Method and kit for detecting target nucleic acid

Abstract

To provide a method that can detect a target nucleic acid on a solid surface directly and easily.SOLUTION: A method for detecting a target nucleic acid includes the steps of: spraying a solution containing a DNA nano tweezer structure and hemin onto a target site containing a target nucleic acid on a solid surface; spraying a luminol reaction liquid onto the target site; and detecting luminol chemiluminescence at the target site.SELECTED DRAWING: Figure 2

Description

[Technical Field]

[0001] The present invention relates to a method and a kit for detecting a target nucleic acid, and more particularly to a method and a kit for detecting a target nucleic acid on a solid surface. [Background technology]

[0002] Methods for specifically detecting target nucleic acids such as DNA and RNA are considered important technologies, not only for the purpose of investigating food safety or environmental contamination issues, but also for the purpose of diagnosing patients suffering from bacterial infections or viral infections, including coronaviruses, which have recently been spreading worldwide. In particular, because bacteria or viruses often adhere to solid surfaces such as skin or clothing, the development of a method for directly and easily detecting target nucleic acids on solid surfaces would be extremely useful, as it would enable rapid testing for the presence or absence of target nucleic acids. However, as described in detail below, few dedicated methods for directly and easily detecting target nucleic acids on solid surfaces have been developed to date. Furthermore, there has been little thought about developing a method for directly detecting target nucleic acids on solid surfaces.

[0003] Conventionally, a common method for detecting a target nucleic acid on a solid surface involves collecting a sample containing the target nucleic acid from the solid surface, dissolving the collected sample in an aqueous solution, amplifying the target nucleic acid by PCR or the like, and then detecting the target nucleic acid by nucleic acid chromatography.

[0004] For example, Patent Document 1 describes a method for specifically detecting or quantifying a target nucleic acid in a sample containing the target nucleic acid, which includes the steps of amplifying a target nucleic acid arbitrarily extracted from the sample as a single-stranded nucleic acid, detecting the amplified product by chromatography, and visually evaluating the detected image. It also describes that the amplification step is preferably performed using, for example, the Nucleic Acid Sequence-Based Amplification (NASBA) method.

[0005] The target nucleic acid detection method disclosed in Patent Document 1 is very useful in that it allows target nucleic acid detection to be completed quickly, approximately 10 to 20 minutes after the target nucleic acid is dropped into a detection kit. On the other hand, the target nucleic acid detection method disclosed in Patent Document 1 requires that a sample containing target nucleic acid present on a solid surface is collected and dissolved in an aqueous solution to prepare a target nucleic acid-containing sample, and then extraction and other procedures are performed. In particular, the target nucleic acid detection method disclosed in Patent Document 1 requires a step of amplifying the target nucleic acid in an aqueous solution by the NASBA method and a step of detecting the amplified target nucleic acid by chromatography, thereby requiring a certain number of steps to detect the target nucleic acid. Furthermore, in order to carry out the detection method, a detection kit must be prepared in advance, in which a first oligonucleotide probe complementary to the target nucleic acid and a second oligonucleotide probe complementary to the target nucleic acid, labeled with a colored polymer carrier, are separately prepared and immobilized on a membrane. This requires time and cost for advance preparation, and there is still room for improvement.

[0006] Meanwhile, Non-Patent Documents 1 and 2 disclose a method for detecting a target nucleic acid using a DNA nanotweezers structure. In Non-Patent Document 1, the DNA nanotweezers structure is a structure formed by self-assembly of a first oligonucleotide containing a sequence (first target recognition site) complementary to a sequence on the 3' side of the target nucleic acid, a second oligonucleotide containing a sequence (second target recognition site) complementary to a sequence on the 5' side of the target nucleic acid, and a third oligonucleotide containing a split G-quadruplex site. The structure has a substantially V-shaped third oligonucleotide with a central bend, and the first and second oligonucleotides are bound to regions on opposite sides of the bend. Under normal circumstances, the structure is in a substantially V-shaped, open state as described above. Non-Patent Document 1 discloses that when the DNA nanotweezers structure recognizes a target nucleic acid having base sequences complementary to the base sequences of the first and second target recognition sites, it changes from the open state to a closed state (a state in which both ends of the substantially V-shaped structure are close to each other). Furthermore, the present inventors have reported in Non-Patent Documents 1 and 2 that the closed state brings the split G-quadruplex sites in the DNA nanotweezer structure into close proximity, and that hemin binds to these split G-quadruplex sites, resulting in peroxidase activity, and that this peroxidase activity was confirmed by colorimetric analysis using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Note that Non-Patent Document 2 corrects the cited references listed in Non-Patent Document 1.

[0007] Furthermore, Non-Patent Document 3 discloses a G-quadruplex tweezer structure, which is a DNA nanotweezers structure incorporating a split G-quadruplex, in which split DNA aptamers are incorporated into the first and second target recognition sites. Non-Patent Document 3 discloses that the tweezers close in the presence of lactate dehydrogenase (PfLDH), a biomarker for malaria. Non-Patent Document 3 also reports that closed tweezers exhibit peroxidase activity via G-quadruplex hemin, and that this peroxidase activity was observed by colorimetric analysis. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] Patent No. 4268944 [Non-patent literature]

[0009] [Non-Patent Document 1] Keisuke Nakatsuka, Hajime Shigeto, Akio Kuroda, Hisakage Funabashi, “A split G-quadruplex-based DNA nano-tweezers structure as a signal-transducing molecule for the homogeneous detection of specific nucleic acids”, Biosens. Bioelectron., 74, 222-226 (2015). [Non-patent document 2] Keisuke Nakatsuka, Hajime Shigeto, Akio Kuroda, Hisakage Funabashi, “Corrigendum to “A split G-quadruplex-based DNA nano-tweezers structure as a signal-transducing molecule for the homogeneous detection of specific nucleic acids” [Biosens. Bioelectron. 74 (2015) 222-226]”, Biosens Bioelectron. 2017 Aug 15;94:729. doi: 10.1016 / j.bios.2017.03.019. [Non-patent document 3] Shiu, SCC, Cheung, YW, Dirkzwager, RM, Liang, S., Kinghorn, AB, Fraser, LA, Tang, MSL, Tanner, JA, “Aptamer-mediated protein molecular recognition driving a DNA tweezer nanomachine.”, Adv. Biosyst. 2017,1,1600006. Summary of the Invention [Problem to be solved by the invention]

[0010] As described above, conventional methods for detecting target nucleic acids, such as those described in Patent Document 1, require that a sample containing target nucleic acids present on a solid surface be collected and dissolved in an aqueous solution to prepare a target nucleic acid-containing sample, and then operations such as extraction must be performed. This necessitates various reactions or operations in the aqueous solution. Therefore, there is a problem in that target nucleic acids cannot be directly detected on a solid surface. Furthermore, a certain number of steps are required to detect target nucleic acids on a solid surface, and a detection kit must be prepared in advance, which increases the time and cost required for advance preparation, leaving room for improvement. Therefore, there has been a strong demand for the development of a method for directly and easily detecting target nucleic acids on a solid surface without the steps of collecting target nucleic acids on the solid surface, dissolving them in an aqueous solution, and amplifying the target nucleic acids in the aqueous solution.

