Target-specific degrading agents and their medical uses

By designing chimeric proteins containing ubiquitin ligase domains and specific targeting regions of RAS or LMO2, selective degradation of KRAS or LMO2 is achieved, solving the problem that existing treatments are difficult to target multiple KRAS-mutant tumors and achieving broad-spectrum anti-KRAS-related cancer therapeutic effects.

JP7779861B2Active Publication Date: 2025-12-03OXFORD UNIVERSITY INNOVATION LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2022569162
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-05-12
Filing Date
2021-05-12
Publication Date
2025-12-03
Estimated Expiration
2041-05-12

Smart Images

  • Figure 0007779861000038
    Figure 0007779861000038
  • Figure 0007779861000039
    Figure 0007779861000039
  • Figure 0007779861000040
    Figure 0007779861000040
Patent Text Reader

Abstract

A chimeric protein is provided that includes a ubiquitin ligase domain and a RAS-specific endogenous targeting moiety. The ubiquitin ligase domain can be a VHL E3 ligase domain or a fragment or variant thereof having ubiquitin ligase activity, or a UBOX domain of CHIP or a fragment or variant thereof having ubiquitin ligase activity. The RAS-specific endogenous targeting moiety can be a RAS-specific DARPin or a RAS-specific intracellular antibody. Specifically, the RAS-specific endogenous targeting moiety can be a KRAS-specific endogenous targeting moiety (e.g., a KRAS-specific DARPin or a KRAS-specific intracellular antibody). The chimeric protein can be used in the prevention and / or treatment of RAS-related disorders, such as RAS-related cancers or RAS-related diseases. Further provided is a chimeric protein that includes a ubiquitin ligase domain and an LMO2-specific endogenous targeting moiety.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to chimeric proteins and nucleic acids encoding such chimeric proteins. The present invention also relates to pharmaceutical compositions comprising the chimeric proteins or nucleic acids of the present invention. Furthermore, the present invention relates to medical uses and methods of treatment using such pharmaceutical compositions, chimeric proteins, or nucleic acids. [Background technology]

[0002] Mutations in the KRAS oncogene represent more than 85% of all RAS family mutations, and individual mutations occur at various codons, resulting in numerous forms of mutant KRAS proteins. Recently, several macromolecules and compounds have been developed that affect the function of RAS family members. Nevertheless, only the G12C mutation of KRAS has been specifically targeted by small molecules thanks to the covalent attachment of the compound to the mutant cysteine. Several small molecules are currently under clinical trials. However, only a small fraction (approximately 12%) of mutant KRAS tumors have KRAS G12C These inhibitors do not express the KRAS protein, and therefore only a small fraction of mutant KRAS tumors can be targeted by these inhibitors. Furthermore, upon treatment with these inhibitors, KRAS expression is impaired, such that some cells become drug insensitive. G12C Rapid adaptation has recently been described in a population of tumors. Therefore, new strategies are needed to specifically target a larger number of other tumors expressing mutant KRAS. Potentially applicable reagents for this purpose are the DARPins K13 and K19, which specifically interfere with KRAS. These DARPins convert mutants into wild-type KRAS (KRAS WT ), while not binding to NRAS and HRAS, so any phenotype produced using these DARPins in cells will preserve the expression and function of these two family members.

[0003] Previous studies involving the expression of a pan-RAS-binding intracellular single-domain antibody (also referred to herein as iDAb RAS) in human cell line xenografts demonstrated that tumor growth was inhibited during the period of intracellular antibody fragment expression and resumed upon antibody removal. A potential complementary approach in this context could be to attach warheads, such as E3 ligases engineered onto intracellular single-domain degraders, to these macromolecules, which have been shown to trigger targeted proteolysis. Macromolecular degraders induce target depletion via the ubiquitin-proteasome system. Macromolecular degraders consist of a binder targeting the protein of interest (e.g., the intracellular single-domain), a linker, and an E3 ligase domain. Similar protein-targeting strategies have been developed in which small molecules that bind to proteins are linked to E3 ligase-binding ligands or small molecule degraders, termed proteolysis-targeting chimeras (PROTACs).

[0004] The main advantage of the protein degradation strategy is that only a binder is required, and the binder does not have to inhibit the function of the protein. Indeed, unlike classical protein-protein inhibitors or other occupancy-driven inhibitors, degraders rely on an event-driven mechanism of action and are consequently often more potent than the parent entities. Most current degraders target the BET or kinase family, with only a few targeting "undruggable" proteins such as transcription factors. The only PROTACs applied to RAS to date are KRAS. G12C These are the only compounds that bind to exogenous GFP-KRAS. G12C Degrades only the fusion protein and not the endogenous KRAS G12C Furthermore, no macromolecular or small molecule-based degraders have been shown to be specific for KRAS in the RAS family of oncogenic targets.

[0005] We report herein the engineering of the KRAS-specific DARPin K19 (also referred to herein as DP KRAS) into a KRAS-specific degrader, and a comparison of its efficacy and tumor specificity with an engineered pan-RAS degrader generated from a previously described pan-RAS intracellular single-domain antibody. We demonstrate that the KRAS degrader efficiently induces endogenous KRAS degradation in vitro and in vivo, and inhibits KRAS. WT We demonstrate that a pan-RAS degrader specifically inhibits mutant KRAS tumors, while sparing cells with only RAS isoform mutations, thereby inhibiting all cell types regardless of RAS isoform mutation. Thus, we leverage this KRAS-specific macrodrug to demonstrate that KRAS ablation may be an attractive approach for targeting any mutant KRAS-expressing tumor. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] WO2007 / 031091 issue [Non-patent literature]

[0007] [Non-Patent Document 1] Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th edition, 1985 [Non-patent document 2] Langer (Science 249:1527-1533, 1990) [Non-patent document 3] Bery, N., Cruz-Migoni, A., Bataille, CJ, Quevedo, CE, Tulmin, H., Miller, A., Russell, A., Phillips, SE, Carr, SB, and Rabbitts, TH (2018). “BRET-based RAS biosensors that show a novel small molecule is an inhibitor of RAS-effector protein-protein interactions.” [Non-patent document 4] Bery, N., Legg, S., Debreczeni, J., Breed, J., Embrey, K., Stubbs, C., Kolasinska-Zwierz, P., Barrett, N., Marwood, R., Watson, J. et al. (2019). “KRAS-specific inhibition using a DARPin binding to a site in the allosteric lobe”. Nat Commun 10, 2607. [Non-Patent Document 5] Bery, N. and Rabbitts, TH (2019). “Bioluminescence Resonance Energy Transfer 2 (BRET2)-Based RAS Biosensors to Characterize RAS Inhibitors”. Curr Protoc Cell Biol Summary of the Invention [Problem to be solved by the invention]

[0008] It is an object of certain aspects and embodiments of the present invention to address at least some of the shortcomings associated with therapeutic agents known in the prior art. It is an object of certain aspects and embodiments of the present invention to provide therapeutic agents suitable for use in the prevention and / or treatment of KRAS-associated cancers or RASopathies. [Means for solving the problem]

[0009] In a first aspect, the present invention provides a chimeric protein comprising a ubiquitin ligase domain and an exogenous RAS-specific endogenous targeting moiety.

[0010] In a second aspect, the present invention provides a chimeric protein comprising a ubiquitin ligase domain and an exogenous LMO2-specific endogenous targeting moiety.

[0011] In a third aspect, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding a chimeric protein according to the first or second aspect of the invention.

[0012] In a fourth aspect, the present invention provides a pharmaceutical composition comprising a chimeric protein of the first or second aspect of the invention and / or a nucleic acid molecule of the third aspect of the invention and a pharmaceutically acceptable carrier.

[0013] In a fifth aspect, the present invention provides a method for preventing or treating a RAS-associated disorder, comprising providing a therapeutically effective amount of a chimeric protein according to the first aspect of the present invention to a subject in need thereof. The RAS-associated disorder may be selected from the group consisting of RAS-associated cancer, RAS-associated psychiatric disorder, and RASopathy. The chimeric protein may be provided by administration of the protein itself or by administration of a nucleic acid molecule encoding the protein. Either the protein or the nucleic acid molecule may be provided by administration of a suitable pharmaceutical composition of the present invention.

[0014] The fifth aspect of the present invention also provides a medical use of the chimeric protein of the first aspect of the present invention, the nucleic acid molecule of the present invention encoding such a chimeric protein, or the pharmaceutical composition of the present invention comprising such a chimeric protein or nucleic acid. The medical use may be for preventing or treating a RAS-related disorder. The RAS-related disorder may be selected from the group consisting of RAS-related cancer, RAS-related psychiatric disorder, and RASopathy. The RAS-related cancer may be selected from RAS-related lung cancer, RAS-related pancreatic cancer, and RAS-related colorectal cancer. Suitable examples of RASopathy and further examples of RAS-related cancers are described elsewhere herein.

[0015] A sixth aspect of the present invention provides a method for preventing or treating a condition associated with LMO2 expression, comprising providing a therapeutically effective amount of a chimeric protein according to the second aspect of the present invention to a subject in need thereof. The condition associated with LMO2 expression may be selected from the group consisting of T-cell acute lymphoblastic leukemia (T-ALL), LMO2+ breast cancer, LMO2+ prostate cancer, and LMO2+ diffuse large B-cell lymphoma. The chimeric protein may be provided by administration of the protein itself or by administration of a nucleic acid molecule encoding the protein. Either the protein or the nucleic acid molecule may be provided by administration of a suitable pharmaceutical composition of the present invention.

[0016] The sixth aspect of the present invention also provides a medical use of a chimeric protein of the second aspect of the present invention, a nucleic acid molecule of the present invention encoding such a chimeric protein, or a pharmaceutical composition of the present invention comprising such a chimeric protein or nucleic acid. The medical use may be for preventing or treating a condition associated with the expression of LMO2. The LMO2-associated condition may be T-ALL, LMO2 + breast cancer, LMO2 + Prostate cancer and LMO2 + Diffuse large B-cell lymphoma. Suitably, the medical use is for preventing or treating T-ALL.

[0017] The chimeric proteins of the present invention and the nucleic acids encoding these proteins represent effective agents for the treatment of diseases associated with RAS or LMO2.

[0018] The chimeric proteins of the present invention provide effective agents that achieve their biological activity by specifically inducing translocation of their targets, either RAS or LMO2, to the proteasome, where the target proteins undergo proteolysis and thus intracellular RAS or LMO2 levels are reduced in treated cells.

[0019] Because elevated levels of RAS or LMO2, or mutant forms of RAS such as KRAS, are associated with numerous diseases, reducing the intracellular levels of these proteins has beneficial therapeutic effects, which can be observed for several different disorders associated with RAS and LMO2.

[0020] LMO2 and RAS (especially mutant forms of RAS) are known to drive the progression of associated cancers (sometimes described as "addiction" to the protein in question). In this case, reducing the presence of the protein prevents further cancer progression. The chimeric proteins of the invention and the nucleic acids encoding them represent useful agents for the treatment of RAS-associated disorders and LMO2-associated disorders such as T-ALL.

[0021] Specifically, chimeric protein of the present invention has been shown to be effective in treating cancer associated with KRAS mutation.In particular, chimeric protein of the present invention has been shown to induce the regression of KRAS-related tumors in animal models.Without wishing to be bound by any hypothesis, the data presented herein shows that chimeric protein of the present invention induces the apoptosis of cancer cells that express mutant forms of KRAS.

[0022] Indeed, the inventors have found that the chimeric proteins of the present invention can effectively bring about tumor regression through their induction of cancer cell apoptosis. Surprisingly, they can achieve this without requiring the ability to recognize specific, or indeed any, mutations in the target protein (e.g., KRAS).

[0023] This is a significant advantage over previous drugs, many of which rely on binding to specific mutations (e.g., the G12C mutation in KRAS) to achieve their effect. However, it is well known that there are many different RAS mutations associated with RAS-based pathologies such as cancer, and even multiple KRAS mutations that are responsible for various KRAS-based cancers. Successful use of such drugs requires identification of the mutations present, because drugs that specifically target one particular mutation will not be effective against different mutations. Furthermore, not all mutations have corresponding targeted drugs that can specifically bind to them.

[0024] The chimeric proteins of the present invention do not suffer from this disadvantage because they can be used as "broad spectrum" agents to treat RAS-associated disorders, such as RAS-associated cancers or RASopathies, which avoids the need to identify the specific mutation or mutations responsible for a patient's disease or to develop new targeting moieties capable of binding to newly identified mutations.

[0025] Furthermore, the inventors have unexpectedly found that the chimeric proteins of the invention are capable of selectively killing cancer cells expressing mutant forms of RAS without killing cells expressing wild-type RAS, even in embodiments in which the RAS-specific endogenous targeting moiety (e.g., K19 DARPin) does not distinguish between mutant and wild-type forms, and in embodiments in which both wild-type and mutant forms of RAS are depleted.

[0026] As described in more detail elsewhere herein, the inventors have surprisingly found that the orientation of each portion of the chimeric protein dramatically and unexpectedly affects the ability of the chimeric protein of the present invention to effect clearance of its cellular target. In an advantageous embodiment, the ubiquitin ligase domain is attached to the N-terminal region of the endogenous targeting moiety. In contrast, chimeric proteins comprising a ubiquitin ligase domain and an endogenous targeting moiety, where the endogenous targeting moiety is attached to the N-terminal region of the ubiquitin ligase domain, are less effective at clearing targets such as KRAS or LMO2.

[0027] As described further below, the ubiquitin ligase domain used in the chimeric protein of the present invention may comprise von Hippel-Lindau (VHL) E3 ligase as the ubiquitin ligase domain. The RAS-specific endogenous targeting moiety of the chimeric protein of the first aspect of the present invention may be selected for a desired target protein. For example, in cases where it is desired to reduce the intracellular levels of several different RAS isotypes, the pan-RAS-specific endogenous targeting moiety of the chimeric protein of the present invention may comprise a pan-RAS intracellular antibody. If it is desired to specifically reduce the intracellular level of KRAS, the chimeric protein of the present invention may comprise a KRAS-specific DARPin as the KRAS-specific endogenous targeting moiety. If it is desired to reduce the intracellular level of LMO2, an anti-LMO2 scFv may be used as the LMO2-specific endogenous targeting moiety of the chimeric protein of the second aspect of the present invention.

[0028] In suitable embodiments, the chimeric protein of the invention may comprise both a VHL ubiquitin ligase domain and one of an anti-pan-RAS intracellular antibody, an anti-KRAS DARPin, or an anti-LMO2 intracellular antibody. The inventors have found that in such embodiments it is particularly advantageous for the VHL E3 ligase domain to be attached to the N-terminal region of the DARPin KRAS-specific endogenous targeting moiety.

[0029] Further details of these various aspects and suitable embodiments of the invention are provided below.

[0030] The invention will now be further described with reference to the accompanying drawings. [Brief explanation of the drawings]

