Treatment of malignant lymphomatous disorders

GSK-3β inhibitors, like 9-ING-41, effectively treat malignant lymphoproliferative disorders by targeting lymphoma cells, achieving efficacy through cell cycle and mitotic arrest, offering potential therapeutic benefits for chemotherapy-resistant lymphomas.

JP7794564B2Active Publication Date: 2026-01-06ACTUATE THERAPEUTICS INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2020567578
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-06-05
Filing Date
2019-06-05
Publication Date
2026-01-06
Estimated Expiration
2039-06-05

AI Technical Summary

Technical Problem

There is a need for new methods to treat malignant lymphoproliferative disorders, particularly refractory lymphomas such as diffuse large B-cell lymphoma, as existing treatments show variable outcomes and chemotherapy-resistant subsets have poor prognoses.

Method used

Administering an effective amount of a GSK-3β inhibitor, such as 9-ING-41, to patients with malignant lymphoproliferative disorders, including diffuse large B-cell lymphoma, either as a monotherapy or in combination with other therapeutic agents like apoptosis modulators or CDK modulators, to inhibit GSK-3β activity and target lymphoma cells.

Benefits of technology

The use of GSK-3β inhibitors effectively reduces lymphoma cell viability and proliferation, leading to cell cycle arrest and mitotic arrest, offering potential therapeutic benefits for chemotherapy-refractory lymphomas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007794564000004
    Figure 0007794564000004
  • Figure 0007794564000005
    Figure 0007794564000005
  • Figure 0007794564000006
    Figure 0007794564000006
Patent Text Reader

Abstract

Methods for treating malignant lymphoproliferative disorders are provided, comprising administering to a patient an effective amount of a GSK-3β inhibitor, such as 9-ING-41, and methods for treating malignant lymphoproliferative disorders are also provided, comprising administering a GSK-3β inhibitor, such as 9-ING-41, in combination with a second therapeutic agent or multiple therapeutic agents. [Selected figure] Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application claims the benefit of priority to U.S. Provisional Application No. 62 / 680,739, filed June 5, 2018, the entire contents of which are incorporated herein by reference.

[0002] The present disclosure relates to methods of using GSK-3β inhibitors, including 3-(5-fluorobenzofuran-3-yl)-4-(5-methyl-5H-[1,3]dioxolo[4,5-f]indol-7-yl)pyrrole-2,5-dione, for the treatment of malignant lymphoproliferative disorders. [Background technology]

[0003] Malignant lymphoproliferative disorders are a group of diseases characterized by abnormal proliferation of lymphocytes. There are two general types of malignant lymphoproliferative disorders: malignant B-cell lymphoproliferative disorders and malignant T-cell lymphoproliferative disorders.

[0004] Malignant B-cell lymphoproliferative disorders include diffuse large B-cell lymphoma, acute lymphocytic leukemia, lymphoblastic-phase chronic myeloid leukemia, chronic lymphocytic leukemia / small lymphocytic lymphoma, extraductal marginal zone B-cell lymphoma, mucosa-associated lymphoid tissue lymphoma, follicular lymphoma, mantle cell lymphoma, nodal marginal zone B-cell lymphoma, Burkitt lymphoma, capillary leukemia, primary central nervous system lymphoma, splenic marginal zone B-cell lymphoma, Waldenstrom's macroglobulinemia / lymphodysplastic lymphoma, multiple myeloma, plasma cell dysplasias, plasma cell neoplasms, primary mediastinal B-cell lymphoma, Hodgkin's disease, and Castelman's disease.

[0005] Malignant T-cell lymphoproliferative disorders include T-cell leukemia / lymphoma, extravascular natural killer / T-cell lymphoma, cutaneous T-cell lymphoma, enteropathic T-cell lymphoma, angioimmunoblastic T-cell lymphoma, anaplastic large T / null cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, T-cell acute lymphoblastic leukemia, T-cell large-grain lymphocytic leukemia, lymphoblastic-phase chronic myeloid leukemia, post-transplant lymphoproliferative syndrome, and human T-cell leukemia virus type 1 (HTLV-1) positive. + ) Adult T-cell leukemia-lymphoma (ATL), T-cell prolymphocytic leukemia (T-PLL), and T-cell lymphoma not otherwise specified.

[0006] Glycogen synthase kinase-3 (GSK-3) is a serine (S) / threonine (T) kinase originally described as a key regulator of metabolism, particularly glycogen biosynthesis. Embi et al. Glycogen synthase kinase-3 isolated from rabbit skeletal muscle. Furthermore, this kinase has been shown to regulate carbohydrate metabolism through its function. Eur J Biochem. 1980;107:519-27. Since then, it has been shown to play a role in several disease processes, including cancer, aging, immune disorders, metabolic disorders, and neurological disorders, through modulation of many diverse substrates. Sutherland C. What are bona fide GSK3 substrates? Int J Alzheimers Dis. 2011;2011:505-607; Gao C, et al. GSK3: an important target for the development of novel therapies for type 2 diabetes and Alzheimer's disease. Rev Neurosci. 2011;23:1-11; Wang H, et al., Convergence of mammalian target of rapamycin complex 1- and glycogen synthase kinase 3-beta signaling pathways regulates the innate inflammatory response. J Immunol. 2011;186:5217-26; Klamer G, et al. Use of small molecule GSK3beta inhibitors to treat inflammation. Curr Med Chem. 2010;17:2873-81; Henriksen EJ. Dysregulation of glycogen synthase kinase-3 in skeletal muscle and the pathogenesis of insulin resistance and type 2 diabetes. Curr Diabetes Rev. 2010;6:285-93. GSK-3 has two ubiquitously expressed, highly conserved isoforms, GSK-3α and GSK-3β, that share and differ in both substrate and functional effects. Aberrant overexpression of GSK-3β promotes tumor growth and chemotherapy resistance in various solid tumors. However, little is known about the impact of GSK-3β on the development, treatment resistance, and survival of B-cell lymphomas, despite its known function as a metabolic checkpoint regulator in B cells. Jellusova J, et al.GSK3 is a metabolic checkpoint regulator in B cells.Nat Immunol.2017;18:303-12.

[0007] GSK-3β inhibitors are of interest due to their ability to potentially alter the clinical course of GSK-3β-mediated diseases. Some GSK-3β inhibitors include tideglusib, LY2090314, 9-ING-41, CHIR-99021 and CHIR-98014, SB216763 and SB415286, AR-A011418, CG701338, and CG202796. See Amy Walz, Andrey Ugolkov, Sunandana Chandra, et al., Molecular Pathways: Revisiting Glycogen Synthase Kinase-3b as a Target for the Treatment of Cancer, Clin Cancer Res; 23(8) April 15, 2017, OF1-OF7.

[0008] 3-(5-Fluorobenzofuran-3-yl)-4-(5-methyl-5H-[1,3]dioxolo[4,5-f]indol-7-yl)pyrrole-2,5-dione (“9-ING-41”) is a GSK-3β inhibitor having the following chemical structure: [ka]

[0009] The synthesis, properties, and / or biological activity of 9-ING-41 are described in U.S. Pat. No. 8,207,216; Gaisina, et al., From a Natural Product Lead to the Identification of Potent and Selective Benzofuran-3-yl-(indol-3-yl)maleimides as Glycogen Synthase Kinase 3β Inhibitors That Suppress Proliferation and Survival of Pancreatic Cancer Cells, J. Med. Chem. 2009, 52, 1853-1863; and Hilliard, et al., Glycogen synthase kinase 3β inhibitors induce apoptosis in ovarian cancer cells and inhibit in vivo tumor growth, Anti-Cancer Drugs 2011, 22:978-985. 9-ING-41 is reported to be useful in treating certain cancers, including brain, lung, breast, ovarian, bladder, neuroblastoma, kidney, and pancreatic cancers, as well as traumatic brain injury.

[0010] The clinical course of diffuse large B-cell lymphoma (DLBCL) remains variable, despite improved response and survival rates following the addition of the anti-CD20 monoclonal antibody rituximab to standard chemotherapy in the late 1990s. Coiffier B, et al. Long-term outcome of patients in the LNH-98.5 trial, the first randomized study comparing rituximab-CHOP to standard CHOP chemotherapy in DLBCL patients: a study by the Groupe d'Etudes des Lymphomes de l'Adulte. Blood. 2010;116:2040-5; Feugier P, et al. Long-term results of the R-CHOP study in the treatment of elderly patients with diffuse large B-cell lymphoma: a study by the Groupe d'Etude des Lymphomes de l'Adulte. J Clin Oncol. 2005;23:4117-26. Although 60% of patients enjoy long-term disease-free survival, a biologically unfavorable subset of patients has chemotherapy-refractory disease and a less favorable prognosis. Sehn LH, et al. Introduction of combined CHOP plus rituximab therapy dramatically improved outcome of diffuse large B-cell lymphoma in British Columbia. J Clin Oncol. 2005;23:5027-33. In particular, double translocations of c-MYC and BCL-2 in DLBCL, known as "double-hit lymphoma" ("DHL"), have been associated with poor outcomes after standard R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone) therapy, with few patients achieving long-term survival.Petrich AM, et al.Impact of induction regimen and stem cell transplantation on outcomes in double-hit lymphoma: a multicenter retrospective analysis.Blood.2014;124:2354-61.

[0011] Thus, there is a need for new methods for treating malignant lymphoproliferative disorders, including lymphomas, and in particular new methods for treating refractory lymphomas such as DLBCL. The prior art documents relevant to the invention of this application are as follows (including documents cited in the international phase after the international filing date and documents cited when the application entered the national phase in other countries). (Prior art document) (Patent document) (Patent Document 1) U.S. Patent Application Publication No. 2016 / 0375006 (Patent Document 2) U.S. Patent Application Publication No. 2017 / 0157121 (Patent Document 3) U.S. Patent Application Publication No. 2016 / 0095873 (Patent Document 4) U.S. Patent Application Publication No. 2017 / 0165230 (Prior art document) (Non-patent literature) (Non-patent document 1) KARMALI et al. "GSK-3B inhibitor, 9-ING-41, reduces cell viability and halts proliferation of B-cell lymphoma cell lines as a single agent and in combination with novel agents," Oncotarget, 11 November 2017 (11.11.2017),Vol.8,No.70,Pgs.114924-114934.entire document Summary of the Invention [Means for solving the problem]

[0012] In some embodiments, the present disclosure provides a method of treating a malignant lymphoproliferative disorder in a patient in need thereof, the method comprising administering to the patient an effective amount of a GSK-3β inhibitor.

[0013] In some embodiments, the present disclosure provides a method of treating a malignant lymphoproliferative disorder in a patient in need thereof, comprising administering to the patient an effective amount of a GSK-3β inhibitor, when the malignant lymphoproliferative disorder is a malignant B-cell lymphoproliferative disorder.

