Efficient method for generating induced pluripotent stem cells

Inhibiting TEAD3 function during nuclear reprogramming improves iPS cell establishment efficiency and stability, addressing inefficiencies in current methods by enhancing colony formation.

JP7813038B2Active Publication Date: 2026-02-12KYOTO UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2022530622
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-06-11
Filing Date
2021-06-10
Publication Date
2026-02-12
Estimated Expiration
2041-06-10

AI Technical Summary

Technical Problem

The process of establishing induced pluripotent stem (iPS) cells is inefficient due to reprogramming barriers, and existing methods to enhance efficiency, such as p53 downregulation, pose safety concerns like genomic instability.

Method used

Inhibiting the function of transcription enhancer-associated domain family member-3 (TEAD3) during nuclear reprogramming using nucleic acids, inhibitors, or dominant-negative mutants to improve iPS cell establishment efficiency.

Benefits of technology

Significantly enhances the efficiency of iPS cell establishment by inhibiting TEAD3, achieving higher colony formation and genomic stability compared to single pathway inhibition.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007813038000001
    Figure 0007813038000001
  • Figure 0007813038000002
    Figure 0007813038000002
  • Figure 0007813038000003
    Figure 0007813038000003
Patent Text Reader

Abstract

The present invention provides: a method that is for improving establishing efficiency of iPS cells and that includes, in a nuclear reprogramming step for somatic cells, inhibiting the function of transcription enhancer factor domain family member-3 (TEAD3); and a method that is for producing iPS cells and that includes bringing somatic cells into contact with nuclear reprogramming substances and a substance for inhibiting the function of TEAD3.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for improving the efficiency of induced pluripotent stem (iPS) cell establishment by inhibiting the function of transcription enhancer-associated domain family member-3 (hereinafter also referred to as "TEAD3") in the nuclear reprogramming process of somatic cells, and to an agent for improving the efficiency of iPS cell establishment, comprising a TEAD3 function inhibitor. The present invention also relates to a method for producing iPS cells by introducing a nuclear reprogramming substance and a TEAD3 function inhibitor into somatic cells. [Background technology]

[0002] Somatic cell reprogramming, driven by nuclear reprogramming factors such as Yamanaka factors (Oct3 / 4, Sox2, Klf4 (and c-Myc)), must overcome a set of powerful transcription factors that protect somatic cell identity in order to reprogram cells and dedifferentiate them into iPS cells. To improve the efficiency of iPS cell establishment, numerous studies have focused on identifying key factors that act as reprogramming barriers. Nevertheless, reprogramming remains an inefficient process.

[0003] The somatic cell reprogramming process can be broadly divided into initiation, stabilization, and maturation stages, and is coupled with the execution of multiple biological programs, including major changes in transcriptional networks. p53 is widely known to act as a critical barrier to reprogramming. Indeed, downregulation of p53 has been shown to significantly increase the number of iPS colonies in mouse and human fibroblasts (see, for example, Patent Document 1 and Non-Patent Document 1). However, because p53 acts as a defense mechanism against uncontrolled cell proliferation in response to DNA damage, some have pointed out that downregulation of the p53 pathway may result in genomic instability and pose safety concerns. Transient p53 suppression using a non-integrating plasmid offers a safer method for improving iPS cell establishment efficiency (see, for example, Non-Patent Document 2).

[0004] The present inventors previously reported that inhibiting p38 function during the nuclear reprogramming process of somatic cells can improve the efficiency of iPS cell establishment (Patent Document 2). However, the underlying mechanism remains unclear. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2009 / 157593 [Patent Document 2] International Publication No. 2012 / 036299 [Non-patent literature]

[0006] [Non-Patent Document 1] Hong, H. et al. (2009) Nature 460, 1132-1135. [Non-patent document 2] Okita, K. et al. (2011) Nat Methods 8,409-412. Summary of the Invention [Problem to be solved by the invention]

[0007] The object of the present invention is to identify a novel key factor that serves as a reprogramming barrier for somatic cells, and to improve the efficiency of iPS cell establishment by controlling the factor to disable the reprogramming barrier. [Means for solving the problem]

[0008] To achieve the above objectives, the present inventors systematically investigated the role of p38 MAPK inhibitors and found that p38 inhibition can dramatically improve the efficiency of human iPS cell establishment at both the initiation and stabilization stages of reprogramming. The present inventors also found that dual inhibition of both the p38 and p53 pathways during reprogramming further increased the efficiency of iPS colony formation compared with inhibition of either pathway alone. Among the genes whose expression was significantly downregulated by dual inhibition, the inventors identified TEAD3 as a gene whose expression could improve iPS cell establishment efficiency to a similar extent as that achieved by dual inhibition, leading to the completion of the present invention.

[0009] That is, the present invention is as follows. [1] A method for improving the efficiency of establishing induced pluripotent stem (iPS) cells, comprising inhibiting the function of transcription enhancer-associated domain family member-3 (TEAD3) in the nuclear reprogramming process of somatic cells. [2] (a) to (c) below: (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the TEAD3 gene; (b) an antisense nucleic acid against a transcript of the TEAD3 gene; and (c) a ribozyme nucleic acid for a transcript of the TEAD3 gene The method according to [1], wherein the function of TEAD3 is inhibited by introducing any one of the nucleic acids into somatic cells. [3] The method described in [1], wherein the function of TEAD3 is inhibited by introducing a dominant-negative mutant of TEAD3 or a nucleic acid encoding the same into somatic cells. [4] The method described in [1], wherein the function of TEAD3 is inhibited by inhibiting a transcription coactivator of TEAD3 in somatic cells. [5] Either (a) or (b) of the following: (a) Decoy nucleic acid against TEAD3; (b) an oligonucleic acid comprising a nucleotide sequence represented by rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r represents a or g, w represents a or t, y represents c or t, and each n independently represents none, a, g, t, or c; SEQ ID NO: 3); The method described in [1], wherein the function of TEAD3 is inhibited by introducing the gene into somatic cells. [6] An agent for improving iPS cell establishment efficiency, comprising a substance that inhibits the function of TEAD3. [7] The inhibitor is one of the following (a) to (c): (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the TEAD3 gene; (b) an antisense nucleic acid against a transcript of the TEAD3 gene; and (c) a ribozyme nucleic acid for a transcript of the TEAD3 gene The agent according to [6], wherein the nucleic acid is any one of the nucleic acids. [8] The agent according to [6], wherein the inhibitor is a dominant-negative mutant of TEAD3 or a nucleic acid encoding the same. [9] The agent according to [6], wherein the inhibitor is an inhibitor of a TEAD3 transcription coactivator.

[10] The inhibitor is selected from the group consisting of (a) and (b) below: (a) Decoy nucleic acid against TEAD3; (b) an oligonucleic acid comprising a nucleotide sequence represented by rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r represents a or g, w represents a or t, y represents c or t, and each n independently represents none, a, g, t, or c; SEQ ID NO: 3); The agent according to [6],

[11] A method for producing iPS cells, comprising contacting somatic cells with a nuclear reprogramming substance and a substance that inhibits the function of TEAD3.

[12] The inhibitor is one of the following (a) to (c): (a) a nucleic acid or a precursor thereof having RNAi activity against a transcript of the TEAD3 gene; (b) an antisense nucleic acid against a transcript of the TEAD3 gene; and (c) a ribozyme nucleic acid for a transcript of the TEAD3 gene The method according to

[11] , wherein the nucleic acid is any one of the nucleic acids.

[13] The method according to

[11] , wherein the inhibitor is a dominant-negative mutant of TEAD3 or a nucleic acid encoding the same.

[14] The method according to

[11] , wherein the inhibitor is an inhibitor of a TEAD3 transcription coactivator.

[15] The inhibitor is selected from the group consisting of (a) and (b) below: (a) Decoy nucleic acid against TEAD3; (b) an oligonucleic acid comprising a nucleotide sequence represented by rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r represents a or g, w represents a or t, y represents c or t, and each n independently represents none, a, g, t, or c; SEQ ID NO: 3); The method according to

[11] .

[16] The method according to any one of

[11] to

[15] , wherein the nuclear reprogramming substances are Oct3 / 4, Klf4 and Sox2, or nucleic acids encoding them.

[17] The method according to any one of

[11] to

[15] , wherein the nuclear reprogramming substances are Oct3 / 4, Klf4, Sox2, and c-Myc, L-Myc, or N-Myc, or nucleic acids encoding the same. [Effects of the Invention]

[0010] According to the present invention, the efficiency of establishing iPS cells from somatic cells can be significantly improved. [Brief explanation of the drawings]

