DNA, expression vector, transcript, cell, pharmaceutical composition, drug

Abstract

To provide a novel pharmaceutical composition.SOLUTION: A pharmaceutical composition contains DNA encoding a suicide gene having at least one intron sequence, where the DNA is constituted such that the intron sequence has a donor sequence or an acceptor sequence, which is used for abnormal splicing that occurs in a tumor cell but does not occur in a normal cell, in itself, the suicide gene is expressed in a transcript of the DNA in the case where the abnormal splicing occurs, and the suicide gene is not expressed in the case where the abnormal splicing does not occur.SELECTED DRAWING: Figure 2

Description

[Technical Field]

[0001] The present invention relates to DNA, expression vectors, transcripts, cells, pharmaceutical compositions, and medicines. [Background technology]

[0002] It has been reported that mutations in specific amino acids in spliceosome components such as SF3B1, SRSF2, U2AF35, and ZRSR2 can be a cause of tumorigenesis in myelodysplastic syndromes (MDS), myeloid leukemia, lymphocytic leukemia, and uveal melanoma (Non-Patent Document 1). As a result, donor or acceptor sequences that do not function in normal cells are utilized, causing aberrant splicing, resulting in the expression of abnormal proteins or the suppression of normal protein expression, leading to tumorigenesis in cells (Non-Patent Documents 2-4). [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Kenichi Yoshida et al., Nature 2011 [Non-patent document 2] H Dolatshad et al., Leukemia, 2016 [Non-patent document 3] Daichi Inoue et al., Nature, 2019 [Non-patent document 4] Lili Wang et al., Cancer Cell, 2016 Summary of the Invention [Problem to be solved by the invention]

[0004] An object of the present invention is to provide novel DNA, expression vectors, transcripts, cells, pharmaceutical compositions, and medicines. [Means for solving the problem]

[0005] One embodiment of the present invention is a DNA encoding a suicide gene having at least one intron sequence, wherein the intron sequence has a donor sequence or an acceptor sequence utilized for aberrant splicing that occurs in tumor cells but not in normal cells, the intron sequence comprises a sequence selected from an intron of a gene encoding at least one protein selected from the group consisting of DYNLL1, HINT2, MAP3K7, TMEM14C, and BRD9; When the abnormal splicing occurs in the transcript of the DNA, the suicide gene is expressed, and when the abnormal splicing does not occur, the suicide gene is not expressed. 、 It is configured as The sequence containing HINT2 is the sequence shown in SEQ ID NO: 1 in the Sequence Listing, the sequence containing DYNLL1 is the sequence shown in SEQ ID NO: 2 in the Sequence Listing, the sequence containing MAP3K7 is the sequence shown in SEQ ID NO: 3 in the Sequence Listing, the sequence containing BRD9 is the sequence shown in SEQ ID NO: 4 in the Sequence Listing, and the sequence containing TMEM14 is the sequence shown in SEQ ID NO: 5 in the Sequence Listing. , DNA . before The suicide gene may encode a cell death-inducing protein, a cell division inhibitory protein, or a protein that converts a cell death-inducing compound or a precursor of a cell division inhibitory compound into the cell death-inducing compound or the cell division inhibitory compound. The suicide gene may also be a gene encoding a protein selected from the group consisting of herpes simplex type 1 thymidine kinase (HSV-TK), cytosine deaminase (CD), inducible caspase 9 (iCasp9), streptolysin O, and diphtheria toxin. When normal splicing occurs, the suicide gene may not be expressed due to a frameshift. The intron sequence may have a branch point.

[0006] Another embodiment of the present invention is an expression vector containing any of the above DNAs. The suicide gene The gene may have a promoter that causes the gene to be specifically expressed in the tumor cells. The suicide gene Expressed in eukaryotic cells to make It may have a promoter. The suicide gene Specifically expressed in hematopoietic stem cells or melanocytes to make It may have a promoter.

[0007] A further embodiment of the present invention is a transcript of any of the above DNAs.

[0008] A further embodiment of the present invention is a cell comprising any of the above DNAs, any of the above expression vectors, or any of the above transcripts.

[0009] A further embodiment of the present invention is a pharmaceutical composition comprising any of the above DNAs, any of the above expression vectors, any of the above transcripts, or any of the above cells as an active ingredient.