[0011] The present invention has been made in consideration of the above-mentioned problems, and its object is to provide a method for directly and simply detecting a target nucleic acid on a solid surface. In particular, it is an object of the present invention to provide a method for directly and simply detecting a target nucleic acid on a solid surface, eliminating the need for steps of performing various reactions or operations in an aqueous solution containing the target nucleic acid, which has been a problem in the prior art. This eliminates the need to bother with reactions or operations in an aqueous solution containing the target nucleic acid, and significantly shortens the time required to complete detection of the target nucleic acid. In addition, since the target nucleic acid can be detected more easily, the effort and cost required for detection can be significantly reduced. Furthermore, since the target nucleic acid can be detected directly and simply, information about the location of the target nucleic acid, such as the location of the target nucleic acid on a handrail or desk, can be easily obtained, thereby providing a method for detecting a target nucleic acid that is extremely convenient compared to conventional detection methods. [Means for solving the problem]

[0012] To achieve the above-mentioned object, the present inventors conducted extensive research and discovered that by combining the peroxidase activity exhibited by hemin binding after the DNA nanotweezers structure recognizes the target nucleic acid and enters a closed state, with the luminol reaction, it is possible to directly and simply detect target nucleic acids on solid surfaces, thereby completing the present invention.

[0013] Specifically, the method for detecting a target nucleic acid according to the present invention includes the steps of spraying a solution containing a DNA nanotweezers structure and hemin onto a target site containing the target nucleic acid on a solid surface; spraying a luminol reaction solution onto the target site; and detecting luminol luminescence at the target site, wherein the DNA nanotweezers structure is composed of a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the first oligonucleotide comprises a first target recognition site having a sequence complementary to a nucleic acid sequence at one end of the target nucleic acid and a first binding site for binding to the third oligonucleotide, the second oligonucleotide comprises a second target recognition site having a sequence complementary to a nucleic acid sequence at the other end of the target nucleic acid and a second binding site for binding to the third oligonucleotide, and the third oligonucleotide comprises a third binding site having a sequence complementary to the first binding site, a fourth binding site having a sequence complementary to the second binding site, a bending site provided between the third binding site and the fourth binding site, and split G-quadruplex sites located on the opposite sides of the bending site in the third binding site and the fourth binding site, respectively.

[0014] According to the target nucleic acid detection method of the present invention, when the first and second target recognition sites in the DNA nanotweezers structure recognize a target nucleic acid on a solid surface and enter a closed state, hemin further binds to the structure, exhibiting peroxidase activity. This allows the luminol reaction to proceed, and the target nucleic acid can be determined to have been detected if luminol luminescence is detected that is stronger than that detected with hemin alone. The target nucleic acid detection method of the present invention allows direct detection of a target nucleic acid on a solid surface by simply spraying a solution containing the DNA nanotweezers structure and hemin, and a luminol reaction solution, respectively, onto a target site containing the target nucleic acid and detecting the luminol luminescence. This allows direct and simple detection of a target nucleic acid on a solid surface without the steps of collecting a sample containing the target nucleic acid from the solid surface and dissolving it in an aqueous solution, and amplifying the target nucleic acid in the aqueous solution, which are required in conventional detection methods. Furthermore, because the target nucleic acid can be detected directly and simply, information about the location of the target nucleic acid, such as the location of the target nucleic acid on a handrail or desk, can be easily obtained, providing a highly convenient target nucleic acid detection method.

[0015] In the method for detecting a target nucleic acid according to the present invention, the first oligonucleotide may have the nucleic acid sequence 5'-[first target recognition site]-TACATTTTACGCCTGGTGCC (SEQ ID NO: 1)-3', the second oligonucleotide may have the nucleic acid sequence 5'-CCGACCGCAGGATCCTATAA (SEQ ID NO: 2)-[second target recognition site]-3', and the third oligonucleotide may have the nucleic acid sequence 5'-[first split G-quadruplex site]-TTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTA (SEQ ID NO: 3)-[second split G-quadruplex site]-3'. Also, the third oligonucleotide may have the nucleic acid sequence 5'-GGGTTGGGTTTTTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTATTTGGGTAGGG (SEQ ID NO: 6)-3'.

[0016] In the method for detecting a target nucleic acid according to the present invention, the step of detecting luminol luminescence can be a step of photographing the target site with an imaging device and detecting the luminol luminescence.

[0017] By detecting luminol luminescence by photographing it with an imaging device such as a digital camera or a smartphone, the target nucleic acid can be easily detected, and the detection record of luminol luminescence can be kept as clear image data.

[0018] In the method for detecting a target nucleic acid according to the present invention, the amount of the DNA nanotweezers structure at the sprayed target site is 0.1 pmol / 3.14 mm 2 Over 2.0 pmol / 3.14 mm 2 and the amount of hemin at the sprayed target site is 1 pmol / 3.14 mm or less. 2 Over 20 pmol / 3.14 mm 2 It can be as follows:

[0019] By setting the amount of DNA nanotweezers structure and hemin at the sprayed target site within the above range, the intensity of luminol luminescence due to the DNA nanotweezers structure, target nucleic acid, and hemin bound together can be made sufficient. Furthermore, within the above range, the intensity of luminol luminescence due to hemin alone can be suppressed, preventing erroneous detection of target nucleic acid due to luminol luminescence due to hemin alone at a target site that does not contain target nucleic acid. Therefore, target nucleic acid on a solid surface can be detected with high accuracy.

[0020] a solution containing a DNA nanotweezers structure and hemin; and a luminol reaction solution, wherein the DNA nanotweezers structure is composed of a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the first oligonucleotide comprises a first target recognition site having a sequence complementary to a nucleic acid sequence at one end of the target nucleic acid and a first binding site for binding to the third oligonucleotide; the second oligonucleotide comprises a second target recognition site having a sequence complementary to a nucleic acid sequence at the other end of the target nucleic acid and a second binding site for binding to the third oligonucleotide; and the third oligonucleotide comprises a third binding site having a sequence complementary to the first binding site, a fourth binding site having a sequence complementary to the second binding site, a bending site provided between the third binding site and the fourth binding site, and split G-quadruplex sites located on opposite sides of the bending site in the third binding site and the fourth binding site, respectively, and detects a target nucleic acid at a target site on a solid surface.

[0021] According to the target nucleic acid detection kit of the present invention, when the first and second target recognition sites in the DNA nanotweezers structure recognize a target nucleic acid on a solid surface and enter a closed state, hemin further binds to the structure, exhibiting peroxidase activity. This allows the luminol reaction to proceed, and the target nucleic acid can be determined to have been detected if luminol luminescence is stronger than that detected by hemin alone. Furthermore, according to the target nucleic acid detection kit of the present invention, target nucleic acids on solid surfaces can be directly detected by simply spraying the DNA nanotweezers structure, a solution containing hemin, and a luminol reaction solution included in the kit onto a target site containing the target nucleic acid and detecting the luminol luminescence. This allows direct and simple detection of target nucleic acids on solid surfaces without the steps of collecting a sample containing the target nucleic acid from the solid surface and dissolving it in an aqueous solution, and amplifying the target nucleic acid in the aqueous solution, which are required in conventional detection methods. Furthermore, because the target nucleic acid can be detected directly and simply, information about the location of the target nucleic acid, such as the location of the target nucleic acid on a handrail or desk, can be easily obtained, providing a highly convenient target nucleic acid detection kit.