[0011] [Figure 1]Figure 1 shows the effect of small-molecule p38 inhibitors on mouse iPS cell establishment. A. iPS cell colony formation assays were performed to examine the effect of a p38 inhibitor (SB202190; 10 μM) on seven compounds (VC, 10 μg / mL; VA, 1.9 mM; CH, 3 μM; PD, 0.5 μM; IL, 0.2 ng / mL; AS, 5 μM; RA, 1 μM) at concentrations proven to alter MEF reprogramming efficiency in vitro. Induction of reprogramming was assayed individually in primary MEFs ectopically expressing four factors (4F; Oct3 / 4, Sox2, Klf4, and c-Myc) inserted into vectors with a Nanog-GFP cassette as the final effector, a reporter of pluripotency. To evaluate the reprogramming efficiency of each compound, the number of GFP-positive (GFP+) colonies was counted 21 days (Day 21) (left bar) and 28 days (Day 28) (right bar) after treatment and compared with the number of GFP-positive colonies in the 4F-transduced negative control (DM). B. Schematic representation of the four SB202190 treatment protocols (A–D). The time axis indicates the period of each treatment, with Day 0 representing the day on which the four factors were transduced into MEFs (A: Days 1–4, B: Days 1–8, C: Days 8–16, D: Days 1–16). C. The reprogramming efficiency of each treatment was examined on Days 21 and 28. The number of iPS cell colonies induced by 4F and the p38 inhibitor (SB202190) (lower bar) was compared with the number of iPS cell colonies induced by 4F alone treated with vehicle (DMSO) (upper bar). D. Fall plot showing the difference in the number of GFP+ colonies between Day 21 and Day 28 for the experimental group treated with SB202190 during Period A. E. Fall plot showing the difference in the number of GFP+ colonies on Day 21 and Day 28 between the experimental group treated with SB202190 during Period A and the experimental group treated with SB202190 during Period D. [Figure 2]Figure 1 shows the effect of small-molecule p38 inhibitors on human iPS cell establishment. A. Schematic representation of four p38 inhibitor treatment protocols (Periods A to D). The time axis indicates the period of each treatment, with Day 0 representing the day the four factors were introduced into HDFs (A: Days 2 to 4, B: Days 6 to 20, C: Days 20 to 32, D: Days 6 to 32). B. The effect of p38 inhibitors on HDF reprogramming efficiency was examined using an iPS cell colony formation assay. Primary HDFs ectopically expressing four factors (4F; Oct3 / 4, Sox2, Klf4, and c-Myc) were treated with 10 μM SB202190, SB203580, or SB239063 using Protocol Period A or Protocol Period D. On days 16, 24, and 32, the reprogramming efficiency was measured by counting the number of ES cell-like (iPS cell) colonies and comparing them with HDFs reprogrammed with 4F alone (DMSO) without p38 inhibitor treatment. The left graph shows the results of inhibitor treatment during period A, and the right graph shows the results of inhibitor treatment during period D. For each day, the results are shown for SB239063, SB203580, SB202190, and DMSO treatment, respectively. *p<0.05, **p<0.01. C. Phase-contrast images of human ES cell-like colonies induced from HDFs with 4F + SB202190 are shown. D. Alkaline phosphatase staining assay for iPS cells induced from HDFs with 4F alone (DMSO) or 4F + SB202190 (SB202190). E. Representative immunohistochemical staining images (right panel) for pluripotency markers (OCT4, SOX2, and TRA-1-60) in iPS cell colonies induced from HDFs by 4F + SB202190. The left panel shows nuclear staining with DAPI. Scale bar: 100 μm. F. The effect of a p38 inhibitor (SB202190) on the efficiency of HDF reprogramming induced by three factors (3F; Oct3 / 4, Sox2, and Klf4) was investigated using an iPS cell colony formation assay.The reprogramming efficiency was measured on Day 24 (bottom) and Day 32 (top) as the number of ES cell-like (iPS cell) colonies. The number of iPS cell colonies induced from HDFs by 3F + SB202190 (top bar for each day) was compared with the number of iPS cell colonies induced by 3F and vehicle (DMSO) (bottom bar for each day). *p<0.05. The effect of the p38 inhibitor (SB202190) on the reprogramming efficiency of HDFs induced by the introduction of reprogramming factors via an episomal vector (pCXLE) was examined using an iPS cell colony formation assay. The reprogramming efficiency was measured on Day 24 (bottom) and Day 32 (top) as the number of ES cell-like (iPS cell) colonies. The number of iPS cell colonies induced from HDFs by reprogramming factors + SB202190 (top bar for each day) was compared with the number of iPS cell colonies induced by reprogramming factors and vehicle (DMSO) (bottom bar for each day). *p<0.05, ***p<0.001. [Figure 3]These figures show pluripotency and genomic stability in human iPS cells established using a small-molecule p38 inhibitor. A. qRT-PCR analysis of the expression of pluripotency genes (OCT4, SOX2, and NANOG), which are indicators of somatic cell reprogramming. Values ​​are relative to the expression level in ES cells, with expression levels set at 1. SB1-SB3: human iPS cell clones induced by SB202190 treatment; DM, B7: human iPS cell clones induced with 4F alone; ES: human ES cells; HD: HDF. B. Karyotype analysis of human iPSC clones induced by SB202190 treatment. C. In vitro differentiation assay of human iPSC clones induced by SB202190 treatment. From left to right, differentiation into embryoid bodies (EBs), ectodermal lineages (β-III-tubulin positive), mesodermal lineages (α-SMA positive), and endodermal lineages (AFP positive) are shown. Nuclei were stained with Hoechst 33342. Scale bar: 100 μm. D. Teratoma formation assay of human iPSC clones induced by SB202190 treatment. The left panel shows a schematic diagram of the three germ layer (ectoderm, mesoderm, and endoderm) lineages. The stained photographs show differentiation into the ectoderm, mesoderm, and endoderm lineages, respectively. E. Left panel: The number of iPS cell colonies induced by 4F transfection and p38 inhibitor (SB202190) treatment (upper bar for each HDF) from four different donors (HDF1616, HDF1079, HDF1078, and Tig109) was compared with the number of iPS cell colonies induced by 4F transfection and vehicle (DMSO) treatment (lower bar for each HDF). Right panel: Statistical analysis of iPS cell colony formation efficiency based on results from four donors (t-test; *p<0.05). [Figure 4]Figure 1 shows the results of transcriptome analysis of human iPS cells established by p38 and / or p53 inhibition. A. Comparison of p53 mRNA levels in HDFs reprogrammed with 4F alone (DMSO) and clones reprogrammed with 4F and p53 shRNA (shp53). The expression level of the former is set to 1, and the relative values ​​are shown. ***p<0.001. B. The number of iPS cell colonies induced from HDFs by 4F transfection and p53 inhibition (shp53) and / or p38 inhibition (SB202190) was compared with that by 4F transfection and vehicle treatment (DMSO) using an iPS cell colony formation assay. **p<0.01, ***p<0.001. C. Principal component analysis (PCA) correlates with increased iPSC colony number (△) for over 58,000 genes expressed in the four groups. D. Upper panel: Agglomerative hierarchical clustering of samples. The Manhattan distance was applied to calculate the distance between samples, and a tree diagram was created using the agnes function. Bottom: Sample correlation matrix showing transcriptome differences obtained by consensus clustering of mRNA data. Scatter plot of clustering results using the Ek-means algorithm. F. Heat map of differentially expressed genes (DEG) analysis. 1147 DEGs between clusters A and C (left) and 2185 DEGs between clusters A and B (right) are shown. [Figure 5]This figure shows the results of a search for genes whose expression levels are specifically reduced when both the p38 pathway and the p53 pathway are inhibited. A. Genes (DEGs) whose expression levels were reduced in iPS cells compared to HDFs were extracted and compared when p53 was inhibited alone (shp53) and when p53 and p38 were dually inhibited (shp53+SB202190) in conjunction with 4F introduction. 651 DEGs whose expression levels were reduced only with dual inhibition were found (top). Of these, 149 DEGs whose expression levels were reduced by more than two-fold (bottom). B. Genes (DEGs) whose expression levels were reduced in iPS cells compared to HDFs were extracted and compared when p38 was inhibited alone (SB202190) and when p53 and p38 were dually inhibited (shp53+SB202190) in conjunction with 4F introduction. 1,056 DEGs whose expression levels were reduced only with dual inhibition were found (top). Of these, 145 DEGs showed a two-fold or greater decrease in expression (bottom). C. The overlap between the 651 genes whose expression levels were reduced only by p53 / p38 dual inhibition compared to p53 alone and the 1,056 genes whose expression levels were reduced only by p53 / p38 dual inhibition compared to p38 alone was examined. 340 genes were found to overlap. Of the 340 genes extracted by DC, 31 were classified as having transcription factor or DNA binding activity. E. Analysis of significant GO terms related to biological processes for DEGs whose expression levels were commonly reduced by p53 / p38 dual inhibition. [Figure 6]Figure 1 shows the effect of TEAD3 inhibition on human iPS cell establishment and the transcriptional regulation of the TEAD3 gene by Klf4. A. The relative expression level of TEAD3 is shown when 4F was introduced into HDFs (DMSO), or when 4F was introduced and p38 alone was inhibited (p382KO), p53 alone was inhibited (shp53), or p53 and p38 were dually inhibited (shp53+p382KO). +100 on the X-axis indicates the expression level of DMSO, and -100 on the X-axis indicates no expression. For example, -75 on the X-axis indicates an expression level 0.125 times that of DMSO. Dashed arrows indicate the direction in which the number of iPS cell colonies increases. B. TEAD3 protein expression is shown when two types of HDFs (HDF1616, HDF1079) were transfected with 4F alone (4F), 4F with a nonspecific shRNA (Scr), or 4F with two TEAD3 shRNAs (4F-shTEAD3#1 and 4F-shTEAD3#2). In both HDFs, TEAD3 protein expression was significantly suppressed by the two TEAD3 shRNAs. C. TEAD3 mRNA expression is shown when two types of HDFs (HDF1616, HDF1079) were transfected with 4F alone (4F), 4F with a nonspecific shRNA (Scr), or 4F with two TEAD3 shRNAs (4F-shTEAD3#1 and 4F-shTEAD3#2). In both HDFs, TEAD3 mRNA expression was significantly suppressed by the two TEAD3 shRNAs. **p<0.01, ***p<0.001. D. The number of iPS cell colonies obtained when 4F alone (4F), 4F with a nonspecific shRNA (Scr), or 4F with two TEAD3 shRNAs (4F-shTEAD3#1 and 4F-shTEAD3#2) was transfected into two types of HDF (HDF1616 and HDF1079). *p<0.05, **p<0.01. E. Alkaline phosphatase staining images of iPS cell colonies obtained when 4F alone (4F), 4F with a nonspecific shRNA (Scr), or 4F with two TEAD3 shRNAs (4F-sh#1 and 4F-sh#2) were transfected into HDF (left: whole dish; right: enlarged photograph).F. Changes in TEAD3 expression during the MEF reprogramming process in the early phase (day 2 and day 4), intermediate phase (day 8), and late phase (day 18), as well as in iPSCs. G. Changes in TEAD3 expression in SSEA1-positive and SSEA1-negative cells during the MEF reprogramming process. H. Transcription start site (TSS) sequences of the TEAD3 gene predicted to bind KLF4 and their relative binding scores are shown. I. Prediction of KLF4 binding consensus sequences based on analysis of the binding cis-element sequences of target genes known to be bound by KLF4. [Figure 7] A. Mouse iPS cells (20D17; initial cell density: 1 x 10 cells / well) were counted 96 hours after SB202190 treatment (**: p<0.01; compared with DMSO). B. Mouse iPS cells obtained by SB202190 treatment produced chimeric mice with brown coat color. C. Germline transmission occurred in mice derived from mouse iPS cells obtained by SB202190 treatment. [Figure 8] This shows that p38 inhibition promotes proliferation of HDFs and HDFs in the early phase of reprogramming, but does not affect the proliferation of human iPS cells. A. HDFs were seeded at a density of 1 x 105 cells / well in 6-well plates and cultured for 96 hours with three p38 inhibitors. Total cell numbers were counted on days 2, 4, 6, and 8 after treatment. Results are shown as the mean and standard deviation of three independent experiments (*: p<0.05; compared with DMSO). B. 4F-transfected HDFs were cultured for 96 hours with three p38 inhibitors. Total cell numbers were counted on days 2, 4, 6, and 8 after treatment. Results are shown as the mean and standard deviation of three independent experiments (*: p<0.05; compared with DMSO). C. Human iPS cells (201B7) were seeded on SNL feeder cells at a density of 2 x 105 cells / well and cultured for 96 hours with three p38 inhibitors. The total number of cells was counted on day 4 after treatment. The results of three independent experiments are shown as the mean and standard deviation. [Figure 9]Correlation between TEAD3 expression and p53 expression in publicly available datasets (GSE36664 containing transcriptome data for MEFs, GSE45276 containing transcriptome data for human lung fibroblasts (HLFs), and a dataset containing transcriptome data for HDFs) is shown (R: Pearson correlation coefficient). [Figure 10] Correlations between TEAD3 expression and p38δ, ERK4, p44-ERK1, CDK4, and CDK6 expression in publicly available single-cell RNA-Seq datasets from HDFs are shown (R: Pearson correlation coefficient). [Figure 11] Figure 1 shows the causal role of TEAD3 in tumor initiation and cell cycle kinetics in HeLa cells. First, we generated daughter cell lines (plenti / Ubc-Slc7a1) expressing the ecotropic receptor Slc7a1 to allow retroviral infection, and then retrovirally transduced them with shTEAD3. Clones with downregulated TEAD3 expression exhibited enhanced cell proliferation and produced larger tumor-like nodules, suggesting that TEAD3 plays a causal role in cervical cancer progression by enhancing cancer-inducing cellular properties (*: p<0.05, **: p<0.01; compared with Scr (HeLa cells transfected with a nonspecific shRNA)). [Figure 12] TEAD3 expression analysis in the human cervical cancer dataset GSE6791 (Cancer Res 2007 May 15;67(10):4605-19). Left: Box plots show corrected TEAD3 mRNA levels in normal (N) and cancer (T) tissue samples. Right: Patients in the GSE691 data shown in the box plots were individually classified according to increased TEAD3 expression levels. [Figure 13]A. Representative bright-field images of putative iPS cell colonies (squares) 12 days after transfection of HDF1616 with 4F(scr) or 4F+shTEAD3. B. Representative bright-field images of putative iPS cell colonies (squares) 12 days after transfection of HDF1079 with 4F+shTEAD3. C. Growth curves of HDF1616 cells in the reprogramming process transfected with 4F(Scr), 4F+shTEAD3, or 4F+shTEAD3+shp53 (*: p<0.05; compared with HDF1616 transfected with Scr (4F+nonspecific shRNA)). D. Growth curves of iPS cells established by transfecting HDF1616 with 4F(Scr), 4F+shTEAD3, or 4F+shTEAD3+shp53. E. Growth curves of HDF1079 cells transfected with 4F(Scr), 4F+shTEAD3, or 4F+shTEAD3+shp53 during reprogramming (**: p<0.01; compared with HDF1079 transfected with Scr (4F+nonspecific shRNA)). F. Growth curves of iPS cells established by transfecting HDF1079 with 4F(Scr), 4F+shTEAD3, or 4F+shTEAD3+shp53. DETAILED DESCRIPTION OF THE INVENTION

[0012] The present invention provides a method for improving iPS cell establishment efficiency by inhibiting TEAD3 function in the nuclear reprogramming step of somatic cells (hereinafter also referred to as the "improving method of the present invention"). The means for inhibiting TEAD3 function are not particularly limited, but a preferred method involves introducing a TEAD3 function inhibitor into somatic cells. Therefore, the present invention also provides an agent for improving iPS cell establishment efficiency (hereinafter also referred to as the "agent of the present invention") comprising a TEAD3 function inhibitor. Furthermore, the present invention provides a method for producing iPS cells by introducing a nuclear reprogramming substance and a TEAD3 function inhibitor into somatic cells (hereinafter also referred to as the "production method of the present invention"; the "improving method of the present invention" and the "production method of the present invention" may be collectively referred to as the "method of the present invention").

[0013] (A) Somatic cell source In the present invention, somatic cells that can be used as starting materials for producing iPS cells may be any cells other than germ cells derived from mammals (e.g., humans, mice, monkeys, cows, pigs, rats, dogs, etc.), and include, for example, keratinizing epithelial cells (e.g., keratinizing epidermal cells), mucosal epithelial cells (e.g., epithelial cells of the surface of the tongue), exocrine gland epithelial cells (e.g., mammary gland cells), hormone-secreting cells (e.g., adrenal medullary cells), metabolic and storage cells (e.g., hepatocytes), luminal epithelial cells that form the interface (e.g., type I alveolar cells), luminal epithelial cells of the inner ducts (e.g., vascular endothelial cells), and somatic cells that form the inner ducts (e.g., vascular endothelial cells). Examples of the somatic cells include erythrocytes (e.g., thyroid cells), ciliated cells with transport capacity (e.g., airway epithelial cells), extracellular matrix-secreting cells (e.g., fibroblasts), contractile cells (e.g., smooth muscle cells), blood and immune system cells (e.g., peripheral blood mononuclear cells, umbilical cord blood, T lymphocytes), sensory cells (e.g., rod cells), autonomic nervous system neurons (e.g., cholinergic neurons), supporting cells of sensory organs and peripheral neurons (e.g., satellite cells), central nervous system neurons and glial cells (e.g., astrocytes), pigment cells (e.g., retinal pigment epithelial cells), and their precursor cells (tissue precursor cells). There are no particular limitations on the degree of cell differentiation or the age of the animal from which the cells are collected, and both undifferentiated precursor cells (including somatic stem cells) and terminally differentiated mature cells can be used as the source of somatic cells in the present invention. Examples of undifferentiated precursor cells include tissue stem cells (somatic stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells.

[0014] Although there are no particular limitations on the mammalian individual from which somatic cells are collected, when the resulting iPS cells are to be used in human regenerative medicine, it is particularly preferable to collect somatic cells from the patient himself or from another person with the same or substantially the same HLA type, in order to avoid rejection. Here, "substantially the same" HLA type refers to a match in HLA type sufficient to allow the transplanted cells to engraft when cells obtained by inducing differentiation of iPS cells derived from the somatic cells using immunosuppressants or other methods are transplanted into a patient. For example, this includes cases where the major HLA loci (e.g., the three HLA loci HLA-A, HLA-B, and HLA-DR) are identical (the same applies below). Furthermore, when iPS cells are not to be administered (transplanted) to humans, for example, when they are used as a source of cells for screening to assess a patient's drug sensitivity or the presence or absence of side effects, it is similarly preferable to collect somatic cells from the patient himself or from another person with the same genetic polymorphisms correlated with drug sensitivity or side effects.

