-resistant clones were analyzed by PCR for IgH KO6B targeting. For the 5' assay, the forward primer was chVH-F5: 5'-TGGTTTGGTTGATGGAAGAATGTA-3' (SEQ ID NO: 52), and the reverse primer was HA-R: 5'-ATACGATGTTCCAGATTACGCTT-3' (SEQ ID NO: 53). For the 3' assay, the forward primer was KO 6B-F: 5'-GCTGAACTAGAATGCATCAAGC-3' (SEQ ID NO: 54), and the reverse primer was chVH-R33: 5'-ACAAACCTTTGCCGCATCCA-3' (SEQ ID NO: 55).

[0175] Cre recombination of loxP sites inserted into the IgH locus: 3 × 10 of strain 1783-9 carrying the CRISPR-targeted loxP site and the JH-KO loxP site. 6 Cells were transiently transfected with 20 μg of the β-actin-Cre expression construct as described above and cultured for 10 days. Cre transfection was then repeated to increase the percentage of excised cells, and after 4 days, cells were harvested for PCR analysis of Cre / lox recombination between the two outermost loxP sites. Two PCR assays were performed. Both used a 5' primer in the upstream VH flanking region (chVH-F3aB: 5'-GATG GGGGGTGGCAATGGAATGAT-3' (SEQ ID NO: 56)). The 3' primer was located in the neo gene of JH-KO (neo-F1: 5'-AGCTGTGCTCGACGTTGTCACT-3' (SEQ ID NO: 57)), generating a 1.6 kb amplicon, or in the IgH locus downstream of the selectable marker (chJC-R45: 5'-GCCCAAAATGGCCCCAAAAC-3' (SEQ ID NO: 58)), generating a 2 kb amplicon.

[0176] To verify whether CRISPR / Cas9 can be used to edit the PGC genome, experiments were first performed to inactivate an enhanced green fluorescent protein (EGFP) transgene inserted into the IgH locus. The EGFP gene is part of a selectable marker cassette used to knock out the JH gene segment in the JH-KO PGC cell line 472-138 (Figure 10, A). A previously described gRNA against EGFP (gRNA5) was cloned into a U6 expression vector (GE6) that also carries wild-type Cas9 nuclease. PGCs were transiently transfected with a construct encoding Cas9, both with and without gRNA5. Nine days after transfection, cell populations were analyzed by flow cytometry, revealing that approximately 9% of cells in the Cas9 / gRNA5 population had lost EGFP expression compared to control transfections (Figure 10, B).

[0177] To generate transgenic birds using CRISPR / Cas9, modifications generated in PGCs must be able to be passed on to the next generation via the germline. For this purpose, a clonal population in which all cells carry the desired mutation is preferred. A drug selection strategy was designed in conjunction with CRISPR / Cas9 to select and grow clones carrying the modification. A region upstream of a single immunoglobulin heavy chain variable region (VH) in JH-KO cells was targeted for the introduction of a loxP site into the IgH locus. Four guide RNAs were designed to direct Cas9-mediated double-stranded genomic breaks at sites approximately 300 bp upstream of the VH translation start site (Figure 11, A), and each was individually cloned into the GE6 vector using Cas9. All Cas9 cleavage sites were approximately 50 bp from the homologous region of the donor targeting vector, IgH KO6B. IgH KO6B was constructed with a short homologous region of approximately 1 kb flanking a hygromycin selection cassette (Figure 11, A).

[0178] Although the chicken IgH locus consists of only short stretches of sequence in genome databases, not organized into contigs, there was enough unique sequence to design PCR primers to amplify these short homologous regions. The homologous regions were amplified from homozygous JH-KO genomic DNA and are therefore syngeneic for the alleles that comprise JH-KO in the 472-138 cell line. Because the birds used to derive cell line 472-138 were outbred, other alleles in these cells may be polymorphic.