[0022] In the kit for detecting a target nucleic acid according to the present invention, the first oligonucleotide may have the nucleic acid sequence 5'-[first target recognition site]-TACATTTTACGCCTGGTGCC (SEQ ID NO: 1)-3', the second oligonucleotide may have the nucleic acid sequence 5'-CCGACCGCAGGATCCTATAA (SEQ ID NO: 2)-[second target recognition site]-3', and the third oligonucleotide may have the nucleic acid sequence 5'-[first split G-quadruplex site]-TTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTA (SEQ ID NO: 3)-[second split G-quadruplex site]-3'. Furthermore, the third oligonucleotide may have the nucleic acid sequence 5'-GGGTTGGGTTTTTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTATTTGGGTAGGG (SEQ ID NO: 6)-3'.

[0023] In the kit for detecting a target nucleic acid according to the present invention, when a solution containing the DNA nanotweezers structure and hemin is sprayed onto the target site, the amount of the DNA nanotweezers structure on the target site is 0.1 pmol / 3.14 mm 2 Over 2.0 pmol / 3.14 mm 2 and the amount of hemin on the target site is 1 pmol / 3.14 mm 2 Over 20 pmol / 3.14 mm 2 It can be as follows:

[0024] By setting the amount of DNA nanotweezers structure and hemin sprayed onto the target site within the above range, the intensity of luminol luminescence due to the DNA nanotweezers structure, target nucleic acid, and hemin bound together can be made sufficient. Furthermore, within the above range, the intensity of luminol luminescence due to hemin alone can be suppressed, preventing erroneous detection of target nucleic acid due to luminol luminescence due to hemin alone. Therefore, target nucleic acid on a solid surface can be detected with high accuracy. [Effects of the Invention]

[0025] According to the target nucleic acid detection method and kit of the present invention, when the first and second target recognition sites in the DNA nanotweezers structure recognize a target nucleic acid on a solid surface and enter a closed state, hemin further binds to the structure, exhibiting peroxidase activity. This allows the luminol reaction to proceed, and the target nucleic acid can be determined to have been detected if luminol luminescence is detected that is stronger than that detected with hemin alone. The target nucleic acid detection method and kit of the present invention can directly detect a target nucleic acid on a solid surface by simply spraying a solution containing the DNA nanotweezers structure and hemin, and a luminol reaction solution onto a target site containing the target nucleic acid, and then detecting the luminol luminescence. This allows for direct and simple detection of the target nucleic acid on a solid surface without the steps of collecting a sample containing the target nucleic acid from the solid surface, dissolving it in an aqueous solution, and amplifying the target nucleic acid in the aqueous solution, which are required in conventional detection methods. Furthermore, because the target nucleic acid can be detected directly and simply, information about the location of the target nucleic acid, such as the location of the target nucleic acid on a handrail or desk, can be easily obtained, thereby providing a highly convenient target nucleic acid detection method and kit. [Brief explanation of the drawings]

[0026] [Figure 1] FIG. 10 is a schematic diagram illustrating a step of spraying a solution containing a DNA nanotweezers structure and hemin onto a target site in a method for detecting a target nucleic acid according to one embodiment of the present invention. [Figure 2] FIG. 2 is a schematic diagram illustrating a step of spraying a luminol reaction solution onto a target site in a method for detecting a target nucleic acid according to one embodiment of the present invention. [Figure 3] FIG. 2 is a schematic diagram illustrating the self-assembly of a DNA nanotweezers structure used in this embodiment. [Figure 4] FIG. 2 is a schematic diagram illustrating the basic operating principle of the DNA nanotweezers structure used in this embodiment. [Figure 5] 1 is a photograph showing the surface of a solid prepared in Example 1. [Figure 6] 6A and 6B are photographs showing luminol luminescence on a solid surface when a target nucleic acid detection method according to Example 1 was performed. (A) is a photograph of the luminol luminescence taken with a digital camera, and (B) is a photograph showing the positions of each spot in FIG. 6A. [Figure 7] 1 is a schematic diagram showing the structures of a DNA nanotweezers structure and a target nucleic acid used in a method for detecting a target nucleic acid according to Example 1. FIG. [Figure 8] 1 is a photograph showing the surface of a solid prepared in Example 2. [Figure 9] 9A and 9B are photographs showing luminol luminescence on a solid surface when a target nucleic acid detection method according to Example 2 was performed. (A) is a photograph of the luminol luminescence taken with a digital camera, and (B) is a photograph showing the positions of each spot in FIG. 9A. [Figure 10] 1 is a photograph of luminol luminescence on a solid surface in Reference Example 1. [Figure 11] 1 is a photograph showing the surface of a solid prepared in Reference Example 2. [Figure 12] 1 is a photograph of luminol luminescence on a solid surface in Reference Example 2. DETAILED DESCRIPTION OF THE INVENTION

[0027] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The following description of preferred embodiments is merely exemplary in nature and is not intended to limit the present invention, its application, or its uses.

[0028] 1, a method for detecting a target nucleic acid according to one embodiment of the present invention includes a step of spraying a solution 18 containing a DNA nanotweezers structure 1 and hemin 16 onto a target site 20 containing a target nucleic acid 13 on a solid surface 19 using a sprayer 17 or the like. Also, as shown in FIG. 2, the method includes a step of spraying a luminol reaction solution 21 onto the target site 20, and a step of detecting luminol luminescence at the target site 20, although this step is not shown.

[0029] As shown in FIG. 3, in this embodiment, the DNA nanotweezer structure 1 is a structure formed by self-assembly of a first oligonucleotide 2, a second oligonucleotide 3, and a third oligonucleotide 4.

[0030] As shown in FIGS. 3 and 4 , in this embodiment, the first oligonucleotide 2 is an oligonucleotide comprising a first target recognition site 5 having a sequence complementary to a nucleic acid sequence 14 at one end (e.g., the 3′ end) of the target nucleic acid 13, and a first binding site 6 for binding to the third binding site 9 of the third oligonucleotide 4. For example, the first oligonucleotide 2 can be an oligonucleotide having the nucleic acid sequence 5′-[first target recognition site]-TACATTTTACGCCTGGTGCC-3′. Here, “5′-[first target recognition site]-TACATTTTACGCCTGGTGCC-3′” refers to a nucleic acid sequence in which the sequence that becomes the first target recognition site 5 is located on the 5′ side of TACATTTTACGCCTGGTGCC (SEQ ID NO: 1). In this sequence, the sequence that becomes the first target recognition site 5 and the sequence of SEQ ID NO: 1 may be contiguous with no nucleotides between them, or there may be several bases, for example, 5 bases or less, preferably 2 bases or less, and most preferably 1 base, between them. In addition, the first target recognition site 5 comprises a sequence complementary to the nucleic acid sequence 14 at one end of the target nucleic acid 13, as described above, in order to bind to the nucleic acid sequence 14 at one end of the target nucleic acid 13. In this embodiment, the complementary sequence includes a sequence having an identity of 90% or more, preferably 95% or more, more preferably 98% or more, and most preferably 99% or more to the complementary sequence, as long as it is capable of binding to the nucleic acid sequence 14 at one end of the target nucleic acid 13. The first target recognition site 5 also includes a sequence having a Tm value with the complementary sequence of 30°C or more, preferably 38°C or more, and most preferably 44°C or more.