[0014] In some embodiments, the present disclosure provides a method of treating a malignant B-cell lymphoproliferative disorder in a patient in need thereof, the method comprising administering to the patient an effective amount of a GSK-3β inhibitor, wherein the malignant B-cell lymphoproliferative disorder is diffuse large B-cell lymphoma, acute lymphocytic leukemia, lymphoblastic phase chronic myeloid leukemia, chronic lymphocytic leukemia / small lymphocytic lymphoma, extraductal marginal zone B-cell lymphoma, mucosa-associated lymphoid tissue lymphoma, follicular lymphoma, mantle cell lymphoma, nodular marginal zone B-cell lymphoma, Burkitt's lymphoma, capillary leukemia, primary central nervous system lymphoma, splenic marginal zone B-cell lymphoma, Waldenstrom's macroglobulinemia / lymphodysplasia lymphoma, multiple myeloma, plasma cell dysplasia, plasma cell neoplasm, primary mediastinal B-cell lymphoma, Hodgkin's disease, and Castelman's disease.

[0015] In some embodiments, the present disclosure provides a method of treating a malignant B-cell lymphoproliferative disorder in a patient in need thereof, comprising administering to the patient an effective amount of a GSK-3β inhibitor, where the malignant B-cell lymphoproliferative disorder is diffuse large B-cell lymphoma.

[0016] In some embodiments, the present disclosure provides a method of treating diffuse large B-cell lymphoma, when the diffuse large B-cell lymphoma is a double-hit lymphoma, comprising administering to said patient an effective amount of a GSK-3β inhibitor.

[0017] In some embodiments, the present disclosure provides a method of treating a malignant lymphoproliferative disorder in a patient in need thereof, comprising administering to said patient an effective amount of a GSK-3β inhibitor, when the malignant lymphoproliferative disorder is a malignant T-cell lymphoproliferative disorder.

[0018] In some embodiments, the present disclosure provides a method of treating a malignant T-cell lymphoproliferative disorder in a patient in need thereof, the method comprising administering to the patient an effective amount of a GSK-3β inhibitor, wherein the malignant T-cell lymphoproliferative disorder is selected from the group consisting of T-cell leukemia / lymphoma, extravascular natural killer / T-cell lymphoma, cutaneous T-cell lymphoma, enteropathic T-cell lymphoma, angioimmunoblastic T-cell lymphoma, anaplastic large T / null cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, T-cell acute lymphoblastic leukemia, T-cell large lymphocytic leukemia, lymphoblastic phase chronic myeloid leukemia, post-transplant lymphoproliferative syndrome, human T-cell leukemia virus type 1 positive (HTLV-1 + ) adult T-cell leukemia-lymphoma (ATL), T-cell prolymphocytic leukemia (T-PLL), and T-cell lymphoma not otherwise specified.

[0019] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein the malignant lymphoproliferative disorder is chemotherapy-refractory.

[0020] In some embodiments, the disclosure provides a method according to any of the above embodiments, wherein the GSK-3β inhibitor is 9-ING-41, tideglusib, LY2090314, CHIR-99021, CHIR-98014, SB216763, SB415286, AR-A01418, CG70138, or CG202796.

[0021] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein the GSK-3β inhibitor is 9-ING-41, tideglusib, or LY20090314.

[0022] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein the GSK-3β inhibitor is 9-ING-41.

[0023] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein the GSK-3β inhibitor is tideglusib.

[0024] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein said GSK-3β inhibitor is LY2090314.

[0025] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein said GSK-3β inhibitor is administered in combination with a second therapeutic agent.

[0026] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein the GSK-3β inhibitor is administered in combination with a second therapeutic agent, and wherein the second therapeutic agent is administered in a sub-therapeutic amount.

[0027] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein the GSK-3β inhibitor is administered in combination with a second therapeutic agent, and the second therapeutic agent is an anti-cancer agent.

[0028] In some embodiments, the present disclosure provides a method according to the preceding embodiment, wherein the GSK-3β inhibitor is administered in combination with an anti-cancer agent, and the anti-cancer agent is an apoptosis modulator, a CDK modulator, or a modulator of the mTOR / AKT / PI3K pathway.

[0029] In some embodiments, the present disclosure provides a method according to the preceding embodiment, wherein said GSK-3β inhibitor is administered in combination with an anti-cancer agent, and said anti-cancer agent is an apoptosis modulator.

[0030] In some embodiments, the present disclosure provides a method according to the preceding embodiment, wherein said GSK-3β inhibitor is administered in combination with an apoptosis modulator, and said apoptosis modulator is a Bcl-2 inhibitor.

[0031] In some embodiments, the present disclosure provides a method according to the preceding embodiment, wherein the GSK-3β inhibitor is administered in combination with a Bcl-2 inhibitor, wherein the Bcl-2 inhibitor is venetoclax, ABT-737, or navitoclax.

[0032] In some aspects, the present disclosure provides a method according to the preceding aspects, wherein the GSK-3β inhibitor is administered in combination with a Bcl-2 inhibitor, wherein the Bcl-2 inhibitor is venetoglax.

[0033] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein said GSK-3β inhibitor is administered in combination with an anti-cancer agent, wherein said anti-cancer agent is a CDK modulator.

[0034] In some embodiments, the present disclosure provides a method according to the preceding embodiment, wherein said GSK-3β inhibitor is administered in combination with a CDK modulator, and said CDK modulator is a CDK9 inhibitor.

[0035] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein said GSK-3β inhibitor is administered in combination with a CDK9 inhibitor, wherein the CDK9 inhibitor is BAY-1143572, LDC000067, Dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-793887.

[0036] In some embodiments, the present disclosure provides a method according to the preceding embodiment, wherein said GSK-3β inhibitor is administered in combination with a CDK9 inhibitor, wherein the CDK9 inhibitor is BAY-1143572.

[0037] In some embodiments, the present disclosure provides a method according to any of the above embodiments, wherein the GSK-3β inhibitor is administered in combination with an anti-cancer agent, and the anti-cancer agent is a modulator of the mTOR / AKT / PI3K pathway.

[0038] In some embodiments, the present disclosure provides a method according to the preceding embodiment, wherein the GSK-3β inhibitor is administered in combination with a modulator of the mTOR / AKT / PI3K pathway, and the modulator of the mTOR / AKT / PI3K pathway is a PI3K inhibitor.

[0039] In some embodiments, the present disclosure provides a method according to the preceding embodiment, wherein said GSK-3β inhibitor is administered in combination with a PI3K inhibitor, and the PI3K inhibitor is copanlisib or idelalisib.

[0040] In some embodiments, the present disclosure provides a method according to the preceding embodiment, wherein said GSK-3β inhibitor is administered in combination with a PI3K inhibitor, and said PI3K inhibitor is idelalisib. [Brief explanation of the drawings]

[0041] [Figure 1] Figures 1A–1E show the viability and proliferation of lymphoma cells with 9-ING-41 treatment. 10,000 cells (SUDHL-4 (Figure 1B), KPUM-UH1 (Figure 1C), Karpas 422 (Figure 1D), and TMD8 (Figure 1E)) per 96-well plate well were either untreated or treated with 1 μM 9-ING-41 in triplicate. Cell numbers were calculated using the MTS assay on days 1, 3, 5, and 7. Briefly, 20 μL of MTS reagent was added to the cells, and after 2 h of incubation, the absorbance at 490 nm (A490) was read using a Biotek plate reader. The absorbance at OD = 490 nm increases proportionally to the cell density. Error bars represent the standard deviation between replicates. The viability on day 3 is shown in Figure 1A. [Figure 2]Figures 2A-2O show the viability of lymphoma cells treated with chemotherapeutic agents in combination with 9-ING-41. 10,000 cells (Figure 1A, F, K: Daudi; Figure 1B, G, L: SUDHL-4; Figure 1C, H, M: KPUM-UH1; Figure 1D, I, N: Karpas422; E, J, O: TMD8) were plated per well of a 96-well plate and treated with both 9-ING-41 (0-0.5 µM) and Venetoclax (0-5,000 nM) (Figure 1A-E) or BAY-1143572 (0-50 µM) (Figure 1F-J) or idelalisib (0-50 µM) (Figure 1K-O) in triplicates. Viability after 1 day was analyzed using an MTS assay. Briefly, 20 μl of MTS reagent was added to the cells, incubated for 2 hours, and the absorbance at 490 nm was read using a Biotek plate reader. The mean absorbance of the untreated control was set to 1, and then the relative absorbance was calculated. The absorbance at OD=490 nm increases proportionally with cell density. [Figure 3] The IC50 values ​​of venetoclax, BAY1143572, and idelalisib with and without 0.5 μM 9-ING-41 are shown in Figure 3. [Figure 4] Figure 4 shows that GSK3α and GSK3β mRNA and protein are overexpressed in lymphomas. (A) Real-time PCR quantification showing that GSK3α and GSK3β mRNA are overexpressed in lymphoma lines compared to low expression in normal B or T lymphocytes. B) Western blot images showing that GSK3α and GSK3β protein are also abundantly expressed in various lymphoma lines compared to purified normal B or T lymphocytes. [Figure 5]Figure 5 shows that GSK3 is essential for lymphoma cell proliferation and survival. Unstimulated peripheral blood B and T lymphocytes isolated from healthy donors were used as normal controls. The pro-apoptotic effect of the GSK3 inhibitor 9-ING-41 in various MCL and TCL lines (A) and DLBCL lines (B). C) Cell proliferation profiles of various lymphoma cell lines treated with 9-ING-41. Results (A-C) are from three independent experiments. [Figure 6] Inhibition or deletion of GSK3 in lymphoma cells results in cell cycle arrest at G2 / M. (A) Cell cycle profiles of three representative cell lines, Jeko, Mino, and OCI-Ly3, after 24-hour treatment with 0, 1.0, and 2.0 μM 9-ING-41. (B) Cell cycle profiles of parental Ly-1 cells and GSK3α, GSK3β, and GSK3αβ knockout subclones. Inset: Western blot images showing depletion of GSK3α and GSK3β proteins in knockout Ly-1 subclones. [Figure 7] Figure 7 shows that inhibition of GSK3 by 9-ING-41 results in mitotic arrest. (A) Cartoon depiction of the sequential steps (M1-M5) during mitosis (purchased and modified from Shutterstock). (B) Representative Wright staining images of Jeco cells untreated and treated with 1.0 μM 9-ING-41 for 24 h. While various mitotic phases (M1-M5) are easily identified in untreated cells (left panel), only prophase (M1) cells are observed in 9-ING-41 cells (right panel). (C) Bar graph showing the number of mitotic M1-M5 cells identified when counting 100 Jeco cells untreated or treated with 9-ING-41. Similar results (data not shown) were observed in at least four different lymphoma cell lines. [Figure 8]Figure 8 shows that GSK3β is localized to centrosomes. (A) Immunofluorescence images showing that GSK3β is localized to the nucleus and centrosome pairs in interphase house fly cells. (B) Close-up (magnified) images of (A). (CF) Single- or multi-channel images of co-immunostaining of GSK3β and pericentrin showing the co-localization of GSK3β and pericentrin to centrosomes in wild-type Ly-1 cells. (GH) Single- or multi-channel images of co-immunostaining of GSK3β and pericentrin in GSK3β-null Ly-1 cells showing that the staining is specific to GSK3β. (K) Immunofluorescence images showing that GSK3β (green) is localized to firework-like structures resembling the mitotic spindle in house fly cells. (L) Close-up image of a mitotic cell in (K). (M) Overlay image of microtubule structures stained with α-tubulin (red) and DNA (blue). (N) Close-up image of (M). (OP) Images showing the absence of spindle structure staining for GSK3β in GSK3β-null Ly-1 cells. (Q) Immunofluorescence images showing that GSK3β localizes to mitotic spindle structures and polarized centrosomes in Jeco cells treated with 9-ING-41. (R) Close-up image of a representative mitotic cell shown in (Q). [Figure 9] Figure 9 shows the aberrant expression of GSK3 protein and the proliferation response to 9-ING-41 in primary lymphoma patient (P) cells. (A) Immunoblots showing overexpression of GSK3α and GSK3β proteins in patient samples and normal B cell controls. P1: MCL, P2: high-grade B cell lymphoma, P3: follicular large B cell lymphoma 3B, P4: DLBCL, and P5: angioimmunoblastic T cell lymphoma. (B) 9-ING-41 inhibited proliferation in all five patient samples. (C) Immunohistochemical staining of GSK3β in paraffin tissue sections from various lymphoma patients. Representative images show the spectrum of GSK3β overexpression (brown areas) in different lymphoma samples. Methylene blue counterstaining (blue) shows GSK3β-negative cells in the background, while the antibody-negative control panel shows GSK3β-negative cells. Images were collected under 40x magnification. [Figure 10]Figure 10 shows the in vivo anti-lymphoma effect of 9-ING-41 in a Jeco-derived xenograft mouse model. (A) Experimental design showing the treatment schedule and dosage of 9-ING-41. (B) Bioluminescence images of xenograft-bearing mice untreated or treated with 9-ING-41. Images shown were collected at the end of the experiment (day 17). The experiment was performed twice, with similar results. DETAILED DESCRIPTION OF THE INVENTION