[0179] Four gRNAs against VH were separately co-transfected with circular IgH KO6B and stable transformants were selected with hygromycin. For the first set of transfections, 15 µg of each plasmid (IgH KO6B and gRNA / Cas9) was used for 5 x 10 cells, an amount of DNA that typically generates approximately 1–10 colonies per 48-well plate when using linearized targeting vector alone. However, when IgH KO6B was used in combination with gRNA / Cas9, transfection was so efficient that wells in all four transfections contained multiple clones of hygromycin-resistant cells. Although these were not clonal populations, three wells from each transfection were harvested to verify targeting by IgH KO6B, and all contained correct targeting events (Figure 11B). With gRNAs 1, 3, and 4, most wells likely had 4–5 colonies per well, indicating a targeting efficiency of at least 20–25% (assuming only one positive clone out of 4–5). When gRNA2 was used, most wells only had approximately 2–3 clones, suggesting a high potential efficiency of approximately 33%. Therefore, we used gRNA2 in subsequent transfections and reduced the amount of donor IgH KO6B to reduce the number of resistant colonies. Transfection with 2.5 µg of IgH KO6B + gRNA2 / Cas9 yielded 12 colonies per 48-well plate, of which 9 were screened for targeting. All nine clonal populations had correct targeting (Figure 11C). Transfection with 5 μg of IgH KO6B plus gRNA2 / Cas9 yielded >50 clones, whereas control transfection with 5 μg of IgH KO6B without gRNA / Cas9 yielded only two colonies, neither of which were correctly targeted (data not shown).

[0180] Targeting of the VH region was independently confirmed using loxP sites located adjacent to the hygromycin gene of the targeted allele. The downstream JH-KO selectable marker should be adjacent to the loxP site (introduced into the loxP site) and on the same chromosome as the VH loxP site. If targeting is correct, Cre recombination should excise the intervening DNA, leaving a single loxP site and a promoterless neo gene (Figure 12, A). Cells of the CRISPR-targeted clone 1783-9 were transiently transfected twice consecutively with the Cre expression construct (to increase the percentage of cells with excision), and the cells were grown for 4 days after the second transfection to allow recombination. PCR primers located outside the loxP site amplified a product of the expected size, whereas in non-recombined cells, the primers were approximately 28 kb apart and no product was observed (Figure 12, B). This indicates that the CRISPR-targeted VH loxP site is correctly positioned and oriented.

[0181] Five targeted cell lines (1783-1, 3, 6, 9, and 10) were injected into embryos to prepare germline chimeras. Male chimeras were mated with wild-type females, and germline offspring were screened for green fluorescence using an EGFP transgene in the JH-KO selectable marker cassette. Four of the five cell lines transmitted germline offspring to varying degrees. One cell line, 1783-10, demonstrated a high rate of germline transmission, including one chimera with nearly 100% transmission of injected cells. Forty-six EGFP-positive offspring obtained from the propagation of cell line 1783-10 were hatched and classified as CRISPR-targeted IgH KO6B. All EGFP-positive birds contained the IgH KO6B insertion, confirming that the PGC clones contained the correct stable integration.