[0010] A further embodiment of the present invention is a medicament comprising any one of the pharmaceutical compositions described above. The medicament may be an antitumor agent. In this case, the disease to be treated may be myelodysplastic syndrome (MDS), myeloid leukemia, lymphocytic leukemia, or uveal melanoma. In a further embodiment of the present invention, the insertion positions of DYNLL1, HINT2, MAP3K7, TMEM14C, and BRD9 into the gene encoding herpes simplex type 1 thymidine kinase (HSV-TK) may be DNA immediately after bases 465, 152, 147, 277, and 799 from the start codon of HSV-TK, respectively. [Effects of the Invention]

[0011] The present invention makes it possible to provide novel DNAs, expression vectors, transcripts, cells, pharmaceutical compositions, and medicines. [Brief explanation of the drawings]

[0012] [Figure 1] This is a schematic diagram of a recombinant gene according to one embodiment of the present invention, in which an intron sequence, which uses an acceptor sequence 10-20 bases upstream in cells with abnormal splicing, has been inserted immediately downstream of the ATG of a suicide gene. If normal splicing occurs, the entire intron sequence is removed; if aberrant splicing occurs, the 10-20 bases 3' of the intron sequence remain. Because a guanine is inserted immediately after the intron, if normal splicing occurs, a frameshift occurs and the suicide gene is not expressed. However, if aberrant splicing occurs, the suicide gene is expressed due to in-frame binding. [Figure 2] This is a schematic diagram of a recombinant gene in one embodiment of the present invention, in which an intron sequence that is spliced ​​only in cells with abnormal splicing is inserted into the suicide gene. If splicing does not occur, translation stops within the intron and the suicide gene is not expressed, but if splicing occurs, the full-length suicide gene is expressed during abnormal splicing. [Figure 3]Figure 1 shows the structure of an HSV-TK expression vector (A) and the intron insertion position in the HSV-TK gene sequence (B) in an example of the present invention. (A) Expression of HSV-TK is induced by the SFFV promoter together with a puromycin resistance gene linked by the ribosomal skipping site P2A. (B) The intron insertion position of each gene shown in the figure is indicated by the base length from the start codon of the HSV-TK gene. [Figure 4] FIG. 1 is a diagram showing a time schedule of an experiment in an example of the present invention. [Figure 5] 1 is a graph showing the results of measuring GCV concentration-dependent cell death in an example of the present invention. The change in cell number is shown as viability (%), based on the number of cells without GCV addition. ■ indicates the SF3B1 K700E mutant expression group, and ● indicates the SF3B1 wild-type overexpression group as a control. [Figure 6] This shows the results of DNA sequencing of HEK293FT cells in which the SF3B1 K700E mutation was introduced into one allele by genome editing in an example of the present invention. It can be seen that C and T overlap at position 111. [Figure 7] 1 is a graph showing the results of measuring GCV concentration-dependent cell death in an example of the present invention. The change in cell number is shown as viability (%), with the number of cells without GCV added as the reference. ■ indicates the results for SF3B1 K700E mutant cells, and ● indicates the results for SF3B1 normal cells as a control. DETAILED DESCRIPTION OF THE INVENTION

[0013] Hereinafter, embodiments of the present invention will be described in detail with reference to the drawings. The objects, features, advantages, and concepts of the present invention will be apparent to those skilled in the art from the description in this specification, and those skilled in the art will be able to easily reproduce the present invention from the description in this specification. The embodiments and specific examples of the invention described below show preferred embodiments of the present invention and are shown for illustrative or explanatory purposes, and are not intended to limit the present invention thereto. It will be apparent to those skilled in the art that various changes and modifications can be made based on the description in this specification within the spirit and scope of the present invention disclosed herein.

[0014] (1) Recombinant gene In an embodiment disclosed herein, the recombinant gene is DNA encoding a suicide gene having at least one intron sequence, the intron sequence containing a donor or acceptor sequence used for aberrant splicing that occurs in tumor cells but not in normal cells. The intron sequence is configured so that the suicide gene is expressed when aberrant splicing occurs in the DNA transcript, and the suicide gene is not expressed when aberrant splicing does not occur. Note that, as used herein, "normal" refers to an event that occurs when a wild-type protein is produced from a wild-type gene, and "abnormal" refers to an event that occurs when splicing that is different from the normal process occurs, resulting in a protein that is different from the wild-type protein. Here, wild-type may include mutations other than those that occur in aberrant splicing. For example, a normal cell refers to a cell in which splicing of a target gene occurs normally and a wild-type protein is produced, and an abnormal acceptor sequence refers to an acceptor sequence used in splicing that is different from the normal process.