[0042] The subject matter of the present invention may be more readily understood by reference to the following detailed description, which forms a part of this disclosure. It will be understood that the present invention is not limited to the specific methods, conditions, or parameters described and / or illustrated herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to limit the claimed invention.

[0043] Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0044] As employed above, and throughout this disclosure, the following terms and abbreviations, unless otherwise indicated, shall be understood to have the following meanings:

[0045] In this disclosure, the singular forms "a," "an," and "the" include plural references, and a reference to a particular value includes at least that particular value unless the context clearly dictates otherwise. Thus, for example, a reference to a "compound" is a reference to one or more of such compounds and equivalents known to those of ordinary skill in the art; such compounds and equivalents are known to those of ordinary skill in the art. As used herein, the term "plurality" means one or more. When ranges of values ​​are expressed, another embodiment includes one particular value and / or the other particular value. Similarly, when values ​​are expressed as approximations, the use of the preposition "about" will understand that the particular value forms another embodiment. All ranges are inclusive and combinable.

[0046] As used herein, the terms "component," "composition," "compound composition," "compound," "drug," "pharmacologically active agent," "active agent," "therapeutic," "therapy," "treatment," or "agent" are used interchangeably herein and refer to a compound or composition of compounds or substances that, when administered to a subject (human or animal), induces a desired pharmacological and / or physiological effect by local and / or systemic action.

[0047] As used herein, the terms "therapeutic," "treatment," or "therapy" (and their different forms) include preventative (e.g., prophylactic), curative, or palliative treatment. As used herein, the term "treatment" includes alleviating or alleviating at least one adverse or negative effect or symptom of a condition, disease, or disorder. The condition, disease, or disorder may be cancer.

[0048] As used above and throughout this disclosure, the term "effective amount" means an amount effective, at dosages and for periods of time necessary, to achieve the desired result with respect to treating the relevant disorder, condition, or side effect. It will be understood that the effective amount of the components of the present invention will vary from patient to patient, depending on factors such as the specific compound, component, or composition selected, the route of administration, and the ability of the component to elicit the desired result in the individual, as well as the pathology or severity of the condition to be alleviated. The appropriate dosage is left to the discretion of the attending physician, taking into account hormone levels, age, sex, weight, patient condition, the severity of the pathological condition being treated, any concurrent medications or special diets a particular patient may be taking, and other factors recognized by those skilled in the art. Dosages may also be adjusted to provide an improved therapeutic response. An effective amount is also one in which any toxic or detrimental effects of the component are outweighed by the therapeutically beneficial effects.

[0049] In some embodiments, the effective amount is based on the patient's weight. In some embodiments, the effective amount of 9-ING-41 is about 0.1 mg / kg to about 10 mg / kg, e.g., about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, or about 10 mg / kg.

[0050] As employed above and throughout this disclosure, the term "sub-therapeutic amount" refers to an amount that is ineffective when administered as the sole therapeutic agent.

[0051] "Pharmaceutically acceptable" means those compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other undesirable complications, commensurate with a reasonable benefit / risk ratio.

[0052] Within the scope of the present invention, the disclosed compounds can be prepared in the form of pharmaceutically acceptable salts. "Pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds in which the parent compound is modified by making an acid or base salt thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic acid salts of acidic residues such as carboxylic acids; and the like. Pharmaceutically acceptable salts include, for example, conventional non-toxic salts or quaternary ammonium salts of the parent compound formed from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid, and the like. and salts prepared from organic acids such as acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pamoic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, isethionic acid, etc. These physiologically acceptable salts are prepared by methods known in the art, for example, by dissolving the free amine base in excess in aqueous alcohol, or by neutralizing the free carboxylic acid with an alkali metal base such as a hydroxide, or by neutralizing with an amine.

[0053] The compounds described herein can be prepared in alternative forms.For example, many amino-containing compounds can be used or prepared as acid addition salts.Often, such salts improve the isolation and handling properties of the compound.For example, depending on the reagent, reaction conditions, etc., the compounds described herein can be used or prepared as, for example, their hydrochloride or tosylate salts.Isomorphic crystalline forms, all chiral and racemic forms, N-oxides, hydrates, solvates, and acid salt hydrates are also contemplated within the scope of the present invention.

[0054] Certain acidic or basic compounds of the present invention may exist as tubitterions. All forms of compounds, including free acids, free bases, and tubitterions, are contemplated as being within the scope of the present invention. It is well known in the art that compounds containing both amino and carboxy groups often exist in equilibrium with their tubitterion forms. Thus, for example, any of the compounds described herein that contain both amino and carboxy groups also includes reference to their corresponding zwitterions.

[0055] The term "administering" means either administering a compound or composition of the invention directly, or administering a prodrug, derivative, or analog that forms an equivalent amount of the active compound or substance in the body.

[0056] The terms "subject," "individual," and "patient" are used interchangeably herein and refer to an animal, e.g., a human, to which treatment, including prophylactic treatment, with the pharmaceutical composition according to the present invention is provided. As used herein, the term "subject" refers to a human and a non-human animal. The terms "non-human animal" and "non-human mammal" are used interchangeably herein and include all vertebrates, such as non-human primates (especially higher primates), sheep, dogs, rodents (e.g., mice or rats), guinea pigs, goats, pigs, cats, rabbits, cows, horses, and non-mammals such as reptiles, amphibians, chickens, and turkeys.

[0057] The present disclosure provides a method of treating a malignant lymphoproliferative disorder, comprising administering to a patient in need thereof an effective amount of a GSK-3β inhibitor.

[0058] The malignant lymphoproliferative disorder that can be treated using the methods of the present disclosure can be a malignant B-cell lymphoproliferative disorder or a malignant T-cell lymphoproliferative disorder. In some embodiments, the malignant lymphoproliferative disorder is a malignant B-cell lymphoproliferative disorder. In other embodiments, the malignant lymphoproliferative disorder is a malignant T-cell lymphoproliferative disorder.

[0059] In some embodiments, malignant B-cell lymphoproliferative disorders that may be treated using the methods of the present disclosure are diffuse large B-cell lymphoma, acute lymphocytic leukemia, lymphoblastic phase chronic myeloid leukemia, chronic lymphocytic leukemia / small lymphocytic lymphoma, extraductal marginal zone B-cell lymphoma, mucosa-associated lymphoid tissue lymphoma, follicular lymphoma, mantle cell lymphoma, nodular marginal zone B-cell lymphoma, Burkitt's lymphoma, capillary leukemia, primary central nervous system lymphoma, splenic marginal zone B-cell lymphoma, Waldenstrom's macroglobulinemia / lymphodysplasia lymphoma, multiple myeloma, plasma cell dysplasia, plasma cell neoplasm, primary mediastinal B-cell lymphoma, Hodgkin's disease, and Castelmann's disease.

[0060] In some embodiments, the malignant B-cell lymphoproliferative disorder treated using the methods of the present disclosure is diffuse large B-cell lymphoma. In some embodiments, the diffuse large B-cell lymphoma is a double-hit lymphoma.

[0061] In some embodiments, the malignant B-cell lymphoproliferative disorder treated using the methods of the present disclosure is mantle cell lymphoma.

[0062] In some embodiments, malignant T-cell lymphoproliferative disorders that may be treated using the methods of the present disclosure include T-cell leukemia / lymphoma, extravascular natural killer / T-cell lymphoma, cutaneous T-cell lymphoma, enteropathic T-cell lymphoma, angioimmunoblastic T-cell lymphoma, anaplastic large T / null cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, T-cell acute lymphoblastic leukemia, T-cell large lymphocytic leukemia, lymphoblastic phase chronic myeloid leukemia, post-transplant lymphoproliferative syndrome, human T-cell leukemia virus type 1 positive (HTLV-1), and human T-cell leukemia virus type 1 positive (HTLV-1). + Adult T-cell leukemia-lymphoma (ATL), T-cell prolymphocytic leukemia (T-PLL), and T-cell lymphoma not otherwise specified is.

[0063] In some embodiments, the malignant T-cell lymphoproliferative disorder treated using the methods of the present disclosure is a T-cell lymphoma.

[0064] In some aspects of the present disclosure, the malignant lymphoproliferative disorder may be a chemotherapy-refractory malignant lymphoproliferative disorder. A chemotherapy-refractory malignant lymphoproliferative disorder is a malignant lymphoproliferative disorder that has failed one or more chemotherapy treatments. In some embodiments, the chemotherapy-refractory malignant lymphoproliferative disorder is a double-hit lymphoma (i.e., a lymphoma with a double translocation of c-MYC and BCL-2). In other embodiments, the chemotherapy that the refractory malignant lymphoproliferative disorder failed to undergo is R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone). In yet another embodiment, the chemotherapy that the refractory malignant lymphoproliferative disorder failed to undergo is a combination of cytotoxic therapies with or without a monoclonal antibody, a kinase inhibitor, an enzyme modulator, and an apoptosis modulator.

[0065] The patient whose condition is treated using the methods of the present invention is an animal, preferably a mammal. In some embodiments, the patient is a human. In other embodiments, the patient is a canine (i.e., dog). In yet other embodiments, the patient is a feline (i.e., cat). In preferred embodiments, the patient whose condition is treated using the methods of the present disclosure is a human.

[0066] The GSK-3β inhibitor administered in the methods of the present disclosure is any compound that inhibits the activity of glycogen synthase kinase-3β (GSK-3β).

[0067] In some embodiments, the GSK-3β inhibitor administered in the methods of the disclosure is 9-ING-41, tideglusib, LY2090314, CHIR-99021, CHIR-98014, SB216763, SB415286, AR-A011418, CG701338, or CG202796.