[0015] Prior to subjecting somatic cells isolated from mammals to the nuclear reprogramming step, they can be pre-cultured in a known medium suitable for the culture of the cell type. Examples of such media include, but are not limited to, minimum essential medium (MEM) containing approximately 5-20% fetal bovine serum, Dulbecco's modified Eagle's medium (DMEM), RPMI 1640 medium, 199 medium, and F12 medium. When using an introduction reagent such as cationic liposomes to contact the cells with a nuclear reprogramming substance and a p38 function inhibitor (and, if necessary, other substances that improve iPS cell establishment efficiency, as described below), it may be preferable to switch to a serum-free medium to prevent a decrease in introduction efficiency.

[0016] (B) TEAD3 functional inhibitors TEAD3, the target molecule in this invention, is a member of the transcription enhancer-associated domain (TEAD) family. This transcription factor activates the transcription of target genes by binding to the coactivators YAP or TAZ, whose nuclear translocation is controlled by the Hippo signaling pathway.

[0017] As used herein, "TEAD3" refers to a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 2. As used herein, proteins and peptides are written in accordance with the convention for notating peptides, with the N-terminus (amino terminus) at the left and the C-terminus (carboxyl terminus) at the right. "An amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2" means (a) the amino acid sequence of an ortholog in another warm-blooded animal (e.g., guinea pig, rat, mouse, chicken, rabbit, dog, pig, sheep, cow, monkey, etc.) of human TEAD3 consisting of the amino acid sequence represented by SEQ ID NO: 2; or (b) an amino acid sequence of a natural allelic variant or genetic polymorphism of human TEAD3 consisting of the amino acid sequence represented by SEQ ID NO: 2 or an orthologue of (a) above; means. Preferably, TEAD3 is human TEAD3 consisting of the amino acid sequence set forth in SEQ ID NO: 2, or a natural allelic variant or genetic polymorphism thereof. Examples of such genetic polymorphisms include, but are not limited to, the SNP in which Thr (ACG) at position 254 is replaced with Met (ATG), which is registered in dbSNP as rs35080860.

[0018] As used herein, the term "TEAD3 function inhibitor" refers to any substance that can inhibit (1) the function of the TEAD3 protein or (2) the expression of the TEAD3 gene. In other words, the term "TEAD3 function inhibitor" as used herein includes not only substances that act directly on the TEAD3 protein to inhibit its function or substances that act directly on the TEAD3 gene to inhibit its expression, but also substances that act on factors involved in transcription activation by TEAD3, thereby inhibiting the function of the TEAD3 protein or the expression of the TEAD3 gene.

[0019] In the present invention, the term "substance that inhibits TEAD3 gene expression" refers to a substance that acts at any stage of the TEAD3 gene, such as the transcription level, post-transcriptional regulation level, protein translation level, or post-translational modification level. Therefore, substances that inhibit TEAD3 expression include, for example, substances that inhibit the transcription of the TEAD3 gene (e.g., antigene), substances that inhibit the processing of initial transcription products into mRNA, substances that inhibit the transport of mRNA into the cytoplasm, substances that inhibit the translation of mRNA into protein (e.g., antisense nucleic acid, miRNA) or that degrade mRNA (e.g., siRNA, gapmer-type antisense nucleic acid, ribozyme, miRNA), and substances that inhibit the post-translational modification of initial translation products. While substances that act at any stage can be used, substances that bind complementarily to mRNA to inhibit translation into protein or degrade mRNA are preferred.

[0020] A preferred example of a substance that specifically inhibits translation of TEAD3 gene mRNA into protein (or degrades mRNA) is a nucleic acid that contains a nucleotide sequence complementary to the nucleotide sequence of the mRNA, or a part thereof. A nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene refers to a nucleotide sequence that is sufficiently complementary to the target sequence of the mRNA to inhibit its translation (or cleave the target sequence) under physiological conditions. Specifically, this refers to a nucleotide sequence that has 90% or more, preferably 95% or more, more preferably 97% or more, and particularly preferably 98% or more homology with a nucleotide sequence that is completely complementary to the nucleotide sequence of the mRNA (i.e., the nucleotide sequence of the complementary strand of the mRNA) in the overlapping region. The "nucleotide sequence homology" in this invention can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions: expectation value = 10; gaps allowed; filtering = ON; match score = 1; mismatch score = -3.

[0021] More specifically, a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene is a nucleotide sequence that hybridizes under stringent conditions with the nucleotide sequence shown in SEQ ID NO: 1. Here, "stringent conditions" refers to, for example, the conditions described in *Current Protocols in Molecular Biology*, John Wiley & Sons, 6.3.1-6.3.6, 1999, such as hybridization at 6xSSC (sodium chloride / sodium citrate) / 45°C, followed by one or more washes at 0.2xSSC / 0.1% SDS / 50-65°C, but those skilled in the art can appropriately select hybridization conditions that provide equivalent stringency.

[0022] Preferred examples of the mRNA of the TEAD3 gene include the mRNA of human TEAD3 (RefSeq Accession No. NM_003214.4) comprising the nucleotide sequence set forth in SEQ ID NO: 1, or its orthologs in other warm-blooded animals, as well as natural allelic variants or genetic polymorphisms thereof.

[0023] A "portion of a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene" is not particularly limited in length or position, as long as it can specifically bind to the mRNA of the TEAD3 gene and inhibit protein translation from the mRNA (or degrade the mRNA), but from the standpoint of sequence specificity, it should contain at least 10 bases, preferably 15 bases, and more preferably 19 bases, complementary to the target sequence.

[0024] Specifically, preferred examples of nucleic acids containing a portion of a nucleotide sequence complementary to the nucleotide sequence of mRNA of the TEAD3 gene include any of the following (a) to (c): (a) a nucleic acid or a precursor thereof having RNAi activity against the mRNA of the TEAD3 gene (b) antisense nucleic acid against the mRNA of the TEAD3 gene (c) a ribozyme nucleic acid for the mRNA of the TEAD3 gene

[0025] (a) a nucleic acid or a precursor thereof having RNAi activity against the mRNA of the TEAD3 gene In this specification, double-stranded RNA consisting of an oligo-RNA complementary to the mRNA of the TEAD3 gene and its complementary strand, so-called siRNA, is defined as being included in nucleic acids containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene or a part thereof.

[0026] siRNA can be designed based on the cDNA sequence information of the target gene, for example, according to the rules proposed by Elbashir et al. (Genes Dev., 15, 188-200 (2001)). The target sequence of siRNA can be, for example, AA+(N) 19 , AA+(N) 21 or NA+(N) 21 (N is any base), but is not limited thereto. The position of the target sequence is also not particularly limited. For the selected group of candidate target sequences, whether there is any homology in the consecutive 16-17 base sequence in mRNA other than the target is checked using homology search software such as BLAST (http: / / www.ncbi.nlm.nih.gov / BLAST / ) to confirm the specificity of the selected target sequence. For example, AA+(N) 19 , AA+(N) 21 or NA+(N) 21 When the target sequence is a nucleotide sequence (N is any base), siRNA may be designed as a double-stranded RNA consisting of a sense strand having a 3'-terminal overhang of TT or UU at 19-21 bases after AA (or NA), and an antisense strand having a sequence complementary to the 19-21 bases and a 3'-terminal overhang of TT or UU for the target sequence whose specificity has been confirmed. Furthermore, short hairpin RNA (shRNA), which is a precursor of siRNA, can be designed by appropriately selecting any linker sequence (e.g., about 5-25 bases) capable of forming a loop structure and linking the sense strand and antisense strand via the linker sequence.

[0027] siRNA and / or shRNA sequences can be searched for using search software provided free of charge on various websites, including, but not limited to, the siDESIGN Center provided by Horizon Discovery Ltd. (https: / / horizondiscovery.com / en / products / tools / siDESIGN-Center) and the siRNA Target Finder provided by GenScript (https: / / www.genscript.com / tools / sirna-target-finder).

[0028] In a preferred embodiment, the siRNA and shRNA of the present invention comprise a nucleotide sequence complementary to a sequence consisting of at least 15 consecutive nucleotides within the region represented by nucleotide numbers 219 to 247 (AGCAACCAGCACAATAGCGTCCAACAGCT: SEQ ID NO: 4) or 1207 to 1235 (AGCATGACCATCAGCGTCTCCACCAAGGT: SEQ ID NO: 5) in the nucleotide sequence represented by SEQ ID NO: 1.

[0029] As used herein, microRNAs (miRNAs) that target the mRNA of the TEAD3 gene are also defined as nucleic acids that contain a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene or a portion thereof. miRNAs are involved in post-transcriptional regulation of gene expression by either binding to the target mRNA in a complementary manner to inhibit the translation of the mRNA or by degrading the mRNA.

[0030] miRNAs are first transcribed from the gene that encodes them as primary-microRNAs (pri-miRNAs), which are then processed by Drosha into precursor-microRNAs (pre-miRNAs) of approximately 70 bases in length with a characteristic hairpin structure. These are then transported from the nucleus to the cytoplasm, where they are further processed by Dicer to become mature miRNAs, which are then incorporated into RISC and act on target mRNAs. Therefore, pre-miRNAs and pri-miRNAs, preferably pre-miRNAs, can be used as miRNA precursors.

[0031] miRNAs can be searched for using target prediction software provided free of charge on various websites. Examples of such websites include, but are not limited to, TargetScan (http: / / www.targetscan.org / vert_72 / ) from the Whitehead Institute in the United States and DIANA-micro-T-CDS (http: / / diana.imis.athena-innovation.gr / DianaTools / index.php?r=microT_CDS / index) from the Alexander Fleming Center for Biomedical Sciences in Greece. Alternatively, miRNAs targeting TEAD3 mRNA can be searched for using TarBase (http: / / carolina.imis.athena-innovation.gr / diana_tools / web / index.php?r=tarbasev8 / index), a database of miRNAs experimentally proven to act on target mRNAs, published by the University of Cesarea and the Institut Pasteur. For example, among the miRNAs that matched the TEAD3 mRNA hits in the database, those that scored highly in the target prediction software include hsa-miR-106b-5p, hsa-miR-20a-5p, etc. Sequence information for these miRNAs and / or pre-miRNAs can be obtained using, for example, miRBase (http: / / www.mirbase.org / search.shtml), published by the University of Manchester, UK.

[0032] The nucleotide molecules constituting siRNA and / or shRNA, or miRNA and / or pre-miRNA may be natural RNA or DNA, but may contain various chemical modifications to improve stability (chemical and / or enzymatic) and specific activity (affinity with RNA). For example, to prevent degradation by hydrolases such as nucleases, the phosphate residues of each nucleotide constituting the antisense nucleic acid may be substituted with chemically modified phosphate residues such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. Furthermore, the hydroxyl group at the 2'-position of the sugar (ribose) of each nucleotide may be substituted with -OR (R = CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, etc.). Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, for example, by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position.

[0033] The sugar conformation of RNA is predominantly C2'-endo (S-form) or C3'-endo (N-form), and in single-stranded RNA, these two conformations exist in equilibrium, but when double-stranded, they are fixed in the N-form. Therefore, to confer strong binding ability to target RNA, BNA (LNA) (Imanishi, T. et al., Chem. Commun., 1653-9, 2002; Jepsen, JS et al., Oligonucleotides, 14, 130-46, 2004) and ENA (Morita, K. et al., Nucleosides, Nucleotides, Nucleic Acids, 22, 1619-21, 2003), which are RNA derivatives in which the sugar conformation is fixed in the N-form by bridging the 2' oxygen and 4' carbon, can also be preferably used.

[0034] siRNA can be prepared by synthesizing the sense and antisense strands of a target sequence on mRNA using an automated DNA / RNA synthesizer, denaturing them in an appropriate annealing buffer at about 90 to about 95°C for about 1 minute, and then annealing them at about 30 to about 70°C for about 1 to about 8 hours. Alternatively, siRNA can be prepared by synthesizing shRNA, which serves as a precursor to siRNA, and cleaving it using a dicer. miRNA and pre-miRNA can be synthesized using an automated DNA / RNA synthesizer based on their sequence information.

[0035] As used herein, nucleic acids designed to produce siRNA or miRNA against TEAD3 gene mRNA in vivo are also defined as nucleic acids containing a nucleotide sequence complementary to the nucleotide sequence of TEAD3 gene mRNA, or a portion thereof. Examples of such nucleic acids include expression vectors constructed to express the aforementioned shRNA or siRNA, miRNA, or pre-miRNA. As shown in the Examples below, TEAD3 expression increases both in the initiation stage of the reprogramming process (e.g., within 3 days after introduction of the nuclear reprogramming substance) and in the stabilization stage (e.g., 2 to 3 weeks after introduction of the nuclear reprogramming substance). Therefore, it is considered desirable to sustain TEAD3 functional inhibition throughout the nuclear reprogramming process. The use of an expression vector is preferable because it allows for the long-term, sustained delivery of nucleic acids that inhibit TEAD3 expression to somatic cells.

