snRNA targeting USH2A pre-mRNA and uses thereof

Abstract

The recognition domain is reverse complementary to the USH2A pre-mRNA sequence and provides a snRNA that targets USH2A pre-mRNA to splice skip exon 13 by binding to the USH2A pre-mRNA, which promotes exon 13 skipping more efficiently than AONs.

Description

[Technical Field]

[0001] The present invention relates to the field of genetic engineering technology, and in particular to snRNAs that target USH2A pre-mRNA and uses thereof. [Background technology]

[0002] Usher syndrome, also known as deafness-retinitis pigmentosa syndrome, is a genetic disorder characterized by varying degrees of congenital sensorineural hearing loss and progressive vision loss due to retinitis pigmentosa (RP). Clinically, Usher syndrome can be classified into three types: 1. Type I Usher syndrome. Patients have congenital profound sensorineural hearing loss, loss of vestibular response, and prepubertal retinitis pigmentosa, followed by gradual blindness. Genes associated with this type include MYO7A, CDH23, USH1C, and PCHD15. 2. Type II Usher syndrome. Patients have congenital moderate-to-severe sensorineural hearing loss, normal vestibular response, and prepubertal retinitis pigmentosa, followed by gradual blindness. Genes associated with this type include SH2A, GPR98, and WHRN. 3. Type III Usher syndrome. Patients have progressive sensorineural hearing loss, normal vestibular response, and prepubertal retinitis pigmentosa, followed by gradual blindness. Genes associated with this type include CLRN1. Among them, type II Usher syndrome accounts for more than 50% of Usher syndrome cases, and mutations in the USH2A gene are the most common cause of type II Usher syndrome, accounting for more than 50% of Usher syndrome patients. At the same time, mutations in the USH2A gene are also an important cause of nonsyndromic retinitis pigmentosa (NSRP).

[0003] USH2A is located on 1q41 and spans over 800 kb of the genome. It encodes the large transmembrane protein Usherin, which is anchored to the plasma membrane of retinal photoreceptor cells and inner ear hair cells and is an essential component for cilia development and maintenance. In the retina, Usherin is an essential part of the USH2 complex and is thought to play a role in stabilizing photoreceptor outer segments. USH2A has two subtypes. The major subtype in retinal cells contains 72 exons and a coding region approximately 15.6 kb long. The extracellular portion of Usherin contains many repeat domains, including 10 laminin EGF-like (LE) domains and 35 fibronectin type 3 (FN3) domains. Human USH2A exon 13 is 642 bp long and encodes amino acids 723–936, which are four of the 10 LE domains of Usherin.

[0004] Mutations in exon 13, exon 50, and intron 40 of the USH2A gene can cause Usher syndrome. To date, more than 1,000 pathogenic variants distributed throughout the USH2A gene have been identified, of which exon 13 is the most frequently mutated exon in the USH2A gene, accounting for approximately 35% of cases. Mutations in exon 13 of the USH2A gene include c.2802T>G (p.Cys934Trp, the most frequent mutation in Chinese patients), c.2299delG (p.Glu767Serfs*21, the most frequent mutation in European and American patients), c.2276G>T (p.cys759phe, the most frequent mutation site causing nonsyndromic RP), c.2522C>A (p.S841Y), c.2242C>T (p.Gln748X), and c.2541C>A (p.C8 47X), c.2761delC(Leu921fs) and c.2776C>T(p.R926C), c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_2432delAA , c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C, c.2332G>T, c.2339G>T (PMID:31904091).

[0005] For exon 13 of the USH2A gene, existing technologies generally offer three common approaches. The first is to edit genomic DNA using the CRISPR / Cas system to directly delete exon 13 or disrupt RNA splicing-related sites. However, the use of segmental deletion carries risks such as chromosomal rearrangements, viral integration, and reverse reintegration. Furthermore, the probability of off-target effects increases when the CAS system is expressed for a long time or when double cleavage induced by two gRNAs is performed in a relatively large genomic background. The second approach is to use a single base editor to modify key bases in the splicing-related sites, which may also promote exon skipping. However, existing single base editors cannot be loaded via a single AAV vector, are limited by PAMs, editing windows, and base conversion types, and there may be a lack of suitable gRNAs near the splicing-related sites. The third approach is to use antisense oligonucleotides (AONs) to target pre-mRNA splicing and promote exon skipping with higher efficiency. However, AONs promote exon 13 skipping while simultaneously promoting the simultaneous skipping of exons 12 and 13. Some AON treatments result in double skipping and no single skipping. The full length of exon 12 is 196 bp, which is not an integer multiple of 3. Deletion of exon 12 results in a frameshift mutation, which inactivates the USH2A protein after the double splicing jump. The AON effect is short-lived, requires high drug dosages, and is not efficient at inducing splicing skipping. Summary of the Invention

[0006] To solve the above problems, the present invention provides snRNAs that target USH2A pre-mRNA, which can promote exon 13 skipping more efficiently than AONs.

[0007] To achieve the above objectives, the present invention provides a snRNA that targets USH2A pre-mRNA, whose recognition domain is reverse complementary to the USH2A pre-mRNA sequence and that induces splicing skipping of exon 13 by binding to USH2A pre-mRNA.

[0008] After investigating and studying USH2A, the inventors discovered that the USH2A coding region is approximately 15.6 kb long, making it difficult to package such a large sequence using conventional gene therapy delivery methods (e.g., recombinant lentivirus, recombinant adeno-associated virus), making direct delivery of USH2A difficult to achieve. Exon 12 of mouse USH2A is homologous to exon 13 of human USH2A, both of which are 642 bp in length. Therefore, removal of this exon did not result in subsequent frameshift mutations. At the same time, the inventors discovered that even after knocking out exon 12 of mouse USH2A, Usherin was still correctly located and capable of performing its normal function. Therefore, for human USH2A exon 13 containing pathogenic mutations, a series of methods can be used to induce a jump and perform treatment.

[0009] Small nuclear RNAs (snRNAs) exist within cells. They are the main components of the RNA spliceosome during post-transcriptional processing in eukaryotes and are involved in pre-mRNA processing by binding to snRNP proteins. Their length ranges from approximately 100 to 215 nucleotides in mammals and they are divided into seven categories, numbered U1 to U7, due to their abundant U residues. Although U7-snRNP is not involved in splicing, it is an important factor in the unique 3'-end processing of replication-dependent histone dehydrogenase (RDH) pre-mRNA.

[0010] Therefore, we replaced the non-canonical Sm-binding site of U7-snRNA with a consensus sequence derived from the major spliceosomal U-snRNP and altered the histone-binding sequence in the 5' region of U7-snRNA to the complementary sequence of the target gene to target the exon, thereby inducing exon skipping.

[0011] Through targeted screening, the inventors discovered seven target regions and 21 target sites of U7-snRNP that induce splicing skipping, which can induce exon 13 splicing skipping. Furthermore, the recognition domain of U7-smOPT-snRNA was designed to be reverse-complementary to the splicing skipping-related site of USH2A pre-mRNA exon 13, thereby inducing U7-smOPT-snRNA to bind to the splicing skipping-related site of USH2A pre-mRNA exon 13. Furthermore, splicing skipping of USH2A pre-mRNA exon 13 was induced while preserving exon 12. This significantly reduced the possibility of unexpected splicing skipping, such as a double jump of exons 12 and 13, significantly improving efficiency while ensuring safety.