[0031] As shown in FIGS. 3 and 4 , in this embodiment, the second oligonucleotide 3 is an oligonucleotide comprising a second target recognition site 7 having a sequence complementary to a nucleic acid sequence 15 at the other end (e.g., the 5′ end) of the target nucleic acid 13, and a second binding site 8 for binding to the fourth binding site 10 of the third oligonucleotide 4. For example, the second oligonucleotide 3 can be an oligonucleotide having the nucleic acid sequence 5′-CCGACCGCAGGATCCTATAA-[second target recognition site]-3′. Here, “5′-CCGACCGCAGGATCCTATAA-[second target recognition site]-3′” refers to a nucleic acid sequence in which the sequence that becomes the second target recognition site 7 is located on the 3′ side of CCGACCGCAGGATCCTATAA (SEQ ID NO: 2). In this sequence, the sequence that becomes the second target recognition site 7 and the sequence of SEQ ID NO: 2 may be contiguous with no nucleotides between them, or there may be several bases, for example, 5 bases or less, preferably 2 bases or less, and most preferably 1 base, between them. Furthermore, in order to bind to the nucleic acid sequence 15 at the other end of the target nucleic acid 13, the second target recognition site 7, as described above, is composed of a sequence complementary to the nucleic acid sequence 15 at the other end of the target nucleic acid 13. In this embodiment, the complementary sequence includes a sequence having an identity of 90% or more, preferably 95% or more, more preferably 98% or more, and most preferably 99% or more to the complementary sequence, as long as it is capable of binding to the nucleic acid sequence 15 at the other end of the target nucleic acid 13. The second target recognition site 7 also includes a sequence having a Tm value with the complementary sequence of 30°C or more, preferably 38°C or more, and most preferably 44°C or more.

[0032] In this embodiment, various types of target nucleic acids 13 can be detected by appropriately changing the nucleic acid sequences of the first target recognition site 5 of the first oligonucleotide 2 and the second target recognition site 7 of the second oligonucleotide 3. Therefore, it is preferable to design the nucleic acid sequences of the first target recognition site 5 and the second target recognition site 7 in accordance with the nucleic acid sequence of the target nucleic acid 13 to be detected.

[0033] As shown in Figures 3 and 4, in this embodiment, the third oligonucleotide 4 is an oligonucleotide comprising a third binding site 9 having a sequence complementary to the first binding site 6, a fourth binding site 10 having a sequence complementary to the second binding site 8, a bending site 11 provided between the third binding site 9 and the fourth binding site 10, and split G-quadruplex sites 12 located on the opposite side of the bending site 11 in the third binding site 9 and the fourth binding site 10, respectively.

[0034] The bending portion 11 is composed of one or more nucleic acid bases and is a portion that causes the DNA nanotweezers structure 1 to have an approximately V-shaped structure. The number of bases in the bending portion 11 may be preferably 5 or less, more preferably 2 or less, and most preferably 1. In this embodiment, the bending portion 11 can be, for example, adenine (A), biotinylated thymine (T), or thymine (T) modified with an amino group. Furthermore, the bending portion 11 is preferably adenine (A). In the method for detecting a target nucleic acid according to this embodiment, the target nucleic acid 13 is detected by utilizing the structural change between the open state and the closed state of the DNA nanotweezers structure 1, which has an approximately V-shaped structure. Therefore, the presence of the bending portion 11 is important.

[0035] The split G-quadruplex region 12 refers to a region obtained by splitting a G-quadruplex into two. In this embodiment, the two regions obtained by splitting a G-quadruplex are referred to as a first split G-quadruplex region and a second split G-quadruplex region, respectively. Note that, as used herein, "G-quadruplex" refers to a special nucleic acid structure formed by overlapping planar structures formed by four guanines. The split G-quadruplex region 12 can be, for example, a nucleic acid sequence having two GGG base sequences. In this case, the split G-quadruplex region 12 as a whole has four GGG base sequences. Specifically, the split G-quadruplex region 12 can have two 5'-GGGXXGGG-3' nucleic acid sequences, where X can be selected from the group consisting of adenine (A), thymine (T), and cytosine (C). More specifically, the split G-quadruplex site 12 can have the nucleic acid sequences 5'-GGGTTGGG-3' and 5'-GGGTAGGG-3'. In this embodiment, the split G-quadruplex site 12 may be contiguous, with no nucleotides between the 3' side of 5'-GGGXXGGG-3' and the fourth binding site 10, and between the 5' side of 5'-GGGXXGGG-3' and the third binding site 9. Alternatively, several X bases, for example, five or fewer, preferably one or more, and most preferably three X bases (the sequence "XXX") may be included between them. Such nucleotides function, for example, as a linker.

[0036] In this embodiment, the split G-quadruplex region 12 can also be, for example, a nucleic acid sequence having three GGG base sequences and a nucleic acid sequence having one GGG base sequence. In this case, the split G-quadruplex region 12 as a whole will also have four GGG base sequences. Specifically, the split G-quadruplex region 12 can have the nucleic acid sequences 5'-GGGXXGGGXXGGG-3' and 5'-GGG-3', where X can be selected from the group consisting of adenine (A), thymine (T), and cytosine (C). Either of the nucleic acid sequences 5'-GGGXXGGGXXGGG-3' and 5'-GGG-3' can be located at the 5'-end of the third oligonucleotide 4. The other nucleic acid sequence not located at the 5'-end of the third oligonucleotide 4 will be located at the 3'-end of the third oligonucleotide 4. In this embodiment, the split G-quadruplex region 12 and the third binding site 9 may be continuous with no nucleotides between them, or may contain several bases, for example, 5 bases or less, preferably 1 base or more, and most preferably 3 bases of X (sequence of "XXX") between them. Similarly, the split G-quadruplex region 12 and the fourth binding site 10 may be continuous with no nucleotides between them, or may contain several bases, for example, 5 bases or less, preferably 1 base or more, and most preferably 3 bases of X (sequence of "XXX") between them.

[0037] For example, the third oligonucleotide 4 can be an oligonucleotide having the nucleic acid sequence 5'-[first split G-quadruplex site]-TTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTA-[second split G-quadruplex site]-3'. Here, "5'-[first split G-quadruplex site]-TTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTA-[second split G-quadruplex site]-3'" refers to a nucleic acid sequence in which a sequence that becomes the first split G-quadruplex site is located on the 5' side of TTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTA (SEQ ID NO: 3) and a sequence that becomes the second split G-quadruplex site is located on the 3' side. In this sequence, the sequence that constitutes the first split G-quadruplex site or the second split G-quadruplex site and the sequence of SEQ ID NO: 3 may be contiguous with no nucleotides between them, or may contain several bases, for example, 5 bases or less, preferably 2 bases or less, and most preferably 1 base, between them.

[0038] FIG. 3 shows an overview of the self-assembly of the DNA nanotweezer structure 1 used in this embodiment. As shown in FIG. 3, when a first oligonucleotide 2, a second oligonucleotide 3, and a third oligonucleotide 4 are mixed in a single container, they self-assemble. Specifically, the first binding site 6 of the first oligonucleotide 2 and the third binding site 9 of the third oligonucleotide 4 bind to each other, and the second binding site 8 of the second oligonucleotide 3 and the fourth binding site 10 of the third oligonucleotide 4 bind to each other, thereby forming the open DNA nanotweezer structure 1. To self-assemble the DNA nanotweezer structure 1, it is preferable to mix the first oligonucleotide 2, the second oligonucleotide 3, and the third oligonucleotide 4 in an aqueous salt solution. The aqueous salt solution can be, for example, phosphate-buffered saline (PBS).