[0182] References 1.Ratcliffe MJH.Antibodies,immunoglobulin genes and the bursa of Fabricius in chicken B cell development.Dev Comp Immunol(2006)30:101-118.doi:10.1016 / j.dci.2005.06.018 2.Pike K,Ratcliffe M.Ligand-independent signaling during early avian B cell development.Immunol Res(2006)35:103-116. 3.Aliahmad P,Pike KA,Ratcliffe MJH.Cell surface immunoglobulin regulated checkpoints in chicken B cell development.Vet Immunol Immunopathol(2005)108:3-9.doi:10.1016 / j.vetimm.2005.08.009 4.McCormack W,Tjoelker L,Carlson L,Petryniak B,(null),Humphries E,Thompson C.Chicken IgL gene rearrangement involves deletion of a circular episome and addition of single nonrandom nucleotides to both coding segments.Cell(1989)56:785-91. 5.Reynaud C,Anquez V,Dahan A,Weill J.A single rearrangement event generates most of the chicken immunoglobulin light chain diversity.Cell(1985)40:283. 6.Reynaud C,Anquez V,Weill J.The chicken D locus and its contribution to the immunoglobulin heavy chain repertoire.Eur J Immunol(1991)21:2661-70. 7.Benatar T,Tkalec L,Ratcliffe MJ.Stochastic rearrangement of immunoglobulin variable-region genes in chicken B-cell development.Proc Natl Acad Sci USA(1992)89:7615-7619. 8.Reynaud C,Dahan A,Anquez V,Weill J.Somatic hyperconversion diversifies the single VH segment of the chicken with a high incidence in the D region.Cell(1989)59:171-83. 9.Yang B,Gathy KN,Coleman MS.T-cell specific avian TdT:characterization of the cDNA and recombinant enzyme.Nucleic Acids Res(1995)23:2041-2048. 10.Mansikka A,Sandberg M,Lassila O,Toivanen P.Rearrangement of immunoglobulin light chain genes in the chicken occurs prior to colonization of the embryonic bursa of Fabricius.Proc Natl Acad Sci USA(1990)87:9416-9420. 11.Reynaud C-A,Anquez V,Grimal H,Weill J-C.A hyperconversion mechanism generates the chicken light chain preimmune repertoire.Cell(1987)48:379-388.doi:10.1016 / 0092-8674(87)90189-9 12.Carlson LM,McCormack WT,Postema CE,Humphries EH,Thompson CB.Templated insertions in the rearranged chicken IgL V gene segment arise by intrachromosomal gene conversion.(1990)4:536-47. 13.McCormack WT,Thompson CB.Chicken IgL variable region gene conversions display pseudogene donor preference and 5“ to 3” polarity.Genes Dev(1990)4:548-558. 14.Parvari R,Ziv E,Lantner F,Heller D,Schechter I.Somatic diversification of chicken immunoglobulin light chains by point mutations.Proc Natl Acad Sci USA(1990)87:3072-3076. 15.Arakawa H,Saribasak H,Buerstedde J.Activation-induced cytidine deaminase initiates immunoglobulin gene conversion and hypermutation by a common intermediate.PLoS Biol(2004)2:E179. 16.Sale J,Calandrini D,Takata M,Takeda S,Neuberger M.Ablation of XRCC2 / 3 transforms immunoglobulin V gene conversion into somatic hypermutation.Nature(2001)412:921-926. 17.Wu L,Oficjalska K,Lambert M,Fennell BJ,Darmanin-Sheehan A,Ni Shuilleabhain D,Autin B,Cummins E,Tchistiakova L,Bloom L,et al Immunol(2012)188:322–333.doi:10.4049 / gymmunol.1102466 [ PubMed ] 18. Ching KH, Collarini EJ, Abdiche YN, Bedinger D, Pedersen D, Left S, Harriman R, Zhu L, Etches RJ, van de Lavoir MC, et al targets.MAbs(2017)doi:10.1080 / 19420862.2017.1386825 19.Leighton PA,Schusser B,Yi H,Glanville J,Harriman W.A Diverse Repertoire of Human Immunoglobulin Variable Genes in a Chicken B Cell Line is Generated by Both Gene Conversion and Somatic Hypermutation.Front Immun(2015)6:126.doi:10.3389 / fimmu.2015.00126 20.Tiller T,Schuster I,Deppe D,Siegers K,Strohner R,Herrmann T,Berenguer M,Poujol D,Stehle J,Stark Y,et al.A fully synthetic human Fab antibody library based on fixed VH / VL framework pairings with favorable biophysical properties.MAbs(2013)5:445-470.doi:10.4161 / mabs.24218 21.Schusser B,Collarini EJ,Yi H,Izquierdo SM,Fesler J,Pedersen D,Klasing KC,Kaspers B,Harriman WD,van de Lavoir MC,et al.Immunoglobulin knockout chickens via efficient homologous recombination in primordial germ cells.Proc Natl Acad Sci USA(2013)110:20170-20175.doi:10.1073 / pnas.1317106110 22.Dimitrov L,Pedersen D,Ching KH,Yi H,Collarini EJ,Izquierdo S,van de Lavoir M-C,Leighton PA.Germline Gene Editing in Chickens by Efficient CRISPR-Mediated Homologous Recombination in Primordial Germ Cells.PLoS ONE(2016)11:e0154303.doi:10.1371 / journal.pone.0154303 23.Chen C,Nagy Z,Prak EL,Weigert M.Immunoglobulin heavy chain gene replacement:a mechanism of receptor editing.Immunity(1995)3:747-755. 