[0068] In some embodiments, the GSK-3β inhibitor administered in the methods of the present disclosure is 9-ING-41. Accordingly, in some aspects, the present disclosure provides a method of treating a malignant lymphoproliferative disorder in a patient in need thereof, comprising administering to said patient an effective amount of 9-ING-41.

[0069] In other embodiments, the GSK-3β inhibitor administered in the methods of the present disclosure is tideglusib, and the present disclosure provides a method of treating a malignant lymphoproliferative disorder in a patient in need thereof, comprising administering to the patient an effective amount of tideglusib.

[0070] In yet another embodiment, the GSK-3β inhibitor administered in the methods of the disclosure is LY2090314, and the disclosure provides a method of treating a malignant lymphoproliferative disorder in a patient in need thereof, comprising administering to said patient an effective amount of LY2090314.

[0071] In the disclosed methods of treating malignant lymphoproliferative disorders, an effective amount of a GSK-3β inhibitor can be administered to a patient as the sole therapeutic agent or in combination with one or more other therapeutic agents.

[0072] In some embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor to a patient as the sole therapeutic agent. When a GSK-3β inhibitor is the only therapeutically effective compound administered in the method of the present disclosure, the treatment is referred to as monotherapy. In some embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 as the sole therapeutic agent. In other embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering tideglusib as the sole therapeutic agent. In yet another embodiment, the method for treating a malignant lymphoproliferative disorder comprises administering LY2090314 as the sole therapeutic agent.

[0073] In another embodiment, a method for treating a malignant lymphoproliferative disorder includes administering GSK-3β in combination with one or more other therapeutic agents. When a GSK-3β inhibitor is administered in combination with a second therapeutic agent, the treatment is referred to as combination therapy. Combination therapy does not require that the GSK-3β inhibitor and the second therapeutic agent be introduced into or administered to the patient at the same time. Combination therapy simply requires that the GSK-3β inhibitor and the second therapeutic agent be introduced into the patient at the same time. Therefore, combination therapy does not imply a specific administration schedule.

[0074] In some embodiments, the method for treating malignant lymphoproliferative disorders comprises administering 9-ING-41 in combination with one or more other therapeutic agents. In other embodiments, the method for treating malignant lymphoproliferative disorders comprises administering tideglusib in combination with one or more other therapeutic agents. In yet another embodiment, the method for treating malignant lymphoproliferative disorders comprises administering LY2090314 in combination with one or more other therapeutic agents.

[0075] In some embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with an apoptosis-regulating agent. In some embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with an apoptosis modulator. In other embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with an apoptosis modulator. In yet another embodiment, the method for treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with an apoptosis modulator.

[0076] In some aspects, the apoptosis modulator is a Bcl-2 inhibitor. Exemplary Bcl-2 inhibitors include venetoclax, ABT-737, and navitoclax. In some aspects, the method for treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with a Bcl-2 inhibitor. In some embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with a Bcl-2 inhibitor. In other embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with a Bcl-2 inhibitor. In yet another embodiment, the method for treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with a Bcl-2 inhibitor.

[0077] In some aspects, the Bcl-2 inhibitor is venetoclax, ABT-737, or navitoclax. In some aspects, the method of treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor to a patient receiving venetoclax. nine In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with venetoclax, ABT-737, or navitograx. nine In other embodiments, the methods of treating malignant lymphoproliferative disorders include administering tideglusib in combination with venetoclax, ABT-737, or navitograx. nine In yet another embodiment, the method of treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with venetoclax, ABT-737, or navitograx. nine The method includes administering the compound in combination with LAX, ABT-737, or navitograx.

[0078] In some aspects, Bcl-2 inhibitors are used in combination with venetoclave. nineIn some aspects, the method of treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with benitograx. In some aspects, the method of treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with benitograx. In some aspects, the method of treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with ABT-737. In some aspects, the method of treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with navitograx.

[0079] In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with navitograx. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with ABT-737. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with navitograx.

[0080] In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with benitoglax. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with ABT-737. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with navitograx.

[0081] In yet another embodiment, the method of treating a malignant lymphoproliferative disorder comprises administering LY2090314 to a subject in need thereof. nine In yet another embodiment, the method of treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with ABT-737. In yet another embodiment, the method of treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with navitograx.

[0082] In some aspects, the method for treating malignant lymphoproliferative disorders comprises administering a GSK-3β inhibitor in combination with a cyclin-dependent kinase (CDK) modulator. In some embodiments, the method for treating malignant lymphoproliferative disorders comprises administering 9-ING-41 in combination with a cyclin-dependent kinase (CDK) modulator. In other embodiments, the method for treating malignant lymphoproliferative disorders comprises administering tideglusib in combination with a cyclin-dependent kinase (CDK) modulator. In yet another embodiment, the method for treating malignant lymphoproliferative disorders comprises administering LY2090314 in combination with a cyclin-dependent kinase (CDK) modulator.

[0083] In some aspects, the CDK modulator is a cyclic dependent kinase 9 ("CDK9") inhibitor. Exemplary CDK9 inhibitors include BAY-1143572, LDC0067, dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-79387. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with a CDK9 inhibitor. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with a CDK9 inhibitor. In other embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with a CDK9 inhibitor. In yet another embodiment, a method of treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with a CDK9 inhibitor.

[0084] In some aspects, the CDK9 inhibitor is BAY-1143572, LDC0067, dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-793887. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with BAY-1143572, LDC0067, dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-793887. In some embodiments, a method of treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with BAY-1143572, LDC0067, dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-79387. In other embodiments, a method of treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with BAY-1143572, LDC000067, dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-793887. In yet another embodiment, a method of treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with BAY-1143572, LDC0067, Dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-79387.

[0085] In some aspects, the CDK9 inhibitor is BAY-1143572. In some aspects, the method of treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with BAY-1143572. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with BAY-1143572. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with BAY-1143572. In yet another embodiment, the method of treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with BAY-1143572.

[0086] In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with a modulator of the MTOR / AKT / PI3 pathway. In some embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with a modulator of the MTOR / AKT / PI3 pathway. In other embodiments, the method of treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with a modulator of the MTOR / AKT / PI3 pathway. In yet another embodiment, the method of treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with a modulator of the MTOR / AKT / PI3 pathway.

[0087] In some aspects, the modulator of the MTOR / AKT / PI3 pathway is a PI3K inhibitor. Exemplary PI3K inhibitors include copanlisib and idelalisib. In some aspects, the method for treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with a PI3K inhibitor. In some embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with a PI3K inhibitor. In other embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with a PI3K inhibitor. In yet another embodiment, the method for treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with a PI3K inhibitor.

[0088] In some aspects, the PI3K inhibitor is copanlisib or idelalisib. In some aspects, the method for treating malignant lymphoproliferative disorders comprises administering a GSK-3β inhibitor in combination with copanlisib or idelalisib. In some embodiments, the method for treating malignant lymphoproliferative disorders comprises administering 9-ING-41 in combination with copanlisib or idelalisib. In other embodiments, the method for treating malignant lymphoproliferative disorders comprises administering tideglusib in combination with copanlisib or idelalisib. In yet another embodiment, the method for treating malignant lymphoproliferative disorders comprises administering LY2090314 in combination with copanlisib or idelalisib.

[0089] In some aspects, the PI3K inhibitor is copanlisib. In some aspects, the method for treating a malignant lymphoproliferative disorder comprises administering a GSK-3β inhibitor in combination with copanlisib. In some embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with copanlisib. In some embodiments, the method for treating a malignant lymphoproliferative disorder comprises administering tideglusib and copanlisib in combination. In yet another embodiment, the method for treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with copanlisib.

[0090] In some aspects, the PI3K inhibitor is idelalisib. In some aspects, the method for treating malignant lymphoproliferative disorders comprises administering a GSK-3β inhibitor in combination with idelalisib. In some embodiments, the method for treating malignant lymphoproliferative disorders comprises administering 9-ING-41 in combination with idelalisib. In some embodiments, the method for treating malignant lymphoproliferative disorders comprises administering tideglusib in combination with idelalisib. In yet other embodiments, the method for treating malignant lymphoproliferative disorders comprises administering LY2090314 in combination with idelalisib.

[0091] In yet other embodiments, the second therapeutic agent is selected from the group consisting of 5-fluorouracil, abiraterone acetate, acetylcholine, ado-trastuzumab emtansine, afatinib, aldesleukin, alectinib, alemtuzumab, alitretinoin, aminolevulinic acid, anastrozole, aprepitant, arsenic trioxide, asparaginase erwinia chrysanthemi, atezolizumab, axitinib, azacitidine, belinstat, bendamustine, benzyl isothiocyanate, bevacizumab, bexalote , bicalutamide, bleomycin, blinatomomab, bortezomib, bosutinib, brentuximab vedotin, busulfan, cabazitaxel, cabozantinib, capecitabine, carboplatin, carfilzomib, carmustine, ceritinib, cetuximab, chlorambucil, cisplatin, clofarabine, cobimetinib, crizotinib, cyclophosphamide, cytarabine, dabrafenib, dacarbazine, dactinomycin, daratumab, dasatinib, daunorubicin, decitabine, defibrotide sodium Degarelix, denilequin-diftitox, denosumab, dexamethasone, dexazoxane, dihydrotestosterone (DHT), dinutuximab, docetaxel, doxorubicin, elotuzumab, eltrombopag, enzalutamide, epirubicin, eribulin mesylate, erlotinib, etoposide, everolimus, exemestane, filgrastim, fludarabine phosphate, flutamide, fulvestrant Gefitinib, gemcitabine, gemtuzumab, gemtuzumab ozogamicin, glucarpidase, gosselin acetate, hydroxyurea, ibritumomab tiuxetan, ibrutinib, idarubicin, idelalisib, ifosfamide, imatinib, ibiquimod, interferon alfa-2b, ipilimumab, irinotecan, ixabepilone, ixazomib, lanreotide, lapatinib, lenalidomide, lenvatinib, letrozole, leucovorin.Luprolide, lomustine, mechlorestamine, megstrol acetate, melphalan, mercaptopurine, mesna, methotrexate, mitomycin C, mitoxantrone, netitumumab, nelarabine, netupitant, nilotinib, nilutamide, nivolumab, obinutuzumab, opatuzumab, olaparib, omacetaxine mepescutinate, osimertinib, oxaliplatin, ozogamicin, paclitaxel, palbociclib, palifermin, pamidronate, panitumumab, panobinostat, pazopanib, pegaspargase, peginterferon alfa-2b, pembrolizumab, pemetrexed, pertuzumab, plerixafor, pomalidomide, ponatinib. Pratrexate, prednisone, procarbazine, propranolol, radium-223 chloride, raloxifene, ramucirumab, rasburicase, regorafenib, rituximab, rolapitant, romidepsin, romiplostim, laxolitinib, siltuximab, sipulcel-T, sonidegib, sorafenib, sunitinib, talimogene laherparepvec, tamoxifen, temozolomide, temsirolimus, thalidomide, thioguanine. In some embodiments, the second therapeutic agent is one or more of thiotepa, tipiracil, topotecan, toremifene, tositumomab, trabectedin, trametinib, trastuzumab, tretinoin, triflidine, uridine triacetate, vandetanib, vemurafenib, venetoclax, vinblastine, vincristine, vinorelbine, vismodegib, vorinostat, difluvicept, zoledronic acid, and pharmaceutically acceptable salts thereof. In some embodiments, the second therapeutic agent is one or more of rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone.