[0012] In one embodiment thereof, the USH2A pre-mRNA sequence is selected from the USH2A exon 13, intron 12, or intron 13 region.

[0013] In one embodiment thereof, the USH2A pre-mRNA sequence is selected from USH2A exon 13 and the region extending 50 bp on either side thereof.

[0014] In one embodiment thereof, the USH2A pre-mRNA sequence is selected from USH2A exon 13 and the region extending 20 bp on either side.

[0015] In one embodiment thereof, the exon 13 comprises a wild-type exon 13 or a mutation-containing exon 13.

[0016] In one embodiment thereof, the mutation comprises at least one of the following mutation sites: c.2242C>T, c.2276G>T, c.2299delG, c.2522C>A, c.2541C>A, c.2761delC, c.2776C>T, c.2802T>G, c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_2432delAA, c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C, and c.2332G>T.

[0017] In one embodiment thereof, the genomic location (corresponding to the NCBI database GRch38 version) region corresponding to the USH2A pre-mRNA sequence is selected from Chr1:216247142-216247185, Chr1:216247130-216247161, Chr1:216246616-216246649, Chr1:216247213-216247246, Chr1:216247204-216247232, Chr1:216247187-216247220, and Chr1:216247169-216247202.

[0018] In one embodiment thereof, the USH2A pre-mRNA sequence is selected from the sequences shown in SEQ ID NOs: 1-7.

[0019] In one embodiment thereof, the genomic locations corresponding to the USH2A pre-mRNA sequence are Chr1:216247223-216247246, Chr1:216247218-216247241, Chr1:216247213-216247236, Chr1:216247209-216247232, Chr1:216247204-21624721 6247227, Chr1:216247197-216247220, Chr1:216247191-216247214, Chr1:216247 187-216247210, Chr1:216247179-216247202, Chr1:216247174-216247197, Chr1:2 16247169-216247192, Chr1:216247162-216247185, Chr1:216247155-216247178, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:216247142-21624 7165, Chr1:216247138-216247161, Chr1:216247130-216247153, Chr1:216246626-216246649, Chr1:216246622-216246645, and Chr1:216246616-216246639.

[0020] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 16 bp of the USH2A pre-mRNA sequence.

[0021] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 17 bp of the USH2A pre-mRNA sequence.

[0022] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 18 bp of the USH2A pre-mRNA sequence.

[0023] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 19 bp of the USH2A pre-mRNA sequence.

[0024] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 20 bp of the USH2A pre-mRNA sequence.

[0025] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 21 bp of the USH2A pre-mRNA sequence.

[0026] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 22 bp of the USH2A pre-mRNA sequence.

[0027] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 23 bp of the USH2A pre-mRNA sequence.

[0028] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 24 bp of the USH2A pre-mRNA sequence.

[0029] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of 18 bp to 40 bp of the USH2A pre-mRNA sequence.

[0030] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a 20-27 bp contiguous sequence of the USH2A pre-mRNA sequence.

[0031] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 8 to 28.

[0032] In one embodiment thereof, the genomic location corresponding to the USH2A pre-mRNA sequence is selected from Chr1:216247213-216247236, Chr1:216247209-216247232, Chr1:216247204-216247227, Chr1:216247197-216247220, Chr1:216247191-216247214, Chr1:216247187-216247210, Chr1:216247179-216247202, Chr1:216247174-216247197, and Chr1:216247169-216247192.

[0033] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 10 to 28.

[0034] In one embodiment thereof, the genomic locations corresponding to the USH2A pre-mRNA sequence are Chr1:216247162-216247185, Chr1:216247155-216247178, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:21624714 ... 247165, Chr1:216247138-216247161, Chr1:216247130-216247153, Chr1:216246626-216246649, Chr1:216246622-216246645, and Chr1:216246616-216246639.

[0035] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 19 to 28.

[0036] In one embodiment thereof, the genomic locations corresponding to the USH2A pre-mRNA sequence are Chr1:216247213-216247236, Chr1:216247209-216247232, Chr1:216247204-216247227, Chr1:216247197-216247220, Chr1:216247191-216247214, Chr1:216247187-216247210, Chr1:216247179-216247202, Chr1:216247187-216247210, Chr1:216247189-216247220, Chr1:216247191-216247214, Chr1:216247192-216247220, Chr1:216247193-216247222 16247174-216247197, Chr1:216247169-216247192, Chr1:216247162-216247185, Chr1:216247155-216247178, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:216247142-216247165, and Chr1:216247130-216247153.

[0037] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 10 to 23 and the sequence shown in SEQ ID NO: 25.

[0038] In one embodiment thereof, the genomic locations corresponding to the USH2A pre-mRNA sequence are Chr1:216247213-216247236, Chr1:216247209-216247232, Chr1:216247204-216247227, Chr1:216247197-216247220, Chr1:216247191-216247214, Chr1:216247187-216247210, Chr1:216247179-216247236 247202, Chr1:216247174-216247197, Chr1:216247169-216247192, Chr1:216247162-216247185, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:216247142-216247165, and Chr1:216247130-216247153.

[0039] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 10 to 19, 21 to 23, and 25.

[0040] In one embodiment thereof, the genomic location corresponding to the USH2A pre-mRNA sequence is selected from Chr1:216247218-216247241, Chr1:216247187-216247210, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:216247142-216247165, and Chr1:216247130-216247153.

[0041] In one embodiment thereof, the snRNA recognition domain is selected from the sequence shown in SEQ ID NO: 9, the sequence shown in SEQ ID NO: 15, the sequence shown in SEQ ID NO: 21, the sequence shown in SEQ ID NO: 22, the sequence shown in SEQ ID NO: 23, and the sequence shown in SEQ ID NO: 25.

[0042] In one embodiment thereof, the snRNA recognition domain is selected from the sequence shown in SEQ ID NO: 15, the sequence shown in SEQ ID NO: 21, the sequence shown in SEQ ID NO: 22, and the sequence shown in SEQ ID NO: 23.

[0043] In one embodiment thereof, the snRNA is U1-snRNA or U7-snRNA.

[0044] In one embodiment thereof, the U7-snRNA is chemically synthesized.

[0045] In one embodiment thereof, at least one nucleotide of the chemically synthesized U7-snRNA is chemically modified.

[0046] In one embodiment thereof, the chemical modification comprises at least one of a 2'-O-alkyl modification, a 2'-O-methoxy modification, or a 2'-O-methoxyethyl modification.

[0047] In one embodiment thereof, the 2'-O-alkyl modification is a 2'-O-methyl modification.

[0048] In one embodiment, at least one nucleotide of the chemically synthesized U7-snRNA is linked via a phosphate bond, and the phosphate bond comprises at least one of a phosphorothioate bond, a phosphorodithioate bond, an alkyl phosphate bond, a phosphoramidate bond, a boranophosphate bond, or a chiral phosphorus bond.

[0049] In one embodiment, 6 to 80 nucleotides on both sides of the chemically synthesized U7-snRNA are all chemically modified and linked by the phosphate ester bond.