[0031] [Figure 1]Figure 1 shows the manipulation of KRAS and pan-RAS targeted proteolysis using single domains. (a) Effect of the single domain-UBOX fusion on RAS proteolysis assessed by Western blot. The UBOX domain was fused to either the N- or C-terminus of the pan-RAS iDAb (iDAb RAS) or iDAb control (Ctl), the KRAS-specific DARPin K19 (DP KRAS), or the DARPin control (DP Ctl). Twenty-four hours after transfection of the plasmids into HCT116 cells, Western blots were performed to determine RAS protein levels and expression from each construct using a FLAG antibody. β-Actin is a loading control. Black arrowheads indicate the specific band corresponding to the NRAS protein in the observed doublet. (b) Histograms show quantification of each RAS isoform from two independent experiments (gray dots), normalized to untransfected cells. (c) Effect of the single domain-VHL fusion on RAS proteolysis assessed by Western blot, as in (a). (d) Quantification of two independent experiments (gray dots) as in (b), normalized to untransfected cells. In (a, b) and (c, d), the best pan-RAS and KRAS degraders are highlighted in orange and blue, respectively. (e) HCT116 transfected cells with the indicated constructs were treated with DMSO (-) or 0.8 μM of the proteasome inhibitor epoxomicin (+) for 18 hours. KRAS degradation was assessed by Western blot. (f) Quantification of KRAS degradation of two independent experiments, normalized to untransfected cells. Each experiment was performed in duplicate. Error bars in b, d, and f are the mean ± SEM from two biological replicates. (g) Scheme summarizing the effects of two RAS degraders: the pan-RAS degrader (iDAb RAS-UBOX) degrades all RAS isoforms through the proteasome mechanism, while the KRAS degrader (VHL-DP KRAS) induces only KRAS degradation without affecting NRAS or HRAS. [Figure 2]Figure 1 shows the characterization of pan-RAS and KRAS degraders in H358 cancer cells. Western blot analysis of RAS and effector protein levels following induction of macrodrug degraders for dose-response and time-course analysis. (a, b) Dose-response experiments in H358 cells expressing either iDAb Ctl-UBOX or iDAb RAS-UBOX (a), VHL-DP Ctl or VHL-DP KRAS (b) were incubated with the indicated doxycycline (dox) concentrations for 18 hours. KRAS, NRAS, and HRAS protein levels were assessed by Western blot. FLAG antibody indicates expression of the constructs, and α-tubulin is a loading control. Black arrowheads indicate the specific band corresponding to the NRAS protein in the observed doublet. (c, d) Time-response experiments in H358 cells expressing the same degraders as in (a, b). The effects of pan-RAS (c) and KRAS degrading agents (d) on KRAS, NRAS, and HRAS protein levels were determined using β-actin as a loading control. (e, f) The effects of pan-RAS (e) and KRAS degrading agents (f) on RAS-dependent pathways were assessed, with the β-actin loading control being the same as in panels (c, d). Each experiment was performed in duplicate. [Figure 3] Figure 1 shows the efficacy of pan-RAS and KRAS degraders in cancer cells. Western blot analysis of RAS family protein levels following induction of macrodrug degraders. (a, b) Efficacy of pan-RAS (a) and KRAS degraders (b) to deplete their targets in various human cell lines harboring the indicated RAS mutations. KRAS, NRAS, and HRAS protein levels were determined by Western blot analysis after 72 hours of doxycycline treatment (+) or without induction (-) of cells at 0.2 μg / mL. The lines used were mutant KRAS cell lines H358, MIA PaCa2, and A549; mutant NRAS H1299, HT1080; mutant HRAS T24 cell line; and RASWT HCC827 and MRC5 cells. Degrader expression is indicated using a FLAG antibody. β-Actin is a loading control. Each experiment in (a-b) was performed in duplicate. [Figure 4] (Figure 1) Pan-RAS degraders inhibit the RAS signaling pathway in all cell lines. The effects of pan-RAS degraders on the RAS downstream signaling pathway were examined by Western blot analysis in various cell lines: (a) H358 (KRASG12C), (b) MIA PaCa-2 (KRASG12C), (c) A549 (KRASG12S), (d) H1299 (NRASQ61K), (e) HT1080 (NRASQ61K), (f) T24 (HRASG12V), (g) HCC827 (RASWT), and (h) MRC5 (RASWT). All cell lines stably express the dox-inducible iDAb RAS-UBOX or its negative control iDAb Ctl-UBOX. FLAG antibody is used to determine the expression of iDAb with (+) or without (-) induction with 0.2 μg.mL-1 doxycycline for 72 hours. β-actin is a loading control. Each experiment was performed at least three times. [Figure 5] Figure 1 shows that KRAS degrading agents inhibit the RAS signaling pathway only in cancer cell lines expressing mutant KRAS. The effects of KRAS degrading agents on the RAS downstream signaling pathway were examined by Western blot analysis in various cell lines: (a) H358 (KRASG12C), (b) MIA PaCa-2 (KRASG12C), (c) A549 (KRASG12S), (d) H1299 (NRASQ61K), (e) HT1080 (NRASQ61K), (f) T24 (HRASG12V), (g) HCC827 (RASWT), and (h) MRC5 (RASWT). All cell lines stably express dox-inducible VHL-DP KRAS or its negative control VHL-DP Ctl. FLAG antibody is used to determine the expression of DARPin (DP) with (+) or without (-) induction with 0.2 μg / mL doxycycline for 72 hours. β-Actin is a loading control. (i) Quantification of pAKTS473 / AKT and pERK / ERK signals from Figures 4 and 5. Signals were normalized to the no-dox condition (-). Each experiment in (a-h) was performed at least three times. Error bars in (i) are the mean ± SEM from at least three biological replicates. [Figure 6] Figure 1 shows that KRAS degraders specifically inhibit the growth of cells expressing mutant KRAS. Evaluation of the effects of pan-RAS and KRAS degraders on 2D adhesion and 3D spheroid growth of various cell lines. Mutant KRAS lines: (a) H358, (b) MIA PaCa2, and (c) A549 stable cell line. (d-e) Mutant NRAS lines: (d) H1299 and (e) HT1080. (f) Mutant HRAS T24 cell line. (g-h) Wild-type RAS cell lines: (g) HCC827 and (h) MRC5. Note that MRC5 cells did not grow as spheroids in 3D low-attachment plates because they are non-transformed cells and therefore require a scaffold for growth. All proliferation assays (2D and 3D) were normalized to the no-dox condition for each cell line. Dotted lines represent cells treated with dox, while solid lines represent the no-dox condition. Each experiment in (a–h) was performed at least three times. Error bars in (a–h) are the mean ± SD from at least three biological replicates. [Figure 7] Figure 1 shows that depletion of KRAS protein by KRAS degraders leads to apoptosis of mutant KRAS-dependent cells. (a) Western blot analysis of apoptosis indicators, namely cleaved PARP (cPARP) and cleaved caspase 3 (cCASP3), induced after degrader expression in H358 cells in a time-response experiment. (b, c) Western blot analysis of two apoptosis markers after degrader expression in 2D adherent cultures of all eight cell lines tested in this study after 72 hours of doxycycline treatment (+) or without induction (-). α-Tubulin is a loading control. Two arrows indicate the 17 / 19 kDa cleaved caspase 3 fragment. Each experiment in (a–c) was performed in duplicate. [Figure 8]This figure shows that KRAS degraders induce regression of mutant KRAS H358 tumors. 4.5 × 10 H358 cells expressing either FLuc / iDAb RAS-UBOX or FLuc / VHL-DP KRAS were subcutaneously injected into CD-1 nude mice. After tumors reached a diameter of 3–4 mm, animals were divided into groups of 5 mice and treated with or without doxycycline (dox) in drinking water and food. (a) Tumor volumes were measured using digital calipers, normalized to 1 on the day of dox treatment (day 1), and monitored for 20 days (4–5 mice / group, mean ± SD). (b) Waterfall plots showing the percentage change in tumor volume for individual tumors after 20 days of − / + dox treatment. The percentage change in tumor volume was calculated as follows: V final − V initial / V initial × 100. (c, d) Tumor burden from H358-FLuc / iDAb RAS-UBOX (c) and H358-FLuc / VHL-DP KRAS (d) tumors was assessed by bioluminescence imaging at the end of the experiment (day 20). Photon flux (i.e., luminescence signal) was quantified for each group on day 20 (mean ± SEM). (e, f) Western blot analysis of H358 tumor lysates from H358-FLuc / iDAb RAS-UBOX tumors (e) or H358-FLuc / VHL-DP KRAS tumors (f) harvested at the endpoint of the experiment (day 20) after 48 hours of dox treatment, compared with untreated H358 mouse tumors. The black arrowhead indicates the specific band corresponding to the FLAG-tagged VHL-DP KRAS protein. [Figure 9]Characterization of DARPin controls and degraders. (a) BRET donor saturation assay between DARPin KRAS (DP KRAS) or DARPin control (DP Ctl) as acceptor and KRASWT, KRASG12D, NRASQ61H, or HRASG12V as donors. (b) Co-immunoprecipitation of 3×FLAG-KRASWT and 3×FLAG-KRASG12D with DARPin-GFP2 fusions in 10% fetal bovine serum. IP: immunoprecipitation; WCE: whole cell extract. DARPin E3.5 is an unrelated DARPin. (c) BRET competition by DARPins showing the interaction between KRASG12D and CRAFFL or (d) dimerization of KRASG12D. (-) indicates that no competitor was used. Each experiment was performed twice (a, b) or four times (c, d). Error bars represent the mean ± SD of biological replicates (a, c, d). (e-h) DNA and protein sequences of iDAb RAS-UBOX (pan-RAS degrader), iDAb Ctl-UBOX, VHL-DP KRAS (KRAS degrader), and VHL-DP Ctl. [Figure 10] Figure 1 shows that RAS degraders induce degradation of their endogenous targets through the proteasome mechanism. (a) H358 cells expressing iDAb Ctl-UBOX, iDAb RAS-UBOX, VHL-DP Ctl, or VHL-DP KRAS were either untreated (-), treated with dox alone (0.5 μg / mL), or treated with dox and epoxomicin (0.8 μM) for 18 hours. RAS protein levels were determined by Western blot using a pan-RAS antibody. α-Tubulin served as a loading control. (b) Quantitative real-time PCR was performed in H358 stable cell lines after treatment with 0.2 μg / mL of dox (+) or untreated (-) for 24 hours. The dox-free condition was normalized to a value of 1.0, and DUSP6 mRNA abundance is expressed as a fold change relative to that value. Data are based on biological duplicates and normalized to GAPDH. Error bars indicate SEM. [Figure 11]Figure 1 shows the effect of parent iDAb macrodrugs on the RAS signaling pathway in various cell lines. The effect of iDAb RAS parent single domains (non-degraders) on the RAS signaling pathway in various cell lines: (a) H358 (KRASG12C), (b) MIA PaCa-2 (KRASG12C), (c) A549 (KRASG12S), (d) H1299 (NRASQ61K), (e) HT1080 (NRASQ61K), (f) T24 (HRASG12V), (g) HCC827 (RASWT), and (h) MRC5 (RASWT). All cells stably express the dox-inducible iDAb RAS-GFP2 and its negative control, iDAb Ctl-GFP2. The iDAb expression is shown with (+) or without (-) induction with 0.2 μg / mL doxycycline for 72 hours using a FLAG antibody. β-actin is a loading control. Each experiment in (a–h) was performed at least three times. [Figure 12] Figure 1 shows the effect of parental DARPin macrodrugs on the RAS signaling pathway in various cell lines. The effect of DP KRAS parental single domains (non-degraders) on the RAS signaling pathway in various cell lines: (a) H358 (KRASG12C), (b) MIA PaCa-2 (KRASG12C), (c) A549 (KRASG12S), (d) H1299 (NRASQ61K), (e) HT1080 (NRASQ61K), (f) T24 (HRASG12V), (g) HCC827 (RASWT), and (h) MRC5 (RASWT). All cells stably express dox-inducible DP KRAS-GFP2 and its negative control, DP Ctl-GFP2. Using a FLAG antibody, expression of DARPin (DP) is shown with (+) or without (-) induction with 0.2 μg / mL doxycycline for 72 hours. β-actin is a loading control. (i) Comparative quantification of pAKTS473 / AKT and pERK / ERK signals affected by iDAb RAS and DP KRAS fused to GFP2 from Figures S3 and S4. Signals were normalized to the no-dox condition (-). Each experiment in (a–h) was performed at least three times. Error bars in (i) are the mean ± SEM from at least three biological replicates. [Figure 13] Figure 1 shows the effect of parental iDAb and DARPin macrodrugs on 2D adherent growth assays of various cell lines. Cells were grown as adherent cultures, and macrodrug induction was induced by doxycycline treatment to assess the effect of iDAb and DP fused to GFP2 on the proliferation of mutant KRAS cell lines: (a) H358, (b) MIA PaCa2, and (c) A549. (d-e) Effect of single domains on 2D adherent growth of NRAS mutant cell lines: (d) H1299 and (e) HT1080. (f) Effect of iDAb-GFP2 and DP-GFP2 fusions on 2D adherent growth of mutant HRAS T24 cell lines. (g-h) Effect of parental single domains on 2D adherent growth of RASWT cell lines: (g) HCC827 and (h) MRC5. All proliferation assays were normalized to the no-dox condition for each cell line. Solid lines represent cells treated with dox, while dotted lines indicate the no-dox condition. Each experiment in (a–h) was performed at least three times. Error bars in (a–h) are the mean ± SD from at least three biological replicates. [Figure 14]Characterization of H358-FLuc and H1299-FLuc clones and the effect of degraders on H1299 tumor xenografts. (a) Western blot analysis of the RAS downstream signaling pathways RAS / RAF / MEK / ERK and PI3K / AKT in H1299-FLuc and H358-FLuc clone cells. FLAG antibody was used to show the expression of iDAb and DARPin with (+) or without (-) induction with 0.2 μg / mL doxycycline for 72 hours. KRAS, NRAS, and HRAS protein levels were also assessed by Western blot to confirm proteolysis of degrader targets. β-Actin is a loading control. Black arrowheads indicate specific bands corresponding to pAKTS473 and NRAS proteins. (b, c) Cell growth assays of each clone in H358 (b) and H1299 (c). Cells were grown with or without 0.2 μg / mL of dox and counted every 2 days for 6 days to determine growth. Each experiment (b, c) was performed twice. Error bars in (b, c) represent the mean ± SD from two biological replicates. (d, e) 5 × 10 H1299 cells inducibly expressing either FLuc / iDAb RAS-UBOX (d) or FLuc / VHL-DP KRAS (e) were subcutaneously injected into CD-1 nude mice. After tumors reached a diameter of 2–3 mm, animals were divided into groups of 3–5 mice and treated with or without doxycycline in the drink and food (+ / – dox). Tumor burden was assessed at the end of the experiment (day 20) by bioluminescence imaging. Photon flux (i.e., luminescence signal) was quantified for each group on day 20 (mean ± SEM). *P<0.05 and ns: non-significant. (f, g) Western blot analysis of H1299 tumor lysates after 20 days of doxycycline treatment in H1299-FLuc / iDAb RAS-UBOX (f) and H1299-FLuc / VHL-DP KRAS (g). The black arrowhead indicates the specific band corresponding to the FLAG-tagged VHL-DP KRAS protein. [Figure 15]This figure shows that chimeric proteins according to the second aspect of the invention can reduce intracellular LMO2 in vitro. Figure 15 shows the results of a study in which an LMO2-expressing HEK293 cell line was transfected with one of several test plasmids incorporating VH576, an intracellular single-domain antibody against LMO2. VH576 was fused to the VHL E3 ligase domain to generate a chimeric protein according to the second aspect of the invention (referred to as "iDAb LMO2-VHL" in the figure and VH576-VHL elsewhere in this specification) and to green fluorescent protein (GFP) or cereblon E3 ligase (CRBN) to generate appropriate control chimeric proteins. An anti-RAS VHY6 fusion protein with CRBN was used as a negative control for endogenous targeting moieties. After 24 hours, protein extracts were prepared, separated by SDS-PAGE, and Western blotted using anti-LMO2 antibodies and β-actin as a loading control. Panel A shows the results of Western blot analysis, panel B shows quantification of LMO2 in lanes from cells treated with a chimeric protein of the invention or a control (compared to the untransfected signal), and panel C shows expanded quantification of LMO2 in cells treated with VHL-iDAb LMO2 (VHL-VH576, a chimeric protein according to the second aspect of the invention) and iDAb LMO2-VHL (VH576-VHL), demonstrating the importance of the orientation of the ubiquitin ligase domain and the LMO2-specific endogenous targeting moiety in embodiments of this second aspect of the invention. DETAILED DESCRIPTION OF THE INVENTION

[0032] The invention will now be further described with reference to the following paragraphs and the definitions provided therein.

[0033] "Chimeric Protein" of the Present Invention The present invention relates to chimeric proteins comprising a ubiquitin ligase domain and either a RAS-specific endogenous targeting moiety (the chimeric protein of the first aspect of the invention) or an LMO2-specific endogenous targeting moiety (the chimeric protein of the second aspect of the invention). Chimeric proteins are composed of sequences from at least two proteins. These may be artificial proteins (such as DARPins or intrabodies) or naturally occurring proteins such as ubiquitin ligases. It will be understood that chimeric proteins do not themselves occur in nature. Suitably, the ubiquitin ligase domain and the RAS-specific or LMO2-specific endogenous targeting moiety are each derived from separate proteins.

[0034] The protein from which the essential domain or portion is derived may be referred to as the "parent" protein in the context of this disclosure. The parent protein may be used to generate fragments or variants that can be used in the chimeric proteins of the present invention.

[0035] To be suitable for incorporation into the chimeric proteins of the present invention, a fragment or variant of a parent protein should retain some or all of the biological activity of the parent protein (e.g., ubiquitin ligase activity or the ability to specifically bind to a RAS such as LMO2 or KRAS).

[0036] A fragment derived from a parent protein shares 100% identity with the corresponding portion of the parent protein, but does not contain 100% of the sequence of the full-length parent protein.

[0037] Suitably, a fragment of a parent protein may comprise at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, or at least 90% of the full-length sequence of the parent protein. By way of example, variants of a parent protein that may be incorporated into a chimeric protein of the invention may share at least at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the full-length sequence of the parent protein.

[0038] Considered another way, a fragment may comprise 10 or more consecutive amino acid residues from the parent protein sequence, for example, 20 or more, 30 or more, or 40 or more consecutive amino acid residues.

[0039] In contrast to such fragments, a variant of a parent protein incorporates one or more changes compared to the sequence of the parent protein from which it is derived. Suitably, a variant of a parent protein that may be incorporated into a chimeric protein of the present invention may share at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, or at least 90% identity with the corresponding portion of the parent protein. By way of example, a variant of a parent protein that may be incorporated into a chimeric protein of the present invention may share at least at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the corresponding portion of the parent protein.

[0040] Suitably, variants of a parent protein that may be incorporated into a chimeric protein of the present invention may share up to 99%, up to 98%, up to 97%, up to 96%, up to 95%, up to 94%, up to 93%, up to 92%, up to 91%, or up to 90% identity with the corresponding portion of the parent protein.

[0041] A variant in this context comprises at least one modification compared to the parent protein sequence. As used herein, "modification" refers to any change made to an amino acid sequence such that the sequence is not the same as the parent protein. Suitably, a variant of a parent protein may comprise at least 2, 3, 4, 5, 10, or 15 amino acid modifications compared to the parent protein sequence. Suitable modifications may include substitution or deletion of amino acid residues present in the parent protein, or addition of amino acid residues not present in the parent protein sequence.

[0042] "Intrinsic targeting moiety" The chimeric proteins of the invention comprise an endogenous targeting moiety in combination with a ubiquitin ligase domain. The endogenous targeting moiety is a polypeptide component of the chimeric protein of the invention that confers on the chimeric protein the ability to specifically bind to its corresponding target, whether specific for RAS or a particular RAS isoform, or for LMO2.

[0043] An endogenous targeting moiety suitable for use in the chimeric proteins of the present invention can be any endogenous polypeptide sequence capable of specifically binding to a selected target. Those skilled in the art will be aware of numerous suitable assays that can assess the ability to specifically bind to a target (such as pan-RAS, KRAS, HRAS, NRAS, or LMO2).

[0044] For purposes of the present invention, an endogenous targeting moiety should be understood as a targeting moiety that does not naturally occur in the intracellular environment. For example, an endogenous RAS targeting moiety suitable for use in the chimeric proteins of the present invention would not include naturally occurring intracellular RAS-binding proteins or fragments of such naturally occurring intracellular RAS-binding proteins.

[0045] By way of example, a suitable endogenous targeting moiety may be selected from the group consisting of a DARPin (or a fragment or variant of a DARPin) and an intrabody (or a fragment or variant of an intrabody).

[0046] DARPin is not a naturally occurring molecule, so it is suitable for being used as the endogenous targeting moiety according to the present disclosure.Therefore, in suitable embodiments, endogenous targeting moiety is DARPin.The affinity maturation used during the generation of DARPin means that these agents can achieve the affinity level for their target, which is much higher than that of naturally occurring agents.

[0047] Intracellular antibodies are also suitable for use as endogenous targeting moieties according to the present disclosure, as they are also not naturally occurring proteins (antibodies must be modified to be suitable for intracellular use). Thus, in a suitable embodiment, the endogenous targeting moiety is an intracellular antibody.

[0048] The ability of an endogenous targeting moiety, such as a DARPin or intrabody, to bind to its target can be determined by a suitable binding assay. In the case of a pan-RAS-specific endogenous targeting moiety, this can be a suitable pan-RAS binding assay. In the case of a KRAS-specific endogenous targeting moiety, this can be a suitable KRAS binding assay. In the case of an HRAS-specific endogenous targeting moiety, this can be a suitable HRAS binding assay. In the case of an NRAS-specific endogenous targeting moiety, this can be a suitable NRAS binding assay. In the case of an LMO2-specific endogenous targeting moiety, this can be a suitable LMO2 binding assay.

[0049] Endogenous targeting moieties, and in particular antibodies or DARPin endogenous targeting moieties, may serve as parent proteins from which fragments or variants suitable for use in embodiments of the present invention may be generated, subject to the considerations described elsewhere herein.

[0050] The ability of a fragment or variant of an endogenous targeting moiety, such as a DARPin or intrabody, to bind to its target can be determined by a suitable binding assay. In the case of a fragment or variant of a pan-RAS-specific DARPin or intrabody, this can be a suitable pan-RAS binding assay. In the case of a fragment or variant of a KRAS-specific DARPin or intrabody, this can be a suitable KRAS binding assay. In the case of a fragment or variant of an HRAS-specific DARPin or intrabody, this can be a suitable HRAS binding assay. In the case of a fragment or variant of an NRAS-specific DARPin or intrabody, this can be a suitable NRAS binding assay. In the case of a fragment or variant of an LMO2-specific DARPin or intrabody, this can be a suitable LMO2 binding assay.

[0051] In the context of the present disclosure, references to an "endogenous targeting moiety" without specifying a target should be interpreted as applying to all chimeric proteins of the invention (including chimeric proteins according to the first aspect of the invention and chimeric proteins according to the second aspect of the invention), unless the context requires otherwise.