[0092] In some aspects, administering a GSK-3β inhibitor in combination with a second therapeutic agent reduces the amount of the second therapeutic agent required to produce a given therapeutic effect. That is, in some embodiments, a therapeutically effective treatment comprises administering a GSK-3β inhibitor in combination with a subtherapeutic amount of the second therapeutic agent (i.e., an amount that would be ineffective when administered as the sole therapeutic agent). In some embodiments, the GSK-3β inhibitor is administered in combination with a subtherapeutic amount of an apoptosis-modulating agent. In some embodiments, 9-ING-41 is administered in combination with a subtherapeutic amount of a Bcl-2 inhibitor. In some embodiments, 9-ING-41 is administered in combination with a subtherapeutic amount of venetoclax, ABT-737, or navitoclax. In some embodiments, 9-ING-41 is administered in combination with a subtherapeutic amount of venetoclax. nine It is given in combination with Lux.

[0093] In other embodiments, tideglusib is administered in combination with a subtherapeutic dose of a Bcl-2 inhibitor. nine In some embodiments, tideglusib is administered in combination with a subtherapeutic dose of venetoclax, ABT-737, or navitograx. nine It is given in combination with Lux.

[0094] In yet another embodiment, LY2090314 is administered in combination with a subtherapeutic dose of a Bcl-2 inhibitor. In some embodiments, LY2090314 is administered in combination with a subtherapeutic dose of venetoclax, ABT-737, or navitoclax. In some embodiments, LY2090314 is administered in combination with a subtherapeutic dose of venetoclax.

[0095] In other embodiments, the GSK-3β inhibitor is administered in combination with a subtherapeutic dose of a CDK modulator. In other embodiments, the GSK-3β inhibitor is administered in combination with a subtherapeutic dose of a CDK9 inhibitor. In other embodiments, the GSK-3β inhibitor is administered in combination with a subtherapeutic dose of a CDK9 inhibitor. In some embodiments, 9-ING-41 is administered in combination with a subtherapeutic dose of a CDK9 inhibitor. In some embodiments, 9-ING-41 is administered in combination with a subtherapeutic dose of BAY-1143572, LDC0067, Dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-793887. In some embodiments, 9-ING-41 is administered in combination with a subtherapeutic dose of BAY-1143572.

[0096] In some embodiments, tideglusib is administered in combination with a subtherapeutic dose of a CDK9 inhibitor. In some embodiments, tideglusib is administered in combination with a subtherapeutic dose of BAY-1143572, LDC0067, dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-793887. In some embodiments, tideglusib is administered in combination with a subtherapeutic dose of BAY-1143572.

[0097] In some embodiments, LY2090314 is administered in combination with a subtherapeutic dose of a CDK9 inhibitor. In some embodiments, LY2090314 is administered in combination with a subtherapeutic dose of BAY-1143572, LDC000067, dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-793887. In some embodiments, LY2090314 is administered in combination with a subtherapeutic dose of BAY-1143572.

[0098] In some embodiments, the GSK-3β inhibitor is administered in combination with a subtherapeutic dose of a modulator of the MTOR / AKT / PI3 pathway. In some aspects, the GSK-3β inhibitor is administered in combination with a subtherapeutic dose of a PI3K inhibitor. In some embodiments, 9-ING-41 is administered in combination with a subtherapeutic dose of a PI3K inhibitor. In other embodiments, 9-ING-41 is administered in combination with a subtherapeutic dose of copanlisib or idelalisib. In some embodiments, 9-ING-41 is administered in combination with a subtherapeutic dose of copanlisib. In yet another embodiment, 9-ING-41 is administered in combination with a subtherapeutic dose of idelalisib.

[0099] In some embodiments, tideglusib is administered in combination with a subtherapeutic dose of a PI3K inhibitor. In other embodiments, tideglusib is administered in combination with a subtherapeutic dose of copanlisib or idelalisib. In some embodiments, tideglusib is administered in combination with a subtherapeutic dose of copanlisib. In yet other embodiments, tideglusib is administered in combination with a subtherapeutic dose of idelalisib.

[0100] In some embodiments, LY2090314 is administered in combination with a subtherapeutic dose of a PI3K inhibitor. In other embodiments, LY2090314 is administered in combination with a subtherapeutic dose of copanlisib or idelalisib. In some embodiments, LY2090314 is administered in combination with a subtherapeutic dose of copanlisib. In yet other embodiments, LY2090314 is administered in combination with a subtherapeutic dose of idelalisib.

[0101] The GSK-3β inhibitor may be administered in a pharmaceutical composition comprising the GSK-3β inhibitor and at least one pharmaceutically acceptable carrier or excipient. In some embodiments, 9-ING-41 may be administered in a pharmaceutical composition comprising 9-ING-41 and at least one pharmaceutically acceptable carrier or excipient. In other embodiments, tideglusib may be administered in a pharmaceutical composition comprising tideglusib and at least one pharmaceutically acceptable carrier or excipient. In other embodiments, LY2090314 may be administered in a pharmaceutical composition comprising LY2090314 and at least one pharmaceutically acceptable carrier or excipient. Similarly, a second therapeutic agent may be administered in a pharmaceutical composition comprising the second therapeutic agent and at least one pharmaceutically acceptable carrier or excipient. Pharmaceutically acceptable carriers or excipients are known in the art. See, for example, Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Company (1990).

[0102] In some embodiments, the GSK-3β inhibitor and the second therapeutic agent can be administered together in a single pharmaceutical composition. Accordingly, in some embodiments, the present disclosure is directed to a pharmaceutical composition comprising a GSK-3β inhibitor, a second therapeutic agent, and at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises a GSK-3β inhibitor; one or more of an apoptosis modulator, a CDK modulator, or an mTOR / AKT / PI3K modulator; and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises one or more of 9-ING-41, tideglusib, or LY2090314, one or more of an apoptosis modulator, a CDK modulator, or an mTOR / AKT / PI3K modulator, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises one or more of 9-ING-41, tideglusib, or LY2090314; one or more of venetoclax, BAY-1143572, or idelalisib; and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises one or more of 9-ING-41, tideglusib, or LY20090314; venetoclax; and a pharmaceutically acceptable carrier or excipient. In other embodiments, the pharmaceutical composition comprises one or more of 9-ING-41, tideglusib, or LY2090314; BAY-1143572; and a pharmaceutically acceptable carrier or excipient. In yet another embodiment, the pharmaceutical composition comprises one or more of 9-ING-41, tideglusib, or LY2090314; idelalisib; and a pharmaceutically acceptable carrier or excipient.

[0103] Representative methods of administering the pharmaceutical compositions and combination therapies are also provided. Various embodiments of the present invention relate to methods of administering pharmaceutical compositions or combination therapies to human patients for the treatment of lymphoma. The methods include administering the pharmaceutical composition or combination therapy by a commonly accepted route of administration (e.g., oral, intravenous, subcutaneous, parenteral, inhalation, topical, etc.). In some embodiments, the pharmaceutical composition or combination therapy can be administered orally, intravenously, and / or subcutaneously. Administration can be carried out using any suitable administration regimen. Suitable administration regimens are known to those of ordinary skill in the art.

[0104] In certain embodiments of the invention, the pharmaceutical composition or combination therapy may be administered to a human patient once daily. In other embodiments, the pharmaceutical composition or combination therapy may be administered to a human patient twice daily. In some embodiments, the pharmaceutical composition or combination therapy may be administered to a human patient between meals.

[0105] In other aspects of the present disclosure, the GSK-3β inhibitor may be administered in combination with another non-chemotherapeutic anti-cancer drug treatment. In some embodiments, the GSK-3β inhibitor is administered in combination with radiation therapy. Thus, in some embodiments, a method of treating a malignant lymphoproliferative disorder comprises administering 9-ING-41 in combination with radiation therapy. In some embodiments, a method of treating a malignant lymphoproliferative disorder comprises administering tideglusib in combination with radiation therapy. In yet another embodiment, a method of treating a malignant lymphoproliferative disorder comprises administering LY2090314 in combination with radiation therapy. [Example]

[0106] The following examples further illustrate certain aspects of the present disclosure and are not intended to limit the scope of the disclosure in any way. Materials - Examples 1 to 5

[0107] Daudi (Burkit) and SUDHL-4 (germinal center (GC) diffuse large B-cell lymphoma (DLBCL)) cell lines were purchased from American Type Culture Collection (ATCC). KPUM-UH1 (double-hit DLBCL) cells were obtained from Junya Kuroda of Kyoto Prefectural University of Medicine. All cell lines were cultured aseptically and maintained at 37°C and 5% CO2 in a water-jacketed incubator (Thermo-Forma). They were supplemented with RPMI-1640 (Corning) containing 0.3 g / mL glutamine, 10% FBS (Sigma), and antibiotic and antimycotic reagent (Gemini Bioproducts; final concentrations: 100 units / mL penicillin G, 100 μg / mL streptomycin sulfate, and 250 ng / mL amphotericin B). Karpas 422 (GC-DLBCL) cells were purchased from Sigma. TMD8 (activated B cell (ABC) DLBCL) cells were obtained from the laboratory of Dr. Louis Stoudt at the National Cancer Institute and maintained as described above, but with 20% FBS. All cell numbers for the assay were quantified using a TC20 automated cell counter (BioRad). All lymphoma cell lines tested express active GSK-3β.

[0108] Venetoclax and Idelalisib were purchased from Selleck Chemicals. BAY-1143572 was purchased from Active Biochem. All drugs were resuspended in DMSO. Drug-free DMSO was used as an untreated control. [Example]

[0109] Example 1 - Viability and proliferation assays (MTS assay) Cell viability at day 3 and proliferation over 7 days were measured after treating cells with varying concentrations of 9-ING-41 using Promega CellTiter 96™ AQueous One Solution Cell Proliferation Assay reagent (MTS) according to the manufacturer's instructions. At the end of treatment, 20 μL of reagent was added per well to a 96-well plate and incubated at 37°C for 2-4 hours. Absorbance at 490 nm (A490) was measured using a Powerwave XS plate reader (Biotek).