[0050] In one embodiment, 1 to 10 nucleotides on both sides of the chemically synthesized U7-snRNA are all chemically modified and linked by the phosphate ester bond.

[0051] In one embodiment thereof, 3 to 40 bases on both sides of the chemically synthesized U7-snRNA are all chemically modified and linked by the phosphate ester bond.

[0052] In one embodiment thereof, all nucleotides of the chemically synthesized U7-snRNA are linked via phosphorothioate bonds and are all 2'-O-methoxy modified.

[0053] In one embodiment, the three nucleotides on either side of the chemically synthesized U7-snRNA are linked via phosphorothioate bonds and modified with 2'-O-methoxy.

[0054] In one embodiment thereof, the first nucleotide at the 5' end of the chemically synthesized U7-snRNA is adenylic acid.

[0055] In one embodiment thereof, the first nucleotide at the 5' end of the chemically synthesized U7-snRNA recognition domain is adenylic acid.

[0056] In one embodiment thereof, there are 0 to 5 mismatched nucleotides in the reverse complementary pair between the recognition domain of the chemically synthesized U7-snRNA and the target site.

[0057] In one embodiment thereof, there are 0 to 1 mismatched nucleotides in the reverse complementary pair between the recognition domain of the chemically synthesized U7-snRNA and the target site.

[0058] In one embodiment thereof, the sequence length of the chemically synthesized U7-snRNA recognition domain is ≧16 bp.

[0059] In one embodiment, the sequence length of the chemically synthesized U7-snRNA recognition domain is 18 bp to 40 bp.

[0060] In one embodiment, the sequence length of the chemically synthesized U7-snRNA recognition domain is 20 bp to 27 bp.

[0061] In one embodiment, the chemically synthesized U7-snRNA continues to extend the length of the recognition domain sequence through reverse complementation along the 5' and / or 3' ends of the target sequence.

[0062] In one embodiment thereof, the length of the extended recognition domain sequence is ≦40 bp.

[0063] In one embodiment thereof, the snRNA comprises an sm sequence.

[0064] In one embodiment thereof, the sm sequence is a smOPT sequence, and the smOPT sequence is as set forth in SEQ ID NO:31.

[0065] In one embodiment thereof, the snRNA comprises a recognition domain, a smOPT sequence, and a U1-snRNA scaffold or a U7-snRNA scaffold sequence; preferably, the U7-snRNA scaffold sequence is as set forth in SEQ ID NO:49.

[0066] In one embodiment thereof, the snRNA further comprises a motif that recruits a splicing control protein.

[0067] In one embodiment thereof, a free tail is introduced into the 5' end of the U7-snRNA, and the sequence of the free tail contains a motif that recruits a splicing control protein.

[0068] In one embodiment thereof, the splicing regulatory protein comprises at least one of hnRNPA1, SRSF1, RBM4, DAZAP1, or SR.

[0069] In one embodiment thereof, the free tail sequence comprises at least one hnRNPA1 binding motif.

[0070] In one embodiment thereof, the free tail sequence comprises two hnRNPA1 binding motifs.

[0071] The present invention also includes nucleotide sequences encoding said snRNAs. nucleic acid to provide.

[0072] The present invention also provides a method for the preparation of a nucleic acid molecule comprising the snRNA and / or the snRNA. nucleic acid A gene expression cassette comprising:

[0073] The present invention also includes the snRNA, nucleic acid and / or a vector comprising a gene expression cassette.

[0074] In one embodiment thereof, the vector comprises a vector backbone and the snRNA, the vector backbone comprises a promoter, an smOPT sequence, and an snRNA gene-specific 3' cassette, and the promoter is connected to the smOPT sequence via a Type IIs restriction endonuclease recognition site.

[0075] In one embodiment thereof, the vector is selected from pUC57, pAAV-CMV, a lentivirus, or a transposon.

[0076] In one embodiment thereof, the snRNA gene-specific 3' cassette is a gene fragment extending 28 to 131 bp from the 3' end of the snRNA gene.

[0077] In one embodiment thereof, the snRNA gene-specific 3' cassette is a gene fragment extending 106 bp from the 3' end of the snRNA gene.

[0078] The present invention also includes the snRNA, nucleic acid and / or a viral particle comprising said vector.

[0079] In one embodiment thereof, the viral particle is an AAV virus.

[0080] In one embodiment thereof, the capsid protein of the AAV virus is naturally occurring, a variant based on a naturally occurring capsid protein.

[0081] In one embodiment thereof, the capsid protein of the AAV virus is derived from an animal or a plant.

[0082] In one embodiment thereof, the AAV viral capsid protein is selected from AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, or AAVrh43.

[0083] In one embodiment thereof, the mutant AAV virus based on a naturally occurring capsid protein is an AAV virus based on directed evolution or rational modification of the amino acid / peptide sequenc- es of the naturally occurring capsid protein.

[0084] In one embodiment thereof, the mutant AAV virus is selected from AAV2.5, AAV2i8, AAV-TT, AAV9.HR, or CAM130.

[0085] In one embodiment thereof, when the AAV virus is an AAV ITR, the serotype corresponds to the serotype of the Rep gene.

[0086] The present invention also includes the snRNA, nucleic acid and providing a cell comprising said vector and / or said viral particle.

[0087] The present invention also includes the snRNA, nucleic acid and providing a pharmaceutical composition comprising said vector and / or said viral particle.

[0088] The present invention also relates to a method for producing a USH2A gene comprising the pre-mRNA, the snRNA, and the nucleic acid and a method for obtaining a Usherin protein lacking the expression product of exon 13, the method comprising contacting the vector, the gene expression cassette, the viral particle, the cell, and / or the pharmaceutical composition.

[0089] In one embodiment, the method is used in scientific research.

[0090] The present invention also provides the use of the method in preparing a mature USH2A mRNA lacking exon 13 by splicing skipping of exon 13 of USH2A pre-mRNA, obtaining an Usherin protein lacking exon 13, and / or inhibiting the expression and function of USH2A pre-mRNA exon 13.

[0091] The present invention also relates to a method for the preparation of a medicament for preventing and / or treating an eye disease and / or an ear disease, comprising administering to said patient a medicament a method for the prevention and / or treatment of ... nucleic acid , the use of said vector, said gene expression cassette, said viral particle or said cell.

[0092] In one embodiment, the eye disease is deafness-retinitis pigmentosa syndrome or non-syndromic retinitis pigmentosa.