[0052] RAS The RAS family of proteins comprises three isoforms: KRAS, HRAS, and NRAS. The various isoforms share common structural elements and each acts as an intracellular signaling agent.

[0053] Pan-RAS For purposes of this specification, the term "pan-RAS" should be construed as encompassing any RAS family isoform, including, but not limited to, KRAS, HRAS, and NRAS.

[0054] KRAS KRAS is an intracellular protein and is part of the RAS / MAPK pathway. The amino acid sequence of human wild-type KRAS is set forth in SEQ ID NO:1.

[0055] For the purposes of this disclosure, reference to "wild-type" KRAS should be construed as referring to a form of KRAS that does not contain any mutations compared to the amino acid sequence of SEQ ID NO:1.

[0056] A "mutated" form of KRAS contains at least one modification compared to the sequence of SEQ ID NO: 1. Mutant forms of KRAS are responsible for KRAS-associated cancers, including, but not limited to, lung adenocarcinoma, mucinous carcinoma, pancreatic ductal carcinoma, and colorectal cancer. Particular mutations are present in KRAS G12C etc., may be mentioned by citing the specific modifications they incorporate.

[0057] Unless the context requires otherwise, references in this document to "KRAS" shall be construed as encompassing both wild-type and mutant forms of KRAS.

[0058] Cellular levels of KRAS may be reduced by use of chimeric proteins of the first aspect of the invention that include either a pan-RAS-specific endogenous targeting moiety or a KRAS-specific endogenous targeting moiety.

[0059] HRAS The intracellular protein HRAS is also known as "transforming protein 21." The amino acid sequence of human wild-type HRAS is set forth in SEQ ID NO:2.

[0060] For the purposes of this disclosure, reference to "wild-type" HRAS should be construed as referring to a form of HRAS that does not contain any mutations compared to the amino acid sequence of SEQ ID NO:2.

[0061] "Mutated" forms of HRAS contain at least one modification compared to the sequence of SEQ ID NO: 2. Mutant forms of HRAS are responsible for HRAS-associated cancers, including, but not limited to, bladder cancer, thyroid cancer, salivary duct cancer, epithelial-myoepithelial carcinoma, and kidney cancer. Particular mutations may be referred to by reference to the specific modification they incorporate.

[0062] Unless the context requires otherwise, references in this document to "HRAS" shall be construed as encompassing both wild-type and mutant forms of HRAS.

[0063] Cellular levels of HRAS may be reduced by use of chimeric proteins of the first aspect of the invention that include either a pan-RAS-specific endogenous targeting moiety or an HRAS-specific endogenous targeting moiety.

[0064] NRAS NRAS is so named because of its identification in the context of neuroblastoma cells. The amino acid sequence of human wild-type NRAS is set forth in SEQ ID NO:3.

[0065] For the purposes of this disclosure, reference to "wild-type" NRAS should be construed as referring to a form of NRAS that does not contain any mutations compared to the amino acid sequence of SEQ ID NO:3.

[0066] "Mutant" forms of NRAS contain at least one modification compared to the sequence of SEQ ID NO: 3. Mutant forms of NRAS are responsible for NRAS-associated cancers, including, but not limited to, melanoma. Particular mutations may be referred to by reference to the specific modification they incorporate.

[0067] Unless the context requires otherwise, references in this document to "NRAS" shall be construed as encompassing both wild-type and mutant forms of NRAS.

[0068] Cellular levels of NRAS may be reduced by use of chimeric proteins of the first aspect of the invention that include either a pan-RAS-specific endogenous targeting moiety or an NRAS-specific endogenous targeting moiety.

[0069] "RAS-specific endogenous targeting moiety" A RAS-specific endogenous targeting moiety is a polypeptide component of a chimeric protein of the invention that confers on the chimeric protein the ability to specifically bind to RAS.

[0070] A RAS-specific endogenous targeting moiety suitable for use in the chimeric proteins of the present invention can be any endogenous polypeptide sequence capable of specifically binding to RAS. Those skilled in the art will be aware of numerous suitable assays that can assess the ability to specifically bind to RAS.

[0071] In a suitable embodiment, the RAS-specific endogenous targeting moiety is selected from the group consisting of a RAS-specific DARPin and a RAS-specific intracellular antibody.

[0072] "Pan-RAS-specific endogenous targeting moiety" A pan-RAS-specific endogenous targeting moiety is a polypeptide component of the chimeric protein of the present invention that confers specific pan-RAS binding ability to the chimeric protein. In the context of the present disclosure, this should be interpreted as meaning the ability to specifically bind to multiple RAS isoforms (such as those selected from the group consisting of KRAS, HRAS, and NRAS) without significant binding to other non-RAS intracellular proteins. Suitably, a pan-RAS-specific endogenous targeting moiety may be capable of binding to all three RAS isoforms: KRAS, HRAS, and NRAS.

[0073] A pan-RAS-specific endogenous targeting moiety suitable for use in the chimeric proteins of the present invention can be any endogenous polypeptide sequence capable of specific pan-RAS binding. Those skilled in the art will be aware of numerous suitable assays that can assess the ability to specifically bind multiple RAS isoforms.

[0074] In a suitable embodiment, the pan-RAS-specific endogenous targeting moiety is selected from the group consisting of a pan-RAS-specific intracellular antibody and a pan-RAS-specific DARPin. Such a pan-RAS-specific intracellular antibody or DARPin may constitute a suitable parent protein for generating a pan-RAS-specific fragment or variant of such an antibody or DARPin.

[0075] An example of a pan-RAS intracellular antibody suitable for use as a pan-RAS-specific endogenous targeting moiety according to the present invention is set forth in SEQ ID NO: 4. This intracellular antibody is sometimes referred to herein as an "iDAb" (intrabody single domain fragment).

[0076] The pan-RAS intracellular antibody of SEQ ID NO: 4 represents a suitable parent protein from which fragments or variants may be made as described elsewhere herein.

[0077] In a suitable embodiment, the pan-RAS-specific endogenous targeting moiety comprises the amino acid sequence set forth in SEQ ID NO: 4, a pan-RAS-binding variant of SEQ ID NO: 4, or a pan-RAS-binding fragment of SEQ ID NO: 4 or a variant thereof.

[0078] A pan-RAS-specific endogenous targeting moiety suitable for use in the chimeric proteins of the present invention can share at least 85% identity with the amino acid sequence of SEQ ID NO:4.

[0079] In a suitable embodiment, the pan-RAS-specific endogenous targeting moiety comprises the amino acid sequence set forth in SEQ ID NO: 4, or a pan-RAS-binding fragment thereof.

[0080] In a suitable embodiment, the pan-RAS-specific endogenous targeting moiety consists of the amino acid sequence set forth in SEQ ID NO:4.

[0081] As described elsewhere herein, chimeric proteins of the present invention comprising a pan-RAS-specific endogenous targeting portion of SEQ ID NO: 4 may comprise this sequence (or a fragment or variant thereof) in combination with a ubiquitin ligase domain comprising the UBOX domain of CHIP.

[0082] An exemplary chimeric protein of the present invention, "UBOX-iDAb" (SEQ ID NO: 5), represents an example of a chimeric protein comprising a pan-RAS-specific endogenous targeting moiety based on SEQ ID NO: 4 and a ubiquitin ligase domain comprising the UBOX domain of CHIP.

[0083] "KRAS-specific endogenous targeting moiety" A KRAS-specific endogenous targeting moiety is a polypeptide component of a chimeric protein of the invention that confers on the chimeric protein the ability to specifically bind to KRAS.

[0084] KRAS-specific endogenous targeting moieties suitable for use in the chimeric proteins of the present invention can be any endogenous polypeptide sequence capable of specifically binding to KRAS. Those skilled in the art will be aware of numerous suitable assays that can assess the ability to specifically bind to KRAS.

[0085] In a suitable embodiment, the KRAS-specific endogenous targeting moiety is selected from the group consisting of a KRAS-specific DARPin and a KRAS-specific intracellular antibody.

[0086] In a suitable embodiment, the KRAS-specific endogenous targeting moiety is a DARPin. The affinity maturation used during the generation of DARPins means that these agents can achieve very high affinity for their target, in this case KRAS, and much higher affinity than naturally occurring agents.

[0087] An exemplary DARPin that can be used as a KRAS-specific endogenous targeting moiety in the chimeric proteins of the invention has been designated by the inventors as K19. The amino acid sequence of K19 is set forth in SEQ ID NO:6, and the DNA sequence encoding K19 is set forth in SEQ ID NO:7.

[0088] An alternative DARPin that may be used as a KRAS-specific endogenous targeting moiety in the chimeric proteins of the invention has been designated by the inventors as K13. The amino acid sequence of K13 is set forth in SEQ ID NO:8, and the DNA sequence encoding K13 is set forth in SEQ ID NO:9.

[0089] The data described in the examples demonstrate that the chimeric protein of the present invention comprising K19 and the chimeric protein of the present invention comprising K13 can both effectively reduce cellular KRAS levels.The chimeric protein of the present invention comprising K13 as a KRAS-specific endogenous targeting moiety induces KRAS degradation, but to a lower extent than that in which K19 is used as a KRAS-specific endogenous targeting moiety.The inventors believe that this difference may be due to the fact that K13 has a lower affinity for KRAS than K19 (approximately 30nM vs. 10nM, respectively).

[0090] DARPins K19 and K13 represent suitable parent proteins from which fragments or mutants may be generated as described elsewhere herein. In a suitable embodiment, the KRAS-specific endogenous targeting moiety comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 6, a KRAS-binding mutant of SEQ ID NO: 6, a KRAS-binding fragment of SEQ ID NO: 6 or a mutant thereof, SEQ ID NO: 8, a KRAS-binding mutant of SEQ ID NO: 8, and a KRAS-binding fragment of SEQ ID NO: 8 or a mutant thereof.

[0091] A KRAS-specific endogenous targeting moiety suitable for use in the chimeric proteins of the present invention may share at least 85% identity with the amino acid sequence of SEQ ID NO:6.

[0092] In a suitable embodiment, the KRAS-specific endogenous targeting moiety comprises the amino acid sequence set forth in SEQ ID NO: 6, or a KRAS-binding fragment thereof.

[0093] In a suitable embodiment, the KRAS-specific endogenous targeting moiety consists of the amino acid sequence set forth in SEQ ID NO:6.

[0094] Fragments or variants of the sequence set forth in SEQ ID NO: 6 may retain a sufficient number of KRAS-binding tryptophan repeats present in SEQ ID NO: 6 to retain effective specific binding of KRAS. For the avoidance of doubt, the KRAS-binding tryptophan repeats in SEQ ID NO: 6 are residues 35, 37, 45, and 46 of this sequence. Suitably, fragments or variants of KRAS-specific endogenous targeting moieties set forth in SEQ ID NO: 6 may comprise at least three of the KRAS-binding tryptophan repeats of SEQ ID NO: 6. Suitably, fragments or variants of KRAS-specific endogenous targeting moieties set forth in SEQ ID NO: 6 may comprise all four of the KRAS-binding tryptophan repeats of SEQ ID NO: 4.

[0095] A KRAS-specific endogenous targeting moiety suitable for use in the chimeric proteins of the present invention may share at least 85% identity with the amino acid sequence of SEQ ID NO:8.

[0096] In a suitable embodiment, the KRAS-specific endogenous targeting moiety comprises the amino acid sequence set forth in SEQ ID NO: 8, or a KRAS-binding fragment thereof.

[0097] In a suitable embodiment, the KRAS-specific endogenous targeting moiety consists of the amino acid sequence set forth in SEQ ID NO:8.

[0098] In a suitable embodiment, the KRAS-specific endogenous targeting moiety is a KRAS-specific intracellular antibody.

[0099] The amino acid sequences of suitable KRAS-specific intracellular antibodies that can be used as KRAS-specific endogenous targeting moieties in the chimeric proteins of the invention are set forth in SEQ ID NOs: 10 and 11. These novel KRAS-specific intracellular antibodies have been designated by the inventors as P2-E2 and P2-F3, respectively.

[0100] In a suitable embodiment, the KRAS-specific endogenous targeting portion of the chimeric protein of the present invention comprises the amino acid sequence set forth in SEQ ID NO: 10, or a KRAS-binding fragment of the amino acid sequence set forth in SEQ ID NO: 10, or a KRAS-binding variant of the amino acid sequence set forth in SEQ ID NO: 10 or a fragment thereof.

[0101] A KRAS-specific endogenous targeting moiety suitable for use in the chimeric proteins of the present invention may share at least 85% identity with the amino acid sequence of SEQ ID NO:10.

[0102] In a suitable embodiment, the KRAS-specific endogenous targeting moiety comprises the amino acid sequence set forth in SEQ ID NO: 10, or a KRAS-binding fragment thereof.

[0103] In a suitable embodiment, the KRAS-specific endogenous targeting moiety consists of the amino acid sequence set forth in SEQ ID NO:10.

[0104] In a suitable embodiment, the KRAS-specific endogenous targeting portion of the chimeric protein of the present invention comprises the amino acid sequence set forth in SEQ ID NO: 11, or a KRAS-binding fragment of the amino acid sequence set forth in SEQ ID NO: 11, or a KRAS-binding variant of the amino acid sequence set forth in SEQ ID NO: 11 or a fragment thereof.

[0105] A KRAS-specific endogenous targeting moiety suitable for use in the chimeric proteins of the present invention may share at least 85% identity with the amino acid sequence of SEQ ID NO:11.

[0106] In a suitable embodiment, the KRAS-specific endogenous targeting moiety comprises the amino acid sequence set forth in SEQ ID NO: 11, or a KRAS-binding fragment thereof.

[0107] In a suitable embodiment, the KRAS-specific endogenous targeting moiety consists of the amino acid sequence set forth in SEQ ID NO:11.

[0108] The scFvs of SEQ ID NO: 10 and SEQ ID NO: 11 are so useful that they give rise to further aspects of the invention. Thus, in a seventh aspect, the invention provides a KRAS-specific binding agent comprising SEQ ID NO: 10, or an antigen-binding fragment or variant thereof. In an eighth aspect, the invention provides a KRAS-specific binding agent comprising SEQ ID NO: 11, or an antigen-binding fragment or variant thereof.

[0109] The ability of a fragment or variant of the scFv of SEQ ID NO: 10 or SEQ ID NO: 11 to bind to an antigen may be determined by a suitable KRAS binding assay, as described elsewhere herein.

[0110] An antigen-binding fragment of SEQ ID NO: 10 can comprise up to 300 consecutive amino acid residues of the parent protein. For example, a suitable antigen-binding fragment of SEQ ID NO: 10 can comprise up to 299, up to 298, up to 297, up to 296, up to 295, up to 294, up to 293, up to 292, up to 291, or up to 290 consecutive amino acid residues of the amino acid sequence set forth in SEQ ID NO: 10. A suitable antigen-binding fragment of SEQ ID NO: WW can comprise up to 285, up to 280, up to 275, up to 270, or up to 265 consecutive amino acid residues of the amino acid sequence set forth in SEQ ID NO: 10.

[0111] An antigen-binding fragment of SEQ ID NO: 10 can comprise up to 99% of the amino acid sequence of the parent protein. For example, a suitable antigen-binding fragment of SEQ ID NO: 10 can comprise up to 98%, up to 97%, up to 96%, up to 95%, up to 94%, up to 92%, up to 91%, or up to 90% of the amino acid sequence set forth in SEQ ID NO: 10.

[0112] Antigen-binding variants of SEQ ID NO: 10 may share at least 85% identity with the parent protein. For example, a suitable antigen-binding fragment of SEQ ID NO: 10 may share at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to the amino acid sequence set forth in SEQ ID NO: 10.

[0113] An antigen-binding fragment of SEQ ID NO: 11 can comprise up to 308 consecutive amino acid residues of the parent protein. For example, a suitable antigen-binding fragment of SEQ ID NO: 11 can comprise up to 307, up to 306, up to 305, up to 304, up to 303, up to 302, up to 301, up to 300, up to 299, up to 298, up to 297, up to 296, up to 295, up to 294, up to 293, up to 292, up to 291, or up to 290 consecutive amino acid residues of the amino acid sequence set forth in SEQ ID NO: 11. A suitable antigen-binding fragment of SEQ ID NO: 11 can comprise up to 285, up to 280, up to 275, up to 270, or up to 265 consecutive amino acid residues of the amino acid sequence set forth in SEQ ID NO: 11.

[0114] An antigen-binding fragment of SEQ ID NO: 11 can comprise up to 99% of the amino acid sequence of the parent protein. For example, a suitable antigen-binding fragment of SEQ ID NO: 11 can comprise up to 98%, up to 97%, up to 96%, up to 95%, up to 94%, up to 92%, up to 91%, or up to 90% of the amino acid sequence set forth in SEQ ID NO: 11.

[0115] Antigen-binding variants of SEQ ID NO: 11 may share at least 85% identity with the parent protein. For example, a suitable antigen-binding fragment of SEQ ID NO: 11 may share at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to the amino acid sequence set forth in SEQ ID NO: 11.

[0116] In suitable embodiments, the KRAS-specific endogenous targeting moiety is capable of binding to both mutant and wild-type KRAS. DARPins K19 (SEQ ID NO: 6) and K13 (SEQ ID NO: 8) and the anti-KRAS scFvs of SEQ ID NOs: 10 and 11, respectively, are examples of such KRAS-specific endogenous targeting moieties.

[0117] The inventors have found that chimeric proteins of the invention incorporating KRAS-specific endogenous targeting moieties that bind to both wild-type and mutant KRAS are capable of inducing proteolysis of both forms of KRAS, but surprisingly, they selectively inhibit the growth of cells, such as cancer cells, that express mutant KRAS in vitro or in vivo, without inhibiting the growth of cells that express wild-type KRAS.

[0118] The bound KRAS can be a KRAS expressed by a subject in need of prevention or treatment of a condition using a chimeric protein according to the present invention.

[0119] Typically, the KRAS-specific endogenous targeting moiety is specific for human KRAS.

[0120] "NRAS-specific endogenous targeting moiety" An NRAS-specific endogenous targeting moiety is a polypeptide component of a chimeric protein of the invention that confers on the chimeric protein the ability to specifically bind to NRAS.

[0121] An NRAS-specific endogenous targeting moiety suitable for use in the chimeric proteins of the present invention can be any endogenous polypeptide sequence capable of specifically binding to NRAS. Those skilled in the art will be aware of numerous suitable assays that can assess the ability to specifically bind to NRAS.

[0122] In suitable embodiments, the NRAS-specific endogenous targeting moiety is selected from the group consisting of an NRAS-specific intrabody and an NRAS-specific DARPin.

[0123] In a suitable embodiment, the NRAS-specific endogenous targeting moiety is an NRAS-specific intracellular antibody. In a suitable embodiment, the NRAS-specific endogenous targeting moiety is an NRAS-specific scFv.

[0124] "HRAS-specific endogenous targeting moiety" An HRAS-specific endogenous targeting moiety is a polypeptide component of a chimeric protein of the invention that confers on the chimeric protein the ability to specifically bind to HRAS.