24.de Wildt R,Hoet R,van Venrooij W,Tomlinson I,Winter G.Analysis of heavy and light chain pairings indicates that receptor editing shapes the human antibody repertoire.J Mol Biol(1999)285:895-901. 25.Cascalho M,Ma A,Lee S,Masat L,Wabl M.A quasi-monoclonal mouse.Science(1996)272:1649-1652. 26.Briney BS,Crowe JE.Secondary mechanisms of diversification in the human antibody repertoire.Front Immun(2013)4:42.doi:10.3389 / fimmu.2013.00042 27.Haryadi R,Ho S,Kok YJ,Pu HX,Zheng L,Pereira NA,Li B,Bi X,Goh L-T,Yang Y,et al.Optimization of heavy chain and light chain signal peptides for high level expression of therapeutic antibodies in CHO cells.PLoS ONE(2015)10:e0116878.doi:10.1371 / journal.pone.0116878 28.Zemlin M,Klinger M,Link J,Zemlin C,Bauer K,Engler JA,Schroeder HW,Kirkham PM.Expressed murine and human CDR-H3 intervals of equal length exhibit distinct repertoires that differ in their amino acid composition and predicted range of structures.J Mol Biol(2003)334:733-749. 29.Larimore K,McCormick MW,Robins HS,Greenberg PD.Shaping of human germline IgH repertoires revealed by deep sequencing.The Journal of Immunology(2012)189:3221-3230.doi:10.4049 / jimmunol.1201303 30.Ohm-Laursen L,Nielsen M,Larsen SR,Barington T.No evidence for the use of DIR,D-D fusions,chromosome 15 open reading frames or VH replacement in the peripheral repertoire was found on application of an improved algorithm,JointML,to 6329 human immunoglobulin H rearrangements.Immunology(2006)119:265-277.doi:10.1111 / j.1365-2567.2006.02431.x 31.Corbett SJ,Tomlinson IM,Sonnhammer EL,Buck D,Winter G.Sequence of the human immunoglobulin diversity(D)segment locus:a systematic analysis provides no evidence for the use of DIR segments,inverted D segments,“minor” D segments or D-D recombination.J Mol Biol(1997)270:587-597.doi:10.1006 / jmbi.1997.1141 32.Collis AVJ,Brouwer AP,Martin ACR.Analysis of the antigen combining site:correlations between length and sequence composition of the hypervariable loops and the nature of the antigen.J Mol Biol(2003)325:337-354. 33.Ofran Y,Schlessinger A,Rost B.Automated identification of complementarity determining regions(CDRs)reveals peculiar characteristics of CDRs and B cell epitopes.The Journal of Immunology(2008)181:6230-6235. 34.Kyte J,Doolittle R.A simple method for displaying the hydropathic character of a protein.J Mol Biology(1982)157:105-132. 35.Eisenberg D.Three-dimensional structure of membrane and surface proteins.Annu Rev Biochem(1984)53:595-623.doi:10.1146 / annurev.bi.53.070184.003115 36.Ivanov II,Schelonka RL,Zhuang Y,Gartland GL,Zemlin M,Schroeder HW.Development of the expressed Ig CDR-H3 repertoire is marked by focusing of constraints in length,amino acid use,and charge that are first established in early B cell progenitors.J Immunol(2005)174:7773-7780. 37.Mroczek ES,Ippolito GC,Rogosch T,Hoi KH,Hwangpo TA,Brand MG,Zhuang Y,Liu CR,Schneider DA,Zemlin M,et al.Differences in the composition of the human antibody repertoire by B cell subsets in the blood.Front Immun(2014)5:96.doi:10.3389 / fimmu.2014.00096 38.Rogosch T,Kerzel S,Hoi KH,Zhang Z,Maier RF,Ippolito GC,Zemlin M.Immunoglobulin analysis tool:a novel tool for the analysis of human and mouse heavy and light chain transcripts.Front Immun(2012)3:176.doi:10.3389 / fimmu.2012.00176 39.Mettler-Izquierdo S,Varela S,Park M,Collarini EJ,Lu D,Pramanick S,Rucker J,Lopalco L,Etches R,Harriman W.High-efficiency antibody discovery achieved with multiplexed microscopy.Microscopy(Oxf)(2016)65:341-352.doi:10.1093 / jmicro / dfw014 40.Sok D,Le KM,Vadnais M,Saye-Francisco K,Jardine JG,Torres J,Berndsen ZT,Kong L,Stanfield R,Ruiz J,et al.Rapid elicitation of broadly neutralizing antibodies to HIV by immunization in cows.Nature(2017)doi:10.1038 / nature23301 41.Konitzer JD,Pramanick S,Pan Q,Augustin R,Bandholtz S,Harriman W,Izquierdo S.Generation of a highly diverse panel of antagonistic chicken monoclonal antibodies against the GIP receptor.MAbs(2017)9:536-549.doi:10.1080 / 19420862.2016.1276683