[0039] An overview of the basic operating principle of the DNA nanotweezer structure 1 used in this embodiment is shown in Figure 4. As shown in Figure 4, the DNA nanotweezer structure 1 is normally in an open state with both ends of the tweezers separated. In this open state, the structure does not have the ability to bind to hemin 16 (left side of Figure 4). Therefore, the DNA nanotweezer structure 1 in the open state does not exhibit peroxidase activity. On the other hand, when the DNA nanotweezer structure 1 recognizes a target nucleic acid 13, the structure undergoes a conformational change to a closed state (right side of Figure 4). As a result, the split G-quadruplex regions 12 located at both ends of the tweezers structure are brought into close proximity to each other. This conformational change restores the DNA nanotweezer structure 1's ability to bind to hemin 16, thereby causing it to exhibit peroxidase activity.

[0040] The hemin used in this embodiment is a compound having the following chemical structure, which is a trivalent iron complex of porphyrin with one chloride ion coordinated thereto.

[0041] [ka]

[0042] In this embodiment, it is preferable to prepare a solution 18 containing the DNA nanotweezers structure 1 and hemin 16. This simplifies the process by eliminating the need to spray the solution containing the DNA nanotweezers structure 1 and the solution containing the hemin 16 onto the target site 20, respectively. Alternatively, the solution containing the DNA nanotweezers structure 1 and the solution containing the hemin 16 may be prepared as separate solutions. This is suitable when it is difficult to make the DNA nanotweezers structure 1 and hemin 16 coexist in one solution. There are no particular limitations on the method for preparing these solutions.

[0043] In this embodiment, a salt solution can be used as the main solvent for the solution 18 containing the DNA nanotweezer structure 1 and hemin 16, such as phosphate-buffered saline (PBS). In this embodiment, since the DNA nanotweezer structure 1 self-assembles in a salt solution, the solvent for the solution 18 containing the DNA nanotweezer structure 1 and hemin 16 preferably includes at least a salt solution. The water used for the salt solution is preferably pure water, and more preferably ultrapure water. Examples of ultrapure water include MilliQ water. Note that, in this specification, "MilliQ water" refers to ultrapure water obtained using a Milli-Q (registered trademark) ultrapure water system manufactured by Merck. Note that, in this specification, "ultrapure water" refers to water with a resistivity of 18 MΩ·cm or greater. In addition to the salt solution, other solvents may also be included. The other solvents are not particularly limited, but may include, for example, organic solvents such as dimethyl sulfoxide (DMSO) or alcoholic solvents such as ethanol. Note that the other solvent is not limited to one type, and may include two or more organic solvents. Furthermore, because hemin 16 has low solubility in water, it is preferable to dissolve hemin 16 in an organic solvent such as dimethyl sulfoxide, prepare a hemin solution in advance, and store the solution. When preparing solution 18 containing a DNA nanotweezers structure and hemin, this hemin solution can be diluted appropriately before use. In this embodiment, a solution containing the DNA nanotweezers structure 1 and a solution containing hemin 16 may be prepared separately, and these solutions may be mixed to prepare solution 18 containing the DNA nanotweezers structure 1 and hemin 16. When mixing these solutions, they can be diluted appropriately before mixing.

[0044] In this embodiment, the solution 18 containing the DNA nanotweezer structure 1 and hemin 16 may further contain at least one of a buffer, a salt, and a surfactant. The buffer may include Tris-hydrochloride buffer (Tris-HCl), the salt may include ammonium chloride (NH4Cl) and potassium chloride (KCl), and the surfactant may include polyoxyethylene (10) octylphenyl ether (Triton X-100). In this embodiment, the solution 18 containing the DNA nanotweezer structure 1 and hemin 16 preferably further contains potassium chloride (KCl) as a salt. This is preferable because it allows the split G-quadruplex region 12 of the DNA nanotweezer structure 1 to fully exhibit peroxidase activity. This is preferable because it increases the intensity of luminol luminescence produced by the DNA nanotweezer structure 1, making it easier to distinguish from luminol luminescence produced by hemin 16 alone.

[0045] In this embodiment, the concentrations of the solution 18 containing the DNA nanotweezers structure 1 and hemin 16 are not particularly limited and can be changed as appropriate. Preferably, the concentration of the DNA nanotweezers structure 1 is 50 nM or more and 1 μM or less, and the concentration of the hemin 16 is 100 nM or more and 2 μM or less.

[0046] In this embodiment, a commercially available sprayer or the like can be used as the sprayer 17 used to spray the solution 18 containing the DNA nanotweezers structure 1 and hemin 16. It is preferable to wash the contents of the sprayer 17 before pouring the solution into it. It is also preferable to thoroughly shake the sprayer 17 containing the solution 18 containing the DNA nanotweezers structure 1 and hemin 16 immediately before spraying the solution onto the target site 20. This ensures a uniform concentration of hemin 16 in the solution, preventing erroneous detection of the target nucleic acid 13.

[0047] In this embodiment, the amount of solution 18 containing the DNA nanotweezers structure 1 and hemin 16 to be sprayed is not particularly limited, but is preferably 0.5 mL to 1 mL per 50 mm × 50 mm square area. This is preferable because the intensity of luminol luminescence produced by the structure in which the DNA nanotweezers structure 1, target nucleic acid 13, and hemin 16 are bound becomes sufficient, while the intensity of luminol luminescence produced by hemin 16 alone becomes low, thereby reducing the possibility of erroneous detection of the target nucleic acid 13. Although not shown, the amount of spray can be adjusted by the size of the sprayer 17 or a spray amount adjuster provided on the sprayer 17.

[0048] In this embodiment, when a solution 18 containing the DNA nanotweezers structure 1 and hemin 16 is sprayed onto a target site 20 on a solid surface 19, the amounts of the DNA nanotweezers structure 1 and hemin 16 on the target site 20 can be changed as appropriate. Furthermore, the upper and lower limits of the amounts are not particularly limited, as long as the amount of luminol reaction solution 21 sprayed and the imaging conditions can be changed as appropriate to distinguish between the luminol luminescence of the structure in which the DNA nanotweezers structure 1, target nucleic acid 13, and hemin 16 are bound and the luminol luminescence of hemin 16 alone. For example, the amount of the DNA nanotweezers structure 1 on the target site 20 is 0.1 pmol / 3.14 mm. 2 Over 2.0 pmol / 3.14 mm 2 However, the amount of the DNA nanotweezers structure 1 on the target site 20 can be 0.1 pmol / 3.14 mm or less. 2 Even if the amount of hemin 16 on the target site 20 is less than 1 pmol / 3.14 mm, as described above, it is possible to distinguish between the luminol luminescence of the bound structure and the luminol luminescence of hemin 16 alone by reducing the amount of hemin 16 on the target site 20 and increasing the sensitivity of the imaging conditions. Therefore, the lower limit is not limited. The upper limit is also similarly not particularly limited. On the other hand, the amount of hemin on the target site 20 is, for example, 1 pmol / 3.14 mm. 2 Over 20 pmol / 3.14 mm 2However, the amount of hemin 16 on the target site 20 is not particularly limited in terms of upper and lower limits, as long as the amount of luminol reaction solution 21 sprayed and the imaging conditions can be appropriately changed to distinguish between the luminol luminescence of the DNA nanotweezers structure 1, the target nucleic acid 13, and the structure to which hemin 16 is bound and the luminol luminescence of hemin 16 alone. For example, when the amount of hemin is 20 pmol / 3.14 mm, 2 When the amount of hemin exceeds 20 pmol / 3.14 mm, the luminol luminescence of hemin 16 alone is detected relatively strongly, making it difficult to use as background. However, the intensity of the luminol luminescence of hemin 16 alone can be reduced by reducing the amount of luminol reaction solution 21 sprayed. 2 Even if the value exceeds this, it is still possible to use it as a background.