[0125] A HRAS-specific endogenous targeting moiety suitable for use in the chimeric proteins of the present invention can be any endogenous polypeptide sequence capable of specifically binding to HRAS. Those skilled in the art will be aware of numerous suitable assays that can assess the ability to specifically bind to HRAS.

[0126] In suitable embodiments, the HRAS-specific endogenous targeting moiety is selected from the group consisting of an HRAS-specific intrabody and an HRAS-specific DARPin.

[0127] In a suitable embodiment, the HRAS-specific endogenous targeting moiety is an HRAS-specific intracellular antibody. In a suitable embodiment, the NRAS-specific endogenous targeting moiety is an HRAS-specific scFV.

[0128] LMO2 LMO2 is a protein also known as LIM domain only 2, RBTNL1, RBTN2, RHOM2, LIM domain only protein 2, TTG2, and T-cell translocation protein 2. LMO2 is activated by chromosomal translocations t(11;14)(p13;q11) and t(7;11)(q35;p13) in T-ALL, as well as by alterations in transcriptional regulatory regions. Furthermore, LMO2 is overexpressed in more than 50% of T-ALL cases and is not expressed in normal T cells; therefore, it is considered a specific marker of lymphoblasts associated with T-ALL and a suitable target protein for use in the prevention or treatment of T-ALL.

[0129] Expression of LMO2 was also + breast cancer, LMO2 + Prostate cancer and LMO2 + It is also associated with several other conditions that may require prevention or treatment, including diffuse large B-cell lymphoma.

[0130] The amino acid sequence of human wild-type LMO2 is set forth in SEQ ID NO:12.

[0131] "LMO2-specific endogenous targeting moiety" An LMO2-specific endogenous targeting moiety is a polypeptide component of a chimeric protein of the invention that confers on the chimeric protein the ability to specifically bind to LMO2.

[0132] LMO2-specific endogenous targeting moieties suitable for use in the chimeric proteins of the present invention can be any endogenous polypeptide sequence capable of specifically binding to LMO2. Those skilled in the art will be aware of numerous suitable assays that can assess the ability to specifically bind to LMO2.

[0133] In suitable embodiments, the LMO2-specific endogenous targeting moiety is selected from the group consisting of an LMO2-specific intrabody and an LMO2-specific DARPin.

[0134] An example of an LMO2-specific intrabody suitable for use as an LMO2-specific endogenous targeting moiety in accordance with the present invention is set forth in SEQ ID NO: 13. This intrabody is also referred to elsewhere herein as VH576.

[0135] The LMO2-specific intracellular antibody of SEQ ID NO: 13 represents a suitable parent protein from which fragments or variants may be generated as described elsewhere herein. In suitable embodiments, the LMO2-specific endogenous targeting moiety comprises the amino acid sequence set forth in SEQ ID NO: 13, an LMO2-binding variant of SEQ ID NO: 13, or an LMO2-binding fragment of SEQ ID NO: 13 or a variant thereof.

[0136] LMO2-specific endogenous targeting moieties suitable for use in the chimeric proteins of the present invention may share at least 85% identity with the amino acid sequence of SEQ ID NO:13.

[0137] In a suitable embodiment, the LMO2-specific endogenous targeting moiety comprises the amino acid sequence set forth in SEQ ID NO: 13, or an LMO2-binding fragment thereof.

[0138] In a suitable embodiment, the LMO2-specific endogenous targeting moiety consists of the amino acid sequence set forth in SEQ ID NO:13.

[0139] As described elsewhere herein, chimeric proteins of the invention comprising the LMO2-specific endogenous targeting moiety of SEQ ID NO: 13 may comprise this sequence (or a fragment or variant thereof) in combination with a ubiquitin ligase domain, including a VHL E3 ligase domain.

[0140] The exemplary chimeric protein of the present invention, "VHL-VH576" (SEQ ID NO: 14), represents one example of a chimeric protein comprising an LMO2-specific endogenous targeting moiety based on SEQ ID NO: 13 and a ubiquitin ligase domain comprising a VHL E3 ligase domain.

[0141] "Ubiquitin ligase domain" The ubiquitin ligase domain is a polypeptide component of the chimeric protein of the present invention that has ubiquitin ligase activity. The presence of this domain in the chimeric protein, along with a KRAS-specific endogenous targeting moiety, allows the ubiquitin ligase activity to be specifically directed to KRAS, e.g., cellular KRAS. This, in turn, increases the targeting of KRAS to the proteasome.

[0142] Numerous ubiquitin ligase domains are known to those skilled in the art. These include the VHL E3 ligase domain described above and the carboxyl-terminal UBOX domain of the Hsc70-interacting protein (CHIP) E3 ligase. By way of example only, the ubiquitin ligase domain of the chimeric protein of the present invention may be selected from the group consisting of the VHL E3 ligase domain or a fragment or variant thereof having ubiquitin ligase activity, and the UBOX domain of CHIP or a fragment or variant thereof having ubiquitin ligase activity. Those skilled in the art will be aware of numerous suitable assays by which ubiquitin ligase activity can be assessed.

[0143] The present inventors have found that the VHL E3 ligase domain, or a fragment or variant thereof having ubiquitin ligase activity, is particularly suitable for use as the ubiquitin ligase domain in the chimeric proteins of the invention. As further described in the Examples below, chimeric proteins of the invention incorporating the VHL E3 ligase domain have proven more effective than those containing other comparable ubiquitin ligase domains.

[0144] The amino acid sequence of VHL E3 ligase is set forth in SEQ ID NO: 15, and the DNA encoding VHL E3 ligase is set forth in SEQ ID NO: 16. The VHL E3 ligase domain represents a suitable parent protein from which fragments or variants may be generated, as described elsewhere herein.

[0145] Residue C162 of the VHL E3 domain is known to be important for its binding to the elongin B / C ubiquitin ligase complex and for VHL ubiquitin ligase activity in vitro. Accordingly, suitable fragments of the VHL E3 domain for use as the ubiquitin ligase domain in the chimeric proteins of the invention may include residue C162. Similarly, suitable variants of the VHL E3 domain for use as the ubiquitin ligase domain in the chimeric proteins of the invention may keep residue C162 unsubstituted.

[0146] A ubiquitin ligase domain suitable for use in a chimeric protein according to the present invention may share at least 85% identity with SEQ ID NO:15.

[0147] In a suitable embodiment, the ubiquitin ligase domain comprises the amino acid sequence set forth in SEQ ID NO: 15, or a fragment thereof that has ubiquitin ligase activity.

[0148] In a suitable embodiment, the ubiquitin ligase domain consists of the amino acid sequence set forth in SEQ ID NO:15.

[0149] In a suitable embodiment, the ubiquitin ligase domain of the chimeric protein of the invention comprises the UBOX domain of CHIP or a fragment or variant thereof.

[0150] The amino acid sequence of the UBOX domain of CHIP is set forth in SEQ ID NO: 17, and DNA encoding the UBOX domain of CHIP is set forth in SEQ ID NO: 18. The UBOX domain of CHIP represents a suitable parent protein from which fragments or variants may be generated for use in embodiments of the present invention.

[0151] A ubiquitin ligase domain suitable for use in a chimeric protein according to the present invention may share at least 85% identity with SEQ ID NO:17.

[0152] In a suitable embodiment, the ubiquitin ligase domain comprises the amino acid sequence set forth in SEQ ID NO: 17, or a fragment thereof that has ubiquitin ligase activity.

[0153] In a suitable embodiment, the ubiquitin ligase domain consists of the amino acid sequence set forth in SEQ ID NO:17.

[0154] As mentioned above, those skilled in the art are well aware of how the ligase activity of ubiquitin ligase domains suitable for use in the chimeric proteins of the present invention can be assessed and quantified. By way of example only, this can be achieved using commercially available kits such as those sold by Abcam.

[0155] Fragments or variants of ubiquitin ligase domains, such as the VHL E3 ligase domain or the CHIP UBOX domain, suitable for use in the proteins of the invention may retain at least 75% of the ligase activity of the parent protein, as measured by a suitable ligase activity assay. For example, suitable fragments or variants may retain at least 80%, at least 85%, at least 90%, or at least 95% of the ligase activity of the parent protein. Suitable fragments or variants may retain at least 96%, at least 97%, at least 98%, or at least 99% of the ligase activity of the parent protein. Suitable variants may even retain greater ligase activity than the parent ubiquitin ligase domain from which they are derived.

[0156] Structure of the chimeric protein of the present invention As described above, the present inventors have unexpectedly discovered that the orientation of components within the chimeric proteins of the present invention can dramatically affect their efficacy. Surprisingly, chimeric proteins of the present invention in which a ubiquitin ligase domain is attached to the N-terminal region of an endogenous targeting moiety exhibit greater efficacy in causing clearance of their cellular targets (such as KRAS, NRAS, or LMO2). This is demonstrated in the results described in the Examples.

[0157] The inventors have found that chimeric proteins of the invention in which a ubiquitin ligase domain is attached to the N-terminal region of an endogenous targeting moiety are more effective than proteins with the opposite orientation, both in embodiments using a VHL E3 ligase domain and in embodiments using the UBOX domain of CHIP, and this difference in effectiveness is particularly pronounced in the case of chimeric proteins of the invention comprising a VHL E3 ligase domain.

[0158] Therefore, when the ubiquitin ligase domain is a VHL E3 ligase domain or a fragment or variant thereof, it is a preferred embodiment of the present invention that in the chimeric protein of the present invention the ubiquitin ligase domain is attached to the N-terminal region of an endogenous targeting moiety.

[0159] Without wishing to be bound by any hypothesis, the inventors believe that this orientation of the components within the chimeric proteins of the present invention advantageously improves the accessibility of free lysines, thereby increasing the biological activity of the chimeric proteins of the present invention. Furthermore, this arrangement may reduce steric hindrance between the endogenous targeting moiety, the ligase domain, and the target protein. This may be particularly important in the case of proteins of the present invention that target RAS, since this protein is membrane-bound within the cell.

[0160] The increased efficacy of chimeric proteins of the first aspect of the invention having this structure is particularly notable with respect to the reduction of intracellular KRAS, whether this is achieved by chimeric proteins incorporating a KRAS-specific endogenous targeting moiety or a pan-RAS-specific endogenous targeting moiety. Thus, it is a preferred embodiment of the invention that the chimeric protein comprises a VHL E3 ligase domain attached to the N-terminal region of a KRAS-specific endogenous targeting moiety.

[0161] In another preferred embodiment of the present invention, the chimeric protein comprises a VHL E3 ligase domain attached to the N-terminal region of a pan-RAS-specific endogenous targeting moiety, and such chimeric proteins of the present invention are particularly effective in reducing intracellular levels of NRAS and / or KRAS.

[0162] In the case of the chimeric proteins of the second aspect of the invention, the results described in the Examples show that the orientation of the protein elements is particularly important for chimeric proteins comprising the anti-LMO2 intracellular antibody of SEQ ID NO: 13 and the VHL E3 domain. In this context, it can be seen that the chimeric protein of the invention, "VHL-VH576" (SEQ ID NO: 14), is effective in causing degradation of intracellular LMO2, whereas the protein VH576-VHL, which contains the same components in the opposite orientation, is not.

[0163] The ubiquitin ligase domain and the endogenous targeting moiety may be indirectly attached to each other via a linker sequence. For example, the C-terminal region of the ubiquitin ligase domain may be attached to a linker sequence, which in turn is attached to the N-terminal region of the endogenous targeting moiety. This arrangement is believed to be particularly beneficial in chimeric proteins of the present invention that include a KRAS-specific endogenous targeting moiety.

[0164] A suitable linker sequence may include multiple glycine residues. By way of example only, a suitable linker sequence may include 3 to 7 glycine residues, e.g., 4 glycine residues. A suitable linker sequence may include a combination of glycine and serine residues. For example, a suitable linker sequence may include multiple glycine residues and a single serine residue, such as GGGGS (SEQ ID NO: 19).

[0165] An example of such a linker sequence is found in an exemplary chimeric protein of the invention set forth in SEQ ID NO: 20. Here, the linker sequence used has the amino acid sequence of SEQ ID NO: 19 and constitutes amino acid residues 216-220 of the exemplary chimeric protein of SEQ ID NO: 20.

[0166] Alternatively, the ubiquitin ligase domain and the endogenous targeting moiety can be fused directly to each other, for example, the C-terminal region of the ubiquitin ligase domain can be fused directly to the N-terminal region of the endogenous targeting moiety.

[0167] Suitably, the ubiquitin ligase domain comprises only a single domain: the VHL E3 ligase domain and the UBOX domain of CHIP may both be used in such embodiments (as may single domain fragments or variants thereof).

[0168] Suitably, the endogenous targeting moiety comprises only a single domain. Both DARPins and intrabodies constitute examples of endogenous targeting moieties with a single domain that may be used in such embodiments.

[0169] Suitably, both the ubiquitin ligase domain and the endogenous targeting moiety each comprise only a single domain. The exemplary chimeric protein of the invention set forth in SEQ ID NO: 2 represents an example of a chimeric protein of the invention according to this embodiment.

[0170] Chimeric proteins according to these embodiments of the invention, in which either the ubiquitin ligase domain or the endogenous targeting moiety, or both of these components each comprise only a single domain, offer several advantages. Examples of such advantages include the relative ease with which such chimeric proteins can be expressed at relatively high levels, the high efficiency with which such chimeric proteins can be isolated after expression, and the beneficial solubility of the proteins. It will be appreciated that these benefits apply particularly to embodiments of the chimeric proteins of the invention in which both the ubiquitin ligase domain and the endogenous targeting moiety each comprise only a single domain.

[0171] Exemplary Chimeric Proteins of the Invention A number of chimeric proteins of the invention are described herein, whether according to the first aspect of the invention or the second aspect of the invention.

[0172] The amino acid sequence of an exemplary chimeric protein of the first aspect of the invention, referred to herein as "VHL-DP KRAS," is set forth in SEQ ID NO:20. This protein comprises a VHL E3 ubiquitin ligase domain connected via a linker sequence to the N-terminal region of a K19 DARPin KRAS-specific endogenous targeting moiety. The DNA sequence encoding the chimeric protein of SEQ ID NO:20 is set forth in SEQ ID NO:21.

[0173] The amino acid sequence of an exemplary chimeric protein of the first aspect of the invention, referred to herein as "VHL-K13," is set forth in SEQ ID NO: 22. This protein comprises a VHL E3 ubiquitin ligase domain connected via a linker sequence to the N-terminal region of the K13 DARPin KRAS-specific endogenous targeting moiety. The DNA sequence encoding the chimeric protein of SEQ ID NO: 22 is set forth in SEQ ID NO: 23.

[0174] The amino acid sequence of an exemplary chimeric protein of the first aspect of the invention, referred to herein as "UBOX-DP KRAS," is set forth in SEQ ID NO:24. This protein comprises the UBOX domain of CHIP connected via a linker sequence to the N-terminal region of a K19 DARPin KRAS-specific endogenous targeting moiety. The DNA sequence encoding the chimeric protein of SEQ ID NO:24 is set forth in SEQ ID NO:25.

[0175] The amino acid sequence of an exemplary chimeric protein of the first aspect of the invention, referred to herein as "VHL-P2-E2," is set forth in SEQ ID NO: 26. This protein comprises a VHL E3 ubiquitin ligase domain connected via a linker sequence to the N-terminal region of an anti-KRAS P2-E2 intracellular scFv as a KRAS-specific endogenous targeting moiety.

[0176] The amino acid sequence of an exemplary chimeric protein of the first aspect of the invention, referred to herein as "VHL-P2-F3," is set forth in SEQ ID NO: 27. This protein comprises a VHL E3 ubiquitin ligase domain connected via a linker sequence to the N-terminal region of an anti-KRAS P2-F3 intracellular scFv as a KRAS-specific endogenous targeting moiety.

[0177] The amino acid sequence of an exemplary chimeric protein of the first aspect of the invention, referred to herein as "UBOX-P2-E2," is set forth in SEQ ID NO: 28. This protein comprises the UBOX domain of CHIP connected via a linker sequence to the N-terminal region of the anti-KRAS P2-E2 intracellular scFv as a KRAS-specific endogenous targeting moiety.

[0178] The amino acid sequence of an exemplary chimeric protein of the first aspect of the present invention, referred to herein as "UBOX-P2-F3," is set forth in SEQ ID NO: 29. This protein comprises the UBOX domain of CHIP connected via a linker sequence to the N-terminal region of the anti-KRAS P2-F3 intracellular scFv as a KRAS-specific endogenous targeting moiety.

[0179] The amino acid sequence of an exemplary chimeric protein of the first aspect of the invention, referred to herein as "P2-E2-VHL," is set forth in SEQ ID NO: 30. This protein comprises a VHL E3 ubiquitin ligase domain connected via a linker sequence to the C-terminal region of the anti-KRAS P2-E2 intracellular scFv as a KRAS-specific endogenous targeting moiety.

[0180] The amino acid sequence of an exemplary chimeric protein of the first aspect of the invention, referred to herein as "P2-F3-VHL," is set forth in SEQ ID NO: 31. This protein comprises a VHL E3 ubiquitin ligase domain connected via a linker sequence to the C-terminal region of the anti-KRAS P2-F3 intracellular scFv as a KRAS-specific endogenous targeting moiety.

[0181] The amino acid sequence of an exemplary chimeric protein of the first aspect of the present invention, referred to herein as "P2-E2-UBOX," is set forth in SEQ ID NO: 32. This protein comprises the UBOX domain of CHIP connected via a linker sequence to the C-terminal region of the anti-KRAS P2-E2 intracellular scFv as a KRAS-specific endogenous targeting moiety.

[0182] The amino acid sequence of an exemplary chimeric protein of the first aspect of the present invention, referred to herein as "P2-F3-UBOX," is set forth in SEQ ID NO: 33. This protein comprises the UBOX domain of CHIP connected via a linker sequence to the C-terminal region of the anti-KRAS P2-F3 intracellular scFv as a KRAS-specific endogenous targeting moiety.

[0183] The amino acid sequence of an exemplary chimeric protein of the first aspect of the present invention, referred to herein as "UBOX-iDAb RAS," is set forth in SEQ ID NO: 5. This protein comprises a UBOX domain connected via a linker sequence to the N-terminal region of an anti-pan-RAS intracellular single-domain antibody as a pan-RAS-specific endogenous targeting moiety.

[0184] The amino acid sequence of an exemplary chimeric protein of the first aspect of the present invention, referred to herein as "iDAb RAS-UBOX," is set forth in SEQ ID NO: 34. This protein comprises a UBOX domain connected via a linker sequence to the C-terminal region of an anti-pan-RAS intracellular single-domain antibody as a pan-RAS-specific endogenous targeting moiety. As illustrated in the Examples, this chimeric protein of the present invention is indeed more effective in reducing intracellular levels of RAS (whether KRAS, HRAS, or NRAS) than the UBOX-iDAb RAS protein mentioned above.

[0185] The amino acid sequence of an exemplary chimeric protein of the first aspect of the invention, referred to herein as "VHL-iDAb RAS," is set forth in SEQ ID NO: 35. This protein comprises a VHL E3 ubiquitin ligase domain connected via a linker sequence to the N-terminal region of an anti-pan-RAS intracellular single-domain antibody as a pan-RAS-specific endogenous targeting moiety.