[0015] The suicide gene may be any gene that suppresses cell proliferation upon expression of the encoded protein, including, but not limited to, genes encoding cell death-inducing proteins or cell division inhibitory proteins. Alternatively, the suicide gene may encode a protein that converts a precursor (e.g., a prodrug) of a cell death-inducing or cell division inhibitory compound into the cell death-inducing or cell division inhibitory compound. Specific examples include, but are not limited to, genes encoding herpes simplex virus type 1 thymidine kinase (HSV-TK), cytosine deaminase (CD), inducible caspase 9 (iCasp9), streptolysin O, or diphtheria toxin. Among these, drugs with drug-induced cytotoxicity are preferred. For example, HSV-TK converts nontoxic ganciclovir (GCV) into toxic phosphorylated metabolites, necessitating co-administration of GCV to inhibit cell proliferation. Furthermore, CD converts nontoxic 5-fluorocytosine (5-FC) into toxic 5-fluorouracil (5-FU), necessitating co-administration of 5-FC to inhibit cell proliferation. Alternatively, iCasp9, a fusion protein of human caspase-9 and recombinant human FK-binding protein, induces apoptotic cell death only after dimerization, and therefore exerts its toxicity only when treated with AP1903 or AP20187, which induce dimerization (Karin C et al., Blood, 2005).

[0016] The tumor cells are not particularly limited as long as they exhibit abnormal splicing, and examples thereof include myelodysplastic syndrome (MDS), myeloid leukemia, lymphocytic leukemia, uveal melanoma, etc. The mechanism of abnormal splicing is also not particularly limited, but it is preferably caused by mutations in spliceosome components such as SF3B1, SRSF2, U2AF35, and ZRSR2.

[0017] The intron sequence is not particularly limited as long as it has a donor or acceptor sequence used in aberrant splicing that occurs in tumor cells but not in normal cells, and may be an intron sequence derived from a natural gene or an artificial sequence. Even if the sequence is artificial, the portion other than the donor or acceptor sequence used in aberrant splicing preferably has 60% or more homology with the intron sequence of the natural gene, more preferably 80% or more homology, even more preferably 90% or more homology, even more preferably 95% or more homology, and even more preferably 99% or more homology. Here, homology can be evaluated using known programs.

[0018] Splicing occurs in two steps, and the first step involves a specific base called the branch point. Therefore, it is preferable that the intron sequence used in the recombinant gene of the present disclosure contains a branch point.

[0019] Specifically, examples include sequences selected from introns of genes encoding at least one protein selected from the group consisting of HINT2, DYNLL1, MAP3K7, BRD9, and TMEM14C. For example, sequences combining 30-70 base pairs from the 5' end and 30-90 base pairs from the 3' end of the intron between exons 4 and 5 of HINT2 (NM_032593.3), the intron between exons 1 and 2 of DYNLL1 (NM_003746.3), or the intron between exons 4 and 5 of MAP3K7 (NM_003188.4) (SEQ ID NOS: 1-3, respectively) are included. These sequences contain a normal acceptor sequence, and a single base (in this case, G) is inserted immediately after the intron sequence so that normal splicing in normal cells results in a frameshift in the suicide gene, preventing normal protein expression (Figure 1). Therefore, recombinant genes containing these intron sequences do not affect the proliferation of normal cells. On the other hand, if splicing occurs in tumor cells using the abnormal acceptor sequence within the intron, the reading frame of the suicide gene becomes in-frame and the normal protein encoded by the suicide gene is expressed, so that recombinant genes containing these intron sequences suppress tumor cell proliferation (Figure 1).

[0020] Another example of an intron sequence is a sequence consisting of 30–70 bases from the 5' end of the intron between exons 1 and 2 of TMEM14C (NM_016462.4) and 20–50 bases from an aberrant acceptor sequence located approximately 13–20 bases upstream from the 3' end (SEQ ID NO: 5). Because these intron sequences lack the normal acceptor sequence, in normal cells, the inserted intron is not removed by splicing, resulting in translation arrest or frameshift within the intron, preventing the suicide gene from being expressed (Figure 2). Therefore, recombinant genes containing these intron sequences do not affect the proliferation of normal cells. On the other hand, in tumor cells, the aberrant acceptor sequence is utilized, resulting in aberrant splicing and removal of the intron, resulting in the expression of the normal protein encoded by the suicide gene. Therefore, recombinant genes containing these intron sequences suppress tumor cell proliferation (Figure 2).