[0183] While the present invention has been described above with reference to preferred embodiments, those skilled in the art will also understand that it is not limited thereto. Various features and aspects of the above-described invention can be used individually or together. Furthermore, while the present invention has been described in the context of its implementation in a particular environment, for a particular application, those skilled in the art will recognize that its usefulness is not limited thereto, and that the present invention can be advantageously utilized in any number of environments and implementations in which it is desirable to examine other samples. Accordingly, the claims set forth below should be construed in light of the full scope and spirit of the invention as disclosed herein.

Claims

1. 1. A transgenic chicken comprising a genome comprising a modified endogenous immunoglobulin heavy chain (IgH) locus, wherein the modified endogenous immunoglobulin heavy chain (IgH) locus comprises: (a) lacking the entire flanking endogenous chicken VDJ region; and (b) an operable linkage; (i) an immunoglobulin heavy chain gene promoter; (ii) a germline human VV comprising a coding sequence for a variable domain including FR1, CDR1, FR2, CDR2, and FR3 sequences; Ｈ segment, (iii) human D cluster; (iv) a single human J segment; (v) multiple sequences encoding constant regions; (vi) each of the human V of (b)(ii) Ｈ (b) multiple pseudogenes of the structure FR1-CDR1-FR2-CDR2-FR3 upstream of said germline human V H segment of (ii), comprising FR1, FR2 and FR3 sequences that are at least 95% identical to the FR1, FR2 and FR3 sequences of said segment, respectively, and CDR1 and CDR2 sequences that differ for each pseudogene; Including, the modified IgH locus undergoes V(D)J recombination in the chicken, The pseudogenes are transformed by gene conversion after V(D)J recombination into the germline human V(D)J. Ｈ Granted to segments, The chicken produces antibodies containing a variety of human immunoglobulin heavy chain variable regions. Transgenic chickens.

2. (b)(vi) is a sequence of the CDR1 and CDR2 of the germline human V Ｈ Different human V segments in the same family Ｈ The transgenic chicken of claim 1 , wherein the CDR1 and CDR2 of the segment are encoded by the gene encoding ...

3. 3. The transgenic chicken according to claim 1, wherein the total length of the flanking endogenous chicken VDJ regions of (a) is in the range of 10 to 12 kb.

4. 4. The transgenic chicken of claim 1, wherein the promoter in (b)(i) is a chicken immunoglobulin heavy chain gene promoter.

5. (b) the germline human V Ｈ segment and (vi) the CDR1 and CDR2 sequences of V Ｈ 3 families, V Ｈ 1 family or V Ｈ 5. The transgenic chicken of claim 1, which is derived from one of four families.