[0186] The amino acid sequence of an exemplary chimeric protein of the second aspect of the invention, referred to herein as "VHL-VH576," is set forth in SEQ ID NO: 14. This protein comprises a VHL E3 ubiquitin ligase domain connected via a linker sequence to the N-terminal region of anti-LMO2 scFv VH576 as an anti-LMO2 endogenous targeting moiety.

[0187] In suitable embodiments, chimeric proteins of the invention may share at least 80% or at least 85% identity with the amino acid sequence of an exemplary chimeric protein set forth in any of SEQ ID NOs: 20, 4, 5, 14, 22, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35. Suitably, such chimeric proteins of the invention may share at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of an exemplary chimeric protein set forth in any of SEQ ID NOs: 20, 4, 5, 14, 22, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35.

[0188] The chimeric proteins of the present invention can comprise the amino acid sequence set forth in any of SEQ ID NOs: 20, 4, 5, 14, 22, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35.

[0189] The chimeric proteins of the present invention can consist of the amino acid sequence set forth in any of SEQ ID NOs: 20, 4, 5, 14, 22, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35.

[0190] It should be noted that the amino acid sequences provided for exemplary chimeric proteins of the invention, SEQ ID NOs: 20, 22, and 24, incorporate the sequence "VDGGS" (SEQ ID NO: 40). Furthermore, the amino acid sequences provided for exemplary chimeric proteins of the invention, SEQ ID NOs: 20, 5, 22, 24, and 35, and the anti-KRAS scFvs of the invention, SEQ ID NOs: 10 and 11, incorporate the sequence "DYKDDDDK" (SEQ ID NO: 41). SEQ ID NO: 40 results from a restriction enzyme used in the preparation of the chimeric proteins of the invention, and SEQ ID NO: 41 is a FLAG tag used to detect the chimeric proteins. It should be understood that a fragment or variant of a chimeric protein or scFv of the invention may lack one or both of SEQ ID NOs: 40 and 41 without any substantial effect on its ability to reduce intracellular levels of RAS (in the case of a chimeric protein of the first aspect of the invention) or bind to KRAS (in the case of an scFv of the invention). Specifically, a fragment or variant of any of the exemplary proteins set forth in SEQ ID NOs: 20, 5, 10, 11, 22, 24, or 35 may lack one or both of SEQ ID NO: 40 and SEQ ID NO: 41.

[0191] Nucleic Acid Molecules of the Invention A third aspect of the invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding a chimeric protein of the invention. This aspect also provides a cell comprising such a nucleic acid molecule. The encoded protein may be a protein according to the first aspect of the invention or a protein according to the second aspect of the invention, or according to any of the embodiments of these aspects described herein.

[0192] Suitably, the nucleic acid molecule of the present invention may comprise DNA. A DNA sequence encoding an exemplary chimeric protein of the first aspect of the present invention as set forth in SEQ ID NO:20 is provided in SEQ ID NO:21.

[0193] Suitably, the nucleic acid molecules of the present invention may comprise RNA.

[0194] The nucleic acid molecules of the invention may be provided in the form of a vector comprising the nucleic acid molecule. Such a vector may be expressed by a cell to produce the chimeric protein of the invention.

[0195] By way of example only, a vector according to such an embodiment may be a lentiviral vector, as further discussed in the Examples.

[0196] Cells comprising nucleic acid according to the invention may be used to produce chimeric proteins according to the invention. Thus, in a further aspect, the invention provides a method of producing a chimeric protein according to the first aspect of the invention, comprising providing a cell comprising nucleic acid according to the third aspect of the invention and maintaining the cell under conditions such that the cell produces a chimeric protein according to the first aspect of the invention.

[0197] As illustrated in the Examples, nucleic acids according to the third aspect of the invention represent suitable agents that may be provided to cancer cells, such as cancer cells of a tumour, to effect treatment of cancer.

[0198] Treatment methods and medical uses A fifth aspect of the present invention provides a method of preventing or treating a RAS-associated disorder, comprising providing a therapeutically effective amount of a chimeric protein of the first aspect of the present invention to a subject in need thereof.

[0199] The RAS-related disorder may be selected from the group consisting of a RAS-related cancer, a RAS-related psychiatric disorder, and a RASopathy.

[0200] RAS-associated cancers may be associated with mutations in RAS isoforms. In such embodiments, suitable chimeric proteins of the invention for use in such treatments may be selected based on the specificity of the endogenous targeting moiety (e.g., using either a pan-RAS-specific endogenous targeting moiety or an endogenous targeting moiety specific for the isoform of RAS associated with the mutation).

[0201] A fifth aspect of the invention also provides a chimeric protein, nucleic acid or pharmaceutical composition according to the first, third or fourth aspect of the invention for use as a medicament in the prevention or treatment of a disorder. Suitably the disorder is selected from RAS-associated cancers and RASopathies.

[0202] In suitable embodiments, the RAS-associated cancer is selected from RAS-associated lung cancer, RAS-associated pancreatic cancer, RAS-associated colorectal cancer, adrenocortical carcinoma, bladder urothelial carcinoma, invasive breast carcinoma, cervical squamous cell carcinoma or endocervical adenocarcinoma, bile duct carcinoma, colon adenocarcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe, renal clear cell carcinoma, papillary renal cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma or paraganglioma, prostate adenocarcinoma, rectal adenocarcinoma, sarcoma, cutaneous melanoma, gastric adenocarcinoma, testicular germ cell tumor, thyroid carcinoma, thymoma, uterine endometrial carcinoma, uterine carcinosarcoma, and uveal melanoma.

[0203] Suitably, the RASopathy to be prevented or treated is selected from capillary malformation-arteriovenous malformation syndrome, autoimmune lymphoproliferative syndrome, cardiofaciocutaneous syndrome, hereditary gingival fibromatosis type 1, neurofibromatosis type 1, Noonan syndrome, Costello syndrome, and Legius syndrome.

[0204] A sixth aspect of the present invention provides a method for preventing or treating a condition associated with expression of LMO2, comprising providing a therapeutically effective amount of a chimeric protein according to the second aspect of the present invention to a subject in need thereof. Conditions associated with expression of LMO2 include T-ALL, LMO2 + breast cancer, LMO2 +Prostate cancer and LMO2 + Diffuse large B-cell lymphoma.

[0205] A sixth aspect of the invention also provides a chimeric protein, nucleic acid or pharmaceutical composition according to the second, third or fourth aspect of the invention for use as a medicament in the prevention or treatment of a condition associated with expression of LMO2, such as T-ALL.

[0206] "Providing" the chimeric protein of the present invention It will be appreciated that the chimeric proteins of the present invention may be "provided" (e.g., to a subject or cell) as desired by administration of the protein itself, suitably incorporated into a pharmaceutical composition of the present invention.

[0207] It should be understood that the chimeric proteins of the present invention (whether according to the first or second aspect of the present invention) achieve their therapeutic effect via intracellular action. Thus, in suitable embodiments, the chimeric proteins of the present invention may be adapted to facilitate entry of the chimeric proteins into cells. Suitable adaptations may include, but are not limited to, those selected from the group consisting of the addition of a protein transduction domain and the addition of an internalizing immunoglobulin g (IgG) sequence. A suitable protein transduction domain may be selected from the group consisting of the antennapedia peptide and the HIV TAT peptide.

[0208] However, it should also be understood that the chimeric protein of the invention may also be provided to a subject by administration and subsequent expression of a nucleic acid molecule according to the third aspect of the invention. Such expression may be permanent. Alternatively, expression may be transient, sufficient to provide a therapeutically effective amount of the chimeric protein of the invention.

[0209] Suitably, the nucleic acid used to provide the chimeric protein of the present invention may be mRNA. Suitably, the nucleic acid used to provide the chimeric protein of the present invention may be provided in the form of a vector or plasmid. Suitably, such a vector may be a viral vector.

[0210] Therapeutic Agents of the Present Invention and Therapeutically Effective Amounts A "therapeutic agent" of the present invention may be a chimeric protein of the present invention, a nucleic acid molecule of the present invention, or a pharmaceutical composition of the present invention (comprising such a chimeric protein or nucleic acid molecule).

[0211] A "therapeutically effective amount" of a therapeutic agent of the invention is an amount sufficient to delay, inhibit, or alleviate any of the clinical symptoms or progression of the disorder being treated.

[0212] A therapeutically effective amount of a therapeutic agent of the invention can be provided in a single administration, or alternatively, a therapeutically effective amount of a therapeutic agent of the invention can be provided in multiple administrations.

[0213] The medical use or method of treatment according to the fifth aspect of the invention may be commenced after a subject has been diagnosed with a RAS-related disorder (such as a RAS-related cancer or RASopathy). Alternatively, the medical use or method of treatment according to the fifth aspect of the invention may be commenced in relation to a subject having symptoms consistent with having a RAS-related disorder (such as a RAS-related cancer or RASopathy).

[0214] Similarly, the medical use or method of treatment according to the sixth aspect of the invention may be commenced after a subject has been diagnosed with a condition associated with expression of LMO2, such as T-ALL. Alternatively, the medical use or method of treatment according to the sixth aspect of the invention may be commenced in relation to a subject having symptoms consistent with having a condition associated with expression of LMO2, such as T-ALL.

[0215] Further Uses of the Chimeric Proteins of the Invention In another aspect, the present invention provides a method of killing cancer cells which express a mutated form of RAS, comprising contacting the cancer cells with an effective amount of a chimeric protein of the first aspect of the invention.

[0216] In a further aspect, the present invention provides a method of reducing the size of a RAS-associated tumor comprising contacting cells of the tumor with an effective amount of a chimeric protein of the first aspect of the invention.

[0217] In a further aspect, the present invention provides a method of reducing intracellular RAS in a cell comprising contacting the cell with an effective amount of a chimeric protein of the first aspect of the invention.

[0218] In a further aspect, the present invention provides a method for killing cancer cells that express LMO2, comprising contacting the cancer cells with an effective amount of the chimeric protein of the second aspect of the present invention. LMO2-expressing cancer cells include T-ALL, LMO2 + breast cancer, LMO2 + Prostate cancer, or LMO2 + It may be associated with diffuse large B-cell lymphoma.

[0219] The chimeric protein of the invention can be provided by administration of the protein or by administration of the nucleic acid molecule of the invention. Either the protein of the invention or the nucleic acid molecule of the invention can be provided by a pharmaceutical composition of the invention.

[0220] "Pharmaceutical composition of the present invention" A fourth aspect of the present invention provides a pharmaceutical composition comprising a chimeric protein of the present invention and / or a nucleic acid encoding a chimeric protein of the present invention and a pharmaceutically acceptable carrier.

[0221] Nanoparticles represent a suitable example of a pharmaceutically acceptable carrier that may be used in the pharmaceutical composition of the present invention.

[0222] The protein may be a protein according to the first aspect of the invention (i.e. the pharmaceutical composition may comprise a chimeric protein comprising a ubiquitin ligase domain and a KRAS-specific endogenous targeting moiety, and / or a nucleic acid molecule comprising a nucleic acid sequence encoding a chimeric protein comprising a ubiquitin ligase domain and a KRAS-specific endogenous targeting moiety).

[0223] Alternatively, the protein may be a protein according to the second aspect of the invention (i.e. the pharmaceutical composition may comprise a chimeric protein comprising a ubiquitin ligase domain and an LMO2-specific endogenous targeting moiety, and / or a nucleic acid molecule comprising a nucleic acid sequence encoding a chimeric protein comprising a ubiquitin ligase domain and an LMO2-specific endogenous targeting moiety).

[0224] Suitable chimeric proteins and / or nucleic acid molecules of the present invention for incorporation into pharmaceutical compositions can be determined with respect to the medical use for which the pharmaceutical composition will be used (following the description of medical uses elsewhere herein).

[0225] The pharmaceutical compositions of the present invention may be formulated for use by any desired route of administration.

[0226] Suitably, the pharmaceutical composition may be formulated for injection. For example, the pharmaceutical composition may be formulated for intravenous administration, such as by intravenous infusion. Such pharmaceutical compositions may contain pharmaceutically acceptable excipients, buffers, etc., conventional in the art.

[0227] The pharmaceutical composition may be in lyophilized form.

[0228] In addition to the chimeric protein or nucleic acid molecule of the present invention or a pharmaceutically acceptable salt thereof and / or the above-mentioned carrier, the pharmaceutical composition of the present invention may optionally contain pharmaceutically acceptable additives. Examples of such additives include emulsifiers (e.g., fatty acids containing 6 to 22 carbon atoms or pharmaceutically acceptable salts thereof, albumin, dextran), stabilizers (e.g., cholesterol, phosphatidic acid), tonicity agents (e.g., sodium chloride, glucose, maltose, lactose, sucrose, trehalose), and pH adjusters (e.g., hydrochloric acid, sulfuric acid, phosphoric acid, acetic acid, sodium hydroxide, potassium hydroxide, triethanolamine). These additives may be used alone or in combination. The content of additives in the pharmaceutical composition of the present invention is reasonably 60% by weight or less, suitably 90% by weight or less, such as 50% by weight or less.

[0229] The pharmaceutical composition of the present invention can be prepared by adding the compound of the present invention (e.g., a chimeric protein or nucleic acid molecule) or a pharmaceutically acceptable salt thereof to a dispersion of a carrier, followed by sufficient stirring. Additives can be added at any appropriate stage, either before or after adding the compound of the present invention or a pharmaceutically acceptable salt or hydrate thereof. Any aqueous solvent can be used to add the compound of the present invention or a pharmaceutically acceptable salt or hydrate thereof, as long as it is pharmaceutically acceptable, and examples include water for injection, distilled water for injection, electrolyte solutions (e.g., physiological saline), and sugar solutions (e.g., glucose solution, maltose solution). Furthermore, in this case, conditions including pH and temperature can be appropriately selected by those skilled in the art.

[0230] Suitable formulations for use in the present invention can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th Edition, 1985. For a brief review of drug delivery methods, see, for example, Langer (Science 249:1527-1533, 1990). WO2007 / 031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents and carriers (incorporated herein by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in WO2007 / 031091.

[0231] The pharmaceutical compositions of the present invention may be formulated into a solution or a lyophilized formulation thereof. Such lyophilized formulations may be prepared by lyophilizing the pharmaceutical composition of the present invention in solution form using standard methods. For example, the pharmaceutical composition of the present invention in solution form may be appropriately sterilized (e.g., by conventional sterilization or sterile filtration techniques) and then dispensed into vials in predetermined amounts. Pre-freezing may then be performed at approximately −40° C. to −20° C. for approximately 2 hours, followed by primary drying under reduced pressure at approximately 0° C. to 10° C., and secondary drying under reduced pressure at approximately 15° C. to 25° C. In addition, in most cases, the vials may be purged with nitrogen gas and then capped, thereby obtaining lyophilized formulations of the pharmaceutical compositions of the present invention.

[0232] Such lyophilized formulations of the pharmaceutical compositions of the present invention can generally be used after reconstitution by adding any appropriate solution (i.e., reconstitution solution). Examples of such reconstitution solutions include water for injection, saline, and other commonly used infusion solutions. The volume of such reconstitution solution varies depending on, for example, the intended use and is not limited in any way, but is reasonably 0.5 to 2 times higher than the volume of the solution before lyophilization, or 500 mL or less.

[0233] The pharmaceutical compositions of the present invention may be administered in any pharmaceutically acceptable manner, which may be selected to be appropriate for the intended method of treatment. Suitable methods include intravenous administration, intraarterial administration, intramuscular administration, subcutaneous administration, oral administration, interstitial administration, transdermal administration, etc. Furthermore, the compositions of the present invention may be in any dosage form, including various types of injections, oral formulations, liquid drops, inhalants, ointments, lotions, etc. [Example]

[0234] Example 1 Chimeric proteins according to the first aspect of the invention 1 background The following studies were conducted to demonstrate the efficacy of the therapeutic agents of the present invention, to investigate their mechanism of action, and to compare their efficacy with appropriate control agents.

[0235] As can be seen, the inventors have found that the chimeric proteins and nucleic acid molecules of the present invention have the ability to inhibit cancer cell growth in vitro and to cause regression of human tumors in vivo. The inhibitory effect of the therapeutic agents of the present invention is selective for cells expressing mutant forms of RAS. Thus, the chimeric proteins and nucleic acid molecules of the present invention represent promising new therapeutic agents for use in the prevention and / or treatment of RAS-related cancers or RASopathies.

[0236] 2 methods 2.1 Cell culture A549, H358, HCT116, HEK293T, HT1080, and MIA PaCa2 cells were grown in DMEM medium (Life Technologies), H1299, HCC827, and T24 cells in RPMI medium (Life Technologies), and MRC5 in MEMα medium (Life Technologies). All cell lines were supplemented with 10% FBS (Sigma) and 1% penicillin / streptomycin (Life Technologies). Cells were grown at 37°C with 5% CO2. Characterization of cell lines was achieved by cloning and sequencing of K, N, and HRAS cDNAs from each lineage. MIA PaCa2 was confirmed by short tandem repeat (STR) DNA profiling service (ATTC). All cell lines were tested to confirm they were mycoplasma-free.

[0237] 2.2 Cell transfection HEK293T cells were seeded in 6-well plates (650,000 cells / well) and transfected with 2 μg of plasmid DNA using Lipofectamine 2000 (Thermo-Fisher; see also the BRET2 Methods section below). HCT116 cells were seeded in 6-well plates (650,000 cells / well). Cells were transfected 24 hours later with 2.5 μg of plasmid, 8.75 μL of Lipofectamine LTX, and 2.5 μg of PLUS™ Reagent (Thermo-Fisher) for an additional 24 hours before Western blot analysis.

[0238] 2.3 Molecular cloning All RAS cDNAs (mutant KRAS, KRAS WT , NRAS Q61H , and HRAS G12V -CAAX) pEF-RLuc8-MCS, pEF-GFP 2 -MCS, or full-length CRAF cloned into pEF-3xFLAG-MCS plasmid S257L pEF-GFP2 - DARPin was cloned into the MCS and expressed as pEF-MCS-GFP 2 or cloned into the pEF-MCS-mCherry plasmid. Cloning details for all these plasmids have been described elsewhere (Bery, N., Cruz-Migoni, A., Bataille, CJ, Quevedo, CE, Tulmin, H., Miller, A., Russell, A., Phillips, SE, Carr, SB, and Rabbitts, TH (2018). "BRET-based RAS biosensors that show a novel small molecule is an inhibitor of RAS-effector protein-protein interactions"; Bery, N., Legg, S., Debreczeni, J., Breed, J., Embrey, K., Stubbs, C., Kolasinska-Zwierz, P., Barrett, N., Marwood, R., Watson, J. et al. (2019). "KRAS-specific inhibition using a DARPin binding to a site in the allosteric lobe". Nat Commun 10, 2607; Bery, N. and Rabbitts, TH (2019). “Bioluminescence Resonance Energy Transfer 2 (BRET2)-Based RAS Biosensors to Characterize RAS Inhibitors”. Curr Protoc Cell Biol).