[0110] All lymphoma cell lines used in this study express active GSK-3β. SUDHL-4, KPUM-UH1, Karpas 422, or TMD8 lymphoma cells were plated and cell numbers were measured on days 1, 3, 5, and 7 using the MTS assay (see Figure 1). Cell viability on day 3 (Figure 1A) was reduced by 40–70% (p<0.05) upon 1 μM 9-ING-41 treatment, with SUDHL-4 and KPUM-UH1 showing the greatest reduction in cell viability. Upon exposure to 1 μM 9-ING-41, all lymphoma cell lines underwent growth arrest (Figure 1B–1E) and showed less than 30% proliferation compared to controls on day 7 (p<0.05). Cell viability of lymphoma cells was also examined with varying concentrations of 9-ING-41 (0.1 μM, 0.5 μM, 1 μM, 5 μM, and 10 μM), and a decrease in viability was observed at concentrations of 9-ING-41 above 0.5 μM. [Example]

[0111] Example 2 - EnzChek® Caspase 3 Assay The EnzChek Caspase 3 Assay (Thermo Fisher Scientific) was performed according to the manufacturer's instructions. 100,000 cells were plated in 12-well plates and treated in duplicate with various concentrations of 9-ING-41 for 24 hours. At the end of treatment, cells were centrifuged at 200 rcf for 5 minutes, washed once with 1X PBS, and lysed in 50 μL of the 1X lysis buffer provided with the kit. For efficient lysis, cells were subjected to one freeze-thaw cycle. Lysed cells were centrifuged again to remove cellular debris, and the supernatant was used for the assay. 50 μL of a 2X substrate working solution containing Z-DEVD-R110 substrate was added to the cell lysate, followed by incubation at room temperature for 45 minutes. The Rhodamin 110-derived substrate (Z-DEVD-R110) used in this assay is a non-fluorescent bisamide compound that, upon enzymatic cleavage via active caspase 3 and possibly caspase 7 in cell lysates, is converted in a two-step process to a fluorescent monoamide, which is then further converted to the fluorescent R110 product. Both of these products were then measured using a Biotek Synergy 2 fluorescent plate reader at the corresponding wavelengths (excitation 496 nm / emission 520 nm). Fluorescence readings were normalized to the protein amount in the cell lysates, as determined via a standard BCA assay (Pierce Thermo Fisher Scientific). Relative fluorescence was calculated after setting the untreated control at 1.

[0112] The ENZCHEK caspase 3 assay revealed increased caspase 3 / 7 activity observed when lymphoma cells were treated with 9-ING-41 at concentrations of 0.5 μM or higher. Pharmacokinetic studies in xenograft mice suggested that intravenous administration of 20 mg / kg resulted in plasma concentrations of approximately 8 μM and brain concentrations of approximately 40 μM within 30 minutes. Ugolkov A, Qiang W, Bondarenko G, Procissi D, Gaisina I, James CD, Chandler J, Kozikowski A, Gunosewoyo H, O'Halloran T, Raizer J, Mazar AP. Combination therapy with the GSK-3 inhibitor 9-ING-41 and CCNU cured orthotopic chemorefractory glioblastoma in a patient-derived xenograft model. Transl Oncol.2017;10:669-78.https: / / doi.org / 10.1016 / j.tranon.2017.06.003.

[0113] Data from MTS and ENZCHEK caspase-3 assays indicate that 9-ING-41 as a single agent inhibits lymphoma cell line proliferation and reduces lymphoma cell viability. Without intending to be bound by theory, these results suggest that targeting GSK-3β reduces the proliferation and viability of aggressive B-cell lymphoma cell lines and induces divergent effects on survival signaling and DNA damage response, ultimately leading to apoptosis. These effects were independent of the cell origin of the DLBCL cell lines.

[0114] Of particular interest is the activity of 9-ING-41 in the DHL cell line KPUM-UH1, a typical chemotherapy-resistant cell line. Without intending to be bound by theory, Luminex analysis (described below) suggests that 9-ING-41 exerts its effects in KPUM-UH1 cells through downregulation of c-MYC signaling and induction of apoptosis via reduction of survivin. This downregulation of survivin does not appear to be associated with or driven by changes in NF-κB in this cell line. This is in contrast to what has been described in acute lymphoblastic leukemia (ALL), where GSK-3β inhibition sensitizes ALL cells to NF-κB-mediated apoptosis via the effect of survivin. See Hu Y, Gu X, Li R, Luo Q, Xu Y. Glycogen synthase kinase-3β inhibition induces nuclear factor-κB-mediated apoptosis in pediatric acute lymphoblastic leukemia cells. J Exp Clin Cancer Res.2010;29:154.https: / / doi.org / 10.1186 / 1756-9966-29-154. [Example]

[0115] Example 3 - Western Blot Analysis c-MYC levels were analyzed in KPUM-UH1 cells via Western blot after 9-ING-41 alone and in combination with either Venetoclax or BAY-1143572. Approximately 100 million cells were spun down at 200 rcf for 5 min and washed once with PBS before lysing in 50 μl of Millipore Milliplex MAP lysis buffer supplemented with protease and phosphatase inhibitors (Roche). Protein denatured in 4X sample buffer supplemented with β-mercaptoethanol (Bio-Rad) was loaded per well. Bio-Rad stain-free Criterion 4-20% precast gels were used. Gels were run for 90 min at 140 volts, after which the stain-free technology was activated using a Bio-Rad gel imager to visualize the total protein levels loaded in the gel. Proteins were then transferred to membranes using a nitrocellulose turbo transfer pack and system (Bio-Rad). The membranes were blocked for 1 hour with 5% w / v dry milk in Tris-buffered saline 0.1% Tween 20 (TBS-T). The membranes were then incubated overnight with primary antibodies diluted in 5% BSA in 5% TBS-T. The membranes were then washed three times with TBS-T (one 15-minute wash and two 5-minute washes), followed by incubation with the corresponding HRP-conjugated secondary antibodies for 1 hour and subsequent washing with TBS-T as before. After the final wash, the membranes were developed using the Pierce SuperSignal West Pico Chemiluminescence Kit and visualized using a Bio-Rad imaging system. The antibodies used were rabbit anti-GSK-3β (Cell Signaling, Cat. No. 12456), rabbit anti-phospho-GSK-3β (Y216) (Abcam, Cat. No. ab75745), rabbit anti-c-MYC (Cell Signaling, Cat. No. 5605), rabbit anti-c-MYC (Ser 62) (Cell Signaling, Cat. No. 13748), rabbit anti-c-MYC (Thr 58) (Abcam, Cat. No. ab185655), and mouse anti-β-actin (Sigma, Cat. No. A5441) diluted 1:1000.Anti-rabbit HRP and anti-mouse HRP secondary antibodies were purchased from Cell Signaling and used at a 1:5000 dilution. Where necessary, membranes were stripped with RESTORE PLUS Western Blot Stripping Buffer (Pierce) for 10 minutes, washed several times with TBS-T, and then reblocked and reprobed as before. Quantification of band intensity was performed using Image J software (NIH). These experiments in the double-hit lymphoma cell line KPUM-UH1 suggest that 9-ING-41 treatment modifies phospho-c-MYC. [Example]

[0116] Example 4 - Luminex analysis Alterations in NF-κB signaling [MILLIPLEXMAP NF-κB Signaling Magnetic Bead Kit 6-plex Kit, EMD Millipore, analytes: c-MYC, FADD (Ser194), IκBα (Ser32), IKKα / β (Ser177 / Ser181), NF-κB (Ser536), TNFR1], DNA damage [MILLIPLEXMAP DNA Damage / Genotoxicity Magnetic Bead Panel, EMD Millipore, analytes: ATR (total), Chk1 (Ser345), Chk2 (Thr68), H2A.X (Ser139), MDM2 (total), p21 (total), p53 (Ser15)], and apoptotic pathways [Bio-plex pro RBM apoptosis panel 2 and The levels of [Bad, Bax / Bcl-2 dimer, Bcl-xL, Bim, Mcl-1, active caspase 3, Bcl-xL / Bak dimer, Mcl-1 / Bak dimer, and survivin] in cells treated with 1 μM 9-ING-41 for 48 h compared with untreated controls were determined using Luminex multiplex technology on a FLEXMAP 3D instrument according to the manufacturer's instructions. Cells were lysed in MILLIPLEX MAP Lysis buffer supplemented with protease inhibitor cocktail (Sigma) and phosphatase inhibitor cocktails 2 and 3 (Sigma). After BCA protein quantification, 15 μg of protein was added to each well. All samples were run in duplicate. Changes in MFI or absolute amounts between 9-ING-41-treated cells and untreated controls were analyzed, and non-logarithmic t-tests were used to determine statistical significance.

[0117] Analysis of NF-κB signaling revealed a significant decrease in total c-MYC levels in Karpas 422 and TMD8 cell lines, while the remaining cell lines showed only a trend toward a decrease in this protein. DNA damage signaling via assessment of p-H2A.X (Ser139) was found to be increased in SUDHL-4 and Karpas 422 cell lines (both p<0.05). Furthermore, a significant increase in phospho-p53 (Ser15) upon 9-ING-41 treatment was observed in SUDHL-4 and TMD8 cells. Analysis of apoptotic signaling pathways revealed a significant decrease in survivin (~2-fold, p<0.05) and an increase in active caspase-3 in all lymphoma cell lines except TMD8. All lymphoma cell lines, except KPUM-UH1, showed a significant decrease (~2-fold, p<0.05) in Mcl-1 / Bak dimers, whereas Bcl-xl / Bak dimer expression showed a significant decrease (~1.5-fold, p<0.05) in all cell lines except TMD8. [Example]

[0118] Example 5 - Combination Dose Response Daudi, SUDHL-4, KPUM-UH1, Karpas 422, or TMD8 cells were simultaneously treated with a series of concentrations of 9-ING-41 (0 μM, 0.05 μM, 0.5 μM) and either Venetoclax (0 nM, 0.05 μM, 0.5 μM, 5 nM, 5 nM, 50 nM, 500 nM, 5000 nM), BAY-1143572 (0 μM, 0.005 μM, 0.05 μM, 0.5 μM, 5 μM, 50 μM), or Idelalisib (0 μM, 0.005 μM, 0.05 μM, 0.5 μM, 5 μM, 50 μM). See Figure 2. Viability at day 3 using the MTS assay was determined as described above. Background absorbance was subtracted from the A490 of the samples, and the relative A490 of the remaining samples was calculated, with the A490 of the vehicle / untreated control set at 1. IC50 was calculated as the fold change in IC50 of the novel drug when combined with 0.5 μM of 9-ING-41.

[0119] As shown in Figure 3, combination therapy with 9-ING-41 and a second therapeutic agent can reduce the amount of the second therapeutic agent required to produce a given therapeutic effect. As shown, combination treatment of the SUDHL-4 cell line with 0.5 μM 9-ING-41 demonstrated an 8-fold decrease in the IC50 value of Venetoclax. Similarly, when the KPUMUH1 cell line was combined with 0.5 μM 9-ING-41, the IC50 value of Venetoclax was reduced 2-fold. Combination treatment of the SUDHL-4 cell line with 0.5 μM 9-ING-41 resulted in an 8-fold decrease in the IC50 value of BAY-1143572. Combination treatment with 9-ING-41 did not significantly alter the IC50 value of idelalisib in the cell lines examined.

[0120] Materials and Methods—Examples 6-11 Such research is not intended to involve patient input. This lymphoma spore biospecimen protocol is in accordance with the Declaration of Helsinki and was approved by the Mayo Clinic Institutional Review Board. All primary patient samples were biopsied tissue from the spleen or lymph nodes. Fresh tissue samples were gently dissociated into cell suspensions and subjected to Ficoll-Paquet density gradient centrifugation. Primary lymphoma cells were then used directly in proliferation assays or stored at -80°C for later Western analysis after lymphoma diagnosis was confirmed.