[0036] shRNAs can be prepared by designing an oligo-RNA containing a nucleotide sequence linking the sense and antisense strands of a target mRNA sequence with a spacer sequence of a length (e.g., approximately 5–25 bases) sufficient to form a suitable loop structure, and synthesizing the resulting oligo-RNA using an automated DNA / RNA synthesizer. shRNA expression vectors are available in tandem and stem-loop (hairpin) types. The former tandemly link an expression cassette for the sense strand of siRNA with an expression cassette for the antisense strand, allowing each strand to express and anneal in the cell to form a double-stranded siRNA (dsRNA). The latter, on the other hand, incorporates an shRNA expression cassette into a vector, allowing the shRNA to be expressed in the cell and processed by a dicer to form dsRNA. While Pol II promoters (e.g., the CMV immediate early promoter) can also be used, Pol III promoters are commonly used to ensure accurate transcription of short RNAs. Pol III promoters include mouse and human U6-snRNA promoters, human H1-RNase P RNA promoters, and human valine-tRNA promoters. A sequence of four or more consecutive Ts is also used as a transcription termination signal. Expression cassettes for miRNAs and pre-miRNAs can also be prepared in the same manner as for shRNAs.

[0037] The siRNA or shRNA, or miRNA or pre-miRNA expression cassette constructed in this manner is then inserted into a plasmid vector or viral vector. Examples of such vectors include viral vectors such as retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes viruses, and Sendai viruses, as well as animal cell expression plasmids. Because TEAD3 is deeply involved in gene expression regulation via the Hippo signaling pathway, which is also involved in maintaining homeostasis, it is considered preferable to quickly restore its function after the reprogramming barrier is released and somatic cells dedifferentiate into iPS cells. Therefore, non-integrative transient expression vectors, such as adenovirus vectors and plasmids, are more preferred as expression vectors. Among these, the use of episomal vectors capable of autonomous extrachromosomal replication is preferred, as they can sustain the expression of nucleic acids that inhibit TEAD3 expression throughout the nuclear reprogramming process and are rapidly eliminated from the cells after iPS cell establishment. Specific methods using episomal vectors are disclosed in Yu et al., Science, 324, 797-801 (2009).

[0038] Examples of episomal vectors include vectors that contain, as vector elements, sequences necessary for autonomous replication derived from EBV, SV40, etc. Specific examples of vector elements necessary for autonomous replication include a replication origin and a gene encoding a protein that binds to the replication origin and controls replication, such as the replication origin oriP and EBNA-1 gene for EBV, and the replication origin ori and SV40 large T antigen gene for SV40.

[0039] (b) antisense nucleic acid against the mRNA of the TEAD3 gene In the present invention, an "antisense nucleic acid against the mRNA of the TEAD3 gene" is a nucleic acid containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA or a part thereof, and has the function of inhibiting protein synthesis by binding to the target mRNA to form a specific and stable double strand.Antisense nucleic acids include polydeoxyribonucleotides containing 2-deoxy-D-ribose, polyribonucleotides containing D-ribose, other types of polynucleotides that are N-glycosides of purine or pyrimidine bases, other polymers with non-nucleotide backbones (e.g., commercially available protein nucleic acids and synthetic sequence-specific nucleic acid polymers), or other polymers containing special linkages, provided that the polymer contains nucleotides with configurations that allow base pairing or base attachment as found in DNA or RNA. They can be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, or DNA:RNA hybrids. They can also be unmodified polynucleotides (or unmodified oligonucleotides), those containing known modifications, such as those labeled, capped, or methylated, those containing analogs of one or more natural nucleotides, or those containing intramolecular nucleotide modifications, such as uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages, or sulfuric acid groups. Nucleosides may contain linkages (e.g., phosphorothioates, phosphorodithioates, etc.), side groups such as proteins (e.g., nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-lysine, etc.) or sugars (e.g., monosaccharides, etc.), intercurrent compounds (e.g., acridine, psoralen, etc.), chelators (e.g., metals, radioactive metals, boron, oxidizing metals, etc.), alkylators, or modified linkages (e.g., alpha-anomeric nucleic acids). As used herein, the terms "nucleoside," "nucleotide," and "nucleic acid" refer not only to purine and pyrimidine bases, but also to those containing other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles.Modified nucleosides and modified nucleotides may also have modified sugar moieties, for example, one or more hydroxyl groups may be substituted with halogens, aliphatic groups, or converted to functional groups such as ethers or amines.

[0040] As described above, antisense nucleic acids may be DNA or RNA, or may be DNA / RNA chimeras. When the antisense nucleic acid is DNA, the RNA:DNA hybrid formed by the target RNA and the antisense DNA can be recognized by endogenous RNase H, causing selective degradation of the target RNA. Therefore, in the case of antisense DNA directed to degradation by RNase H, the target sequence may be not only a sequence in mRNA, but also a sequence in an intron region in the initial translation product of the TEAD3 gene. The intron sequence can be determined by comparing the genomic sequence with the cDNA nucleotide sequence of the TEAD3 gene using a homology search program such as BLAST or FASTA.

[0041] The target region of the antisense nucleic acid of the present invention is not particularly limited in length, as long as hybridization of the antisense nucleic acid results in inhibition of protein translation. It may be the entire or partial sequence of the mRNA encoding the protein, ranging from as short as about 10 bases to as long as the entire sequence of the mRNA or initial transcription product. Considering ease of synthesis, antigenicity, intracellular internalization, and other issues, oligonucleotides consisting of about 10 to about 40 bases, particularly about 15 to about 30 bases, are preferred, but are not limited to these. Specifically, preferred target regions of the TEAD3 gene include, but are not limited to, the 5'-end hairpin loop, 5'-end 6-base pair repeat, 5'-end untranslated region, translation initiation codon, protein-coding region, ORF translation termination codon, 3'-end untranslated region, 3'-end palindrome region, and 3'-end hairpin loop.

[0042] In one embodiment, the target region of the antisense nucleic acid of the present invention, like the above-mentioned siRNA, can be a sequence consisting of at least 15 consecutive nucleotides within the region represented by nucleotide numbers 219 to 247 or 1207 to 1235 in the nucleotide sequence represented by SEQ ID NO: 1. When a gapmer-type antisense nucleic acid is used, TEAD3 mRNA can be degraded within the target region by the action of RNase H, thereby achieving an effect equivalent to that of siRNA.

[0043] TEAD4, a paralog of TEAD3, is known to have a splicing variant lacking the N-terminal DNA-binding domain. This is thought to be due to the skipping of exon 3, which alters the position of the initiation codon (Nat Commun 7:11840 | DOI: 10.1038 / ncomms11840). The DNA-binding domain is highly conserved within the TEAD family, and it is predicted that TEAD3 also has a splicing variant lacking the DNA-binding domain. Therefore, by using antisense nucleic acids targeting the splicing-promoting sequence within exon 3 or an adjacent intron, transcription of the splicing variant lacking exon 3 can be promoted, generating a TEAD3 isoform beginning with Met at amino acid 112 in the amino acid sequence represented by SEQ ID NO: 2. This isoform binds to the coactivator YAP / TAZ but cannot bind to the promoters of target genes, functioning as a dominant-negative mutant of TEAD3.

[0044] Furthermore, the antisense nucleic acid of the present invention may not only hybridize with the mRNA or initial transcription product of the TEAD3 gene and inhibit translation into protein, but may also bind to these genes, which are double-stranded DNA, to form a triplex and inhibit transcription into RNA (antigene).

[0045] The nucleotide molecules constituting the antisense nucleic acid may also be modified in the same manner as in the above-mentioned siRNA, etc., in order to improve stability, specific activity, etc.

[0046] The antisense oligonucleotides of the present invention can be prepared by determining the target sequence of mRNA or an early transcription product based on the cDNA or genomic DNA sequence of the TEAD3 gene, and synthesizing a sequence complementary to the target sequence using a commercially available automated DNA / RNA synthesizer (Applied Biosystems, Beckman, etc.). Antisense nucleic acids containing the various modifications described above can also be chemically synthesized by known methods.

[0047] Alternatively, antisense nucleic acids can be incorporated into expression vectors and introduced into somatic cells, as in the case of the above-mentioned siRNAs.

[0048] (c) a ribozyme nucleic acid for the mRNA of the TEAD3 gene Other examples of nucleic acids containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene, or a portion thereof, include ribozyme nucleic acids capable of specifically cleaving the mRNA within the coding region. In a narrow sense, the term "ribozyme" refers to RNA with enzymatic activity that cleaves nucleic acids. However, as used herein, the term encompasses DNA as long as it has sequence-specific nucleic acid cleavage activity. The most versatile ribozyme nucleic acids are the self-splicing RNAs found in infectious RNAs such as viroids and virusoids, and are known to include hammerhead and hairpin types. Hammerhead types exert their enzymatic activity with approximately 40 bases. By arranging several bases (totaling approximately 10 bases) adjacent to the hammerhead structure at both ends to be complementary to the desired cleavage site in the mRNA, they can specifically cleave only the target mRNA. This type of ribozyme nucleic acid has the additional advantage that it uses only RNA as a substrate and therefore does not attack genomic DNA. When the TEAD3 mRNA itself has a double-stranded structure, the target sequence can be made single-stranded by using a hybrid ribozyme containing an RNA motif derived from a viral nucleic acid that can specifically bind to an RNA helicase [Proc. Natl. Acad. Sci. USA, 98(10): 5572-5577 (2001)]. Furthermore, when a ribozyme is used in the form of an expression vector containing DNA encoding it, a hybrid ribozyme can be further ligated with a modified tRNA sequence to promote the translocation of the transcript into the cytoplasm [Nucleic Acids Res., 29(13): 2780-2788 (2001)].

[0049] Nucleic acids containing a nucleotide sequence complementary to the nucleotide sequence of the TEAD3 gene mRNA, or a portion thereof, can be provided in specialized forms such as liposomes or microspheres, or in a form with other components attached. Examples of such attached forms include polycationic bodies such as polylysine, which neutralize the charge of the phosphate backbone, and hydrophobic lipids (e.g., phospholipids, cholesterol, etc.) that enhance interaction with cell membranes and increase nucleic acid uptake. Preferred lipids for attachment include cholesterol and its derivatives (e.g., cholesteryl chloroformate, cholic acid, etc.). These can be attached to the 3' or 5' end of the nucleic acid via the base, sugar, or intramolecular nucleoside bond. Other groups include capping groups specifically placed at the 3' or 5' end of the nucleic acid to prevent degradation by nucleases such as exonucleases and RNases. Such capping groups include, but are not limited to, hydroxyl protecting groups known in the art, including glycols such as polyethylene glycol, tetraethylene glycol, and the like.

[0050] When the nucleic acid containing a portion of a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene is in the form of RNA, it can be introduced into somatic cells by techniques such as lipofection and microinjection. On the other hand, when the vector is in the form of an expression vector containing DNA encoding the RNA, it can be introduced into cells by known methods depending on the type of vector. For example, in the case of a viral vector, a plasmid containing the DNA is introduced into appropriate packaging cells (e.g., Plat-E cells) or complementation cell lines (e.g., 293 cells), the viral vector produced in the culture supernatant is collected, and the vector is then used to infect cells using an appropriate method for each viral vector. For example, specific methods using retroviral vectors as vectors are disclosed in WO2007 / 69666, Cell, 126, 663-676 (2006), and Cell, 131, 861-872 (2007), and methods using lentiviral vectors as vectors are disclosed in Science, 318, 1917-1920 (2007). Methods using adenoviral vectors are described in Science, 322, 945-949 (2008). On the other hand, in the case of a plasmid vector, which is a non-viral vector, the vector can be introduced into cells using the lipofection method, liposome method, electroporation method, calcium phosphate co-precipitation method, DEAE-dextran method, microinjection method, gene gun method, etc.

[0051] (d) an oligonucleotide containing a consensus binding sequence for p53; Another preferred embodiment of the substance that inhibits TEAD3 gene expression is a substance that inhibits the binding of a transcriptional activator of the TEAD3 gene to the promoter region of the TEAD3 gene. For example, such a substance can include an oligonucleic acid containing the p53 consensus binding sequence rrrcwwgyyynnnnnnnnnnnnnnnrrrcwwgyyy (r represents a or g, w represents a or t, y represents c or t, and each n independently represents absent, a, g, t, or c; SEQ ID NO: 3). Preferably, the oligonucleic acid is double-stranded DNA. Since p53 is thought to positively regulate TEAD3 gene transcription by binding to a cis-element sequence present in the TEAD3 promoter region, an oligonucleic acid containing the p53 consensus binding sequence can inhibit the binding of p53 to the TEAD3 promoter region and suppress its transcription. The length of the oligonucleic acid is, for example, 20 to 50 nucleotides, preferably 25 to 40 nucleotides.

[0052] The oligonucleic acid can be produced by synthesizing the sense and antisense strands using a commercially available automated DNA / RNA synthesizer (Applied Biosystems, Beckman, etc.) based on the sequence information of SEQ ID NO: 3 and annealing them.

[0053] The oligonucleic acid can be introduced into somatic cells by techniques such as lipofection and microinjection.

[0054] In the present invention, the term "substance that suppresses the function of TEAD3" refers to any substance that suppresses the function of TEAD3 once it has been functionally produced (e.g., the transcription activation function of a group of genes that maintain the somatic cell identity), and examples thereof include substances that bind to TEAD3 and suppress the function, substances that inhibit the binding activity of TEAD3 to target genes, and substances that inhibit the interaction between TEAD3 and transcriptional coactivators.

[0055] (e) Dominant-negative mutant of TEAD3 In humans, TEAD3 is a protein consisting of the amino acid sequence shown in SEQ ID NO: 2. The region of approximately 30 to 100 amino acids from the N-terminus is a DNA-binding domain highly conserved within the TEAD family, and the regions from approximately position 200 onward are the YAP / TAZ-binding domain and transcriptional activation domain. Therefore, a TEAD3 fragment lacking the DNA-binding domain binds to the transcriptional coactivator YAP / TAZ competitively with endogenous full-length TEAD3 and can suppress the transcriptional activation of target genes mediated by the interaction between TEAD3 and YAP / TAZ. On the other hand, a TEAD3 fragment lacking the YAP / TAZ-binding domain and transcriptional activation domain binds to the promoter regions of target genes competitively with endogenous full-length TEAD3 and can suppress the transcriptional activation of target genes mediated by the interaction between TEAD3 and YAP / TAZ.