[0239] Full-length VHL and UBOX domain (amino acids 128–303 from CHIP E3 ligase) were cloned into pEF-GFP 2 -within the PmlI / XhoI sites of MCS or pEF-MCS-GFP 2 GFP was cloned into the NotI / XbaI sites of the plasmid 2The DARPin and iDAb were inserted into pEF-VHL-MCS and pEF-UBOX-MCS using the NotI / XbaI sites, or into pEF-MCS-UBOX and pEF-MCS-VHL using the PmlI / NotI sites. A single FLAG tag was added by PCR to the carboxy terminus of the DARPin degrader vector or the amino terminus of the iDAb degrader vector.

[0240] The VHL-DP KRAS-FLAG, VHL-DP Ctl-FLAG, FLAG-iDAb RAS-UBOX, and FLAG-iDAb Ctl-UBOX sequences were cloned by PCR into the TLCV2 lentivector (Addgene plasmid #87360) using the AgeI / NheI sites. The coding region DNA and protein sequences of these four constructs are shown in Figure 9.

[0241] 2.4 Lentivirus generation For each virus generated, 4.5 x 10 cells were collected per 100 mm dish. 6 HEK293T cells were seeded in 9 mL of complete DMEM (7 × 100 mm dishes per virus generation). 24 hours later, the cells were transfected with 12 μg of the desired TLCV2 construct (i.e., VHL-DP KRAS-FLAG, VHL-DP Ctl-FLAG, FLAG-iDAb RAS-UBOX, and FLAG-iDAb Ctl-UBOX), 8 μg of psPAX2, 3 μg of pMD2.G (the latter being lentiviral packaging and envelope vectors, respectively), and 46 μL of Lipofectamine 2000 (amount for one 100 mm dish). 48 hours after transfection, the supernatant was collected, centrifuged at 640 × g for 5 minutes, filtered (0.45 μm filter), and centrifuged at 48,000 × g for 2 hours at 4°C. Virus from 7 x 100 mm dishes was resuspended in 250 μL of PBS.

[0242] 2.5 Viral Transduction and Macrodrug Expression Cells were transfected with the appropriate lentivirus in 6-well plates for 48 hours at 8 μg.mL -1 Transduction was performed in 1 mL of medium containing 100 μg of polybrene (Sigma, Cat. No. 107689). Transduced cells were selected with puromycin (MP Biomedicals, Cat. No. 194539). The puromycin concentrations used for selection of each cell line are listed below.

[0243] [Table 1]

[0244] Doxycycline (Sigma, Cat. No. D9891) was used to induce the expression of macrodrug E3-ligase or macrodrug GFP. 2 Expression of the fusion or control was induced from the TLCV2 lentivector. Doxycycline induction was performed using a stock solution (100 μg mL -1 ) was added to the culture medium and incubation continued at 37° C. Proteasome inhibition was performed using epoxomicin (Sigma, Cat. No. E3652) at 0.8 μM for 18 hours, followed by protein analysis.

[0245] 2.6 Establishment of H358- and H1299-FLuc stable clones H358 and H1299 cells expressing VHL-DP KRAS and iDAb RAS-UBOX were transfected with pEF-FLuc using Lipofectamine LTX according to the manufacturer's recommendations. After 48 h of transfection, cells were transfected with 1 mg mL -1 The cells were selected with 1000 kJ of G418 (Sigma, Cat. No. A1720) and clones were picked and characterized.

[0246] 2.7 Quantitative Real-Time PCR 0.8 × 10 H358 cells 6 Cells were plated in a 6-well plate at 0.2 μg / mL. After 24 hours, the cells were treated with 0.2 μg / mL -1Cells were treated with or without 100 mg of doxycycline for 24 hours. Cells were lysed in 1 mL of TRIzol Reagent (Life Technologies) per 6 wells. Total RNA was extracted using Direct-zol™ RNA miniprep (Zymo Research) according to the manufacturer's protocol. RNA was eluted with 15 μL of nuclease-free HO. cDNA was synthesized from 1.5 μg of total RNA per condition using SuperScript II reverse transcriptase (Invitrogen). Real-time PCR was performed using 400 nM primers diluted in 12.5 μL of Fast SYBR Green Master Mix (Applied Biosystems) to a final volume of 25 μL. RT-PCR experiments were performed on a 7500 Fast (Applied Biosystems) using the following protocol: 95°C for 20 seconds, 40 cycles of 95°C for 3 seconds, and 60°C for 30 seconds. qRT-PCR samples were performed in duplicate from two independent experiments. GAPDH was used for normalization.

[0247] The primers used in this study are as follows: DUSP6For: 5' CTCGGATCACTGGAGCCAAAAC 3' (SEQ ID NO: 36) DUSP6Rev: 5' GTCACAGTGACTGAGCGGCTAA 3' (SEQ ID NO: 37) GAPDHFor: 5' GTCTCCTCTGACTTCAACAGCG 3' (SEQ ID NO: 38) GAPDHRev: 5' ACCACCCTGTTGCTGTAGCCAA 3' (SEQ ID NO: 39)

[0248] 2.8 BRET2 Assay and Measurement For all BRET experiments (titration curves and competition assays), 650,000 HEK293T cells were seeded into each well of a 6-well plate. After 24 h at 37°C, the cells were transfected with a total of 1.6 μg of DNA mix (containing donor + acceptor ± competitor plasmids) using Lipofectamine 2000 transfection reagent (Thermo-Fisher). After 24 h, the cells were detached, washed with PBS, and seeded into white 96-well plates (clear bottom, PerkinElmer) in OptiMEM phenol red-free medium supplemented with 4% FBS. The cells were incubated for an additional 20–24 h at 37°C before reading the BRET assay. A detailed protocol for the BRET assay has been published elsewhere.

[0249] Immediately after injecting the cells with coelenterazine 400a substrate (10 μM final) (Cayman Chemicals), the BRET2 signal was determined using the luminescence module on a CLARIOstar instrument (BMG Labtech).

[0250] 2.9 2D and 3D cell proliferation assays Cells were seeded into white 96-well plates (clear bottom, PerkinElmer, catalog no. 6005181) for 2D adherent growth assays or into ultra-low attachment 96-well plates (Corning, catalog no. 7007) for 3D spheroid assays. All cell seedings were optimized to maintain linear growth over the duration of the assay. The following day, 10x doxycycline solution was prepared (0.1–0.2 μg mL). -1 for a final concentration of 1-2 μg.mL -1). Cells were incubated in the presence of doxycycline for 6 days. Cell viability was analyzed every 2 days using CellTiter-Glo (Promega, Cat. No. G7572) by incubating with the cells for 15 minutes. Cell viability was determined by normalizing doxycycline-treated cells to untreated cells. Cells from ultra-low attachment plates were read on a CLARIOstar instrument after transfer into white 96-well plates (Greiner, Cat. No. 655075).

[0251] 2.10 Cell growth assay of H358-FLuc and H1299-FLuc clones 40,000 H358-FLuc (iDAb RAS-UBOX or VHL-DP KRAS) or 60,000 H1299-FLuc (iDAb RAS-UBOX or VHL-DP KRAS) cells were seeded per well of a 6-well plate (each condition was performed in duplicate). After 24 hours, medium alone (-dox) or 0.2 μg mL -1 Medium containing doxycycline (+dox) was added to each well. Viable cells were counted every two days using a hemocytometer and trypan blue.

[0252] 2.11 Immunoprecipitation assay HEK293T cells were cultured for 24 hours in a culture medium containing pEF-3×FLAG-KRAS WT or pEF-3×FLAG-KRAS G12D and pEF-DARPin-GFP 2The cells were transfected with the plasmid. The cells were washed once with PBS and lysed for 20 minutes in immunoprecipitation buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 10 mM MgCl2, 10% glycerol, and 0.5% Triton X-100) supplemented with protease inhibitors (Sigma, catalog no. P8340) and phosphatase inhibitors (Thermo-Fisher, catalog no. 1862495). The lysate was centrifuged for 15 minutes, and the supernatant was incubated with protein G magnetic beads (Life Technologies, catalog no. 10004D) and anti-FLAG antibody (Sigma, catalog no. F3165). The complexes were incubated for 4 hours at 4°C with rotation. After washing the beads five times with IP buffer, bound proteins were eluted with 1x loading buffer and separated on a 12.5% ​​SDS-PAGE.

[0253] 2.12 Western blot analysis Cells were washed once with PBS and lysed in SDS-Tris buffer (STB: 1% SDS, 10 mM Tris-HCl, pH 7.4) supplemented with protease inhibitors (Sigma) and phosphatase inhibitors (Thermo-Fisher). The cell lysate was sonicated using a Branson sonifier.

[0254] Mouse tumors were lysed in radioimmunoprecipitation assay (RIPA) buffer (150 mM NaCl, 1.0% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0) using 200 μL of lysis buffer at a fixed ratio for 10 mg of tumor. The tissue was homogenized using an electric homogenizer (T10 basic ULTRA-TURRAX, IKA) until liquefied. The lysate was incubated on ice for 1 hour, then centrifuged at 16,100 × g at 4°C, and the supernatant was collected. Protein concentrations from cell and tumor lysates were determined using the Pierce BCA Protein Assay Kit (Thermo-Fisher). Equal amounts of protein (20–50 μg) were separated on 10 or 12.5% ​​SDS-PAGE and subsequently transferred to PVDF membranes (GE Healthcare). Membranes were blocked with either 10% nonfat milk (Sigma, Cat. No. 70166) or 10% BSA (Sigma, Cat. No. A9647) in TBS-0.1% Tween 20 and incubated with primary antibodies overnight at 4°C. After washing, membranes were incubated with horseradish peroxidase-conjugated secondary antibodies for 1 hour at 20°C. Membranes were washed with TBS-0.1% Tween and developed using Clarity Western ECL substrate (Bio-Rad) and CL-XPosure film (Thermo-Fisher) or a ChemiDoc XRS+ imaging system (Bio-Rad).

[0255] The primary antibodies were anti-phospho-p44 / 22MAPK (pERK1 / 2) (1 / 4000, CST, Catalog No. 9101S), anti-p44 / 42MAPK (total ERK1 / 2) (1 / 1000, CST, Catalog No. 9102S), anti-phospho-MEK1 / 2 (1 / 2000, CST, Catalog No. 9154S), anti-MEK1 / 2 (1 / 500, CST, Catalog No. 4694S), anti-phospho-AKT S473 (1 / 1000, CST, Catalog No. 4058S), anti-AKT (1 / 1000, CST, Catalog No. 9272S), anti-pan-RAS (1 / 200, Millipore, Catalog No. OP40), and anti-KRAS (1 / 100, Santa Cruz). Antibodies against cleaved PARP (1 / 1000, Santa Cruz Biotechnologies, Catalog No. sc-30), anti-NRAS (1 / 100, Santa Cruz Biotechnologies, Catalog No. sc-31, now discontinued, and 1 / 3000, Abcam, Catalog No. ab77392), anti-HRAS (1 / 500, Proteintech, Catalog No. 18295-1-AP), anti-cleaved PARP (1 / 1000, CST, Catalog No. 9541), anti-cleaved caspase 3 (1 / 500, CST, Catalog No. 9664), anti-GFP (1 / 500, Santa Cruz Biotechnologies, Catalog No. Antibodies include anti-mouse IgG HRP-linked (CST, Catalog No. 7076), anti-rabbit IgG HRP-linked (CST, Catalog No. 7074), and anti-goat IgG HRP-linked (Santa Cruz Biotechnologies, Catalog No. 2354).

[0256] 2.13 Human tumor xenograft assay in nude mice 4.5 × 10 cells expressing either iDAb RAS-UBOX clone B2 or VHL-DP KRAS clone F7 65 x 10 H358-FLuc or 5 x 10 expressing either iDAb RAS-UBOX clone E1 or VHL-DP KRAS clone E5 6 H1299-FLuc was injected subcutaneously into the left flank of 5-7 week-old female CD-1 athymic nude mice (Charles River). Mice were provided with normal chow and water until approximately 18 days after injection, when their subcutaneous tumors reached a diameter of 3-4 mm (2-3 mm for H1299 cells). Mice were divided into two groups of 5 mice (3 mice for H1299-FLuc / VHL-DP KRAS), one of which received 2 mg / mL of H1299-FLuc in drinking water (20% black currant juice). -1 ) and doxycycline diet (200 mg.kg -1 Dox (Sigma) was provided via Special Diets Services. On the first day of doxycycline treatment, mice received 100 μL of 4 mg / mL doxycycline in sterile 0.9% aqueous NaCl solution. -1 Note that 1000 mg of doxycycline was injected intraperitoneally. One mouse from each of the H358-FLuc / VHL-DP KRAS, H358-FLuc / iDAb RAS-UBOX, and H1299-FLuc / VHL-DP KRAS-injected control groups without doxycycline was excluded from analysis due to lack of tumor development. Subcutaneous tumor growth was monitored three times weekly by measurement with a digital caliper (Thermo-Fisher) or by bioluminescence as described below. Tumor volume was calculated using the formula: tumor volume = (L × W 2 ) / 2, where L and W refer to the length and width of the tumor, respectively. Animals were culled according to license restrictions. After humane sacrifice, mice were dissected for tumor sampling.

[0257] 2.14 In vivo bioluminescence imaging (BLI) Bioluminescence was measured noninvasively in implanted subcutaneous tumors using an IVIS Lumina imaging system (PerkinElmer) following injection of the luciferase substrate D-luciferin. All images were taken at 150 mg / kg. -1Add 150 µL of D-luciferin (30 mg mL in DPBS) corresponding to 100 mg of D-luciferin by weight. -1 Images were taken after intraperitoneal injection of a stock solution of 1000 mg ...

[0258] 2.15 Quantitative and Statistical Analysis Quantitation was performed using Image Lab (Biorad), Prism 8.0 (GraphPad Software), or Living Image (PerkinElmer). BRET titration curves and statistical analysis were performed using Prism 8.0 (GraphPad Software). Data are typically expressed as mean ± SD or SEM as specified in the figure legends. Unless otherwise specified in the figure legends, statistical analysis was performed using an unpaired, two-tailed Student's t-test. ns indicates non-significant; *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001.

[0259] 3 Results 3.1 Engineering KRAS-specific and pan-RAS degraders The addition of warheads to intracellular antibodies and other macromolecular reagents is an implicit strategy for increasing efficacy, for example, by translocating target proteins to the proteasome for degradation. Intracellular single domains have been functionalized with E3 ligase domains, such as the Hsc70-interacting protein (CHIP) ligase, VHL, or the carboxyl-terminal UBOX domain of FBOX. However, there is nothing in the literature that allows prediction of which E3 ligase will be applicable in a particular case or how various components in a protein should be engineered relative to each other (N- or C-terminal fusions with E3 ligases). We tested both UBOX domains and VHL E3 ligase fused to specific DP KRAS or iDAb RAS. Controls included a mutant DARPin (herein DP Ctl) in which the RAS-binding tryptophan repeats were mutated to glycine and alanine residues, or an unrelated iDAb (herein iDAb Ctl). All proteins were engineered to have either N- or C-terminal fusions with the respective E3 ligase. Therefore, DP Ctl does not bind to KRAS (mutant and WT), as shown by BRET donor saturation assays (Figure 9a) and co-immunoprecipitation (Figure 9b). Furthermore, like the negative control DARPin E3.5, DP Ctl mutants did not bind to mutant KRAS / CRAF in BRET competition assays. FL It does not inhibit the interaction (Fig. 9c) or dimerization of mutant KRAS (Fig. 9d).

[0260] HCT116 cells (KRAS G13DWe transiently transfected iDAb RAS-UBOX and UBOX-iDAb RAS constructs with KRAS, NRAS, and HRAS protein levels by Western blot. Both the iDAb RAS-UBOX and UBOX-iDAb RAS constructs induced a decrease in KRAS, NRAS, and HRAS protein levels, with iDAb RAS-UBOX showing higher degradation (Fig. 1a, b). Conversely, only slight RAS turnover was detected with a C-terminal VHL fusion to iDAb RAS (i.e., iDAb RAS-VHL), whereas some degradation was observed with an N-terminal VHL fusion (i.e., VHL-iDAb RAS) (Fig. 1c, d). Similarly, UBOX fusions with DP KRAS showed only a slight effect on RAS protein levels (Fig. 1a, b). However, when a VHL fusion was engineered at the N-terminus of DP KRAS (VHL-DP KRAS), a substantial reduction in KRAS protein was observed in transfected HCT116 cells (Fig. 1c, d). The VHL-DP KRAS fusion attenuated KRAS protein levels to a much greater extent than the DP KRAS-VHL fusion (Fig. 1d). An important observation is that, unlike iDAb RAS-UBOX, VHL-DP KRAS depleted only KRAS, but not NRAS or HRAS, due to the KRAS-specific binding properties of this DARPin (Fig. 1c, d). These degradation effects were proteasome-dependent, as epoxomicin treatment (a proteasome inhibitor) prevented RAS degradation by iDAb-UBOX and VHL-DP KRAS (Fig. 1e, f). Thus, functionalization of iDAb RAS with the UBOX domain (herein referred to as the "pan-RAS degrader") and functionalization of DP KRAS with VHL (herein referred to as the "KRAS degrader") promotes degradation of RAS and KRAS, respectively (sequences in Figure 1g, Figure 9e-h).

[0261] 3.2 KRAS degrading agents specifically deplete KRAS in human cancer cell lines We investigated the effects of stably transduced H358 (lung, KRAS G12CWe compared the KRAS specificity of KRAS degraders and pan-RAS degraders in cancer cell lines. The engineered proteins were expressed in lentiviral vector-transduced cells using a Tet-On inducible system (i.e., degrader expression is induced after doxycycline treatment). We first characterized the degrader properties in these H358 cells using increasing doses of doxycycline induction. The KRAS degrader demonstrated depletion of only KRAS, while the pan-RAS degrader knocked down all three K / N / HRAS proteins in a dose-dependent manner (Fig. 2a, b). No effect was observed with the control degrader (Fig. 2a, b). These results confirmed the specificity of degradation observed in the transient transfection experiments shown in Fig. 1. We analyzed the kinetics of RAS protein degradation following doxycycline induction of either the pan-RAS or KRAS degraders and the resulting effects on RAS-dependent downstream signaling. Synthesis of degrader proteins (detected by Western blot with anti-FLAG antibody) could be observed as early as 2 h after doxycycline treatment (Fig. 2c, d). Expression of the pan-RAS degrader was followed by a similar profile of loss of K, N, and HRAS 2 h later (Fig. 2c). However, expression of the KRAS degrader reduced only KRAS levels, and the decrease in KRAS coincided with degrader expression (Fig. 2d). As expected, loss of AKT, MEK, and ERK phosphorylation was also observed in parallel with the synthesis of either degrader (Fig. 2e, f). Treatment of cells with the proteasome inhibitor epoxomicin confirmed that RAS degradation was proteasome-dependent (Fig. 10a). Furthermore, consistent with potent inhibition of MAPK pathway activity, both pan-RAS and KRAS degraders reduced the expression of the MAPK pathway downstream transcript DUSP6 (Fig. 10b). Our data demonstrate that KRAS-specific degraders cause rapid depletion of KRAS, coupled with inhibition of RAS downstream signaling and sustained degradation of KRAS throughout the duration of doxycycline treatment (as long as 72 hours). Pan-RAS degraders exhibit similar properties.