[0093] Compared with the prior art, the present invention has the following beneficial effects:

[0094] The snRNA targeting USH2A pre-mRNA of the present invention selects USH2A exon 13 as the target region and induces splicing skipping of exon 13, thereby treating eye and ear diseases caused by USH2A protein dysfunction, such as missense, frameshift, stop codon, nonsense, and synonymous mutations in USH2A exon 13. At the same time, the USH2A-targeting U7-snRNA of the present invention is not involved in splicing using the U7-snRNP, but is a key factor in the specific 3'-end processing of replication-dependent histone dehydrogenase (RDH) pre-mRNA. The modified U7-snRNA replaces the non-canonical Sm-binding site of U7-snRNA with a consensus sequence derived from the main spliceosomal U-snRNP, changing the histone-binding sequence in the 5' region of U7-snRNA to the complementary sequence of the target gene. In combination with snRNA targeting USH2A pre-mRNA, this induces splicing skipping of USH2A pre-mRNA exon 13 while preserving exon 12. This significantly reduces the probability of unexpected splicing skipping, such as double skipping of exons 12 and 13, and significantly improves the efficiency of single skipping of exon 13 while ensuring safety. [Brief explanation of the drawings]

[0095] [Figure 1] Schematic diagram of the structure and function of U7-snRNA. [Figure 2] 1 is a map of the pUC57-U7 snRNA backbone vector. [Figure 3] 1 shows the plasmid map of the reporter vector pCMV-EGFPleft-Exon13c.2802T>G-EGFPright. [Figure 4] 1 shows the plasmid map of the reporter vector pCMV-EGFPleft-Exon13c.2299delG-EGFPright. [Figure 5] Schematic diagram of the location of U7-snRNA targeting target region 1 on the genome. [Figure 6]10 is a graph showing the results of the percentage of cells in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 1 in reporter vector cells. [Figure 7] This is a histogram of the average FITC intensity of GFP-positive cells induced by U7-snRNA targeting target region 1 (splicing skipping of USH2A pre-mRNA exon 13). [Figure 8] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 2 on the genome. [Figure 9] 10 is a graph showing the results of the percentage of cells in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 2 in reporter vector cells. [Figure 10] This is a histogram of the average FITC intensity of GFP-positive cells induced by U7-snRNA targeting target region 2 (splicing skipping of USH2A pre-mRNA exon 13). [Figure 11] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 3 on the genome. [Figure 12] 10 is a graph showing the results of the percentage of cells in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 3 in reporter vector cells. [Figure 13] This is a histogram of the average FITC intensity of GFP-positive cells induced by U7-snRNA targeting target region 3 (splicing skipping of USH2A pre-mRNA exon 13). [Figure 14] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 4 on the genome. [Figure 15] 10 is a graph showing the results of the percentage of cells in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 4 in reporter vector cells. [Figure 16] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 5 on the genome. [Figure 17] 10 is a graph showing the results of the percentage of cells in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 5 in reporter vector cells. [Figure 18] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 6 on the genome. [Figure 19] 10 is a graph showing the results of the percentage of cells in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 6 in reporter vector cells. [Figure 20] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 7 on the genome. [Figure 21] 10 is a graph showing the results of the percentage of cells in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 7 in reporter vector cells. [Figure 22] 10 is a graph showing the results of the average FITC intensity of cells in which USH2A pre-mRNA exon 13 splicing skipping was induced by U7 snRNAs targeting different regions in reporter gene cells. [Figure 23] 1 is a graph showing experimental results demonstrating that the efficiency of USH2A pre-mRNA exon 13 splicing skipping induced by U7-snRNA was significantly superior to that of AON1. [Figure 24] 10 is a graph showing the results of detecting the splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by chemically synthesized U7 snRNA in WERI cells. [Figure 25] Schematic diagram of the structure of U7-hnRNP A1-snRNA. [Figure 26]1 is a graph showing the results of splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by U7-hnRNP A1-snRNA. DETAILED DESCRIPTION OF THE INVENTION

[0096] To facilitate understanding of the present invention, the present invention will now be described in more detail with reference to the associated drawings. Preferred embodiments of the present invention are shown in the drawings. However, the present invention may be embodied in many different forms and is not limited to the embodiments set forth herein. Rather, these embodiments are provided to provide a thorough understanding of the present disclosure.

[0097] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Terms used in the specification of the present invention in describing the present invention are for the purpose of describing particular embodiments only and are not intended to limit the present invention. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items. When a sequence is said to be "selected" from another sequence, it can be directly the other sequence or a sequence fragment of the other sequence; when a genomic mapping region is "selected" from another genomic mapping region, the corresponding sequence can be a sequence directly corresponding to the other genomic mapping region or a sequence fragment in a sequence corresponding to the other genomic mapping region; such sequences include DNA or RNA.

[0098] Definition: The snRNAs described in this invention are major components of the RNA spliceosome in post-transcriptional processing in eukaryotes and are involved in the processing of pre-mRNAs by binding to snRNP proteins.

[0099] Material Suppliers: AAVpro® Helper Free System (AAV5) Kit (TAKARA, Code No. 6650)

[0100] The reagents, materials, and equipment used in the examples are all commercially available unless otherwise specified; the experimental methods are conventional in the art unless otherwise specified.

[0101] Example 1 U7-snRNA system design and vector construction.

[0102] 1. Synthesis of U7-snRNA expression vector backbone. Wild-type U7-snRNA contains a stem-loop structure (scaffold), a U7-specific Sm sequence (AAUUUGUCUAG :SEQ ID NO: 61 ), and a recognition domain (complementary to histone pre-mRNA).

[0103] The U7-snRNA in this example was derived from the NCBI mouse wild-type U7-snRNA gene sequence (NCBI Reference Sequence: NR_024201.3) by replacing the U7-specific sm sequence AATTTGTCTAG (SEQ ID NO: 30) with an optimized consensus sm sequence, i.e., smOPT:AATTTTTGGAG (SEQ ID NO: 31). As shown in Figure 1, the original recognition domain at the 5' end of the smOPT sequence was replaced with a recognition domain reverse-complementary to the USH2A pre-mRNA-specific target site, while the original U7 stem-loop structure at the 3' end of the smOPT sequence was retained. The U7-snRNA recognition domain sequence, which targets and directs USH2A pre-mRNA exon 13, is reverse-complementarily paired with a target sequence selected from intron 12-exon 13-intron 13 of USH2A pre-mRNA.

[0104] Specific procedure: First, a pUC57 vector containing the gene sequence, i.e., a U7-snRNA gene expression cassette backbone (5'-mouse U7 promoter-smOPT sequence-U7 snRNA scaffold-snRNA gene-specific 3' cassette-3') was synthesized by total gene synthesis (as shown in Figure 2). Two Type IIs restriction endonuclease recognition sites were added between the U7 promoter and smOPT to facilitate subsequent cleavage, replacement, and insertion of other recognition domain sequences. The snRNA gene-specific 3' cassette contains the gtctacaatgaaa (SEQ ID NO: 32) sequence following the 3' end of the U7-snRNA gene in the mouse genome (GenBank: X54748.1), which is involved in pre-snRNA processing. It is preferably a sequence connected to the 3' end of the U7 snRNA gene, preferably a gene fragment of 28 to 131 bp in length, and more preferably 106 bp in length.

[0105] 2. Constructed U7-snRNA vectors targeting different sites in and near USH2A exon 13.

[0106] In this example, 21 target sites were set for each of the seven target regions of USH2A pre-mRNA, and the seven target regions of USH2A pre-mRNA are as shown below.