[0056] Dominant-negative mutants of TEAD3 can be obtained, for example, by designing an appropriate primer set and cloning a nucleic acid encoding a TEAD3 fragment lacking the desired DNA-binding domain or YAP / TAZ-binding domain (transcription activation domain) from mRNA, cDNA, or a cDNA library derived from cells or tissues expressing TEAD3 from warm-blooded animals such as humans using (RT-)PCR, inserting the nucleic acid into an appropriate expression vector, introducing the vector into host cells, culturing the cells, and recovering the recombinant protein from the resulting culture.

[0057] Contact of a dominant-negative mutant with a somatic cell can be carried out using a known method for introducing a protein into a cell. Examples of such methods include a method using a protein introduction reagent, a method using a protein introduction domain (PTD) fusion protein, and microinjection. Protein introduction reagents include cationic lipid-based BioPOTER Protein Delivery Reagent (Gene Therapy Systems), Pro-Ject TMCommercially available reagents include Protein Transfection Reagent (PIERCE) and ProVectin (IMGENEX), lipid-based Profect-1 (Targeting Systems), and membrane-permeable peptide-based Penetrain Peptide (Q biogene) and Chariot Kit (Active Motif). Transfection can be performed according to the protocols provided with these reagents, but the general procedure is as follows: A dominant-negative mutant of p38 is diluted in an appropriate solvent (e.g., a buffer solution such as PBS or HEPES), and the transfection reagent is added. The complex is incubated at room temperature for 5–15 minutes to form a complex. This complex is then added to cells in serum-free medium and incubated at 37°C for one to several hours. The medium is then removed and replaced with serum-containing medium.

[0058] PTDs using the cell passage domains of proteins such as Drosophila-derived AntP, HIV-derived TAT, and HSV-derived VP22 have been developed. Fusion protein expression vectors incorporating the cDNA of a dominant-negative mutant of p38 and a PTD sequence are constructed and recombinantly expressed, and the fusion protein is recovered and used for transfection. Transfection can be performed in the same manner as above, except that no protein transfection reagent is added. This method is suitable for transfection of relatively small molecular weight deletion mutants such as p38DD.

[0059] Microinjection is a method in which a protein solution is placed in a glass needle with a tip diameter of about 1 μm and then punctured into a cell, ensuring reliable introduction of proteins into cells.

[0060] (f) a nucleic acid encoding a dominant-negative mutant of TEAD3 However, considering the ease of introduction into somatic cells, it is preferable to use a dominant-negative mutant of TEAD3 in the form of a nucleic acid encoding it rather than as the protein itself. Therefore, in another preferred embodiment of the present invention, the TEAD3 function inhibitor is a nucleic acid encoding a dominant-negative mutant of TEAD3. The nucleic acid may be DNA, RNA, or a DNA / RNA chimera, but is preferably DNA. Furthermore, the nucleic acid may be double-stranded or single-stranded. A cDNA encoding a dominant-negative mutant of TEAD3 can be cloned by the techniques described above for producing the mutant protein.

[0061] The isolated cDNA, like the nucleic acid containing a portion of a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene described above, can be inserted into an appropriate viral or non-viral expression vector and introduced into somatic cells by a similar gene transfer method.

[0062] (g) Inhibitors of TEAD3 transcription coactivators As mentioned above, TEAD3 activates the transcription of target genes by conjugating with the coactivators YAP / TAZ. When YAP / TAZ is phosphorylated (e.g., phosphorylated at Ser127), it binds to 14-3-3 and is localized in the cytoplasm, where it is inactivated. However, upon dephosphorylation, it dissociates from 14-3-3 and translocates to the nucleus, where it conjugates with TEAD3 to promote the transcription of target genes. Therefore, inhibiting YAP / TAZ, which are transcriptional coactivators of TEAD3, can inhibit TEAD3 function.

[0063] Methods for inhibiting YAP / TAZ include introducing siRNA or miRNA against YAP or TAZ, or their precursors, antisense nucleic acids against YAP or TAZ, ribozyme nucleic acids, etc. into somatic cells to suppress their expression, or promoting phosphorylation of YAP / TAZ or complex formation with 14-3-3 to suppress its activation and nuclear translocation.

[0064] siRNAs and shRNAs against YAP or TAZ can be appropriately designed based on the sequence information of YAP mRNA (e.g., NM_001130145 for human YAP1-2γ isoform) or TAZ mRNA (e.g., NM_000116 for human TAZ isoform-1) using the same methods as those described for siRNAs against TEAD3.

[0065] MiRNAs for YAP or TAZ can be searched using the same database as described for miRNAs for TEAD3. For example, according to TarBase (mentioned above), miRNAs for YAP1 include, but are not limited to, hsa-miR-204-5p and hsa-miR-506-3p. MiRNAs for TAZ include, but are not limited to, hsa-miR-382-3p and hsa-miR-26b-5p. Sequence information for these miRNAs and / or pre-miRNAs can be obtained, for example, using miRBase (mentioned above).

[0066] Antisense nucleic acids and ribozyme nucleic acids against YAP and TAZ can also be designed and used in the same manner as the antisense nucleic acids and ribozyme nucleic acids against TEAD3 described above.

[0067] In another embodiment, 14-3-3 proteins can be used as inhibitors of YAP or TAZ. Enriching intracellular 14-3-3 proteins can promote the formation of complexes with YAP / TAZ and inhibit the nuclear translocation of YAP / TAZ. In another embodiment, activators of the Hippo signaling pathway can also be used as inhibitors of YAP or TAZ. Activation of the Hippo signaling pathway promotes phosphorylation of YAP / TAZ, suppressing their nuclear translocation. Examples of activators of the Hippo signaling pathway include Lats1 / 2 (and their coactivators Mob1A / 1B) and, further upstream, MST1 / 2 (and their coactivators WW45). In yet another embodiment, dominant-negative mutants of YAP or TAZ can be used. The TEAD-binding domain of YAP and TAZ is 50 to 100 amino acids and 13 to 57 amino acids from the N-terminus, respectively, and the transcription activation domain is 276 to 472 and 208 to 381, respectively. Therefore, when translocated into the nucleus, a YAP or TAZ fragment containing the TEAD-binding domain but lacking the transcription activation domain binds to TEAD3 competitively with endogenous YAP / TAZ and can suppress the transcription activation of target genes mediated by the interaction between TEAD3 and YAP / TAZ. If nuclear localization is impaired by deletion of the transcription activation domain, a known nuclear localization signal sequence may be added. The amino acid sequences and mRNA sequences of these YAP / TAZ inhibitors are all known, and sequence information is available from various databases. The desired proteins or nucleic acids encoding them can be obtained in the same manner as for the above-described dominant-negative mutants of TEAD3 and the nucleic acids encoding them. The obtained proteins or nucleic acids can be introduced into somatic cells in the same manner as for the dominant-negative mutants of TEAD3 or the nucleic acids encoding them.

[0068] (h) Decoy nucleic acid for TEAD3 YAP / TAZ conjugates not only with TEAD3 but also with other transcription factors. Therefore, to selectively suppress the transcriptional activation of target genes using TEAD3, it is more preferable to use a substance that inhibits the binding of TEAD3 to the promoter region of the target gene. Examples of such substances include the above-mentioned dominant-negative mutants of TEAD3 lacking the YAP / TAZ-binding domain (transcriptional activation domain), as well as decoy nucleic acids containing the consensus binding sequence of TEAD3. An example of the consensus binding sequence of TEAD3 is ACATTCCA. Preferably, the decoy nucleic acid is double-stranded DNA. The length of the decoy nucleic acid is, for example, 8 to 30 nucleotides, preferably 8 to 20 nucleotides.

[0069] A decoy nucleic acid for TEAD3 can be prepared in the same manner as the oligonucleic acid containing the consensus binding sequence for p53 described above, and can be introduced into somatic cells.

[0070] The TEAD3 function inhibitor must be introduced into somatic cells in a manner sufficient to inhibit TEAD3 function in the nuclear reprogramming process of somatic cells. Here, nuclear reprogramming of somatic cells can be carried out by introducing a nuclear reprogramming substance into the somatic cells.

[0071] (C) Nuclear reprogramming material In the present invention, a "nuclear reprogramming substance" refers to any substance (or substances) that can induce iPS cells from somatic cells when introduced into the somatic cells, and may be composed of any substance, such as a proteinaceous factor or a nucleic acid encoding the same (including in a form incorporated into a vector), or a low-molecular-weight compound. When the nuclear reprogramming substance is a proteinaceous factor or a nucleic acid encoding the same, preferred examples include the following combinations (hereinafter, only the names of the proteinaceous factors are given): (1) Oct3 / 4, Klf4, c-Myc (2) Oct3 / 4, Klf4, c-Myc, Sox2 (wherein Sox2 can be replaced with Sox1, Sox3, Sox15, Sox17, or Sox18, preferably Sox1, Sox3, Sox15, or Sox17, more preferably Sox1 or Sox3. Klf4 can be replaced with Klf1, Klf2, or Klf5, preferably Klf2. c-Myc can be replaced with T58A (active mutant), N-Myc, or L-Myc.) (3) Oct3 / 4, Klf4, c-Myc, Sox2, Fbx15, Nanog, Eras, ECAT15-2, TclI, β-catenin (active mutant S33Y) (4) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, SV40 Large T antigen (hereinafter referred to as SV40LT) (5) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV16 E6 (6) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV16 E7 (7) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV6 E6, HPV16 E7 (8) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, Bmil (For the above, see WO 2007 / 069666 (however, for the substitution of Sox2 with Sox18 and the substitution of Klf4 with Klf1 or Klf5 in the combination (2) above, see Nature Biotechnology, 26, 101-106 (2008)). For the combination of "Oct3 / 4, Klf4, c-Myc, Sox2", see also Cell, 126, 663-676 (2006), Cell, 131, 861-872 (2007), etc. For the combination of "Oct3 / 4, Klf2 (or Klf5), c-Myc, Sox2", see also Nat. Cell Biol., 11, 197-203 (2009). For the combination of "Oct3 / 4, Klf4, c-Myc, Sox2, hTERT, For the combination of "SV40LT", see Nature, 451, 141-146 (2008). (9) Oct3 / 4, Klf4, Sox2 (see Nature Biotechnology, 26, 101-106 (2008)) (wherein Sox2 can be replaced with Sox1, Sox3, Sox15, Sox17, or Sox18. Also, Klf4 can be replaced with Klf1, Klf2, or Klf5.) (10) Oct3 / 4, Sox2, Nanog, Lin28 (Science, 318, 1917-1920 (2007)) (11) Oct3 / 4, Sox2, Nanog, Lin28, hTERT, SV40LT (see Stem Cells, 26, 1998-2005 (2008)) (12) Oct3 / 4, Klf4, c-Myc, Sox2, Nanog, Lin28 (see Cell Research (2008) 600-603) (13) Oct3 / 4, Klf4, c-Myc, Sox2, SV40LT (see also Stem Cells, 26, 1998-2005 (2008)) (14) Oct3 / 4, Klf4 (see Nature 454:646-650 (2008), Cell Stem Cell 2:525-528 (2008)) (15) Oct3 / 4, c-Myc (see Nature 454:646-650 (2008)) (16) Oct3 / 4, Sox2 (Nature, 451, 141-146 (2008), see WO2008 / 118820) (17) Oct3 / 4, Sox2, Nanog (see WO2008 / 118820) (18) Oct3 / 4, Sox2, Lin28 (see WO2008 / 118820) (19) Oct3 / 4, Sox2, c-Myc, Esrrb (where Esrrb can be replaced by Esrrg. See Nat. Cell Biol., 11, 197-203 (2009)) (20) Oct3 / 4, Sox2, Esrrb (see Nat. Cell Biol., 11, 197-203 (2009)) (21) Oct3 / 4, Klf4, L-Myc (22) Oct3 / 4, Nanog (23) Oct3 / 4 (Cell 136: 411-419 (2009), Nature, 08436, doi:10.1038 published online(2009)) (24) Oct3 / 4, Klf4, c-Myc, Sox2, Nanog, Lin28, SV40LT (Science, 324: 797-801 (2009)) (25) Oct3 / 4, Sox2, Klf4, L-Myc, Lin28 (26) Oct3 / 4, Sox2, Klf4, L-Myc, Lin28, Glis1

[0072] In the above (1)-(26), other Oct family members, such as Oct1A and Oct6, can be used instead of Oct3 / 4. Also, other Sox family members, such as Sox7, can be used instead of Sox2 (or Sox1, Sox3, Sox15, Sox17, and Sox18). Furthermore, combinations that do not fall under the above (1)-(26) but contain all of the components of any of them and further contain any other substances can also be included in the category of "nuclear reprogramming substances" in the present invention. Furthermore, under conditions where the somatic cells to be subjected to nuclear reprogramming endogenously express some of the components of any of the above (1)-(26) at levels sufficient for nuclear reprogramming, combinations of only the remaining components excluding those components can also be included in the category of "nuclear reprogramming substances" in the present invention.

[0073] Among these combinations, preferred examples of nuclear reprogramming substances include at least one, preferably two or more, and more preferably three or more selected from Oct3 / 4, Sox2, Klf4, c-Myc or L-Myc, Nanog, Lin28, and SV40LT.