[0049] In this embodiment, the molar ratio of the DNA nanotweezers structure 1 on the target site 20 to the hemin 16 on the target site 20 is not particularly limited and can be changed as appropriate as long as it is possible to distinguish between the luminol luminescence of the structure to which the DNA nanotweezers structure 1, target nucleic acid 13, and hemin 16 are bound and the luminol luminescence of hemin 16 alone. For example, the molar ratio of the DNA nanotweezers structure 1 on the target site 20 to the hemin 16 on the target site 20 can be 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5, 1:5, 1:6, 1:7, 1:8, 1:9, or 1:10. However, if the amount of hemin 16 on the target site 20 is less than the amount of DNA nanotweezer structure 1 on the target site 20 (for example, if the molar ratio of DNA nanotweezer structure 1 on the target site 20 to hemin 16 on the target site 20 is 1:0.5), even if there is a DNA nanotweezer structure 1 that has recognized the target nucleic acid 13 and entered a closed state, it will not be able to bind to a sufficient amount of hemin 16, which is undesirable. Therefore, it is preferable that the amount of hemin 16 on the target site 20 be equal to or greater than the amount of DNA nanotweezer structure 1 on the target site 20.

[0050] In this embodiment, when a solution 18 containing the DNA nanotweezers structure 1 and hemin 16 is sprayed onto a target site 20 on a solid surface 19, the amount of the DNA nanotweezers structure 1 on the target site 20 is 0.1 pmol / 3.14 mm. 2 Over 2.0 pmol / 3.14 mm 2 and the amount of hemin 16 on the target site 20 was 1 pmol / 3.14 mm 2 Over 20 pmol / 3.14 mm 2 It is preferable that the amount is within the above range. By setting the amount within the above range, the intensity of the luminol luminescence produced by the combination of the DNA nanotweezers structure 1, the target nucleic acid 13, and the hemin 16 is sufficient. On the other hand, hemin 16 itself normally exhibits peroxidase activity, so the luminol reaction proceeds and pale blue luminescence is detected. However, by setting the amount within the above range, the luminescence intensity of the luminol luminescence of hemin 16 itself is reduced to an extent that it is barely detectable. Therefore, erroneous detection of the target nucleic acid 13 due to the detection of the luminol luminescence of hemin 16 itself can be prevented.

[0051] In this embodiment, the amount of DNA nanotweezers structure 1 and hemin 16 on the target site 20 as described above varies depending on the concentration of the solution 18 containing the DNA nanotweezers structure 1 and hemin 16, the amount of the solution sprayed, and the spraying operation, etc., and these can be adjusted appropriately to adjust the amount sprayed onto the target site 20 to the desired amount.

[0052] In this embodiment, the solid surface 19 is not particularly limited and includes various solid surfaces such as the surface of clothing, fabric, and paper. On the other hand, when the solid surface 19 is, for example, the surface of skin, blood-derived hemin may be present, making it impossible to distinguish between luminol luminescence due to blood-derived hemin and the target luminol luminescence. For this reason, it is preferable to use a solid surface 19 that contains as few substances as possible that will react independently with the luminol reaction solution 21.

[0053] In this embodiment, the target site 20 refers to a site on the solid surface 19 that contains at least the target nucleic acid 13. The target site 20 can be arbitrarily selected as a site on the solid surface 19 that contains the target nucleic acid 13.

[0054] In this embodiment, the target nucleic acid 13 is not particularly limited and may be any nucleic acid present as a nucleic acid, including, for example, DNA, RNA, and other nucleic acids. Furthermore, in order to detect the target nucleic acid 13, it is preferable to clarify the nucleic acid sequence of the target nucleic acid. However, it is not preferable for the nucleic acid sequence of the target nucleic acid 13 to include a sequence that forms a G-quadruplex structure. In this case, the target nucleic acid 13 would bind to hemin 16 and exhibit peroxidase activity, making it unlikely that the target nucleic acid detection method of this embodiment would be applicable. Furthermore, a nucleic acid containing multiple "CCC" (cytosine triplet) sequences is also not preferable. In this case, it becomes necessary to introduce a "GGG" sequence into the first target recognition site 5 of the first oligonucleotide 2 and the second target recognition site 7 of the second oligonucleotide 3 in the DNA nanotweezer structure 1. This may result in hemin binding between the first target recognition site 5 and the split G-quadruplex structure site 12, or between the second target recognition site 7 and the split G-quadruplex structure site 12, making it unlikely that the target nucleic acid detection method of this embodiment would be applicable.

[0055] 2, the method for detecting a target nucleic acid according to this embodiment includes a step of spraying a luminol reaction solution 21 onto a target site 20. Luminol is a compound having the following chemical structure, and in a basic aqueous solution, it reacts with hydrogen peroxide in the solution through the catalytic action of a substance with peroxidase activity, such as the heme iron contained in hemoglobin, to produce pale blue luminescence.

[0056] [ka]

[0057] The luminol reaction solution 21 can be, for example, a solution containing luminol, sodium peroxide, and water. Sodium peroxide reacts with water to produce sodium hydroxide and hydrogen peroxide. The luminol reaction solution 21 can be prepared, for example, using a luminol reaction reagent set (3 g x 5 packets) manufactured by Fujifilm Wako Pure Chemical Industries, Ltd., by the following preparation method. First, 500 mL of distilled water is prepared in a beaker or wide-mouth plastic container, and the aluminum pack containing luminol and sodium peroxide is cut along the black perforation line and opened. Next, the two reagents are simultaneously added to the beaker or wide-mouth plastic container containing distilled water and stirred thoroughly to dissolve the two reagents, preparing the luminol reaction solution 21. However, the luminol reaction solution 21 is not limited to these components; for example, a solution containing luminol, sodium hydroxide, hydrogen peroxide, and water can also be used. The water used as the solvent for the luminol reaction solution 21 is preferably distilled water, MilliQ water, or sterilized purified water. Furthermore, the method for preparing the luminol reaction solution 21 is not particularly limited.

[0058] In this embodiment, a commercially available sprayer or the like can be used as the sprayer 17 used to spray the luminol reaction solution 21. It is preferable to clean the inside of the sprayer 17 before pouring the solution into it.

[0059] In this embodiment, the spray volume of the luminol reaction solution 21 is not particularly limited, but is preferably 0.5 mL to 1 mL per 50 mm × 50 mm square area. Furthermore, it is preferable to spray so that one-third to one-half of the total spray volume is added to the 50 mm × 50 mm square area. This is preferable because it allows sufficient detection of luminol luminescence. However, the spray volume of the luminol reaction solution 21 can be appropriately changed as long as it is possible to distinguish between the luminol luminescence of the structure in which the DNA nanotweezers structure 1, the target nucleic acid 13, and the hemin 16 are bound and the luminol luminescence of the hemin 16 alone. Although not shown, the spray volume can be adjusted by the size of the sprayer 17 or a spray volume adjuster provided on the sprayer 17.