[0107] Exon 13 region 1 (SEQ ID NO: 1) (Chr1:216247142-216247185): CGAAGCUUUAAUGAUGUUGGAUGUGAGCCCUGCCAGUGUAACCU; Exon 13 region 2 (SEQ ID NO:2) (Chr1:216247130-216247161):GAGCCCUGCCAGUGUAACCUCCAUGGCUCAGU; Exon 13 region 3 (SEQ ID NO: 3) (Chr1:216246616-216246649): AAUCAGUGGCCAGUGCCUGUGUGUGCCUAAUCGU; Exon 13 region 4 (SEQ ID NO: 4) (Chr1:216247213-216247246): UAAAUAUAUUUUAUCUUUAGGGCUUAGGUGUGAU; Exon 13 region 5 (SEQ ID NO: 5) (Chr1:216247204-216247232): CUUUAGGGCUUAGGUGUGAUCAUUGCAAU; Exon 13 region 6 (SEQ ID NO: 6) (Chr1:216247187-216247220): GGUGUGAUCAUUGCAAUUUUGGAUUUAAAUUUCU; Exon 13 region 7 (SEQ ID NO: 7) (Chr1:216247169-216247202): UUGGAUUUAAAUUUCUCCGAAGCUUUAAUGAUGU.

[0108] The 21 target locations are as shown in the table below.

[0109] [Table 1]

[0110] Example 2 Chemical synthesis and modification of U7-snRNA. Similar to oligonucleotides, U7-snRNA can be directly chemically synthesized to generate RNA containing the recognition domain, smOPT, and U7-snRNA scaffold. In vitro synthesized U7-snRNA can be specifically modified to resist nuclease degradation and to enhance its affinity for target sequences.

[0111] In this example, U7-snRNA was chemically synthesized and modified with 2'-methoxy (2'-OME) and sulfo-modifications at the three bases at its 5' and 3' ends, respectively, to enhance nuclease resistance. Using snRNA#16 and snRNA#15 as examples, the sequences and modifications of the chemically synthesized snRNAs are as follows (* indicates a phosphorothioate backbone, m indicates a 2'-methoxy modification, the underlined portion indicates the reverse-complementary recognition domain to the target sequence, and italics indicate the smOPT sequence).

[0112] Chemically synthesized and modified U7-snRNA#16: [ka] (SEQ ID NO: 64)

[0113] The modified sequence is obtained by adding a phosphorothioate backbone modification and a methoxy modification to the first three bases at the 5'-end and 3'-end of the sequence shown in SEQ ID NO:33.

[0114] Chemically synthesized and modified U7-snRNA#15: [ka] (SEQ ID NO: 65)

[0115] The modified sequence is the sequence shown in SEQ ID NO:34, with the addition of phosphorothioate backbone modification and methoxy modification to the first three bases at the 5'-end and 3'-end.

[0116] Example 3 We constructed a reporter vector to quantitatively evaluate the splicing skipping efficiency of USH2A exon 13.

[0117] RG left -USH2A EXON13 mut -RG rightThe sequence (with AgeI and EcoRI enzyme cleavage sites added to the 5' and 3' ends, respectively) was obtained by total gene synthesis. The synthetic sequence was inserted between the AgeI and EcoRI restriction sites of the pX601 plasmid (Addgene, 61591) through digestion with restriction endonucleases AgeI and EcoRI, electrophoresis, gel recovery, and ligation. The synthetic sequence replaced the original SaCas9 gene sequence to obtain a reporter vector. Further transformation of E. coli competent cells, single cloning, PCR, and sequence verification yielded a purified reporter vector plasmid, which was then stored at -20°C for future use.

[0118] The reporter vector structure is: pCMV-RG left -USH2A EXON13 mut -RG right where RG represents a reporter gene, and RG left represents the first half of the 5' end of the reporter gene without reporting function, and RG right The latter half of the 3' end of the reporter gene does not have a reporting function, and RG left and R.G. right The tandem expression of the reporter gene ensures that the reporter gene functions normally. In the present example, the reporter gene is the green fluorescent gene EGFP, and the vector structure is pCMV-EGFP. left -Exon13 mut -EGFP right It was. EXON13 mutindicates a sequence containing USH2A exon 13 containing a pathogenic mutation and its upstream and downstream intron sequences (the upstream intron sequence is the gene sequence formed by tandemly linking the 5'-terminal 204 bp and 3'-terminal 490 bp of intron 12 of the human USH2A gene; the downstream intron sequence is the gene sequence formed by tandemly linking the 5'-terminal 703 bp and 3'-terminal 216 bp of intron 13 of human USH2A). The pathogenic mutation in USH2A exon 13 may include c.2802T>G, c.2299delG, c.2276G>T, c.2522C>A, c.2242C>T, c.2541C>A, c.2761delC, or c.2776C>T. The pathogenic mutation in USH2A exon 13 described in the examples of the present invention is c.2802T>G, c.2299delG, and the resulting vector construct is pCMV-EGFP, respectively. left -Exon13 c.2802T>G -EGFP right (The report vector map is shown in Figure 3 ), pCMV-EGFP left -Exon13 c.2299delG -EGFP right (Report vector map shown in Figure 4) and EGFP left The sequence is as shown in SEQ ID NO: 35, and EGFP right The sequence is as shown in SEQ ID NO:36.

[0119] Example 4 Detection of the splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 1.

[0120] Detection method: 293T cells were seeded in a 24-well plate at a predetermined concentration so that the cell confluence reached approximately 80% after 24 hours. pCMV-EGFP was transfected using Lipofectamine 2000. left -Exon13 c.2802T>G -EGFP rightand pUC57-U7-snRNA plasmids targeting USH2A pre-mRNA were co-transfected into 293T cells (vector mass ratio was 100 ng:400 ng). 293T cells transfected with reporter plasmid alone and co-transfected with reporter plasmid and pUC57-U7-con were used as two negative controls, respectively. 293T cells without any plasmid transfected were used as blank controls. After transfection, the cells were subsequently cultured for 4 to 72 hours and digested into single cells using trypsin. Flow cytometry was then used to detect the GFP-positive rate (i.e., the proportion of cells in which splice skipping of USH2A pre-mRNA exon 13 was induced) and the average FITC intensity of GFP-positive cells (i.e., the average level of splice skipping of USH2A pre-mRNA exon 13 in GFP cells) of different U7-snRNA groups. The genomic location of U7-snRNA targeting target region 1 (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in Figure 5.

[0121] Experimental results: As shown in Figure 6 and the table below, all U7-snRNAs targeting target region 1 can induce splicing skipping of USH2A exon 13 in reporter gene cells. Existing AONs targeting region 1 cannot induce splicing skipping of exon 13, but snRNAs targeting region 1 can effectively induce splicing skipping of exon 13.

[0122] [Table 2]

[0123] Example 5 Detection of the splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 2.

[0124] Detection method: Same as in Example 4. The position of U7-snRNA targeting target region 2 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in Figure 8.

[0125] Experimental results: As shown in Figure 9 and the table below, all U7-snRNAs targeting target region 2 can induce splicing skipping of USH2A exon 13 in reporter gene cells. While existing AONs targeting region 2 are less effective at inducing splicing skipping of exon 13, snRNAs targeting region 2 can effectively induce splicing skipping of exon 13.

[0126] [Table 3]

[0127] Example 6 Detection of the splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 3.

[0128] Detection method: Same as in Example 4. The position of U7-snRNA targeting target region 3 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in Figure 11.