[0074] In particular, when the therapeutic use of the resulting iPS cells is considered, a combination of the three factors Oct3 / 4, Sox2, and Klf4 (i.e., (9) above) is preferred. On the other hand, when the therapeutic use of iPS cells is not considered (for example, when they are used as research tools for drug discovery screening, etc.), an example of a combination is the three factors Oct3 / 4, Sox2, and Klf4 plus c-Myc, which is a four-factor combination. Alternatively, regardless of the manner in which the iPS cells are used, an example of a combination is the five factors Oct3 / 4, Sox2, and Klf4 plus L-Myc and Lin28 (i.e., (25) above), or six factors further including Glis1 (i.e., (26) above) and SV40 Large T.

[0075] Furthermore, a combination in which the above c-Myc is changed to L-Myc is also an example of a preferred nuclear reprogramming substance.

[0076] The nucleotide sequences of the mouse and human cDNAs for each of the above nuclear reprogramming substances and the amino acid sequence information of the proteins encoded by the cDNAs can be obtained by referring to the NCBI accession numbers listed in WO 2007 / 069666, and the mouse and human cDNA and amino acid sequence information for L-Myc, Lin28, Lin28b, Esrrb, Esrrg, and Glis1 can be obtained by referring to the NCBI accession numbers listed below. Those skilled in the art can prepare the desired nuclear reprogramming substances using standard methods based on the cDNA sequences or amino acid sequence information. Gene Name Mouse Human L-Myc NM_008506 NM_001033081 Lin28 NM_145833 NM_024674 Lin28b NM_001031772 NM_001004317 Esrrb NM_011934 NM_004452 Esrrg NM_011935 NM_001438 Glis1 NM_147221 NM_147193

[0077] When a proteinaceous factor itself is used as the nuclear reprogramming substance, the resulting cDNA can be inserted into an appropriate expression vector, introduced into host cells, and the cells can be cultured to recover the recombinant proteinaceous factor from the resulting culture. When a nucleic acid encoding a proteinaceous factor is used as the nuclear reprogramming substance, the resulting cDNA can be inserted into a viral vector, episomal vector, or plasmid vector to construct an expression vector, as in the case of the nucleic acid encoding the dominant-negative mutant of TEAD3. If necessary, the Cre-loxP system or piggyBac transposon system can also be used. When nucleic acids encoding two or more proteinaceous factors are introduced into cells as nuclear reprogramming substances, each nucleic acid can be carried on a separate vector, or multiple nucleic acids can be linked in tandem to form a polycistronic vector. In the latter case, to enable efficient polycistronic expression, it is preferable to use a 2A sequence, such as the 2A sequence of foot-and-mouth disease virus (PLoS ONE 3, e2532, 2008; Stem Cells 25, 1707, 2007) or an IRES sequence (US Patent No. 4,937,190).

[0078] The nuclear reprogramming substance can be contacted with somatic cells in the following manner: (a) if the substance is a protein factor, it can be contacted in the same manner as the dominant-negative mutant of TEAD3 described above; and (b) if the substance is a nucleic acid encoding the protein factor of (a), it can be contacted in the same manner as the nucleic acid encoding the dominant-negative mutant of TEAD3 described above.

[0079] (D) Substances that improve the efficiency of iPS cell establishment In addition to the above-mentioned TEAD3 function inhibitor, contacting somatic cells with other known establishment efficiency improvers is expected to further increase the establishment efficiency of iPS cells.

[0080] Substances for improving the efficiency of iPS cell establishment include, for example, histone deacetylase (HDAC) inhibitors [e.g., small molecule inhibitors such as valproic acid (VPA) (Nat. Biotechnol., 26(7): 795-797 (2008)), trichostatin A, sodium butyrate, MC 1293, and M344, and nucleic acid expression inhibitors such as siRNA and shRNA against HDAC (e.g., HDAC1 siRNA Smartpool™ (Millipore), HuSH 29mer shRNA Constructs against HDAC1 (OriGene))], DNA methyltransferase inhibitors (e.g., 5'-azacytidine) (Nat. Biotechnol., 26(7): 795-797 (2008)), and G9a histone methyltransferase inhibitors [e.g., BIX-01294 (Cell Stem Cell, 2: 525-528 (2008)), small molecule inhibitors such as siRNA and shRNA against G9a (e.g., G9a siRNA (human) (Santa Cruz Biotechnology)), nucleic acid expression inhibitors such as L-channel calcium agonists (e.g., Bayk8644) (Cell Stem Cell, 3, 568-574 (2008)), UTF1 (Cell Stem Cell, 3, 475-479 (2008)), Wnt signaling activators (e.g., soluble Wnt3a) (Cell Stem Cell, 3, 132-135 (2008)), 2i / LIF (2i is an inhibitor of mitogen-activated protein kinase signaling and glycogen synthase kinase-3, PloS Biology, 6(10), 2237-2247 (2008)), ES cell-specific miRNAs (e.g., miR-302-367 cluster (Mol. Cell. Biol. doi:10.1128 / MCB.00398-08), miR-302 (RNA (2008) 14: 1-10), miR-291-3p, miR-294 and miR-295 (all from Nat. Biotechnol.27: 459-461 (2009)), 3'-phosphoinositide-dependent kinase-1 (PDK1) acitvator (e.g., PS48 (Cell Stem Cell, 7: 651-655 (2010))), neuropeptide Y (WO 2010 / 147395), prostaglandins (e.g., prostaglandin E2 and prostaglandin J2) (WO 2010 / 068955), and the like, but are not limited to these. The nucleic acid expression inhibitor may be in the form of an expression vector containing DNA encoding siRNA or shRNA.

[0081] Among the components of the nuclear reprogramming substances, for example, SV40 large T, which is a supplementary factor but not essential for the nuclear reprogramming of somatic cells, can also be included in the category of iPS cell establishment efficiency improvers. Given that the mechanism of nuclear reprogramming is currently unclear, it may be expedient to classify supplementary factors other than those essential for nuclear reprogramming as either nuclear reprogramming substances or iPS cell establishment efficiency improvers. In other words, since the nuclear reprogramming process of somatic cells can be viewed as a holistic event that occurs upon contact of somatic cells with a nuclear reprogramming substance and an iPS cell establishment efficiency improver, those skilled in the art will not necessarily need to clearly distinguish between the two.

[0082] These other substances for improving iPS cell establishment efficiency can be contacted with somatic cells in the same manner as described above for the TEAD3 function inhibitor, depending on whether the substance is (a) a proteinaceous factor or (b) a nucleic acid encoding the proteinaceous factor. When the substance is a low-molecular-weight compound, it can be added to the culture medium for somatic cells at an appropriate concentration.

[0083] (E) Improving establishment efficiency by culture conditions The efficiency of iPS cell establishment can be further improved by culturing cells under hypoxic conditions during the nuclear reprogramming of somatic cells. As used herein, "hypoxic conditions" refers to conditions in which the oxygen concentration in the atmosphere during cell culture is significantly lower than that in air. Specifically, these conditions include conditions with an oxygen concentration lower than the oxygen concentration in the 5-10% CO2 / 95-90% air atmosphere commonly used in conventional cell culture, such as conditions in which the oxygen concentration in the atmosphere is 18% or less. Preferably, the oxygen concentration in the atmosphere is 15% or less (e.g., 14% or less, 13% or less, 12% or less, 11% or less, etc.), 10% or less (e.g., 9% or less, 8% or less, 7% or less, 6% or less, etc.), or 5% or less (e.g., 4% or less, 3% or less, 2% or less, etc.). The oxygen concentration in the atmosphere is preferably 0.1% or more (e.g., 0.2% or more, 0.3% or more, 0.4% or more, etc.), 0.5% or more (e.g., 0.6% or more, 0.7% or more, 0.8% or more, 0.95% or more, etc.), or 1% or more (e.g., 1.1% or more, 1.2% or more, 1.3% or more, 1.4% or more, etc.). For more detailed culture conditions regarding hypoxic culture, see, for example, WO 2010 / 013845.

[0084] After contacting the cells with the nuclear reprogramming substance and the TEAD3 function inhibitor, the cells can be cultured under conditions suitable for culturing ES cells, for example. Mouse cells are cultured in a standard medium supplemented with leukemia inhibitory factor (LIF) as a differentiation inhibitor. Human cells, on the other hand, are preferably cultured with basic fibroblast growth factor (bFGF) and / or stem cell factor (SCF) instead of LIF. Furthermore, cells are typically cultured in the presence of mouse embryonic fibroblasts (MEFs) that have been treated with radiation or antibiotics to arrest cell division. While STO cells are commonly used as MEFs, SNL cells (McMahon, AP & Bradley, A. Cell 62, 1073-1085 (1990)) are often used to induce iPS cells. Co-culture with feeder cells can be initiated before, at the time of, or after contact (e.g., 1-10 days after contact).

[0085] Candidate colonies of iPS cells can be selected by using drug resistance and reporter activity as indicators or by visual morphological observation. The former method involves using recombinant cells in which a drug resistance gene and / or a reporter gene is targeted to the locus of a gene that is specifically highly expressed in pluripotent cells (e.g., Fbx15, Nanog, Oct3 / 4, etc., preferably Nanog or Oct3 / 4), and selecting colonies that are positive for drug resistance and / or reporter activity. Examples of such recombinant cells include MEFs derived from mice in which the βgeo gene (encoding a fusion protein of β-galactosidase and neomycin phosphotransferase) was knocked into the Fbx15 locus (Takahashi & Yamanaka, Cell, 126, 663-676 (2006)), and MEFs derived from transgenic mice in which the green fluorescent protein (GFP) gene and puromycin resistance gene were integrated into the Nanog locus (Okita et al., Nature, 448, 313-317 (2007)). On the other hand, methods for selecting candidate colonies by visual morphological observation include the method described in Takahashi et al., Cell, 131, 861-872 (2007). While methods using reporter cells are simple and efficient, visual colony selection is preferable for generating iPS cells for human therapeutic use from the perspective of safety.

[0086] The cells of the selected colonies can be confirmed to be iPS cells by the above-mentioned Nanog (or Oct3 / 4) reporter positivity (puromycin resistance, GFP positivity, etc.) and visual inspection of the formation of ES cell-like colonies. However, for greater accuracy, tests such as alkaline phosphatase staining, analysis of the expression of various ES cell-specific genes, or transplantation of the selected cells into mice to confirm teratoma formation can also be performed.

[0087] iPS cells established in this manner can be used for a variety of purposes. For example, differentiation of iPS cells into various cells (e.g., cardiomyocytes, blood cells, nerve cells, vascular endothelial cells, insulin-secreting cells, etc.) can be induced using differentiation induction methods reported for ES cells. Therefore, if iPS cells are derived from somatic cells collected from the patient or from a donor with the same or substantially identical HLA type, the cells can be differentiated into desired cells (i.e., cells of the patient's affected organ or cells that exert a therapeutic effect against the disease) and then transplanted into the patient, enabling autologous stem cell therapy. Furthermore, functional cells (e.g., hepatocytes) differentiated from iPS cells are thought to more closely reflect the actual state of these functional cells in vivo than corresponding existing cell lines, and therefore can be suitably used for in vitro screening of the efficacy and toxicity of candidate pharmaceutical compounds.

[0088] The present invention will be further explained below with reference to examples, but the present invention is not limited to the following examples in any way. [Example]

[0089] Materials and Methods [Method 1] Cell culture Primary culture of mouse embryonic fibroblasts (MEFs) was performed according to a previously described established method (Okita et al., 2007). MEFs were cultured in Dulbecco's modified Eagle's medium (DMEM, Nacalai Tesque) supplemented with 10% fetal bovine serum (FBS, Invitrogen) at 37°C under 5% CO2. DMEM was supplied with 0.5% penicillin and streptomycin (Invitrogen). Human dermal fibroblasts (HDFs) were cultured under similar conditions. MEF- and HDF-derived iPS cells were cultured in DMEM containing 15% FBS, 2 mM L-glutamine (Invitrogen), 0.1 mM non-essential amino acids (Invitrogen), 0.1 mM 2-mercaptoethanol (Invitrogen), and 0.5% penicillin and streptomycin, supplemented with leukemia inhibitory factor (LIF).

[0090] [Method 2] Generation of mouse iPS cells iPS cells were established as previously described (Okita et al., 2007; Takahashi and Yamanaka, 2006) with some modifications. 1 × 10 cells per well. 5 MEFs were seeded and cultured overnight. After 24 hours, four factors (Oct3 / 4, Sox2, Klf4, and c-Myc; sometimes abbreviated as "4F" herein) were introduced into the MEFs by infection with a retrovirus containing a Nanog-GFP cassette containing 4F. After 24 hours, the cells were passaged once and plated at 2.5 × 10 cells per dish on a feeder layer of mitomycin C-treated SNL cells. 3 The next day, the medium was replaced with mouse iPS cell medium, and the cells were cultured for 30 days.

[0091] [Method 3] Generation of human iPS cells using retroviral vectors iPS cells were established as previously described (Takahashi et al., 2007) with some modifications. HDFs were cultured at 1 × 10 cells per well. 5 The HDFs were seeded at 2.5 × 10 cells per well and cultured overnight. After 24 hours, four factors (4F: OCT3 / 4, SOX2, KLF4, and c-MYC) or three factors (4F minus c-MYC, sometimes referred to as "3F" in this document) were introduced into the HDFs by retroviral infection. After 96 hours, the cells were passaged and cultured at 2.5 × 10 cells per well. 5 (4 factors) or 5 x 10 5 The cells were seeded onto a feeder layer of SNL cells treated with mitomycin C so that the total number of cells (three factors) was 1. The next day, the medium was replaced with primate ES medium (ReproCELL, Japan) supplemented with 4 ng / mL human basic fibroblast growth factor (bFGF), and the cells were cultured for 30 days.