[0021] Alternatively, the suicide gene sequence may contain an intron sequence consisting of 39 bases from the 5' end and 82 bases from the 3' end of the intron between exons 14 and 15 of BRD9 (XM_024446194.1) (SEQ ID NO: 4). In this case, too, in normal cells, the intron is not removed by splicing, resulting in translation arrest and no expression of the suicide gene (Figure 2). On the other hand, in tumor cells, the intron is removed by splicing, resulting in expression of the suicide gene (Figure 2).

[0022] Regarding sequences 1 to 4, the sequences of the following parts are particularly important, and in these parts, it is preferable that they have a homology of 60% or more, more preferably a homology of 80% or more, even more preferably a homology of 90% or more, even more preferably a homology of 95% or more, and even more preferably a homology of 99% or more. SEQ ID NO: 6: Sequence from the branch point of the HINT2 intron to the normal acceptor site (including the branch point base and the acceptor sequence. The same applies below.) SEQ ID NO: 7: Sequence from the branch point of the DYNLL1 intron to the normal acceptor site SEQ ID NO: 8: Sequence from the branch point of the intron of MAP3K7 to the normal acceptor site SEQ ID NO: 9: Sequence from the branch point of the BRD9 intron that does not contain the normal acceptor sequence to the aberrant acceptor site SEQ ID NO: 10: Sequence from the branch point of the TMEM14C intron that does not contain the normal acceptor sequence to the aberrant acceptor site

[0023] The expression vectors disclosed herein are capable of expressing the recombinant suicide gene in cells. Examples include plasmid vectors and viral vectors (e.g., vectors derived from adenovirus, vaccinia virus, lentivirus, herpes simplex virus, baculovirus, retrovirus, adeno-associated virus (AAV), rhinovirus, human immunodeficiency virus (HIV), Sendai virus, and filovirus). However, vectors derived from AAV, adenovirus, or Sendai virus are particularly preferred, as they have high transduction efficiency and do not integrate into the genome.

[0024] These expression vectors have a promoter for expressing a recombinant gene.

[0025] (2) Pharmaceuticals The pharmaceutical compositions disclosed herein may contain as an active ingredient the recombinant gene, an expression vector containing the recombinant gene, or a transcript of the recombinant gene (mRNA and its precursor). In addition, they may contain a delivery agent for administering the nucleic acid to a patient. Known delivery agents can be used, including exosomes, virosomes, lipid nanoparticles, and liposomes.

[0026] Furthermore, the pharmaceutical compositions disclosed herein may contain, as an active ingredient, the above-mentioned recombinant gene, an expression vector containing the recombinant gene, or cells containing a transcript of the recombinant gene (mRNA and its precursor). These cells can be used, for example, as follows: In autologous hematopoietic stem cell transplantation after the administration of a large amount of anticancer drug or whole-body radiation therapy, the above-mentioned nucleic acid vector is introduced ex vivo into previously collected hematopoietic stem cells, killing tumor cells and allowing only normal cells to survive, thereby obtaining only normal hematopoietic stem cells, which can then be re-transplanted into the patient.

[0027] The pharmaceutical composition of the present disclosure can be used as a medicine, and the target disease is not limited as long as it is caused by aberrant splicing, but is particularly preferably used as an antitumor agent. The tumor cells may be those in which aberrant splicing occurs, such as myelodysplastic syndrome (MDS), myeloid leukemia, lymphocytic leukemia, and uveal melanoma. The mechanism of aberrant splicing is also not particularly limited, but it is preferably caused by mutations in spliceosome components (e.g., SF3B1, SRSF2, U2AF35, ZRSR2). [Example]

[0028] In this example, to verify the toxicity of the suicide gene in cells expressing the SF3B1 K700E mutant, HEK293FT cells (ThermoFisher Scientific) were co-transfected with pHR-SFFVp-SF3B1 K700E (SEQ ID NO: 18), pHR-SFFVp-HSVTK-puro containing each intron (Figure 3A, B; SEQ ID NOs: 11-15), and the intron-free control pHR-SFFVp-HSVTK-puro (SEQ ID NO: 16). Cell death upon addition of GCV was quantified using an MTT assay. The detailed procedure is described below. The time schedule is shown in Figure 4. The nucleotide sequences used are also described below.