[0129] Experimental results: As shown in Figure 12 and the table below, all U7-snRNAs targeting target region 3 can induce splicing skipping of USH2A exon 13 in reporter gene cells. While existing AONs targeting region 3 are less effective at inducing splicing skipping of exon 13, snRNAs targeting region 3 can effectively induce splicing skipping of exon 13.

[0130] [Table 4]

[0131] Combining the analyses of Examples 4, 5, and 6, we found that target regions 1, 2, and 3 in the prior art target non-sensitive regions of AONs, i.e., targeting these regions does not induce or only slightly induces splicing skipping of exon 13, whereas snRNA targeting these regions can significantly induce splicing skipping of exon 13. Thus, although both snRNA and AONs can induce splicing skipping, their mechanisms of action are different, and their target site sensitivities (applicable target sites within the target regions) are also different.

[0132] At the same time, as shown in Figures 7, 10, 13 and the table below, although the percentage of cells (GFP%) that induced splicing skipping targeting the same region was similar, there were differences in the mRNA and protein levels (average FITC intensity) obtained by splicing skipping in the same cells when snRNAs targeting different targets within the same region were used. Furthermore, the mRNA and protein levels obtained by inducing splicing skipping in the same cells for target region 1 and target region 2 were superior to those for target region 3.

[0133] [Table 5]

[0134] Example 7 The splicing skipping effect of USH2A exon 13 mediated by U7-snRNA and snRNA#24 targeting target region 4 was detected.

[0135] Detection method: Same as in Example 4. The location of U7-snRNA targeting region 4 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in Figure 14.

[0136] Experimental results: As shown in Figure 15 and the table below, all U7-snRNAs targeting target region 4 can induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0137] [Table 6]

[0138] Example 8 Detection of the splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 5.

[0139] Detection method: The same as in Example 4. The location of the U7-snRNA target region 5 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in FIG.

[0140] Experimental Results: As shown in Figure 17 and the table below, all U7-snRNAs targeting target region 5 can induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0141] [Table 7]

[0142] Example 9 Detection of the splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 6.

[0143] Detection method: Same as in Example 4, and the location of the U7-snRNA target region 6 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in Figure 18.

[0144] Experimental results: As shown in Figure 19 and the table below, all U7-snRNAs targeting target region 6 can induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0145] [Table 8]

[0146] Example 10 Detection of the splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 7.

[0147] Detection method: Same as in Example 4. The position of U7-snRNA targeting target region 7 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in Figure 20.

[0148] Experimental results: As shown in Figure 21 and the table below, all U7-snRNAs targeting target region 7 can induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0149] [Table 9]

[0150] Example 11 Detection of splicing skipping effect of USH2A exon 13 mediated by U7-snRNA.

[0151] Verification method: Same as in Example 4.

[0152] Experimental results: The average FITC intensity of GFP-positive cells induced by U7-snRNA in different regions is shown in Figure 22 and the table below.

[0153] [Table 10]

[0154] Although the GFP% (proportion of cells in which splicing skipping was induced) of snRNAs targeting the same region is similar, snRNAs targeting different targets within the same region have different protein levels (average FITC intensity) compared to the mRNAs resulting from splicing skipping in the same cells.

[0155] Targeting region 2 not only resulted in a higher percentage of cells in which splicing skipping was induced (GFP%), but also resulted in higher levels of mRNA and protein (mean FITC intensity) in the same cells upon induction of splicing skipping.

[0156] However, in the prior art, target site #2 and its adjacent sites #1 and #3, which were highly efficient at inducing splicing skipping by AONs, induced low levels of mRNA and protein in the same cells using the snRNA system. While the efficiency of AONs targeting region 3 was higher than that of region 2 using existing technology, the efficiency of targeting region 2 in the snRNA system was higher than that of region 3. Therefore, although both snRNA and AONs can induce splicing skipping, their mechanisms of action differ, and the sensitivity of their target sites also differ. Combined with the analysis of the results in Example 12, the efficiency of snRNA #24 was similar to that of snRNA #2 and AON1, ​​suggesting that the effects of snRNAs #3 to #11 are all superior to those of snRNA #2 and snRNA #24, and therefore superior to AON1.

[0157] Example 12 Confirmation that the splicing skipping efficiency of USH2A exon 13 mediated by U7-snRNA is significantly superior to that of AON.

[0158] Detection method: 293T cells were seeded in a 24-well plate at a predetermined concentration so that the cell confluence reached approximately 80% after 24 hours. pCMV-EGFP was transfected using Lipofectamine 2000.left -Exon13 c.2802T>G -EGFP right and pUC57-U7-snRNA plasmids of different targets were co-transfected into 293T cells (vector mass ratio was 100 ng:400 ng). 293T cells transfected with reporter plasmid alone, reporter plasmid and pUC57-U7 Scramble were used as two negative controls, respectively. The reporter plasmid and 10 pmol of antisense oligonucleotide AON1 (5′-MA*MG*MC*MU*MU*MC*MG*MG*MA*MG*MA*MA*MA*MA*MU*MU*MU*MA*MA*MA*MU*MC*-3′, where “M” indicates 2′-O-methoxy modification and “*” indicates phosphorothioate. SEQ ID NO: 62 293T cells co-transfected with ) were used as a positive control, and 293T cells not transfected with any plasmid were used as a blank control. The transfected cells were cultured for 48–72 hours and digested into single cells using trypsin. Then, a flow cytometer was used to detect the GFP positivity and average FITC intensity of various snRNAs.

[0159] Experimental Results: As shown in FIG. 23 and the table below, snRNA#8 and snRNA#18 screened by the present invention are both superior to AON1, ​​and snRNA#2 has an efficiency similar to that of AON1.

[0160] [Table 11]

[0161] Example 13 Induction of splicing skipping of USH2A exon 13 in WERI cells by chemically synthesized U7-snRNA.

[0162] 6 x 10 human host cells in a 24-well plate 5The human retinal neuronal cells selected in this example were WERI-Rb-1 cells (retinal neuronal cell line).

[0163] WERI cells were transfected with 100 pmol of in vitro synthesized U7-snRNA#1, snRNA#4, snRNA#8, snRNA#10, and snRNA#14, respectively, using Lipofectamine 2000, and the same amount (100 pmol) of antisense oligonucleotide AON1 (5′-MA*MG*MC*MU*MU*MC*MG*MG*MA*MG*MA*MA*MA*MA*MU*MU*MU*MA*MA*MA*MU*MC*-3′, where “M” indicates 2′-O-methoxy modification and “*” indicates phosphorothioate). SEQ ID NO: 62 ) and AON2 (5′-MU*MG*MA*MU*MC*MA*MC*MA*MC*MC*MU*MA*MA*MG*MC*MC*MC*MU*MA*MA*MA*-3′, where “M” indicates 2′-O-methoxy modification and “*” indicates phosphorothioate. SEQ ID NO: 63 ) as a control group, 1 μg of EGFP plasmid as a negative control, and WERI cells without any plasmid were used as a blank control. The transfected cells were then cultured for 72 hours, after which RNA from each experimental group was extracted and reverse transcribed to obtain cDNA. RT-PCR experiments were performed using primers AGCCTTTTCCGCCAAGGTGATC (SEQ ID NO: 37) and CACAACGTTGCCCAGCAATGG (SEQ ID NO: 38) to detect the presence of exon 13 in mature USH2A mRNA. The electrophoresis results are shown in Figure 24.