[0092] [Method 4] Generation of human iPS cells using episomal vectors iPS cells were established as previously described (Okita et al., 2011) with some modifications. HDFs were cultured in DMEM supplemented with 10% FBS. According to the instructions of the Neon transfection system (Invitrogen), 3 μg of the expression plasmid mixture (pCXLE-hOCT3 / 4-shp53, pCXLE-hSOX2-hKLF4, and pCXLE-hLIN28-hL-MYC) was transfected with 100 μL of the kit solution into 6 × 10 cells. 5 The cells were transduced into 2 × 10 HDFs by electroporation. Electroporation was performed three times (3 pulses) at 1650 V for 10 ms. Four days after transduction, the cells were trypsinized and plated at 2 × 10 cells per dish on a 100 mm dish covered with a feeder layer of mitomycin C-treated SNL cells. 5 The next day, the medium was replaced with primate ES cell medium supplemented with bFGF, and the cells were cultured for 30 days.

[0093] [Method 5] Alkaline phosphatase staining and immunocytochemistry Alkaline phosphatase (AP) staining was performed according to the protocol of the alkaline phosphatase detection kit (Sigma). For immunocytochemical analysis, the cells were fixed in 4% paraformaldehyde in PBS at room temperature for 20 minutes. After washing with PBS, the cells were treated with blocking solution (PBS containing 5% normal goat serum (Millipore), 1% bovine serum albumin (BSA, Nacalai Tesque), and 0.2% Triton X-100) at room temperature for 45 minutes. The primary antibodies and dilutions were as follows: Anti-OCT4 antibody (1:50, Santa Cruz, sc-5279), anti-SOX2 antibody (1:100, Abcam, ab75485), and anti-TRA1-60 antibody (1:50, Millipore, MAB4360) were used as secondary antibodies. Alexa Fluor 488-conjugated anti-mouse IgG (1:500, Invitrogen, A-11001) was used as secondary antibodies. Hoechst 33342 (1 μg / mL, Invitrogen) was used for nuclear staining.

[0094] [Method 6] Differentiation induction iPS cells were harvested using CTK solution containing 0.25% trypsin (Invitrogen), 0.1 mg / mL collagenase IV (Invitrogen), 20% KSR, and 0.1 mM CaCl2. The resulting cell clusters were suspended in primate ES medium containing 10 μM Y-27632 (Wako) without bFGF and seeded onto ultra-low binding plates (Corning) to form embryoid bodies. The embryoid bodies were cultured in suspension for 8 days, then seeded onto gelatin-coated plates and cultured for an additional 8 days. The cells were then subjected to immunocytochemical analysis. The primary antibodies used were as follows: Antibodies used were anti-Tuj1 (1:100, Chemicon: MAB1637), anti-α-smooth muscle actin (α-SMA, 1:500, DAKO: M085101), and anti-α-fetoprotein (1:100, R&D: MAB1368). Alexa488-conjugated anti-mouse IgG (1:500, Invitrogen: A-11001) was used as the secondary antibody.

[0095] [Method 7] Microarray pretreatment and differential gene expression analysis Microarray slides were scanned using a single-color Agilent DNA microarray scanner and analyzed using default parameters. Raw data were loaded into RStudio (R visual scripting), and gene expression data for reads, searching, and preprocessing were analyzed using the Bioconductor package Limma. The Limma workflow was used for differential gene expression (DEG) analysis. Hierarchical cluster derived trees were generated using hclust from the stat package and agnes from the cluster package. Distances were calculated using the Manhattan city-block distance method, and k-means were calculated using the kmeans function. Distance and correlation matrices were visualized using get_dist and fviz_dist from the factoroextra package. Cluster scatter plots were calculated using the fviz_cluster function. Expression data for DEGs were clustered using R scripts, and heatmaps were generated. Gene ontology and statistical analysis of gene clusters were performed using the DOSE and clusterProfiler packages. The microarray data obtained in this application is available in Gene Expression Omnibus under the accession number GSE56167.

[0096] [Method 8] Gene silencing Continuous knockdown of the p53 gene was achieved using short hairpin RNA (shRNA) as previously described (Hong et al., 2009; Masutomi et al., 2003) with minor modifications. The shRNA against the p53 gene (pMKO.1-puro p53 shRNA-2; Addgene plasmid 10672) or a mock vector (pMXs) was introduced into MEFs or HDFs by retroviral infection along with 4F. Continuous knockdown of the TEAD3 gene was achieved using two shRNAs, sh#1 and sh#2, directed against TEAD3 mRNA (target mRNA sequences: sh#1 5'-AGCATGACCATCAGCGTCTCCACCAAGGT-3' (SEQ ID NO: 5); sh#2 5'-AGCAACCAGCACAATAGCGTCCAACAGCT-3' (SEQ ID NO: 4)). HDFs were cultured in 6-well plates at 1 × 10 5 The HDFs were seeded at 2 × 10 cells / well and cultured overnight. The next day, the shRNA or mock vector (pSINsi-hH1) was retrovirally transfected into the HDFs along with 4F. After 4 days, the cells were harvested by trypsinization and plated at 2 × 10 cells / well on a mitomycin C-treated SNL cell feeder layer. 5 The cells were seeded at 100 mm per dish.

[0097] [Method 9] Teratoma formation iPS cells were harvested using CTK solution and seeded in 60 mm dishes. After culturing until confluent, the cells were harvested and injected into the testes of non-obese diabetic / severe combined immunodeficient (NOD-SCID) mice (CREA, Japan). Three months after injection, the resulting tumors were dissected and fixed in 4% paraformaldehyde in PBS. Thin sections from the paraffin-embedded tissue were stained with hematoxylin and eosin.

[0098] Animal Welfare This study was carried out in strict compliance with the recommendations of the Kyoto University Animal Experiment Regulations.

[0099] result 1) p38 inhibition promotes reprogramming of mouse embryonic fibroblasts (MEFs) iPSCs were generated from MEFs according to Method 2. At 24 h after retroviral transduction of 4Fs, DMSO (vehicle, negative control), a p38-selective inhibitor (SB202190, Calbiochem, 10 μM), or one of seven compounds known to promote MEF reprogramming efficiency was added to the medium. After 98 h, the medium was replaced with medium without the compounds. The seven compounds and their concentrations were as follows: vitamin C (Sigma, 10 μg / mL), valproic acid (Sigma, 1.9 mM), CHIR99021 (Calbiochem, 3 μM), PD0325901 (Calbiochem, 0.5 μM), interleukin-6 (R&D, 0.2 ng / mL), AS601245 (Calbiochem, 5 μM), and rapamycin (Sigma, 1 μM). As a negative control for 4F transfection, cells infected with a retrovirus that does not encode 4F (empty vector) were subjected to the same drug treatment. To evaluate the efficiency of viral infection, cells were infected with a retrovirus carrying both the 4F and DsRed genes (4F+DsRed) and then subjected to the same procedure.

[0100] The number of GFP-positive colonies was counted 21 days (Day 21) and 28 days (Day 28) after 4F transduction and compared with the number of GFP-positive colonies in the 4F-transduced negative control to calculate the reprogramming efficiency. Correction was performed using the number of GFP-positive colonies obtained by infection with a retrovirus containing both the 4F and DsRed genes (4F+DsRed) (correction for viral infection efficiency). The results are shown in Figure 1A. Similar corrections were also performed in the subsequent analysis of reprogramming efficiency, but a detailed explanation will be omitted. As shown in Figure 1A, MEFs treated with the p38-selective inhibitor (SB202190) yielded nearly twice as many GFP-positive colonies as MEFs treated with DMSO on both Day 21 and Day 28. The number of GFP-positive colonies was almost equivalent to that obtained with treatment with the antioxidant (VC, vitamin C) and GSK3β inhibitor (CH, CHIR99021), which were the most effective of the seven known compounds.

[0101] Next, we performed analysis by varying the duration of drug treatment. DMSO or SB202190 was added to the medium for four periods (A: Days 1-4, B: Days 1-8, C: Days 8-16, D: Days 1-16) as shown in Figure 1B, and the number of GFP-positive colonies was counted on Days 21 and 28. The results are shown in Figure 1C. As shown in Figure 1C, the experimental group treated with SB202190 during the early phase (Period A) showed a significant increase in the number of GFP-positive colonies at both Day 21 and Day 28 compared to the control (DMSO-treated during the same period). Furthermore, as shown in Figure 1D, the experimental group treated with SB202190 during Period A tended to have a higher number of GFP-positive colonies on Day 28 than on Day 21. Furthermore, as shown in Figure 1E, the experimental group treated with SB202190 during Period A had significantly higher numbers of GFP-positive colonies at both Day 21 and Day 28 than the experimental group treated with SB202190 during Period D. Interestingly, long-term treatment with SB202190 suppressed iPS cell proliferation (Figure 7A), suggesting that p38 inhibition during the late phase may impair reprogramming. Chimeric embryos were generated from mouse iPS cells obtained by treatment with SB202190 during the early phase (period A) and transplanted into foster mothers. These embryos successfully differentiated into multiple tissues (Figure 7B), and germline transmission was also confirmed (Figure 7C).

[0102] These results demonstrate that inhibiting p38 significantly increases the reprogramming efficiency of mouse cells by expressing reprogramming factors. Furthermore, inhibiting p38 during the early phase of reprogramming in mouse cells significantly promotes reprogramming.

[0103] 2) p38 inhibition promotes reprogramming of human dermal fibroblasts (HDFs) We investigated whether p38 inhibition has a similar effect on human cells using several p38-selective inhibitors. During the process of generating iPSCs from HDFs (Method 3), DMSO (negative control) or one of the p38-selective inhibitors (SB202190, SB203580, or SB239063 (all Calbiochem, final concentration 10 μM)) was added to the medium at four different time periods (A–D) as shown in Figure 2A. The number of GFP-positive colonies was counted 16 days (Day 16), 24 days (Day 24), and 32 days (Day 32) after 4F transduction. The reprogramming efficiency was calculated according to the method for calculating MEF reprogramming efficiency (see section 1) above. Figure 2B shows the results for the experimental groups treated with the inhibitors at time periods A and D. In the experimental groups treated with inhibitors during Period A, the number of GFP-positive colonies on Day 24 and Day 32 was significantly higher than that of the control (DMSO-treated) experimental group, regardless of the type of inhibitor used (Figure 2B, left bar graph). Furthermore, in the experimental groups treated with inhibitors during Period D, the number of GFP-positive colonies tended to be significantly higher than that of the control, regardless of the type of inhibitor used (Figure 2B, right bar graph). In particular, when SB202190 or SB203580 was added throughout the entire phase (Period D), the number of GFP-positive colonies on Day 32 was significantly increased by more than two-fold compared to when SB202190 or SB203580 was added only during the initial phase.

[0104] These results demonstrate that inhibiting p38 during the reprogramming process significantly increases the reprogramming efficiency in both mouse and human cells. Furthermore, in the reprogramming of human cells, inhibiting p38 throughout the entire reprogramming phase, not just the initial phase, was highly effective in promoting reprogramming (more than twice as effective as inhibiting p38 only during the reprogramming phase). Furthermore, the above results suggest that there may be differences in the role of p38 in the reprogramming process between mouse and human cells, with p38 more strongly inhibiting reprogramming in human cells.

[0105] Human iPSCs obtained by treatment with SB202190 maintained an ESC-like morphology even after 30 passages from Day 32 (Figure 2C) and expressed the ESC-specific marker alkaline phosphatase (Figure 2D, [Method 5]). Furthermore, expression of OCT4, SOX2, and TRA-1-60 was observed (Figure 2E, [Method 5]), confirming their human ESC-like marker profile.

[0106] Furthermore, we performed a similar analysis using 3F (Oct3 / 4, Sox2, and Klf4) instead of 4F, transfected and expressed using a retroviral vector, or 4F using an episomal vector. Cells were treated with SB202190 during period A, and the number of GFP-positive colonies was counted on days 24 and 32. The results are shown in Figure 2F and G.

[0107] When cells were reprogrammed with 3F (Fig. 2F) or when 4F was expressed using an episomal vector (Fig. 2G), the number of GFP-positive colonies ultimately obtained was significantly increased compared to the control (DMSO) group.

[0108] These results demonstrate that inhibition of p38 significantly increases the reprogramming efficiency of human cells, regardless of the type of reprogramming factor or the method of reprogramming factor introduction. Furthermore, treatment of HDFs or 4F-transfected HDFs with a p38 inhibitor for 96 hours promoted cell proliferation (Figure 8A and B). However, similar treatment of HDF-derived iPSCs did not alter the proliferation rate of human iPSCs (Figure 8C). This suggests that p38 inhibition does not increase iPSC numbers via enhanced proliferation.