[0060] In this embodiment, as shown on the right side of Figure 2, when a luminol reaction solution 21 is sprayed onto a target site 20 containing a DNA nanotweezers structure 1 in a closed state, the structure binds to hemin 16, and the luminol reaction proceeds due to the peroxidase catalytic action of the hemin 16, resulting in the detection of strong bluish-white luminescence. On the other hand, as shown on the left side of Figure 2, when a luminol reaction solution 21 is sprayed onto a target site 20 containing a DNA nanotweezers structure 1 in an open state, the structure cannot bind to hemin 16, so it does not exhibit peroxidase activity and the luminol reaction does not proceed, resulting in no detection of bluish-white luminescence. Although the luminol reaction proceeds even with hemin 16 alone, this is detected as weak luminescence, which can be distinguished from the strong luminol luminescence resulting from the binding of the structure to hemin 16. Furthermore, as described above, the DNA nanotweezers structure 1 assumes a closed state when a target nucleic acid 13 is present and an open state when a target nucleic acid 13 is absent. Therefore, if luminol luminescence is detected stronger than that of hemin alone, it can be determined that the target nucleic acid 13 has been detected, and if luminol luminescence is not detected or is weakly detected, it can be determined that the target nucleic acid 13 has not been detected.

[0061] The target nucleic acid detection method according to this embodiment includes a step of detecting luminol luminescence at the target site. In this embodiment, luminol luminescence can be detected visually or by capturing images using an imaging device. The imaging device can be, for example, a digital camera or a smartphone camera. This is preferable because it can record the detection of luminol luminescence as clear image data. Furthermore, the settings of the imaging device when capturing luminol luminescence can be changed as needed, and the settings are not particularly limited. For example, settings such as ISO sensitivity, aperture value (F-number), and exposure time can be changed as needed. Furthermore, it is preferable to adjust the imaging device settings so that luminol luminescence due to the DNA nanotweezers structure 1 that has recognized the target nucleic acid 13 and entered a closed state and the structure to which hemin 16 is bound can be distinguished from luminol luminescence due to hemin 16 alone. For example, in the examples described below, the ISO sensitivity was set to 12800 (EV shift +7), the aperture value (F-number) to 3.5 (AV value +3.6), and the exposure time to 1 second (TV value 0), resulting in an EV value of +3.6 (EV shift +7). This is preferable because it allows for distinguishing between the target luminol luminescence and the luminol luminescence of hemin-16 alone. Furthermore, in the target nucleic acid detection method according to this embodiment, the settings of the imaging device can be appropriately adjusted so that the EV values ​​are equivalent. Therefore, the preferred ISO sensitivity, aperture value (F-number), and exposure time are not limited to the above values. The EV value is also not limited to +3.6 (EV shift +7). Furthermore, the settings of the imaging device, including the EV value, can be appropriately changed as long as it allows distinguishing between the luminol luminescence of the DNA nanotweezers structure 1 that has recognized the target nucleic acid 13 and entered a closed state, the structure to which hemin-16 is bound, and the luminol luminescence of hemin-16 alone. Therefore, the EV value can be appropriately adjusted in accordance with conditions such as the amount of the DNA nanotweezers structure 1 and the solution 18 containing hemin-16 sprayed, and the amount of the luminol reaction solution 21 sprayed, so that the luminol luminescence of the bound structure and the luminol luminescence of hemin-16 alone can be distinguished. Furthermore, the captured image may be subjected to, for example, a general binarization process.In this case, by providing a threshold between the luminol luminescence level of the bound structure and the luminol luminescence level of hemin 16 alone, it becomes easy to observe the required luminescence.

[0062] A target nucleic acid detection kit according to one embodiment of the present invention comprises a solution 18 containing a DNA nanotweezer structure 1 and hemin 16, and a luminol reaction solution 21, and is characterized by detecting a target nucleic acid 13 on a solid surface 19 (not shown).

[0063] The target nucleic acid detection kit according to this embodiment can use the same components as those described in detail in the embodiment relating to the target nucleic acid detection method: DNA nanotweezers structure 1, first oligonucleotide 2, second oligonucleotide 3, third oligonucleotide 4, target nucleic acid 13, hemin 16, sprayer 17, solution 18 containing DNA nanotweezers structure 1 and hemin 16, solid surface 19, luminol reaction solution 21, target site 20, buffer, salt, surfactant, imaging device, etc. Furthermore, the concentrations of solution 18 containing DNA nanotweezers structure 1 and hemin 16, and the amounts and molar ratios of DNA nanotweezers structure 1 and hemin 16 on the sprayed target site 20 can be the same as those described above.

[0064] In the detection kit for target nucleic acid according to this embodiment, a solution containing the DNA nanotweezers structure 1 and a solution containing hemin 16 may be prepared as separate solutions, and these solutions may be used instead of the solution 18 containing the DNA nanotweezers structure 1 and hemin 16. The methods for preparing the various solutions may be the same as those described above.

[0065] Detection of the target nucleic acid 13 at the target site 20 on the solid surface 19 using the detection kit according to this embodiment can be carried out by the method described in detail in the above embodiment. [Example]

[0066] Examples are given below to explain in detail the method for detecting a target nucleic acid according to the present invention.

[0067] Example 1 (Fabrication of DNA nanotweezers structure) The first, second, and third oligonucleotides were mixed with phosphate-buffered saline (PBS) to a final concentration of 5 μM. Using a PCR thermal cycler, the mixture was heated at 95°C for 5 minutes and then slowly cooled to 10°C (-3°C / 1 minute). A DNA nanotweezers structure was fabricated by further incubating at 10°C for 4 minutes, and then stored at 4°C. The nucleic acid sequences of the first, second, and third oligonucleotides are shown below. The first, second, and third oligonucleotides were purchased from Integrated DNA Technologies, Inc. First oligonucleotide: 5'-CTTTTCGACAAGCGCTACATTTTACGCCTGGTGCC-3' (SEQ ID NO: 4) Second oligonucleotide: 5'-CCGACCGCAGGATCCTATAATTAACCGATAAATATGAA-3' (SEQ ID NO: 5) Third oligonucleotide: 5'-GGGTTTGGGTTTTTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTATTTGGGTAGGG-3' (SEQ ID NO: 6)

[0068] Preparation of target sites on a solid surface As shown in Figure 5, hemin was dropped onto the four corners of a filter paper at 20 pmol / spot and then dried. Target nucleic acid (Target) was dropped onto the filter paper at 1.0 pmol / spot (leftmost column, three spots in the middle), 5.0 pmol / spot (second column from the left, five spots), and 10 pmol / spot (third column from the left, five spots) and then dried. Non-target nucleic acid (Non-Target) was dropped onto the filter paper at 10 pmol / spot (fourth column from the left, five spots) and then dried. Water (fifth column from the left, three spots in the middle) was dropped onto the filter paper as a buffer region and then dried. A photograph of the filter paper prepared in this manner is shown in Figure 5. Each spot was a circular spot with a radius of approximately 1 mm, and the area of ​​one spot was approximately 3.14 mm. 2 The nucleic acid sequences of the target nucleic acid and non-target nucleic acid are shown below. The target nucleic acid and non-target nucleic acid were purchased from Integrated DNA Technologies. Target nucleic acid: 5'-TTCATATTTATCGGTTAAGCGCTTGTCGAAAAG-3' (SEQ ID NO: 7) Non-target nucleic acids: 5'-TATGTTCATATTGGATTGCGCCTTTGTATTATAAAAGTTGAGATGACATT-3' (SEQ ID NO: 8)

[0069] (Preparation of spray solution) The spray solution (containing DNA nanotweezers and hemin) was prepared as follows. First, a 4x concentrated working buffer (4x WB) was prepared to final concentrations of 200 mM Tris-HCl, 600 mM NHCl, 80 mM KCl, and 0.12% Triton X-100, with a pH of 7.5. Next, 250 μL of 4x WB, 200 μL of a 5 μM DNA nanotweezers solution, 20 μL of 100 μM hemin (in DMSO), and 530 μL of MilliQ water were mixed (final concentrations: 1 μM DNA nanotweezers, 2 μM hemin). This resulted in 1 mL of spray solution.