[0164] Experimental results: In WERI cells endogenously expressing Usherin protein, the induction effect of chemically synthesized U7-snRNA on USH2A pre-mRNA exon 13 splicing skipping was compared with the AON technology scheme. RT-PCR test data and analysis results showed that the AON single-hop band was weaker than snRNA, and there was a significant double-hop band below the AON single-hop band. This indicates that chemically synthesized U7-snRNA experimental group 1 and U7-snRNA experimental group 2 are significantly better than AON1 and AON2 technology schemes in inducing exon 13 single-splicing skipping. Furthermore, we performed further quantitative analysis of the RT-PCR electrophoresis bands using ImageJ software to analyze the ratio of exon 12 and exon 13 double-skipped USH2A mRNA to the total amount of skipped USH2A mRNA (exon 13 single-skipping and exon 12 and exon 13 double-skipping USH2A mRNA combined). The results showed that the ratio of double-splicing skipping induced by U7-snRNA in exons 12 and 13 was very low, lower than the ratios of double-skipping induced by AON1 and AON2. Therefore, we found that U7-snRNA significantly improved the efficiency of exon 13 single-splicing skipping and simultaneously ensured lower double-skipped USH2A mRNA by-products.

[0165] Furthermore, the target site of U7-snRNA#14 is close to the AON site, which has a very high probability of double splicing skipping in exons 12 and 13 in conventional techniques, but the probability of double splicing skipping occurring after U7-snRNA#14 treatment is very low. Furthermore, we found that U7-snRNA can induce splicing skipping of exon 13 while significantly reducing the probability of double splicing skipping between exons 12 and 13.

[0166] Example 14 Detection of the splicing skipping effect of U7-snRNA linked to the hnRNP A1 binding motif.

[0167] 1, Construction of U7-snRNA linked to hnRNP A1 binding motif. The corresponding oligo DNA was synthesized according to the pretranscriptional DNA sequence corresponding to the gRNA sequence in the table. The sense strand of the oligo DNA was the reverse complement of the target sequence (the DNA sequence corresponding to the recognition domain sequence), with CCGCAATATGATAGGGACTTAGGGTG (SEQ ID NO: 39) added to the 5' end. The antisense strand of the target sequence was AATT added to the 5' end and CACCCTAAGTCCCTATCATATT (SEQ ID NO: 40) added to the 3' end. For example, the recognition domain sequence of snRNA #14 was ACACUGGCAGGGCUCACAUCCA (SEQ ID NO: 41), and the synthesized sense strand of the oligo DNA was [ka] (SEQ ID NO: 42), and the antisense strand is [ka] (SEQ ID NO: 43), where the underlined portion indicates the DNA double-stranded sequence corresponding to the recognition domain sequence, and the bold italic portion indicates the DNA double-stranded sequence corresponding to the binding motif "UAGGGU" of the hnRNP A1 protein.

[0168] The synthesized Oligo DNA sense and antisense strands were mixed in an annealing reaction system (total reaction volume 20 μl: 2 μl of Oligo-F (100 μM) + 2 μl of Oligo-R (100 μM) + 2 μl of 10× NEB Cutter smart buffer + 16 μl of deionized water), incubated at 95°C for 5 minutes, then cooled on ice to form double-stranded DNA with sticky ends. After a 100-fold dilution, 1 μl of the reaction mixture was ligated to the linearized pUC57-U7-snRNA backbone plasmid, digested with 10 ng of BsaI, and then transformed into E. coli competent cells. Following PCR and sequence confirmation, a U7-snRNA vector containing the hnRNP A1-binding motif for inducing splicing skipping of USH2A exon 13 was obtained and designated pUC57-U7-hnRNP A1-snRNA#. The plasmid was purified and stored at −20° C. for future use.

[0169] U7-hnRNP A1-snRNA can also be chemically synthesized and modified according to the methods described in Examples 2 and 4. Taking snRNA#14 as an example, the sequence and modifications of the chemically synthesized U7-hnRNP A1-snRNA are as follows (* indicates a phosphorothioate backbone, m indicates a 2'-methoxy modification, underline indicates a recognition domain reverse-complementary to the target sequence, italics indicate the smOPT sequence, and bold indicates the hnRNP A1 protein-binding motif): [ka] (SEQ ID NO: 66) The schematic structure of U7-hnRNP A1-snRNA is shown in Figure 25.

[0170] The modified sequence is the sequence shown in SEQ ID NO:44, with the addition of phosphorothioate backbone modification and methoxy modification to the first three bases at the 5'-end and 3'-end.

[0171] 2, we tested the efficiency of U7-snRNA linked to an hnRNP A1-binding motif to induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0172] Detection method: 293T cells were seeded in a 24-well plate at a predetermined concentration so that the cell confluence reached approximately 80% after 24 hours. pCMV-EGFP was transfected using Lipofectamine 2000. left -Exon13 c.2802T>G -EGFP right The reporter plasmids were co-transfected with pUC57-U7-hnRNP A1-snRNA plasmid and pUC57-U7-snRNA plasmid (vector mass ratio: 100 ng:400 ng) into 293T cells. 293T cells transfected with the reporter plasmid alone and the reporter plasmid and pUC57-U7 Scramble were used as negative controls, respectively. 293T cells untransfected with any plasmid served as blank controls. The transfected cells were then cultured for 48-72 hours, digested into single cells using trypsin, and analyzed using a flow cytometer to detect the splicing skipping efficiency induced by the various snRNA groups.

[0173] Experimental results: As shown in Figure 26 and the table below, introduction of the hnRNP A1 binding motif into the 5' end of U7-snRNA significantly improved the effect of inducing splicing skipping of USH2A pre-mRNA exon 13, not only increasing the proportion of cells (GFP+) with splicing skipping of exon 13, but also increasing the level (average FITC intensity) of mRNA with splicing-skipped exons in each cell.

[0174] [Table 12]

[0175] In this embodiment, a free tail is introduced at the 5' end of U7-snRNA, and the free tail sequence contains the hnRNP A1 protein binding motif "UAGGGU". The free tail sequence is preferably "UAUGAUAGGGACUUAGGGUG" (sequence number 45), which can recruit hnRNP A1 protein to promote splicing skipping of USH2A exon 13, but does not increase double skipping of exon 12 and exon 13, does not affect other target specificities, and does not induce or increase the target detargeting effect.

[0176] Example 15 Construction and viral packaging of an AAV-U7-snRNA-associated plasmid vector targeting induction of splicing skipping of USH2A pre-mRNA exon 13.