[0029] SEQ ID NO: 11: A sequence comprising an SFFV promoter, HSV-TK into which a BRD9 intron not containing a normal acceptor sequence has been inserted, and a puromycin resistance gene linked to HSV-TK by the P2A sequence

[0030] SEQ ID NO: 12: A sequence comprising an SFFV promoter, HSV-TK into which an intron of TMEM14C not containing a normal acceptor sequence has been inserted, and a puromycin resistance gene linked to HSV-TK by the P2A sequence

[0031] SEQ ID NO: 13: A sequence obtained by linking the SFFV promoter, HSV-TK into which the HINT2 intron (SEQ ID NO: 1) containing the normal acceptor sequence has been inserted, and the puromycin resistance gene linked to HSV-TK by the P2A sequence

[0032] SEQ ID NO: 14: A sequence obtained by linking the SFFV promoter, HSV-TK into which the DYNLL1 intron (SEQ ID NO: 2) containing the normal acceptor sequence has been inserted, and the puromycin resistance gene linked to HSV-TK by the P2A sequence

[0033] SEQ ID NO: 15: A sequence comprising an SFFV promoter, HSV-TK into which an intron (SEQ ID NO: 3) of MAP3K71 containing a normal acceptor sequence has been inserted at position 5, and a puromycin resistance gene linked to HSV-TK by the P2A sequence.

[0034] SEQ ID NO: 16: Sequence of the SFFV promoter, HSV-TK, and puromycin resistance gene linked to HSV-TK by the P2A sequence

[0035] The specific experimental method will be described in detail below.

[0036] First, 1 × 10 cells were suspended in DMEM medium (cDMEM medium) containing 10% bovine serum (Corning) and penicillin-streptomycin (Nacalai Tesque). 6 pieces / mL The HEK293FT cells were seeded onto a 96-well plate at 50 μL / well and cultured in a cell culture device adjusted to 37°C and a CO 2 concentration of 5%.

[0037] After 24 hours, HEK293FT cells were co-transfected with 50 ng of pHR-SFFVp-SF3B1 WT (wild-type SF3B1 with a FLAG tag attached to the N-terminus; the amino acid sequence is shown in SEQ ID NO: 19) (SEQ ID NO: 17) or pHR-SFFVp-SF3B1 K700E (SF3B1 with a FLAG tag attached to the N-terminus; the amino acid sequence is shown in SEQ ID NO: 20) (SEQ ID NO: 18) and 50 ng of each pHR-SFFVp-HSVTK-puro (SEQ ID NOs: 11 to 16) using Lipofectamine 3000, and then cultured at 37°C in a cell culture device adjusted to a CO2 concentration of 5%.

[0038] After 24 hours, the culture supernatant was completely removed and replaced with 100 μL of GCV-containing cDMEM medium (GCV final concentrations: 500, 100, 20, and 0 μg / mL). The cells were cultured in a cell culture device adjusted to 5%.

[0039] After 48 hours, HEK293FT cells were suspended in cDMEM medium at cell concentrations of 20, 10, 5, 2.5, 1.25, and 0 × 10. 5 The concentration was adjusted to cells / mL and seeded at 100 μL / well on a 96-well plate to serve as a standard for cell counting.

[0040] MTT solution from an MTT cell count measurement kit (Nacalai Tesque) was added at 10 μL / well, and the cells were cultured for 4 hours in a cell culture device adjusted to 37°C and a CO 2 concentration of 5%.

[0041] 100 μL / well of the solubilization solution from the MTT cell count measurement kit (Nacalai Tesque) was added, and the plate was incubated for 20 hours in a humid environment at 37°C.

[0042] The absorbance was measured at 570 nm (reference wavelength 655 nm) using a microplate reader (SH-9000Lab, Hitachi High-Tech).

[0043] The number of viable cells was calculated based on a standard curve using the above-mentioned serially diluted HEK293FT cells, and the viability was expressed as a percentage of the cell count in the GCV-free group, which was set at 100%. The specific cytotoxicity in cells with abnormal splicing was evaluated by comparing it with the control group expressing SF3B1 WT (SEQ ID NO: 17). The results for each condition are shown in Figure 5.

[0044] As shown in Figure 5, under each condition, cells with an abnormal splicing mechanism due to the suicide gene containing each intron had a lower survival rate than normal cells without that mechanism. [Example]

[0045] In this example, to verify the toxicity of the suicide gene in cells carrying the SF3B1 K700E mutation in one allele in the genome, similar to actual cancer cells, HEK293FT cells were genome-edited to establish an SF3B1 K700E mutant cell line.