6. 6. The transgenic chicken of claim 1, wherein any codon for cysteine ​​in the D cluster is mutated to encode another amino acid.

7. The transgenic chicken of claim 6, wherein in the D cluster, any codon for cysteine ​​is mutated to encode tyrosine or tryptophan.

8. 8. The transgenic chicken of claim 1, wherein the intervening sequence of the D cluster is derived from chicken.

9. 9. The transgenic chicken of claim 1, wherein the plurality of pseudogenes in (b)(vi) comprises at least 10 pseudogenes.

10. (b)(vi) the plurality of pseudogenes is (b)(ii) the germline human V Ｈ 10. The transgenic chicken of claim 1, wherein the transgenic chicken is inverted relative to the segment.

11. 11. The transgenic chicken of claim 1, wherein the plurality of sequences encoding the constant regions of (b)(v) are endogenous to the chicken.

12. 12. A transgenic chicken as described in any one of claims 1 to 11, wherein the transcription product of the modified immunoglobulin heavy chain (IgH) locus comprises an intron joining the 3' end of a copy of the J coding sequence to the 5' end of a copy of the constant region coding sequence of (b)(v).

13. 13. The transgenic chicken of claim 1, wherein the chicken is homozygous for the modified IgH locus.

14. 14. The transgenic chicken of claim 1, wherein the chicken is heterozygous for the modified IgH locus and the other IgH locus on the homologous chromosome is knocked out.

15. 15. The transgenic chicken of claim 1, wherein the chicken is heterozygous for the modified IgH locus and the other IgH locus on the homologous chromosome is wild type.

16. 15. The transgenic chicken of claim 14, wherein the chicken is heterozygous for the modified IgH locus, and the IgH locus on the homologous chromosome lacks the entire adjacent endogenous chicken V-D-J region.

17. 15. The transgenic chicken of claim 14, wherein the chicken is heterozygous for the modified IgH locus and the IgH locus of the homologous chromosome lacks a J region.

18. 18. The transgenic chicken of claim 1, wherein the antibodies produced by the chicken are diversified in the heavy chain CDR1, CDR2 and CDR3 regions.

19. 19. A B cell derived from the transgenic chicken of any one of claims 1 to 18, wherein the B cell expresses a human immunoglobulin heavy chain variable region.

20. (a) immunizing the transgenic chicken of any one of claims 1 to 18 with an antigen; and (b) obtaining an antibody that specifically binds to the antigen from the chicken; A method comprising: The method, wherein the antibody comprises a human immunoglobulin heavy chain variable region.

21. 21. The method of claim 20, wherein the antibody is polyclonal.

22. 21. The method of claim 20, wherein the antibody is monoclonal.

23. (c) preparing hybridomas using B cells from the transgenic chicken; and (d) screening the hybridomas to identify hybridomas that produce antibodies that specifically bind to the antigen.

23. The method of any of claims 20 to 22, further comprising:

24. 24. The method of any of claims 20 to 23, further comprising using PCR to amplify nucleic acids encoding the heavy and light chain variable regions from B cells of the transgenic animal, and using the amplified nucleic acids to express a recombinant antibody.

25. It is a method (a) deleting the entire contiguous endogenous chicken V-D-J region from the chicken immunoglobulin heavy chain (IgH) locus; and (b) inserting a construct into the locus, wherein the construct comprises: (i) an immunoglobulin heavy chain gene promoter; (ii) a germline human VV comprising a coding sequence for a variable domain including FR1, CDR1, FR2, CDR2, and FR3 sequences; Ｈ segment, (iii) human D cluster; (iv) a human J segment, and (vi) each of the human V of (b)(ii) Ｈ multiple pseudogenes of the structure FR1-CDR1-FR2-CDR2-FR3, comprising FR1, FR2 and FR3 sequences that are at least 95% identical to the FR1, FR2 and FR3 sequences of the segment, respectively, and different CDR1 and CDR2 coding sequences for each pseudogene; Including, Steps (a) and (b) are carried out in any order; The method provides chickens that produce antibodies containing diverse human immunoglobulin heavy chain variable regions. method.

Images