[0177] In this example, a U7-snRNA gene targeting exon 13 splicing skipping of USH2A pre-mRNA was inserted into the pAAV-CMV vector, replacing the central gene sequence of the two ITR domains. The pAAV-U7-snRNA vector, an AAV packaging plasmid, was constructed by co-transfecting the serotype pRC plasmid (containing the AAV2 Rep gene and the respective serotype Cap genes) and the pHelper plasmid (a vector plasmid containing the adenovirus E2A, E4, and VA genes) into host cells and packaging the resulting AAV-U7-snRNA virus targeting exon 13 splicing skipping of USH2A pre-mRNA. The specific engineering process is as follows:

[0178] First, we synthesized the gene sequence—a U7-snRNA gene expression cassette backbone (without the recognition domain): 5'-mouse U7 promoter-smOPT sequence-U7-snRNA scaffold-snRNA gene-specific 3' cassette-3'. Two Type IIs restriction endonuclease recognition sites were added between the U7 promoter and smOPT to facilitate subsequent cleavage, replacement, and insertion of other recognition domain sequences. The synthetic gene sequence was inserted between the two AAV2-ITR domains of the pAAV-CMV plasmid to obtain the pAAV-U7-snRNA backbone vector.

[0179] U7-snRNA gene expression cassette backbone (without recognition domain) (SEQ ID NO: 46): AAGCTTAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTG GAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGCAGAGACCAATGTGGGTCTCGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGCGGCCGC.

[0180] According to the methods described in Examples 1 and 6, the corresponding sense and antisense oligo DNA strands were synthesized according to the pretranscriptional DNA sequences corresponding to the snRNA recognition domain sequences in Table 1. Sticky ends similar to those cleaved by Type IIs restriction endonuclease recognition sites were added to both ends. The recognition domain double-stranded DNAs with sticky ends were annealed and ligated with T4 ligase to a linearized pAAV-U7-snRNA backbone plasmid digested with the corresponding Type IIs restriction endonuclease to form pAAV-U7-snRNA plasmids that target specific sites in USH2A pre-mRNA exon 13 to induce splicing skipping. These plasmids were named according to the snRNA number corresponding to the recognition domain sequence, such as pAAV-U7-snRNA#3, pAAV-U7-snRNA#14, and pAAV-U7-snRNA#16.

[0181] The target gene (a U7-snRNA gene expression cassette targeting splicing skipping of USH2A pre-mRNA exon 13) was inserted and replaced with the gene sequence between the AAV2-ITR domains of the pAAV-CMV plasmid to obtain the pAAV-U7-snRNA plasmid vector. Following the manufacturer's instructions and standard cell manipulation procedures, the AAV-U7-snRNA virus targeting splicing skipping of USH2A pre-mRNA exon 13 was packaged and obtained.

[0182] 24 hours before transfection, HEK293 / 293T cells were seeded onto 100 mm cell culture dishes in DMEM medium containing 10% FBS. Transfection was performed when the cells reached 80%-90% confluence. Three hours before transfection, the old medium was discarded and replaced with new medium. At the time of transfection, the pAAV-U7-snRNA plasmid, pRC plasmid, pHelper plasmid, and PEI (polyethyleneimine) transfection reagent were simultaneously prepared according to the system in the table below and added dropwise to the culture dish. After adding the PEI transfection mixture, the culture dish was gently shaken to evenly distribute the transfection reagent, and the culture medium was incubated at 37°C in a 5% CO2 incubator.

[0183] [Table 13]

[0184] Twenty-four hours after transfection, the medium was replaced with fresh DMEM containing 2% FBS. 48–72 hours after transfection, AAV virus-containing cells were harvested, washed, centrifuged, and the cell pellet was collected and vortexed to loosen it. Following the kit instructions, 0.5 mL of AAV Extraction Solution A was added to the cell pellet and vortexed for 15 seconds to completely suspend the cell pellet. The mixture was left at room temperature for 5 minutes, then vortexed for 15 seconds. The mixture was then centrifuged at 2000–14000 g for 10 minutes at 4°C to remove cell debris. The supernatant was collected in a new sterile centrifuge tube, and 50 μL of AAV Extraction Solution B was added. The mixture was mixed thoroughly using a pipette to obtain a solution of AAV-U7-snRNA viruses with different recognition domains. An aliquot was used to detect the virus titer using qPCR and stored at 80°C for later use.

[0185] The AAV2-ITR domain and inserted target gene fragment of the pAAV-U7-snRNA plasmid must be less than 4.7 kb. Therefore, by inserting multiple U7-snRNA gene expression cassettes (5'-mouse U7 promoter recognition domain-smOPT sequence, snRNA gene-specific 3' cassette-3'), the expression level of U7-snRNA can be increased while ensuring the same number of AAV viral particles. The gene sequence length is approximately 450 bp. Preferably, a pAAV-U7-snRNA plasmid contains 1 to 10 U7-snRNA gene expression cassettes, and the multiple U7-snRNA gene expression cassettes in the pAAV-U7-snRNA plasmid may have the same recognition domain.

[0186] The technical features of the above-described embodiments can be combined in any manner, and for the sake of simplicity, we will not describe all possible combinations of the technical features of the above-described embodiments, but as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0187] The above examples only represent some embodiments of the present invention, and although the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art can make some modifications and improvements without departing from the concept of the present invention, and all of these fall within the scope of protection of the present invention. Therefore, the patent protection scope of the present invention should be determined by the appended claims.

Claims

1. An snRNA that targets USH2A pre-mRNA and induces splicing skipping of exon 13, comprising a recognition domain reverse-complementary to the USH2A pre-mRNA sequence and a U7-snRNA scaffold sequence, wherein the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 8 to 28.

2. The snRNA according to claim 1, wherein the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 8 to 23, 25, and 28.

3. The snRNA described in claim 2, characterized in that the recognition domain of the snRNA is selected from the sequences shown in SEQ ID NOs: 8, 11, 15, 17, and 21.

4. The snRNA of claim 1, characterized in that the snRNA comprises the smOPT sequence shown in SEQ ID NO:

31.

5. The snRNA described in claim 4, characterized in that the U7-snRNA scaffold sequence is as shown in CAGGTTTTCTGACTTCGGTCGGAAAACCCCT.

6. The snRNA of claim 4, further comprising a motif that recruits a splicing regulatory protein, wherein the splicing regulatory protein comprises at least one of hnRNPA1, SRSF1, RBM4, DAZAP1 and SR.

7. A nucleic acid comprising a nucleic acid sequence encoding the snRNA of claim 1.

8. A vector, characterized in that it comprises the snRNA according to claim 1 and / or the nucleic acid according to claim 7.

9. A viral particle, characterized in that it contains the snRNA of claim 1 and / or the nucleic acid of claim 7.

10. A pharmaceutical composition comprising the snRNA of claim 1 and / or the nucleic acid of claim 7.

11. A pharmaceutical composition comprising the virus particles described in claim 9.

12. A method for obtaining an Usherin protein lacking an exon 13 expression product, comprising contacting USH2A pre-mRNA with the snRNA of claim 1 and / or the nucleic acid of claim 7.

13. A method for obtaining an Usherin protein lacking the exon 13 expression product, comprising contacting USH2A pre-mRNA with the virus particle described in claim 9.

14. A method for obtaining an Usherin protein lacking the exon 13 expression product, comprising contacting USH2A pre-mRNA with the pharmaceutical composition described in claim 11.

15. The snRNA of claim 1 or the nucleic acid of claim 7 for preventing and / or treating eye and / or ear diseases.

Images