[0262] In addition to H358, we also investigated several stably transduced cancer cell lines, namely MIA PaCa2 (pancreatic, KRAS G12C ), A549 (lung, KRAS G12S ), H1299 (lung, NRAS Q61K ), HT1080 (fibrosarcoma, NRAS Q61K ), T24 (bladder, HRAS G12V ), HCC827 (lung, RAS WT but EGFR mutated), and non-transformed cell lines: MRC5 (non-transformed lung fibroblasts, RAS WT The specificity of degradation of both degraders in the RAAS-expressing cells was also assessed. The engineered proteins were again expressed using the Tet-On inducible system in lentiviral vector-transduced cells. Degrader expression was detected in Western blots using an anti-FLAG tag antibody after induction with doxycycline (Fig. 3), resulting in efficient knockdown of K, N, and HRAS in cells expressing pan-RAS (Fig. 3a), or degradation of KRAS alone when the KRAS degrader was expressed (Fig. 3b). This occurred in all cell lines tested.

[0263] 3.3 KRAS degraders specifically inhibit RAS-dependent signaling in mutant KRAS cell lines The kinetics of RAS degradation in H358 cells was examined to determine the onset and duration of the effect on RAS signaling (Figure 2). We further assessed the impact of pan-RAS or KRAS-only degradation on RAS downstream signaling pathways in a panel of cell lines using Western blot analysis 72 hours after induction with doxycycline. Pan-RAS degraders induced loss of RAS protein, which resulted in inhibition of RAS signaling (either the PI3K and / or MAPK pathways). This was determined by reduced phosphorylation of AKT, MEK, and / or ERK in all cell lines, although not all proteins in the MAPK and PI3K pathways were similarly affected (Figures 4 and 5i). Loss of RAS signaling was also observed in two lines without RAS gene mutations (Figures 4g, h), while the control iDAb Ctl-UBOX had no effect (Figures 4a-h). Conversely, KRAS degraders In cells with mutant KRAS, namely H358, MIA PaCa2, and to a lesser extent A549, it inhibited only the phosphorylation of AKT, ERK, and MEK (Fig. 5a-c, i). In fact, it had no effect on cells with NRAS mutations (H1299 and HT1080) or HRAS mutations (T24) or cells without mutant RAS (HCC827 and MRC5) (Fig. 5d-h). VHL-DP Ctl had no effect (Fig. 5). These data are quantified in Fig. 5i. GFP 2 Expression of the pan-RAS iDAb fused to GFP resulted in reduced RAS levels in H358, A549, and T24 (Fig. 11a-h). 2 KRAS-specific DARPin fused to iDAb RAS-GFP had no effect on RAS protein levels (Fig. 12a-h). 2 had similar inhibitory output on the RAS downstream pathway as its degrader version (Fig. 11a-h and Fig. 12i for quantification). 2While KRAS-specific DARPins fused to KRAS also reduced RAS signaling in mutant KRAS cells (H358, MIA PaCa2, and A549, Figures 12a-c, i), they differentially altered RAS signaling in other cell lines (Figures 12d-i). Indeed, they increased MEK and ERK phosphorylation while reducing or having no effect on pAKT levels in H1299, HT1080, and T24 cells with mutant NRAS or HRAS (Figures 12d-f, i), and attenuated pERK and pAKT in HCC827 and MRC5 cell lines lacking RAS mutations (Figures 12g-i). Because KRAS-specific DARPins interact with KRAS-GTP and KRAS-GDP and may be GAP inhibitors, increased pMEK / pERK signaling may be related to KRAS. WT This may be due to its GAP inhibitory mechanism against β-glucan.

[0264] 3.4 KRAS degraders specifically inhibit the growth of mutant KRAS cell lines Our data demonstrated that the engineered KRAS-specific DARPin K19 possesses focused specificity toward mutant KRAS cells compared to the parent DARPin. We assessed the effect of KRAS or pan-RAS degrading on the proliferation of our panel of cell lines using inducible macrodrugs by testing proliferation in 2D adhesive and 3D spheroid assays. The pan-RAS degrading agent inhibited the proliferation of all cell lines, including MRC5, which is not transformed and has wild-type RAS, in both 2D adhesive and 3D spheroid assays (Figures 6a-h). This was in contrast to the parent iDAb RAS-GFP in 2D adhesive proliferation assays. 2 This was also observed in the 2D adhesion and 3D spheroid assays (Fig. 6a-c), but not in cancer cell lines with mutant NRAS or HRAS (Fig. 6d-f). WTThe proliferation of HCC827 and MRC5 cells was also not altered (Fig. 6g, h). These data are consistent with the effects of KRAS degraders described in Fig. 5 on the RAS signaling pathway. In contrast, the parental DARPin KRAS-GFP 2 pan-RAS iDAb-GFP 2 and pan-RAS degraders, reduced 2D adherent growth of all stable cell lines (Figure 6 and Figures ​(Figures13a-h)), supporting the benefit of engineering DARPin KRAS into a KRAS-specific degrader.

[0265] Both pan-RAS and KRAS degraders inhibited proliferation in H358 cells by inducing programmed cell death, as evidenced by the apoptotic markers cleaved PARP and cleaved caspase-3, which began 16–24 h after doxycycline addition, with the highest response occurring at 72 h (Figure 7a). Therefore, we assessed the induction of apoptotic markers after 72 h of degrader expression in all stable cell lines. KRAS degraders and pan-RAS induced caspase-3 and PARP cleavage in H358 and MIA PaCa2 cell lines, as well as in A549 cells, upon expression of the pan-RAS degrader alone (Figure 7b). Other cell lines showed little cleaved PARP or caspase-3 compared to the negative control (Figure 7b, c). These results suggest that in 2D adherent culture methods, KRAS degrading agents blocked the proliferation of cells expressing mutant KRAS by inducing apoptosis in KRAS-dependent cells (i.e., H358 and MIA PaCa2), but not in KRAS-independent cells (A549).

[0266] 3.5 KRAS degraders induce regression of mutant KRAS tumors in vivo Finally, we determined whether the degraders could be effective in a subcutaneous xenograft mouse model. From our previously established H358 and H1299 stable cell lines, we isolated unique clones of the pan-RAS / KRAS degrader that additionally expressed firefly luciferase (FLuc) for in vivo tumor detection. These individual clones were characterized in vitro by Western blot and growth curve analysis. Induction of expression of the pan-RAS and KRAS degraders in H358 inhibited the RAS downstream signaling pathway (Fig. 14a) and strongly inhibited cell growth (Fig. 14b). While only the pan-RAS degrader had an inhibitory effect on the RAS signaling pathway and cell growth in H1299 cells (Fig. 14a, c), the KRAS degrader had no effect on either in H1299 cells (Fig. 14a, c).

[0267] The in vivo growth of doxycycline-induced cells was examined by subcutaneously injecting cells into nude mice to establish xenograft models. While the pan-RAS degrader significantly inhibited H1299 tumor burden (Figure 14d), the KRAS degrader caused little inhibition (Figure 14e). However, expression of both pan-RAS and KRAS degraders in mutant KRAS H358 xenografts induced tumor regression after only 3 days of doxycycline treatment, and all tumors substantially regressed after 20 days of treatment (Figures 8a-d). Because doxycycline-treated tumors regressed and could not be resected after 20 days of treatment, to analyze RAS downstream signaling in H358 xenografts, we treated two mice with doxycycline for 48 hours and then performed Western blot analysis of the tumors compared with untreated tumors. After 48 hours of doxycycline, a prolonged decrease in MEK and ERK phosphorylation was observed in H358 pan-RAS and KRAS degraders, paralleling degradation of their RAS targets (Fig. 8e, f). In contrast, in H1299 tumors, after 20 days of treatment, decreased phosphorylation of MEK and ERK kinases was detected in tumors expressing the pan-RAS degrader (Fig. 14f), but not in tumors expressing the KRAS degrader (Fig. 14g).

[0268] In conclusion, our in vitro and in vivo data demonstrate that KRAS degrading agents inhibit endogenous KRAS. WT and KRAS 突然変異 This indicates that despite depleting both, it inhibits only cancer cells expressing mutant KRAS.

[0269] 4 Consideration Effective cancer therapy based on the development of reagents against intracellular targets, including families of proteins, should ideally incorporate specific targeting of individual family members. The RAS family is a key example, with three isoforms present, each of which can undergo mutations in various tumor types. The KRAS protein is the most frequently mutated isoform in human cancers, primarily resulting from base alterations that result in single amino acid changes spread throughout the protein but located within mutational hotspots. Targeting mutant KRAS is therefore challenging due to the number of different mutations and the high sequence identity (>80%) between the three RAS isoforms. However, our recently described KRAS-specific DARPin demonstrates the feasibility of specifically targeting both wild-type and mutant KRAS by binding to the allosteric lobe of RAS. The addition of warheads to intracellular antibodies, such as fusion of procaspases to induce apoptosis or FBOX proteins to trigger protein degradation, provides a mechanism by which macromolecules can be converted into potent macrodrugs. PROTAC small molecules have been described that inhibit KRAS through covalent interactions between the compound and the protein. G12C Although specific, these are endogenous KRAS G12C Furthermore, although affinity-directed protein missile systems have been shown to degrade KRAS and HRAS, no isoform-specific RAS degraders have been found to date.

[0270] In this study, we demonstrated a generalized approach to KRAS inhibition by engineering a KRAS-specific DARPin as a fusion protein with an E3 ligase to induce proteasomal targeting and subsequent degradation of KRAS. We engineered a KRAS-specific DARPin bearing our E3 ligase warhead and compared it with an engineered pan-RAS-binding iDAb. We found that RAS degradation could be easily achieved with either macrodrug, but the specific E3 ligase and the terminal position of the E3 ligase on the macrodrug were important. Interestingly, the VHL E3 ligase was most efficient in binding KRAS to the DARPin, while the UBOX domain from the CHIP E3 ligase bound to the pan-RAS iDAb. Both degraders enabled efficient depletion of endogenous RAS protein in multiple cell lines (i.e., lung, pancreas, bladder, and connective tissue), suggesting the broad applicability of this strategy. Furthermore, we demonstrated high specificity of the KRAS degraders, depleting only KRAS without affecting HRAS or NRAS protein levels in all cell lines tested. As previously described, we also observed that degrader technology can modify the potency and / or selectivity of parent binders using DP KRAS, as shown herein. Furthermore, KRAS degraders inhibited only mutant KRAS cancer cells, while pan-RAS degraders did not show specificity for any RAS isoform mutant proteins.

[0271] The key finding of our study is that KRAS degrading agents inhibit KRAS WT RAS depletion WTThese data are supported by previous studies showing that expression of only one RAS in RAS-null mouse embryonic fibroblasts did not interfere with their ability to proliferate, whereas ablation of only three RAS isoforms arrested the growth of these engineered fibroblasts. This conclusion has been confirmed in multiple cell lines using the pan-RAS degrading agents described herein, demonstrating that RAS depletion occurs in such a way that loss of expression of one (or two) of the isoforms can be overcome through expression of the other isoforms. WT These findings strongly suggest the existence of a compensation mechanism between the three RAS isoforms in cells. Furthermore, our data highlight the in vivo efficacy of our KRAS degrading agent in the rapid regression of mutant KRAS tumors. Therefore, targeted degradation of KRAS is an attractive therapeutic strategy for cancers that harbor KRAS mutations and are not limited to any particular codon change.

[0272] Our study demonstrates the proof of concept for the development of pan-KRAS-specific degraders as viable therapeutic agents in any cancer with a KRAS mutation. G12C As has been done previously with inhibitors, the design of combination therapies can be accomplished to enhance the impact of KRAS degraders on these tumors.

[0273] Example 2 Chimeric proteins according to the second aspect of the invention LMO2 encodes an 18-kDa polypeptide containing two zinc-binding LIM domains. These domains form the interface for binding with class II basic helix-loop-helix (bHLH) transcription factors, such as TAL1 / E2A and GATA. Furthermore, these two DNA-binding complexes are bridged by the scaffolding protein LIM domain binding 1 (LDB1), which binds LMO2 to different interfaces. This complex regulates the expression of genes important for the development and maintenance of T-ALL. LMO2 is overexpressed in more than 50% of T-ALL cases, as well as in a subset of breast and prostate tumors and some diffuse large B-cell lymphomas. A general review of the role of LMO2 in normal and cancerous cells is known to those skilled in the art.

[0274] HEK293 cells (clones 18 and 22) stably expressing LMO2 were transfected with the indicated plasmid DNA constructs using Lipofectamine LTX. 2.5 μg of DNA was transfected per well of a 6-well plate for 24 hours. Cells were washed once with PBS and lysed in SDS-Tris buffer (STB: 1% SDS, 10 mM Tris-HCl, pH 7.4) supplemented with protease inhibitors (Sigma) and phosphatase inhibitors (Thermo-Fisher). Cell lysates were sonicated using a Branson sonifier.

[0275] Protein concentrations were determined using the Pierce BCA Protein Assay Kit (Thermo-Fisher). Equal amounts of protein (20 μg) were separated on a 12.5% ​​SDS-PAGE gel and then transferred onto a PVDF membrane (GE Healthcare). The membrane was blocked with 10% nonfat milk in TBS-0.1% Tween 20 (Sigma, Cat. No. 70166) and incubated overnight at 4°C with primary antibodies: anti-FLAG (1 / 2000, Sigma, Cat. No. F3165), anti-LMO2 (1 / 1000, R&D, Cat. No. AF2726), and anti-β-actin (1 / 5000, Sigma, Cat. No. A1978). After washing, the membrane was incubated with horseradish peroxidase-conjugated secondary antibodies for 1 hour at 20°C. The membrane was washed with TBS-0.1% Tween and developed using Clarity Western ECL substrate (Bio-Rad) and a ChemiDoc XRS+ imaging system (Bio-Rad).

[0276] The data show a substantial reduction (50%) in LMO2 protein levels when VHL-VH576 is expressed in HEK293 cells stably expressing LMO2 compared to non-transfected conditions and other E3 ligase-VH576 fusions. Note that GFP2-VH576 protects LMO2 from physiological degradation, thereby increasing LMO2 protein levels compared to non-transfected conditions.

[0277] [Table 2A]

[0278] [Table 2B]

[0279] SEQ ID NO: 1 Amino acid sequence of WT human KRAS

[0280] [ka]

[0281] SEQ ID NO: 2 Amino acid sequence of WT human HRAS

[0282] [ka]

[0283] SEQ ID NO: 3 Amino acid sequence of WT human NRAS

[0284] [ka]

[0285] SEQ ID NO:4 Amino acid sequence of iDAb RAS, an anti-pan-RAS intracellular single domain antibody

[0286] [ka]

[0287] SEQ ID NO:5 Amino acid sequence of UBOX-iDAb RAS

[0288] [ka]

[0289] SEQ ID NO:6 Amino acid sequence of anti-KRAS DARPin K19 ("DP KRAS")

[0290] [ka]

[0291] SEQ ID NO:7 DNA encoding DARPin K19

[0292] [ka]

[0293] SEQ ID NO:8 Amino acid sequence of anti-KRAS DARPin K13

[0294] [ka]

[0295] SEQ ID NO:9 DNA encoding K13

[0296] [ka]

[0297] SEQ ID NO: 10 Amino acid sequence of anti-KRAS scFv P2-E2

[0298] [ka]

[0299] SEQ ID NO: 11 Amino acid sequence of anti-KRAS scFv P2-F3

[0300] [ka]

[0301] SEQ ID NO: 12 Amino acid sequence of WT human LMO2

[0302] [ka]

[0303] SEQ ID NO: 13 Amino acid sequence of anti-LMO2 VH576

[0304] [ka]

[0305] SEQ ID NO: 14 Amino acid sequence of VHL-VH576, an exemplary chimeric protein of the second aspect of the invention

[0306] [ka]

[0307] SEQ ID NO: 15 Amino acid sequence of the VHL E3 domain

[0308] [ka]

[0309] SEQ ID NO: 16 DNA encoding the VHL E3 domain

[0310] [ka]

[0311] SEQ ID NO: 17 Amino acid sequence of the UBOX domain of CHIP

[0312] [ka]

[0313] SEQ ID NO: 18 DNA sequence encoding the UBOX domain of CHIP

[0314] [ka]

[0315] SEQ ID NO: 19 Exemplary Linker Amino Acid Sequences GGGGS

[0316] SEQ ID NO: 20 Amino acid sequence of VHL-DP KRAS (also called VHL-K19), an exemplary chimeric protein of the first aspect of the invention The KRAS-binding tryptophan repeats within the KRAS-specific endogenous targeting moiety are underlined.

[0317] [ka]

[0318] SEQ ID NO: 21 DNA sequence encoding the protein VHL-DP KRAS

[0319] [ka]

[0320] SEQ ID NO: 22 Amino acid sequence of VHL-K13, an exemplary chimeric protein of the first aspect of the invention

[0321] [ka]

[0322] SEQ ID NO: 23 DNA sequence encoding VHL-K13

[0323] [ka]

[0324] SEQ ID NO: 24 Amino acid sequence of UBOX-DP-KRAS, an exemplary chimeric protein of the first aspect of the present invention

[0325] [ka]

[0326] SEQ ID NO: 25 DNA sequence encoding UBOX-DP-KRAS

[0327] [ka]

[0328] SEQ ID NO: 26 Amino acid sequence of VHL-P2-E2, an exemplary chimeric protein of the first aspect of the invention

[0329] [ka]

[0330] SEQ ID NO: 27 Amino acid sequence of VHL-P2-F3, an exemplary chimeric protein of the first aspect of the invention

[0331] [ka]

[0332] SEQ ID NO: 28 Amino acid sequence of UBOX-P2-E2, an exemplary chimeric protein of the first aspect of the present invention

[0333] [ka]

[0334] SEQ ID NO: 29 Amino acid sequence of UBOX-P2-F3, an exemplary chimeric protein of the first aspect of the present invention

[0335] [ka]

[0336] SEQ ID NO: 30 P2-E2-VHL, an exemplary chimeric protein of the first aspect of the invention, amino acid sequence

[0337] [ka]

[0338] SEQ ID NO: 31 P2-F3-VHL, an exemplary chimeric protein of the first aspect of the invention, amino acid sequence

[0339] [ka]

[0340] SEQ ID NO: 32 P2-E2-UBOX, an exemplary chimeric protein of the first aspect of the present invention, amino acid sequence

[0341] [ka]

[0342] SEQ ID NO: 33 P2-F3-UBOX, an exemplary chimeric protein of the first aspect of the present invention, amino acid sequence

[0343] [ka]

[0344] SEQ ID NO: 34 iDAb RAS-UBOX, an exemplary chimeric protein of the first aspect of the invention, amino acid sequence

[0345] [ka]

[0346] SEQ ID NO: 35 Amino acid sequence of VHL-iDAb RAS, an exemplary chimeric protein of the first aspect of the invention

[0347] [ka]

[0348] SEQ ID NO: 36 DNA sequence of primer DUSP6For CTCGGATCACTGGAGCCAAAAC

[0349] SEQ ID NO: 37 DNA sequence of primer DUSP6Rev GTCACAGTGACTGAGCGGCTAA

[0350] SEQ ID NO: 38 DNA sequence of primer GAPDHFor GTCTCCTCTGACTTCAACAGCG

[0351] SEQ ID NO: 39 DNA sequence of primer GAPDHRev ACCACCCTGTTGCTGTAGCCAA

[0352] SEQ ID NO: 40 Amino acid sequences of optional sequences in certain exemplary proteins of the invention VDGGS

[0353] SEQ ID NO: 41 Amino acid sequences of optional FLAG tag sequences in exemplary proteins of the invention DYKDDDDK

[0354] The following paragraphs are not intended to claim the invention, but rather to aid in understanding the invention and in identifying subject matter for which protection may be sought in connection with the present disclosure.