[0046] Meanwhile, an HSV-TK expression lentiviral vector containing the BRD9 intron was constructed using the pHR vector shown in SEQ ID NO: 11 (Fig. 3A, B). This lentiviral vector was introduced into the SF3B1 K700E mutant strain and the SF3B1 normal control strain, and the cell death rate upon addition of GCV was quantified using the MTT assay. The detailed procedure is shown below.

[0047] First, 1 x 10 cells were suspended in cDMEM medium. 6 HEK293FT cells were seeded at 1.5 mL / well in a 6-well plate at 1 / mL and cultured in a cell culture device adjusted to 37°C and a CO2 concentration of 5%.

[0048] After 24 hours, Lipofectamine CRISPRMAX (ThermoFisher Scientific) was used to transfect the cells with 6.25 μg of TrueCut Cas9 Protein v2 (ThermoFisher Scientific), 1.2 μg of guide RNA for SF3B1 (AACUUUCUGCUCAUCCA) (SEQ ID NO: 21), SF3B1 K700E 100 pmol of ssODN (single-stranded DNA: SEQ ID NO: 22) for mutation was co-transfected into HEK293FT cells, and then cultured in a cell culture device adjusted to 37°C and a CO2 concentration of 5%.

[0049] After 24 hours, the culture supernatant was removed, and the cells were separated into single cells using trypsin-EDTA solution (Nacalai Tesque), diluted to 2 cells per 10 wells, and seeded onto a 96-well plate. SF3B1 K700E By directly sequencing the surrounding area, SF3B1 K700E The mutant strains were screened and the resulting mutant strains were propagated.

[0050] For direct sequencing, the genome of the alkaline-heat-extracted cells was amplified by PCR using KOD One (TOYOBO) and primers (GTTGATATATTGAGAGAATCTGGATG (SEQ ID NO: 23) and AAATCAAAAGGTAATTGGTGGA (SEQ ID NO: 24)). The resulting amplified product was purified and used as a template to determine the base sequence. The base sequence obtained is shown in Figure 6. In this way, it was confirmed that the SF3B1 K700E mutation had indeed been introduced into one of the alleles.

[0051] Next, to prepare lentivirus, 1.2 × 10 cells suspended in cDMEM medium were used. 6 HEK293FT cells were seeded at 4 mL / well in a T25 flask and cultured at 37°C in a cell culture device adjusted to a CO2 concentration of 5%.

[0052] After 24 hours, HEK293FT cells were co-transfected with an HSV-TK expression vector (pHR-SFFVp-HSVTK-puro containing the BRD9 intron: SEQ ID NO: 11) and packaging vectors (pCMVR8.74, pMD2.G, and pAdVAntage) using a 1 mg / mL solution of Polyethylenimine (Polysciences). The cells were then cultured in a cell culture device adjusted to 37°C and a CO2 concentration of 5%. After 24 hours, the medium was replaced with fresh cDMEM medium, and the culture supernatant was collected after 48 and 72 hours.

[0053] The collected culture supernatant was added to SF3B1 K700E mutant cells derived from HEK293FT cells and normal SF3B1 cells, which were then infected with the prepared lentivirus.

[0054] After 48 hours, puromycin was added to a final concentration of 4 μg / mL, and the cells were cultured for an additional 48 hours to select only the transduced cells.

[0055] The resulting BRD9 intron-containing HSV-TK-expressing HEK293FT cells SF3B1 K700E cell line SF3B1 normal cells derived from HEK293FT cells expressing HSV-TK containing the BRD9 intron were suspended in cDMEM medium at a cell concentration of 4 × 10 5 The concentration was adjusted to cells / mL and seeded at 50 μL / well on a 96-well plate.

[0056] 50 μL of GCV-containing cDMEM medium (GCV final concentrations: 100, 20, 4, 0.8, 0.16, and 0 μg / mL) was added, and the cells were then cultured in a cell culture device adjusted to 37°C and a CO 2 concentration of 5%.

[0057] After 48 hours, HEK293FT cells were suspended in cDMEM medium at cell concentrations of 40, 20, 10, 5, 2.5, 1.25, 0.625, and 0 × 10. 5 The concentration was adjusted to cells / mL and seeded at 100 μL / well on a 96-well plate to serve as a standard for cell counting.