[0121] All lymphoma cell lines used in this study were purchased from ATCC (Manassas, VA) or DSMZ (Braunschweig, Germany). DLBCL (diffuse large B-cell lymphoma) lines were cultured in IMDM medium supplemented with 10% human serum (Sigma-Aldrich); TCL (T-cell non-Hodgkin's lymphoma) and MCL (mantle cell lymphoma) lines were maintained in RPMI-1640 medium supplemented with 10% fetal calf serum. The Jeko cell line used for mouse xenograft modeling was stably transduced with Firefly luciferase (Fluc) by lentiviral transduction. Cell lines were routinely checked for mycoplasma infection and authenticated by in-house SNP-based PCR or short tandem repeat profiling by ATCC.

[0122] Antibodies and other reagents Common reagents were from Sigma-Aldrich. Antibodies for immunoblotting, including anti-human GSK3α (Cat#4337), GSK3β (Cat#12456), and phospho-GSK3α-S21 / GSK3β-S9 (Cat#9327), were purchased from Cell Signaling. Mouse anti-GSK3β monoclonal antibody (clone 7 / GSK3β, Cat#610201, BD Biosciences), anti-α-tubulin antibody (clone MD1A, Cat#T9026), and rabbit anti-pericentrin antibody (Cat#ab4448) used for immunofluorescence were purchased from Sigma and Abcam, respectively. Alexa 488- or Alexa 565-conjugated secondary antibodies were from Life Technologies.

[0123] Apoptosis assay Cells were plated in 24-well plates at 5x10 5 Cells were seeded at 1000 x g / well and incubated with the indicated concentrations of 9-ING-41 for 48 h. Cells were then stained with FITC-conjugated Annexin V (Life Technologies) and propidium iodide, followed by analysis on a BD FACS Calibur flow cytometer.

[0124] dna cell cycle Cells were fixed and permeabilized with cold ethanol, treated with RNase, and stained with propidium iodide (Sigma). Stained cells were run on a BD FACS Calibur using CELLQuest PRO software (Becton Dickinson). Data were analyzed using FlowJo vX software (Tree Star Inc.).

[0125] Proliferation assay Cells were plated in a 96-well plate at 1x10 4 Cells / well were seeded and incubated with the indicated concentrations of 9-ING-41 for 48 hours, then pulsed overnight with tritiated thymidine before being analyzed for thymidine incorporation.

[0126] Western immunoblotting Western analysis was performed on a LI-COR Odyssey CLX imager using the LI-COR reagent system as previously described and developed.

[0127] quantitative PCR Total mRNA from lymphoma cell lines was isolated using the RNAeasy kit (Qiagen), and cDNA was synthesized using the Superscript III cDNA Synthesis Kit (Life Technologies). RT-PCR was then performed on an ABI 7500 Real-Time PCR System (Applied Biosystems). 2 qPCR was performed using SYBR Green ROX qPCR Mastermix (Qiagen).

[0128] Drug IC 50 Calculation of The IC50 of 9-ING-41 on cell survival and proliferation was calculated using an online IC50 calculation tool (https: / / www.aatbio.com / tools / ic50-calculator / ).

[0129] Immunohistochemical staining Immunohistochemistry (IHC) on 5-µm-thick paraffin sections was performed according to standard protocols. Tissue sections on slides were deparaffinized with xylene and rehydrated through a series of alcohols. Antigen retrieval was performed with citrate buffer (pH 6.0). Endogenous peroxidase was quenched with 30% hydrogen peroxide. Slides were incubated with anti-GSK3b antibody (BD, 1:150) for 2 hours at room temperature, washed three times with Tris-buffered saline (5 minutes each), and then incubated with biotinylated anti-mouse secondary antibody (1:200) for 1 hour at room temperature. Slides were treated with HRP-conjugated ABC complex (Vectastain, Vector Laboratories) for 1 h at room temperature, then developed with 3,39-diaminobenzidine (DAB, Vector Laboratories), counterstained with methylene blue, mounted with DPX, and examined and imaged under a Nikon Eclipse Ti microscope.

[0130] Immunofluorescence staining for centrosome and spindle localization of GSK3β For co-immunostaining of GSK3β and pericentrin in the centrosome (Figures 8C-8J), we used a partial fixation method by fixing cells on cytospin slides in 3% paraformaldehyde in PBS for 5 minutes at room temperature. Cells were then permeabilized with 0.2% Triton X-100 in PBS for 10 minutes, blocked with 5% BSA in PBS for 1 hour, and immunostained with mouse anti-GSK3β mAb and rabbit anti-pericentrin overnight at 4°C. Cells were then washed and further stained with fluorochrome-conjugated secondary antibodies.

[0131] All other immunostaining of GSK3β and α-tubulin on cytospin preparations of lymphoma cells was performed using 4% paraformaldehyde in PBS for 15 min at room temperature, followed by permeabilization and the same staining steps as above. Cells were analyzed and imaged using a conventional Zeiss microscope or a Zeiss LSR 780 confocal microscope. [Example]

[0132] Example 6. GSK3α and GSK3β are overexpressed in lymphoma cells. We examined the expression of GSK3α and GSK3β in purified human normal B and T cells and DLBCL, MCL, and TCL lymphoma cell lines. RT-qPCR revealed that GSK3α and GSK3β mRNA expression levels were high but variable in most lymphoma cell lines, compared with low expression in normal lymphocytes (Figure 4A). Western blot analysis of GSK3 protein expression revealed that GSK3α protein was strongly expressed in most lymphoma cell lines (except Ly-19), whereas its expression was weak in B and T lymphocytes (Figure 4B, green). Similarly, GSK3β protein was also strongly expressed in all lymphoma cell lines, but very weakly expressed in normal lymphocytes (visible after prolonged exposure; not shown) (Figure 4B, red). These data indicate that GSK3 protein is overexpressed in most B- and T-lymphoma cell lines.

[0133] Western blots showed that both GSK3α and GSK3β proteins were variably phosphorylated across our panel of lymphoma cell lines, as well as in normal lymphocytes. [Example]

[0134] Example 7. GSK3α and GSK3β are functionally important in lymphoma cells. Given that both GSK3α and GSK3β are overexpressed in lymphoma cells and that both enzymes participate in multiple signaling pathways important for cellular function, we investigated whether GSK3α and GSK3β functionally support lymphoma cell survival and proliferation. Treatment of TCL and MCL lines with low doses of 9-ING-41 for 48 h induced apoptosis (Figure 5A); DLBCL lines required higher concentrations (Figure 5B). In contrast, even at a concentration of 10.0 μM, no significant apoptosis was detected in purified normal unstimulated T lymphocytes or peripheral blood mononuclear cells. The inhibitory concentrations of 9-ING-41 at half the maximal effect (IC50) on cell viability of various lymphoma cell lines were calculated (Table 1). [Table 1]

[0135] 9-ING-41 can specifically induce apoptosis in lymphoma cells without affecting normal lymphocytes. To investigate the role of GSK3 in lymphoma cell proliferation, thymidine incorporation assays were performed in the presence or absence of 9-ING-41. The proliferation rates of all TCL and MCL lines were significantly suppressed at concentrations as low as 1.0 μM with 9-ING-41. DLBCL lines required slightly higher concentrations. The IC values ​​of 9-ING-41 on cell proliferation of various lymphoma cell lines were 50 was calculated (Table 1). These data indicate that GSK3 activity is important for lymphoma cell proliferation and survival.

[0136] The GSK3A and GSK3B genes were genetically deleted using CRISPR / CAS9 knockout technology.

[0137] Additionally, guide RNAs (gRNAs) targeting the first coding exons of both GSK3α and GSK3β genes were designed using a web tool (http: / / crispr.mit.edu / ). The gRNA sequences (GSK3α: GACAGATGCCTTTCCGCCGC; GSK3β: CGGCTTGCAGCTCTCCGCAA) were cloned into the px458 vector (Addgene) co-expressing GFP. The constructs were nucleofected into lymphoma cells using a nucleofection kit (Lonza, Basel, Switzerland). 36 hours post-nucleofection, GFP-expressing single cells were sorted into 96-well plates at 1 cell / well on an Aria II FACS sorter. After 2 weeks of culture, each subclone was genotyped by PCR and Sanger DNA sequencing.

[0138] After transient expression of constructs carrying CAS9-T2A-GFP and gRNA-specific GSK3A or GSK3B gene exon 1 sequences, single cells expressing GFP were selected by flow sorting into 96-well plates. After 2–3 weeks of culture, single-cell subclones harboring specific modifications of GSK3A, GSK3B, or both genes were genotyped for gene deletion and verified by Western blot for protein deficiency. As summarized in Table 2, several GSK3A null knockout subclones were readily obtained from all five cell lines tested, and GSK3B null subclones were also obtained from the Ly-1 cell line. However, no knockout subclones were detected when 24–36 single-cell subclones were analyzed from the Ly-19, Jeko, Mino, and Karpas 299 cell lines. CRISPR / CAS9 was a highly efficient approach for Baytril deletion of the GSK3B gene in Ly-1 cells (19 / 24, 79%), but given that there were no GSK3B-null clones in the other lymphoma cell lines tested (0 / 24, 0 / 24, 0 / 36, 0 / 26, 0%), these data support the conclusion that GSK3B is required for lymphoma cell survival in these cell lines. Similar results were observed using shRNA knockdown, showing that GSK3B knockdown was lethal in several lymphoma cell lines except for Ly-1. [Table 2]

[0139] Example 7. GSK3 inhibition blocks G2 / M progression in lymphoma cells. We investigated the effect of 9-ING-41 on lymphoma cell cycle dynamics. Following 9-ING-41 treatment, a cell cycle block at G2 / M was observed in all lines tested after just 24 hours of treatment (Figure 6A), indicating that GSK3 activity is required for successful progression through mitosis. To further determine whether this G2 / M arrest was specifically due to GSK3β inhibition, we examined the cell cycle profiles of parental (wild-type), GSK3A, GSK3B, and GSK3A / B knockout Ly-1 subclones. Without treatment, parental wild-type and GSK3A null Ly-1 subclones displayed normal cell cycle profiles, whereas GSK3B and GSK3A / B knockout subclones showed an increase in cells in G2 / M (Figure 6B). Furthermore, the GSK3A / B double knockout subclones also showed an increase in polymorphic (>4N) cells, likely due to mitotic failure. These cell cycle defects in GSK3B-null and GSK3A / B-null Ly-1 cells are likely mediated by compensatory mechanisms inherent to the Ly-1 cell line and have little impact on the survival of Ly-1 progeny. 9-ING-41 treatment phenocopied the effects of GSK3B single or GSK3A / B double deletion on cell cycle progression, indicating that GSK3B is important for lymphoma cell cycle G2 / M progression and that 9-ING-41 is a potent cell cycle blocker for lymphoma cells. [Example]