[0109] 3) Differentiation potential of human iPSCs obtained by inhibiting p38 We analyzed the differentiation potential of human iPSCs obtained by inhibiting p38 during reprogramming. Three clones (SB1-SB3) were established from HDF-derived iPSCs obtained by SB202190 treatment, and the expression levels of SOX2, OCT4, and NANOG, indicators of pluripotency, were analyzed for these clones (Figure 3A). As shown in Figure 3A, compared with HDFs (HD), SB1-SB3 showed increased levels of SOX2, OCT4, and NANOG mRNA, comparable to or greater than those of human iPSCs (DM, B7) and embryonic stem cells (ES) obtained by reprogramming without inhibiting p38. Furthermore, karyotyping confirmed normal karyotypes (Figure 3B), indicating that p38 inhibition during reprogramming does not impair chromosomal stability. Furthermore, when these clones were induced to differentiate into three germ layers via embryoid bodies ([Method 6]), they differentiated into mesoderm expressing smooth muscle actin (A-SMA), ectoderm expressing beta-III tubulin (B-3-TUBULIN), and endoderm expressing alpha-fetoprotein (AFP), respectively (Figure 3C). Furthermore, when their in vivo teratoma formation ability was analyzed according to [Method 9], teratomas were formed from all analyzed clones, confirming that they differentiated into three germ layers, including neuroepithelium, cartilage, and various glandular structures (Figure 3D). Therefore, human iPSCs obtained by inhibiting p38 during the reprogramming process possess the ability to differentiate into three germ layers both in vitro and in vivo.

[0110] Furthermore, we analyzed the effect of p38 inhibition on the reprogramming efficiency of HDFs derived from four new donors (HDF1616, HDF1079, HDF1078, and Tig109). As in 2) above, HDFs were treated with SB202190 during period D of the reprogramming process, and the number of GFP-positive colonies was counted on day 32. The results are shown in Figure 3E. Regardless of the donor-derived HDFs used, the number of GFP-positive colonies was significantly increased in the SB202190-treated experimental group compared to the control, confirming that p38 inhibitor treatment significantly promoted reprogramming efficiency.

[0111] These results demonstrate that human iPSCs obtained by inhibiting p38 during the reprogramming process are comparable to human iPS cells and ES cells obtained without p38 inhibition, and are karyotypically normal and capable of differentiating into the three germ layers.

[0112] 4) Analysis of genes whose expression levels are decreased by both p38 and p53 p53 is a gene that functions as a powerful reprogramming barrier during reprogramming of human and mouse cells. As shown in Figure 4B, continuous p53 knockdown using shRNA against p53 mRNA (Figure 4A) during reprogramming with 4F (Method 8) significantly increased the number of iPS cell colonies (shp53 bar). Surprisingly, in the experimental group where continuous p53 knockdown was combined with SB202190 treatment during Period A (shp53+SB202190 bar), the number of iPS cell colonies obtained was significantly greater than the sum of the increases in iPS cell colonies obtained by each treatment alone (shp53 and SB202190 bars) compared to the control (DMSO bar) (Figure 4B). Therefore, p53 knockdown and p38 inhibition demonstrated a synergistic (promoting) effect on reprogramming. These results suggest the existence of a transcription factor commonly regulated, either directly or indirectly, by p53 and p38.

[0113] To investigate the correlation between changes induced by p53 knockdown and p38 inhibition and their correlation with increased reprogramming efficiency (ΔiPSC colony count), we performed principal component analysis (PCA) based on the total mRNA transcriptome. Three principal components (PC1 54.37%, PC2 19.64%, PC3 18.57%) were identified, and the expression levels of these components were plotted for each sample to confirm the changes in expression profile (Figure 4C). Furthermore, hierarchical clustering analysis of these pluripotent transcriptomes classified them into three clusters (Figure 4D, upper panel). SB202190 treatment and shp53·SB202190 double treatment were classified into the same cluster (Cluster C), suggesting similarity of certain components. However, sample correlation matrix analysis indicated that many genes were differentially regulated by the four treatments, with the largest difference between DMSO treatment and the double treatment (Figure 4D, lower panel). Similarly, the k-means algorithm on the cluster scatter plot showed that cluster A (DMSO-treated group) was mapped most distally from the other clusters, indicating that the pluripotency transcriptomes regulated by either shp53 or p38 inhibition were most separated along the first dimension (Figure 4E), consistent with the PCA analysis described above.

[0114] To identify the key factors behind the increased reprogramming efficiency, we performed differentially expressed gene (DEG) analysis between each cluster. As a result, we found 1147 DEGs induced by SB202190 and 2185 DEGs induced by shp53 (Figure 4F), revealing significant changes in gene expression between each cluster.

[0115] 5) Identification of genes that function as reprogramming barriers To identify genes that function as a strong barrier to reprogramming, we first analyzed genes whose expression levels were reduced between the shp53-treated group and the shp53·SB202190 double-treated group. Of these, 651 genes were identified as genes whose expression levels were specifically reduced in the double-treated group (DOWN1 in Figure 5A). Similarly, we analyzed genes whose expression levels were reduced between the SB202190-treated group and the shp53·SB202190 double-treated group. Of these, 1,056 genes were identified as genes whose expression levels were specifically reduced in the double-treated group (DOWN2 in Figure 5B). Furthermore, we used a 2-fold cutoff to exclude genes with a fold change of 2 or less between the shp53-treated group and the double-treated group, and between the SB202190-treated group and the double-treated group. We identified 340 genes that were common to both DOWN1 and DOWN2 (Figure 5C).

[0116] Of the 340 genes, 31 were classified as transcription factors or DNA-binding genes (Figure 5D). GO enrichment analysis of the 340 genes revealed the following main GO terms: tyrosine kinase activity / membrane receptor kinase activity / membrane receptor tyrosine kinase activity, collagen binding / collagen receptor activity, and oligosaccharyltransferase activity (Figure 5E).

[0117] After extensive investigation of these 31 genes, we finally identified TEAD3 as a gene that functions as a strong barrier to somatic cell reprogramming. First, we investigated the relationship between the effects of p53 and / or p38 inhibition on 4F-induced HDF reprogramming and endogenous TEAD3 expression. Compared with 4F transfection alone (vehicle (DMSO) treatment), single inhibition of p53 or p38 significantly reduced TEAD3 expression, whereas dual inhibition of p53 and p38 significantly reduced TEAD3 expression (Figure 6A).

[0118] 6) Increased reprogramming efficiency by inhibiting TEAD3 expression Next, we analyzed the role of TEAD3 in reprogramming using two shRNAs specific for TEAD3 (4F-shTEAD3#1 and #2, Figure 6B). Expression of these shRNAs during HDF reprogramming with 4F (method 2) significantly reduced TEAD3 expression (Figure 6C) and significantly increased the number of GFP-positive colonies (Figure 6D). Furthermore, colonies obtained by TEAD3 shRNA expression were confirmed to be alkaline phosphatase-positive (Figure 6E). Therefore, downregulation of TEAD3 expression during HDF reprogramming significantly increased reprogramming efficiency.

[0119] We investigated the correlation between TEAD3 and p53 expression using the GSE36664 dataset (see J Biol Chem 2012 Oct 19;287(43):35825-37), which contains transcriptome data for MEFs, the GSE45276 dataset (see Mol Cell 2011 Apr 8;42(1):36-49), which contains transcriptome data for human lung fibroblasts, and the HDF transcriptome dataset. We found a positive correlation in all cell types (Figure 9), suggesting that p53 positively regulates the expression of TEAD3, a reprogramming barrier. Analysis of single-cell RNA-Seq datasets from HDFs revealed a positive correlation between TEAD3 and MAPK13 (p38δ), ERK4 (MAPK4), and p44-ERK1 (MAPK3), as well as a negative correlation between TEAD3 and cyclin-dependent kinases that regulate cell cycle progression, such as CDK4 and CDK6 (Figure 10).

[0120] To investigate whether the increased colony-forming ability of iPSCs through its contribution to cell cycle kinetics by TEAD3 inhibition is related to tumorigenesis, we examined the tumor-forming ability of HeLa cells with different levels of TEAD3 expression. The number and size of tumor-like nodules derived from cells in which TEAD3 expression was reduced by shRNA transfection were significantly increased compared with those derived from control cells (Fig. 11). Furthermore, TEAD3 expression was reduced in human cervical cancer tumor tissue compared with normal tissue, confirming the role of TEAD3 in cancer progression (Fig. 12).

[0121] HDFs transfected with shRNAs against 4F and TEAD3 showed a faster reprogramming rate than those transfected with 4F alone (4F + nonspecific shRNA) (Fig. 13A and B). This may be partially explained by faster cell proliferation during the early phase of reprogramming (Fig. 13C and E). However, once pluripotency was achieved, human iPSCs transfected with 4F alone and those transfected with shRNA against TEAD3 proliferated at similar rates (Fig. 13D and F), suggesting the safety of iPSC clones derived by TEAD3 inhibition through restoration of cell cycle checkpoints.

[0122] Using the GSE116309 dataset (see Stem Cell Reports 2019 Feb 12;12(2):319-332), we investigated the expression of TEAD3 during the reprogramming process from MEFs to iPSCs. We found that TEAD3 expression rapidly decreased immediately before pluripotency acquisition (Figure 6F). SSEA1 is an early reprogramming marker in MEFs, indicating successful commitment to reprogramming. Therefore, we used the GSE106835 dataset (see Cell Stem Cell 2018 Aug 2;23(2):289-305.e5) to examine the expression of TEAD3 during the reprogramming process from MEFs to iPSCs in SSEA1-positive and SSEA1-negative cells, respectively. We found that TEAD3 expression was downregulated only in SSEA1-positive MEF reprogramming intermediates upon acquisition of pluripotency (Figure 6G). This indicates that only cells that successfully commit to reprogramming require reduced TEAD3 expression to overcome cellular mechanisms that attempt to block reprogramming.

[0123] Furthermore, we explored the regulatory mechanism of TEAD3 expression. First, we obtained the sequence of the 5'-upstream promoter region from genomic DNA based on the TEAD3 mRNA sequence. Using known transcription start site (TSS) sequences as a query, we performed BLAST analysis against the promoter sequence and found a sequence that matched 100% with AGGGCGGAGC (SEQ ID NO: 6), a TSS consensus sequence. We then searched for transcription factors that could bind to this TSS sequence and predicted that KLF4 could bind to this TSS sequence (Figure 6H). Furthermore, analysis of the binding cis-element sequences of target genes known to be KLF4-bound identified the KLF4 binding consensus sequence GGGCGGGGC (SEQ ID NO: 7), which was confirmed to share high homology with the TEAD3 TSS sequence (Figure 6I). Since KLF4 has been suggested to be partially regulated by p38, inhibition of p38 may promote pluripotency by suppressing TEAD3 transcription. Furthermore, a search of the promoter region of TEAD3 revealed the presence of a consensus sequence to which p53 can bind.

[0124] These results demonstrate that TEAD3 functions as a powerful barrier that prevents the reprogramming of human cells, and that inhibiting its expression or activity promotes the reprogramming efficiency of these cells. [Industrial Applicability]

[0125] According to the present invention, inhibition of TEAD3 function in the nuclear reprogramming process significantly improves the efficiency of iPS cell establishment, equivalent to dual inhibition of the p38 and p53 pathways. Because the method of the present invention is effective for various reprogramming methods, it is extremely useful in terms of both safety and cost for the application of human iPS cells to regenerative medicine.

[0126] This application is based on Patent Application No. 2020-101932 filed in Japan on June 11, 2020, the contents of which are incorporated herein by reference in their entirety.

Claims

1. A method for improving the efficiency of establishing induced pluripotent stem (iPS) cells, comprising inhibiting the transcriptional activation function of transcriptional enhancer-associated domain family member-3 (TEAD3) in a group of genes that maintain somatic cell identity during the nuclear reprogramming process of somatic cells, The following (a) to (e): (a) a nucleic acid or a precursor thereof having RNAi activity against a transcription product of the TEAD3 gene; (b) an antisense nucleic acid against a transcript of the TEAD3 gene; (c) a ribozyme nucleic acid against a transcription product of the TEAD3 gene; (d) a dominant-negative mutant of TEAD3 or a nucleic acid encoding the same; or (e) Decoy nucleic acid for TEAD3 A method for inhibiting the transcriptional activation function of a group of genes that maintain the somatic specificity of TEAD3 by introducing the gene into somatic cells.

2. An agent for improving iPS cell establishment efficiency, comprising an inhibitor of the transcription activation function of a group of genes that maintain the somatic identity of TEAD3, The inhibitor is one of the following (a) to (e): (a) a nucleic acid or a precursor thereof having RNAi activity against a transcription product of the TEAD3 gene; (b) an antisense nucleic acid against a transcript of the TEAD3 gene; (c) a ribozyme nucleic acid against a transcription product of the TEAD3 gene; (d) a dominant-negative mutant of TEAD3 or a nucleic acid encoding the same; or (e) Decoy nucleic acid for TEAD3 That is, a drug.

3. A method for producing iPS cells, comprising contacting a somatic cell with a nuclear reprogramming substance and an inhibitor of the transcription activation function of a group of genes that maintain the somatic cell identity of TEAD3, The inhibitor is one of the following (a) to (e): (a) a nucleic acid or a precursor thereof having RNAi activity against a transcription product of the TEAD3 gene; (b) an antisense nucleic acid against a transcript of the TEAD3 gene; (c) a ribozyme nucleic acid against a transcription product of the TEAD3 gene; (d) a dominant-negative mutant of TEAD3 or a nucleic acid encoding the same; or (e) Decoy nucleic acid for TEAD3 That's the method.

4. The method according to claim 3, wherein the nuclear reprogramming substances are Oct3 / 4, Klf4 and Sox2, or nucleic acids encoding the same.

5. The method according to claim 3, wherein the nuclear reprogramming substances are Oct3 / 4, Klf4, Sox2, and c-Myc, L-Myc, or N-Myc, or nucleic acids encoding them.

Citation Information

Patent Citations

  • Culture medium for pluripotent stem cells

    JP2017525351A

  • Method of efficiently establishing induced pluripotent stem cells

    WO2009157593A1

  • Method of efficiently establishing induced pluripotent stem cells

    WO2012036299A1

  • Development of pluripotent stem cell employing novel dedifferentiation induction method

    WO2014097875A1