[0058] MTT solution from an MTT cell count measurement kit (Nacalai Tesque) was added at 10 μL / well, and the cells were cultured for 4 hours in a cell culture device adjusted to 37°C and a CO 2 concentration of 5%.

[0059] The solubilization solution of the MTT cell count measurement kit (Nacalai Tesque) was added at 100 μL / well and incubated at 37° C. After 20 hours, the absorbance was measured at 570 nm (reference wavelength 655 nm) using a microplate reader.

[0060] The number of viable cells was calculated based on a standard curve using the above serially diluted HEK293FT cells, and the viability was expressed as a percentage of the number of cells in the GCV-free group, which was set at 100%. Furthermore, the efficacy of GCV was evaluated by comparing the cytotoxicity of normal SF3B1 cells with that of SF3B1 K700E mutant cells. SF3B1 K700E The survival rates of mutant and normal cells are shown in a graph.

[0061] As shown in FIG. 7, the survival rate of SF3B1 K700E mutant cells mutated by a suicide gene containing the BRD9 intron was lower than that of normal SF3B1 cells.

Claims

1. DNA encoding a suicide gene having at least one intron sequence, the intron sequence has within it a donor or acceptor sequence that is utilized for aberrant splicing that occurs in tumor cells but not in normal cells; The intron sequence comprises a sequence selected from an intron of a gene encoding at least one protein selected from the group consisting of DYNLL1, HINT2, MAP3K7, TMEM14C, and BRD9; In the transcript of the DNA, When the abnormal splicing occurs, the suicide gene is expressed, The suicide gene is configured so that it is not expressed when the abnormal splicing does not occur, The sequence containing HINT2 is the sequence shown in SEQ ID NO: 1 in the sequence listing, The sequence containing DYNLL1 is the sequence shown in SEQ ID NO: 2 in the sequence listing, The sequence containing MAP3K7 is the sequence shown in SEQ ID NO: 3 in the sequence listing, The sequence containing BRD9 is the sequence shown in SEQ ID NO: 4 in the Sequence Listing, The sequence containing TMEM14 is the sequence shown in SEQ ID NO: 5 in the sequence listing, DNA.

2. The DNA of claim 1, wherein the suicide gene encodes a cell death-inducing protein, a cell division inhibitory protein, or a protein that converts a cell death-inducing compound or a precursor of a cell division inhibitory compound into said cell death-inducing compound or said cell division inhibitory compound.

3. 3. The DNA of claim 1 or 2, wherein the suicide gene is a gene encoding a protein selected from the group consisting of herpes simplex type 1 thymidine kinase (HSV-TK), cytosine deaminase (CD), inducible caspase 9 (iCasp9), streptolysin O, and diphtheria toxin.

4. The DNA according to any one of claims 1 to 3, wherein when normal splicing occurs, the suicide gene is not expressed due to frameshift.

5. The DNA according to any one of claims 1 to 4, wherein the intron sequence has a branch point.

6. An expression vector comprising the DNA according to any one of claims 1 to 5.

7. The expression vector of claim 6 , wherein the DNA has a promoter that causes specific expression in the tumor cells.

8. The expression vector of claim 7 , which has a promoter that is expressed in eukaryotic cells.

9. The expression vector according to claim 7 or 8, which has a promoter that is specifically expressed in hematopoietic stem cells or melanocytes.

10. A transcript of the DNA according to any one of claims 1 to 5.

11. A cell comprising the DNA according to any one of claims 1 to 5, the expression vector according to any one of claims 6 to 9, or the transcript according to claim 10.

12. A pharmaceutical composition comprising, as an active ingredient, the DNA according to any one of claims 1 to 5, the expression vector according to any one of claims 6 to 9, the transcript according to claim 10, or the cell according to claim 11.

13. A medicament comprising the pharmaceutical composition of claim 12.

14. An antitumor agent comprising the pharmaceutical composition of claim 12.

15. The antitumor agent according to claim 14, wherein the disease to be treated is myelodysplastic syndrome (MDS), myeloid leukemia, lymphocytic leukemia, or uveal melanoma.

16. The DNA according to claim 3, wherein the insertion positions of DYNLL1, HINT2, MAP3K7, TMEM14C, and BRD9 into the gene encoding herpes simplex type 1 thymidine kinase (HSV-TK) are immediately after bases 465, 152, 147, 277, and 799 from the initiation codon of HSV-TK, respectively.

Images