[0140] Example 8. GSK3 inhibition arrests lymphoma cells at a pre-mitotic stage. Although cells arrested in G2 / M appear as a single DNA content (4N) peak on flow cytometry histograms (Figure 6A), there are actually at least five consecutive steps (M1-M5) in G2 / M that are critical for successful cell division. These include prophase (M1, chromosome condensation, initiation of mitotic spindle formation), prometaphase (M2, nuclear envelope breakdown, centrosome polarization), metaphase (M3, chromosome pairs align at the midplane), anaphase (M4, separation of daughter chromosomes), telophase (M5, reformation of daughter nuclei), and finally cytokinesis (separation of the two daughter cells). Each of these discrete steps has a unique, distinguishable nuclear morphology on Wright-stained cells (depicted in Figure 7A). To determine at which stage cells become arrested, we examined the morphology of untreated and 9-ING-41-treated JeCHO cells. As shown in Figure 7B (left panel), all M1-M5 mitotic stages were easily identified in untreated Jeco cells, whereas in 9-ING-41-treated cells (right panel), the majority of cells displayed condensed chromosome morphology and reduced cytoplasmic staining resembling protophase (M1) cells, with no identifiable cells with M2-M5 morphology. By differential counting of 100 mitotic cells, all stages of mitotic cells (M1-M5) were found to be easily identifiable in untreated cells; in 9-ING-41-treated mitotic cells, only protophase (M1) cells were identified (Figure 7C). Similar results were observed in other lymphoma lines, including DHL-6, Ly-3, Mino, and Karpas299. These observations support the conclusion that GSK3 activity is required for mitotic progression. [Example]

[0141] Example 9. GSK3β localizes to the centrosome and mitotic spindle in lymphoma cells. We investigated the involvement of GSK3β in two key prophase events, centrosome polarization and mitotic spindle formation. We examined the subcellular localization of GSK3β protein in interphase Jeko or Ly-1 cells by immunofluorescence staining. During interphase, GSK3β was prominently localized in the nucleus in Jeko cells and in centrosome-like paired dots in the cytoplasm (Figure 8A-B). To further demonstrate that these cytoplasmic paired dots are indeed centrosomes, we first stained wt Ly-1 cells for GSK3β protein and pericentrin, a centrosome marker, using an incomplete fixation protocol. We found that the cytoplasmic GSK3β dots perfectly colocalized with pericentrin (Figure 8D-8F). Furthermore, anti-GSK3β antibody staining was shown to be specific for GSK3β protein in GSK3B-null Ly1 cells (Figure 8G-J). From this, we concluded that GSK3β is localized to the centrosome and nucleus in interphase cells.

[0142] To determine the subcellular localization of GSK3β in mitotic cells, we analyzed the localization of GSK3β in normal mitotic JECO cells. GSK3β staining (green, Figure 8K-L) revealed a "fireworks-like" pattern with a centrally polarized centrosome and the mitotic spindle and microtubules extending outward. α-Tubulin showed a similar staining pattern to GSK3β (red, Figure 8M-N), suggesting that GSK3β localizes to microtubules during mitosis. These results suggest that GSK3β specifically localizes to the centrosome and mitotic spindle during mitosis. We also determined the localization of GSK3β in JECO cells treated with 9-ING-41 (Figure 8Q-R). A similar fireworks-like GSK3β staining pattern was observed in all protophase cells without any changes in GSK3β localization. Collectively, these data indicate that GSK3β localizes to centrosomes and the nucleus during interphase (Fig. 8A-B) and to centrosomes and mitotic microtubules during mitosis (Fig. 8K-L). Treatment with 9-ING-41 did not alter the localization of GSK3β, nor did it affect centrosome polarization or microtubule formation. [Example]

[0143] Example 10. Expression and targeting of GSK3 in primary cells from lymphoma patients We examined the expression of GSK3α and GSK3β proteins in freshly isolated primary lymphoma cells from patients with MCL, high-grade B-cell lymphoma, follicular lymphoma grade 3B, DLBCL, or angioimmunoblastic TCL. All five samples showed enhanced expression of GSK3α and GSK3β proteins compared with normal blood B-cell controls (Figure 9A). These patient cells also responded similarly to the antiproliferative effects of 9-ING-41 (Figure 9B). Paraffin samples from another cohort of patients with various types of lymphoma were probed by IHC for GSK3β protein expression. As shown in Figure 9C, overexpression of GSK3β was observed in all samples, with varying intensities. RNA-Seq analysis of primary DLBCL patient samples obtained from the public database of Gene Expression Profile Interactive Analysis (http: / / gepia.cancerpku.cn) also demonstrated increased expression of GSK3α and GSK3β in lymphomas compared with normal lymphocytes.

[0144] We analyzed a cohort of 234 DLBCL patients with clinical survival data (median follow-up 10.5 years (95% CI: 7.9-not reached)) from recently published RNA-Seq data (Schmitz R, Wright GW, Huang DW, et al. Genetics and Pathogenesis of Diffuse Large B-Cell Lymphoma. N Engl J Med. 2018;378(15):1396-1407). Receiver operating characteristic (ROC) curve analysis was performed to dichotomize GSK3α and GSK3β expression and establish optimal cutoff values ​​for high and low expression (10.5 for GSK3α and 8.6 for GSK3β). The OS was significantly higher (p=0.03) in patients with high GSK-3α expression (≥10.5, n=172) than in those with low GSK-3α expression (<10.5, n=62), at 7.8 years (95% OS: 7.2-8.4). Similarly, the OS was significantly higher (p=0.03) in patients with high GSK-3β expression (≥8.6, n=170) than in those with low GSK-3β expression (<8.6, n=62), at 7.8 years (95% OS: 7.2-8.2) and 9.7 years (95% OS: 8.6-11.5). These results suggest that overexpression of either GSK-3α or GSK-3β correlates with poorer clinical outcomes. Furthermore, the grouping data also showed that the majority of DLBCL patients segregated into either GSK3α or GSK3β high expression groups, further validating the conclusion that GSK3α and GSK3β are commonly overexpressed in lymphomas. [Example]

[0145] Example 11. Targeting GSK3 in mouse xenografts of human lymphoma An MCL xenograft mouse model was established by subcutaneously injecting NGS mice with Jeco cells expressing the firefly luciferase reporter gene Fluc.

[0146] NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ) mice used in these experiments were purchased from The Jackson Laboratory (Bar Harbor, ME). Eight to ten 8-week-old mice of the same sex were subcutaneously injected with 5 x 10 Fluc-expressing Jeko cells in the right flank. Tumor implantation was confirmed by imaging 4 days after Jeko cell inoculation. Tumor-implanted mice were randomly grouped into control and treatment groups and subsequently untreated or treated with 9-ING-41 via IP injection as indicated. Tumor volume was measured with an IVIS imager (Xenogen, Alameda, CA) 20 minutes after IP injection of 200 μl of 15 mg / ml D-leuciferin (GoldBio, St. Louis, MO) while anesthetized with 2.5% isoflurane. All imaging parameters were maintained consistent for comparability. The experiment was terminated when the largest tumor met the size limit of the IACUC protocol.

[0147] In two independent experiments, 8 and 10 mice bearing implanted tumors confirmed by imaging (usually 4 days after tumor inoculation) were randomly assigned to either control or 9-ING-41 treatment 40 mg / kg IP every other day (Figure 10A). As shown in Figure 10B, mice in the control (untreated) group had large tumors with significant luciferase activity by day 17; however, 9-ING-41-treated mice had small tumors with much lower luciferase activity. These data demonstrated that 9-ING-41 has single-agent antitumor activity in a mouse model of MCL. [Example]

[0148] Example 12 Treatment of Diffuse Large B-Cell Lymphoma (DLBCL) with 9-ING-41 A human with diffuse large B-cell lymphoma was given 9-ING-41 at 1 mg / kg daily in six 21-day cycles. After treatment, the patient's DLBCL went into remission. [Example]

[0149] Example 13 Treatment of Mantle Cell Lymphoma (MCL) with 9-ING-41

[0150] Humans suffering from mantle cell lymphoma were given 9-ING-41 at 3 mg / kg daily for six 21-day cycles. After treatment, the human's MCL went into remission. [Example]

[0151] Example 14 Treatment of T-cell lymphoma (TCL) with 9-ING-41 A human suffering from T-cell lymphoma (non-Hodgkin's) is given 9-ING-41 at 2 mg / kg per day for six 21-day cycles. After treatment, the human's T-cell lymphoma goes into remission.

[0152] See Karmali, et al., GSK-3β inhibitor, 9-ING-41, reduces cell viability and halts proliferation of B-cell lymphoma cell lines as a single agent and in combination with novel agents, Oncotarget. 2017 Dec 29;8(70):114924-114934, the entirety of which is incorporated herein by reference.

[0153] See Wu, et al., Targeting glycogen synthase kinase 3 for therapeutic benefit in lymphoma, Blood. Published online May 17, 2019 (http: / / www.bloodjournal.org); doi:10.1182 / blood.2018874560, the entire disclosure of which is incorporated herein by reference.

Claims

1. 1. A GSK-3β inhibitor for use in the treatment of a malignant T-cell lymphoproliferative disorder in a patient in need thereof, wherein the GSK-3β inhibitor is 3-(5-fluorobenzofuran-3-yl)-4-(5-methyl-5H-[1,3]dioxolo[4,5-f]indol-7-yl)pyrrole-2,5-dione (9-ING-41).

2. In the GSK-3β inhibitor according to claim 1, the malignant T-cell lymphoproliferative disorder is selected from the group consisting of T-cell leukemia / lymphoma, extravascular natural killer / T-cell lymphoma, cutaneous T-cell lymphoma, enteropathic T-cell lymphoma, angioimmunoblastic T-cell lymphoma, anaplastic large T / null cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, T-cell acute lymphoblastic leukemia, T-cell large lymphocytic leukemia, lymphoblastic phase chronic myeloid leukemia, post-transplant lymphoproliferative syndrome, human T-cell leukemia virus type 1 positive (HTLV-1 + ) A GSK-3β inhibitor for adult T-cell leukemia / lymphoma (ATL), T-cell prolymphocytic leukemia (T-PLL), or T-cell lymphoma not otherwise specified.

3. 3. The GSK-3β inhibitor according to claim 1 or 2, wherein the malignant lymphoproliferative disorder is resistant to chemotherapy.

4. The GSK-3β inhibitor of any one of claims 1 to 3, wherein the GSK-3β inhibitor is administered in combination with a second therapeutic agent.

5. 5. The GSK-3β inhibitor of claim 4, wherein the second therapeutic agent is administered in a sub-therapeutic amount.

6. The GSK-3β inhibitor according to claim 4 or 5, wherein the second therapeutic agent is an anticancer agent.

7. 7. The GSK-3β inhibitor of claim 6, wherein the anticancer drug is a Bcl-2 inhibitor, and the Bcl-2 inhibitor is venetoclax, ABT-737, or navitoclax.

8. The GSK-3β inhibitor of claim 7, wherein the Bcl-2 inhibitor is venetoclax.

9. 7. The GSK-3β inhibitor according to claim 6, wherein the anticancer drug is a CDK9 inhibitor, and the CDK9 inhibitor is BAY-1143572, LDC000067, dinaciclib (SCH727965), SNS-032 (BMS-387032), AT7519, P276-00, AZD5438, PHA-767491, or PHA-793887.

10. The GSK-3β inhibitor according to claim 9, wherein the CDK9 inhibitor is BAY-1143572.

11. The GSK-3β inhibitor according to claim 6, wherein the anticancer drug is a PI3K inhibitor, and the PI3K inhibitor is copanlisib or idelalisib.

12. The GSK-3β inhibitor according to claim 11, wherein the PI3K inhibitor is idelalisib.

Citation Information

Patent Citations

  • Adult t-cell leukemia therapeutic agent

    JP2016060741A