[0355] 1. A chimeric protein comprising a ubiquitin ligase domain and a RAS-specific endogenous targeting moiety.

[0356] 2. The chimeric protein of paragraph 1, wherein the ubiquitin ligase domain is selected from the group consisting of a VHL E3 ligase domain or a fragment or variant thereof having ubiquitin ligase activity, and a UBOX domain of CHIP or a fragment or variant thereof having ubiquitin ligase activity.

[0357] 3. A chimeric protein according to paragraph 2, comprising a VHL E3 ligase domain or a fragment or variant thereof that has ubiquitin ligase activity.

[0358] 4. A chimeric protein described in any one of paragraphs 1 to 3, wherein the ubiquitin ligase domain comprises the amino acid sequence set forth in SEQ ID NO: 15.

[0359] 5. The chimeric protein of any one of paragraphs 1 to 4, wherein the RAS-specific endogenous targeting moiety is selected from the group consisting of a RAS-specific DARPin and a RAS-specific intracellular antibody.

[0360] 6. The chimeric protein of any one of paragraphs 1 to 5, wherein the endogenous targeting moiety is a KRAS-specific endogenous targeting moiety selected from the group consisting of a KRAS-specific DARPin and a KRAS-specific intracellular antibody.

[0361] 7. The chimeric protein of any one of paragraphs 1 to 6, wherein the KRAS-specific endogenous targeting moiety comprises a KRAS-specific DARPin.

[0362] 8. A chimeric protein described in any one of paragraphs 1 to 7, wherein the KRAS-specific endogenous targeting moiety comprises the amino acid sequence set forth in SEQ ID NO: 6 or 8, a KRAS-binding mutant of SEQ ID NO: 6 or 8, or a KRAS-binding fragment of SEQ ID NO: 6 or 8 or a mutant thereof.

[0363] 9. The chimeric protein of paragraph 8, wherein the KRAS-specific portion consists of the amino acid sequence set forth in SEQ ID NO: 6 or 8, or a KRAS-binding fragment thereof.

[0364] 10. A chimeric protein described in any one of paragraphs 6 to 9, wherein the KRAS-specific endogenous targeting moiety is capable of binding to both mutant and wild-type KRAS.

[0365] 11. The chimeric protein of any one of paragraphs 1 to 10, which shares at least 85% identity with the amino acid sequence of SEQ ID NO: 20.

[0366] 12. The chimeric protein of paragraph 11, comprising the amino acid sequence of SEQ ID NO: 20.

[0367] 13. The chimeric protein described in paragraph 11, consisting of the amino acid sequence of SEQ ID NO: 20.

[0368] 14. The chimeric protein of any one of paragraphs 1 to 5, wherein the endogenous targeting moiety is a pan-RAS-specific intracellular antibody that shares at least 85% identity with the amino acid sequence of SEQ ID NO:4.

[0369] 15. The chimeric protein of paragraph 14, which shares at least 85% identity with the amino acid sequence of SEQ ID NO:5.

[0370] 16. A chimeric protein described in any one of paragraphs 1 to 15, wherein the ubiquitin ligase domain consists of a single domain and / or the RAS-specific endogenous targeting moiety consists of a single domain.

[0371] 17. A nucleic acid molecule comprising a nucleic acid sequence encoding a chimeric protein comprising a ubiquitin ligase domain and a RAS-specific endogenous targeting moiety as defined in any one of paragraphs 1 to 16.

[0372] 18. A pharmaceutical composition comprising a chimeric protein comprising the ubiquitin ligase domain described in any one of paragraphs 1 to 16 and a RAS-specific endogenous targeting moiety and / or the nucleic acid molecule described in paragraph 17, and a pharmaceutically acceptable carrier.

[0373] 19. A chimeric protein described in any one of paragraphs 1 to 16 for use as a medicament.

[0374] 20. The chimeric protein for use according to paragraph 19 in the prevention and / or treatment of a RAS-related disorder selected from the group consisting of RAS-related cancers and RASopathies.

[0375] twenty one. 21. The chimeric protein according to paragraph 20 for use in the prevention and / or treatment of a RAS-related cancer selected from the group consisting of RAS-related lung cancer, RAS-related pancreatic cancer, RAS-related colorectal cancer, adrenocortical carcinoma, bladder urothelial carcinoma, invasive breast carcinoma, cervical squamous cell carcinoma or endocervical adenocarcinoma, bile duct carcinoma, colon adenocarcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma or paraganglioma, prostate adenocarcinoma, rectal adenocarcinoma, sarcoma, cutaneous melanoma, gastric adenocarcinoma, testicular germ cell tumor, thyroid carcinoma, thymoma, uterine endometrial carcinoma, uterine carcinosarcoma, and uveal melanoma.

[0376] 22. The chimeric protein for use according to paragraph 20 in the prevention and / or treatment of a RASopathy selected from the group consisting of capillary malformation-arteriovenous malformation syndrome, autoimmune lymphoproliferative syndrome, cardiofaciocutaneous syndrome, hereditary gingival fibromatosis type 1, neurofibromatosis type 1, Noonan syndrome, Costello syndrome, and Legius syndrome.

[0377] 23. A chimeric protein comprising a ubiquitin ligase domain and an LMO2-specific endogenous targeting moiety.

[0378] 24. The chimeric protein of paragraph 23, which shares at least 85% identity with the amino acid sequence of SEQ ID NO: 14.

[0379] 25. The chimeric protein of paragraph 24, comprising the amino acid sequence of SEQ ID NO: 14.

Claims

1. A chimeric protein comprising a ubiquitin ligase domain and a RAS-specific endogenous targeting moiety, wherein the ubiquitin ligase domain is a VHL E3 ligase domain or a fragment or variant thereof having ubiquitin ligase activity, and the ubiquitin ligase domain is attached to the N-terminal region of the RAS-specific endogenous targeting moiety.

2. The chimeric protein of claim 1, wherein the ubiquitin ligase domain shares at least 90% identity with SEQ ID NO:

15.

3. The chimeric protein of claim 1 or 2, wherein the ubiquitin ligase domain comprises the amino acid sequence set forth in SEQ ID NO:

15.

4. The chimeric protein of claim 3, wherein the ubiquitin ligase domain consists of the amino acid sequence set forth in SEQ ID NO:

15.

5. 5. The chimeric protein of any one of claims 1 to 4, wherein the RAS-specific endogenous targeting moiety is selected from the group consisting of a pan-RAS-specific endogenous targeting moiety, a KRAS-specific endogenous targeting moiety, an NRAS-specific endogenous targeting moiety, and an HRAS-specific endogenous targeting moiety.

6. 6. The chimeric protein of claim 1, wherein the RAS-specific endogenous targeting moiety is selected from the group consisting of a RAS-specific DARPin and a RAS-specific intracellular antibody.

7. 7. The chimeric protein of claim 1, wherein the endogenous targeting moiety is a KRAS-specific endogenous targeting moiety selected from the group consisting of a KRAS-specific DARPin and a KRAS-specific intracellular antibody.

8. 8. The chimeric protein of claim 1, wherein the KRAS-specific endogenous targeting moiety comprises a KRAS-specific DARPin.

9. A chimeric protein described in any one of claims 1 to 8, wherein the KRAS-specific endogenous targeting portion comprises the amino acid sequence set forth in SEQ ID NO: 6 or 8, a KRAS-binding mutant of SEQ ID NO: 6 or 8, or a KRAS-binding fragment of SEQ ID NO: 6 or 8 or its mutant.

10. The chimeric protein of claim 9, wherein the KRAS-specific endogenous targeting portion shares at least 90% identity with the amino acid sequence of SEQ ID NO: 6 or 8.

11. 10. The chimeric protein of claim 9, wherein the KRAS-specific portion comprises the amino acid sequence set forth in SEQ ID NO: 6 or 8, or a KRAS-binding fragment thereof.

12. 10. The chimeric protein of claim 9, wherein the KRAS-specific portion consists of the amino acid sequence set forth in SEQ ID NO: 6 or 8, or a KRAS-binding fragment thereof.

13. 13. The chimeric protein of claim 7, wherein the KRAS-specific endogenous targeting moiety is capable of binding to both mutant and wild-type KRAS.

14. 7. The chimeric protein of claim 1, wherein the endogenous targeting moiety is a pan-RAS-specific endogenous targeting moiety selected from the group consisting of a pan-RAS-specific intracellular antibody and a pan-RAS-specific DARPin.

15. The chimeric protein of claim 14, wherein the pan-RAS-specific endogenous targeting moiety is a pan-RAS-specific intracellular antibody.

16. The chimeric protein of claim 15, wherein the pan-RAS-specific endogenous targeting portion shares at least 90% identity with the amino acid sequence of SEQ ID NO:

4.

17. The chimeric protein of claim 15, wherein the pan-RAS-specific portion comprises the amino acid sequence set forth in SEQ ID NO:

4.

18. 16. The chimeric protein of claim 15, wherein the pan-RAS-specific portion consists of the amino acid sequence set forth in SEQ ID NO: 4 or a pan-RAS-binding fragment thereof.

19. 7. The chimeric protein of claim 1, wherein the endogenous targeting moiety is an HRAS-specific endogenous targeting moiety selected from the group consisting of an HRAS-specific intracellular antibody and an HRAS-specific DARPin.

20. 7. The chimeric protein of claim 1, wherein the endogenous targeting moiety is an NRAS-specific endogenous targeting moiety selected from the group consisting of an NRAS-specific intracellular antibody and an NRAS-specific DARPin.

21. 21. A chimeric protein according to any one of claims 1 to 20, wherein the ubiquitin ligase domain consists of a single domain.

22. 22. The chimeric protein of claim 1, wherein the RAS-specific endogenous targeting moiety consists of a single domain.

23. 23. The chimeric protein of any one of claims 1 to 22, wherein the ubiquitin ligase domain consists of a single domain and the RAS-specific endogenous targeting moiety consists of a single domain.

24. 14. A chimeric protein according to any one of claims 1 to 13, which shares at least 90% identity with the amino acid sequence of SEQ ID NO:

20.

25. 25. The chimeric protein of claim 24, comprising the amino acid sequence of SEQ ID NO:

20.

26. 25. The chimeric protein of claim 24, consisting of the amino acid sequence of SEQ ID NO:

20.

27. A nucleic acid molecule comprising a nucleic acid sequence encoding a chimeric protein comprising a ubiquitin ligase domain and a RAS-specific endogenous targeting moiety, wherein the ubiquitin ligase domain is a VHL E3 ligase domain or a fragment or variant thereof having ubiquitin ligase activity, and the ubiquitin ligase domain is attached to the N-terminal region of the RAS-specific endogenous targeting moiety.

28. 28. The nucleic acid molecule of claim 27, wherein the chimeric protein is as defined in any one of claims 1 to 26.

29. 29. The nucleic acid molecule of claim 27 or claim 28 provided in the form of a vector comprising the nucleic acid molecule.

30. 30. The nucleic acid molecule of claim 29, provided in the form of a lentiviral vector comprising the nucleic acid molecule.

31. A pharmaceutical composition comprising a chimeric protein comprising a ubiquitin ligase domain and a RAS-specific endogenous targeting moiety and / or a nucleic acid molecule comprising a nucleic acid sequence encoding a chimeric protein comprising a ubiquitin ligase domain and a RAS-specific endogenous targeting moiety, and a pharmaceutically acceptable carrier, wherein the ubiquitin ligase domain is a VHL E3 ligase domain or a fragment or variant thereof having ubiquitin ligase activity, and the ubiquitin ligase domain is attached to the N-terminal region of the RAS-specific endogenous targeting moiety.

32. 32. A pharmaceutical composition according to claim 31, comprising a chimeric protein according to any one of claims 1 to 26 and / or a nucleic acid molecule as defined in any one of claims 27 to 31.

33. A composition for preventing or treating a RAS-related disorder, comprising a chimeric protein according to any one of claims 1 to 26.

34. 34. The composition of claim 33, wherein the chimeric protein is provided by administering the protein to a subject.

35. 34. The composition of claim 33, which provides a chimeric protein by administering to a subject a nucleic acid of any one of claims 27 to 30.

36. 36. A composition according to any one of claims 33 to 35, for providing a protein or nucleic acid molecule by administering the pharmaceutical composition of claim 31 or 32 to a subject.

37. 37. The composition of any one of claims 33 to 36, wherein the RAS-associated disorder is selected from the group consisting of RAS-associated cancer and RASopathy.

38. 38. The composition of claim 37, wherein the RAS-related cancer is selected from the group consisting of RAS-related lung cancer, RAS-related pancreatic cancer, RAS-related colorectal cancer, adrenocortical carcinoma, bladder urothelial carcinoma, invasive breast carcinoma, cervical squamous cell carcinoma or endocervical adenocarcinoma, bile duct carcinoma, colon adenocarcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe, renal clear cell carcinoma, papillary renal cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma or paraganglioma, prostate adenocarcinoma, rectal adenocarcinoma, sarcoma, cutaneous melanoma, gastric adenocarcinoma, testicular germ cell tumor, thyroid carcinoma, thymoma, uterine endometrial carcinoma, uterine carcinosarcoma, and uveal melanoma.

39. 38. The composition of claim 37, wherein the RAS disease is selected from capillary malformation-arteriovenous malformation syndrome, autoimmune lymphoproliferative syndrome, cardiofaciocutaneous syndrome, hereditary gingival fibromatosis type 1, neurofibromatosis type 1, Noonan syndrome, Costello syndrome, and Legius syndrome.

40. 27. A chimeric protein according to any one of claims 1 to 26 for use as a medicament.

41. The chimeric protein of claim 40 in the prevention and / or treatment of RAS-related disorders.

42. 42. The chimeric protein of claim 41, wherein the RAS-associated disorder is selected from RAS-associated cancer and RASopathy.

43. 43. The chimeric protein of claim 42 for the prevention and / or treatment of a RAS-related cancer selected from the group consisting of RAS-related lung cancer, RAS-related pancreatic cancer, RAS-related colorectal cancer, adrenocortical carcinoma, bladder urothelial carcinoma, invasive breast carcinoma, cervical squamous cell carcinoma or endocervical adenocarcinoma, bile duct carcinoma, colon adenocarcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma or paraganglioma, prostate adenocarcinoma, rectal adenocarcinoma, sarcoma, cutaneous melanoma, gastric adenocarcinoma, testicular germ cell tumor, thyroid carcinoma, thymoma, uterine endometrial carcinoma, uterine carcinosarcoma, and uveal melanoma.

44. 44. The chimeric protein of claim 43 for the prevention and / or treatment of a RAS disorder selected from the group consisting of capillary malformation-arteriovenous malformation syndrome, autoimmune lymphoproliferative syndrome, cardiofaciocutaneous syndrome, hereditary gingival fibromatosis type 1, neurofibromatosis type 1, Noonan syndrome, Costello syndrome, and Legius syndrome.

45. 31. A nucleic acid molecule according to any one of claims 27 to 30 for use as a medicament.

46. 46. ​​The nucleic acid molecule of claim 45 in the prevention and / or treatment of RAS-related disorders.

47. 47. The nucleic acid molecule of claim 46, wherein the RAS-associated disorder is selected from RAS-associated cancer and RASopathy.

48. 48. The nucleic acid of claim 47, for the prevention and / or treatment of a RAS-related cancer selected from the group consisting of RAS-related lung cancer, RAS-related pancreatic cancer, RAS-related colorectal cancer, adrenocortical carcinoma, bladder urothelial carcinoma, breast invasive carcinoma, cervical squamous cell carcinoma or endocervical adenocarcinoma, bile duct carcinoma, colon adenocarcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma or paraganglioma, prostate adenocarcinoma, rectal adenocarcinoma, sarcoma, cutaneous melanoma, gastric adenocarcinoma, testicular germ cell tumor, thyroid carcinoma, thymoma, uterine endometrial carcinoma, uterine carcinosarcoma, and uveal melanoma.

49. 48. The nucleic acid of claim 47, in the prevention and / or treatment of a RASopathy selected from the group consisting of capillary malformation-arteriovenous malformation syndrome, autoimmune lymphoproliferative syndrome, cardiofaciocutaneous syndrome, hereditary gingival fibromatosis type 1, neurofibromatosis type 1, Noonan syndrome, Costello syndrome, and Legius syndrome.

50. 33. A pharmaceutical composition according to claim 31 or 32 for use as a medicament.

51. 51. The pharmaceutical composition of claim 50 in the prevention and / or treatment of RAS-related disorders.

52. 52. The pharmaceutical composition of claim 51, wherein the RAS-associated disorder is selected from RAS-associated cancer and RASopathy.

53. 52. The pharmaceutical composition of claim 51 for the prevention and / or treatment of a RAS-related cancer selected from the group consisting of RAS-related lung cancer, RAS-related pancreatic cancer, RAS-related colorectal cancer, adrenocortical carcinoma, bladder urothelial carcinoma, invasive breast carcinoma, cervical squamous cell carcinoma or endocervical adenocarcinoma, bile duct carcinoma, colon adenocarcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe, renal clear cell carcinoma, papillary renal cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma or paraganglioma, prostate adenocarcinoma, rectal adenocarcinoma, sarcoma, cutaneous melanoma, gastric adenocarcinoma, testicular germ cell tumor, thyroid carcinoma, thymoma, uterine endometrial carcinoma, uterine carcinosarcoma, and uveal melanoma.

54. 52. The pharmaceutical composition of claim 51 for the prevention and / or treatment of a RAS disorder selected from the group consisting of capillary malformation-arteriovenous malformation syndrome, autoimmune lymphoproliferative syndrome, cardiofaciocutaneous syndrome, hereditary gingival fibromatosis type 1, neurofibromatosis type 1, Noonan syndrome, Costello syndrome, and Legius syndrome.

Citation Information

Patent Citations

  • Anti-activating ras antibody

    JP2006521088A

  • Compositions and method of treating hypoxia-associated diseases

    US20090192084A1

  • RNA antagonist compounds for the modulation of p21 ras expression

    WO2007031091A2

  • Antibody protac conjugates

    WO2019140003A1

  • Broad-spectrum proteome editing with an engineered bacterial ubiquitin ligase mimic

    WO2019178604A1