[0070] (Detection of target nucleic acid) The prepared spray solution was sprayed onto the filter paper using a commercially available simple sprayer (a 50 mL Nafco alcohol disinfectant spray bottle removed and washed), with 1 mL of the solution sprayed onto the filter paper and allowed to penetrate into a square area of ​​approximately 50 mm x 50 mm. One spot (a circle with a radius of approximately 1 mm and an area of ​​approximately 3.14 mm) was used. 2 The estimated amounts of DNA nanotweezers and hemin per spot were approximately 1.3 pmol / spot for the DNA nanotweezers and approximately 2.6 pmol / spot for hemin. After 30 minutes, approximately 1 mL of luminol reaction solution (Fujifilm Wako Pure Chemical Industries, Ltd.) prepared according to the manufacturer's instructions was sprayed onto the filter paper from a distance of approximately 300 mm using the same type of simple sprayer. Within 5 seconds of spraying the luminol reaction solution, the filter paper was placed in a dark box and photographed using a SONY DSC-TX30 digital camera (Sony Corporation) at ISO 12800, an f-stop of 3.5, and an exposure time of 1 second. The photograph is shown in Figure 6A. Figure 6B shows the locations of each spot in Figure 6A.

[0071] As shown in Figures 6A and 6B, strong luminol luminescence was detected at the 5.0 pmol / spot (second column from the left, five spots) and 10 pmol / spot (third column from the left, five spots) of target nucleic acid, whereas weak luminol luminescence was detected at the 1.0 pmol / spot of target nucleic acid (leftmost column, three spots in the middle). Furthermore, no luminol luminescence was detected at the 10 pmol / spot of non-target nucleic acid (fourth column from the left, five spots), nor was luminol luminescence detected at the buffer region where water was dropped (fifth column from the left, three spots in the middle). Therefore, in Example 1, we demonstrated that the target nucleic acid (SEQ ID NO: 7) on a solid surface can be directly and easily detected by spraying a solution containing a DNA nanotweezers structure consisting of a first oligonucleotide (SEQ ID NO: 4), a second oligonucleotide (SEQ ID NO: 5), and a third oligonucleotide (SEQ ID NO: 6) and hemin onto a target site on the solid surface containing the target nucleic acid (SEQ ID NO: 7). We then sprayed a luminol reaction solution onto the target site and detected luminol luminescence at the target site. On the other hand, when the amount of target nucleic acid was approximately 1.0 pmol / spot, the intensity of luminol luminescence was low, making it difficult to determine whether the target nucleic acid was clearly detected. However, since it may be possible to detect luminol luminescence by adjusting the concentrations of the DNA nanotweezers structure and hemin in the spray solution and the amount of luminol reaction solution sprayed, the results of Example 1 do not define the detection limit. Although not clearly observed in Figures 6A and 6B, luminol luminescence can sometimes be detected as small spots outside the target nucleic acid spot. This is thought to be due to the fact that a high concentration of hemin was sprayed, or a large amount of luminol reaction solution was sprayed, or both, causing the luminol reaction of hemin alone to proceed, resulting in weakly detected luminol luminescence. However, since the luminol luminescence intensity at the spot where the target nucleic acid was spotted was clearly higher than that of hemin alone, it was found that erroneous detection of the target nucleic acid was unlikely. Furthermore, the results at the four corners of the filter paper confirmed that a certain amount of luminol luminescence from hemin alone was detected when the amount of hemin was 20 pmol / spot.Therefore, if the hemin concentration in the spray solution is set too high, luminol luminescence may be detected in the background, potentially making the target nucleic acid detection method of this example unfeasible. Therefore, it was found that the concentration settings of the DNA nanotweezers structure and hemin in the spray solution are important. Furthermore, theoretically, luminol luminescence should be observed with uniform intensity in the 20 pmol / spot hemin spots at the four corners of the filter paper. However, as shown in Figure 6A, in reality, the luminol luminescence intensity of the hemin at the four corners was found to be non-uniform. In particular, the luminol luminescence intensity at the hemin spot in the lower right of Figure 6A was clearly high. This is thought to be due to uneven spraying of the luminol reaction solution. This is thought to be one of the reasons why, as explained above, luminol luminescence may be detected as small spots outside the target nucleic acid spot position as a result of spraying a large amount of luminol reaction solution.

[0072] The detection principle of the target nucleic acid in Example 1 will be briefly described. Figure 7 shows a schematic diagram of the DNA nanotweezer structure (consisting of a first oligonucleotide of SEQ ID NO: 4, a second oligonucleotide of SEQ ID NO: 5, and a third oligonucleotide of SEQ ID NO: 6) and the target nucleic acid (SEQ ID NO: 7) used in Example 1. As shown in Figure 7, in Example 1, the nucleic acid sequence "CTTTTCGACAAGCGC" of the first target recognition site of the DNA nanotweezer structure is complementary to the nucleic acid sequence "GCGCTTGTCGAAAAG" at one end of the target nucleic acid, and thus they bind to each other. Furthermore, the nucleic acid sequence "TTAACCGATAAATATGAA" of the second target recognition site of the DNA nanotweezer structure is complementary to the nucleic acid sequence "TTCATATTTATCGGTTAA" at the other end of the target nucleic acid, and thus they bind to each other. This causes the DNA nanotweezer structure to undergo a structural change to a closed state. As a result, the split G-quadruplex regions located at both ends of the tweezer structure come into close proximity to each other, restoring the structure's ability to bind to hemin and exhibiting peroxidase activity. In this case, the luminol reaction proceeds, and luminol luminescence is detected more strongly than in the case of hemin alone, allowing us to determine that the target nucleic acid has been detected. On the other hand, the DNA nanotweezers structure used in Example 1 does not have a sequence complementary to the non-target nucleic acid (SEQ ID NO: 8). Therefore, the DNA nanotweezers structure cannot change its structure to a closed state and does not exhibit peroxidase activity. In this case, the luminol reaction does not proceed, and therefore no luminol luminescence is detected or is detected weakly, allowing us to determine that the target nucleic acid has not been detected.

[0073] Example 2 In this Example 2, the non-target nucleic acid used in Example 1 was used as the target nucleic acid, and the target nucleic acid used in Example 1 was used as the non-target nucleic acid. Then, the target nucleic acid was detected using a DNA nanotweezers structure capable of detecting the target nucleic acid according to Example 2. Other points are the same as in Example 1, and therefore a description thereof will be omitted.

[0074] The nucleic acid sequences of the first oligonucleotide, second oligonucleotide, third oligonucleotide, target nucleic acid, and non-target nucleic acid used in Example 2 are shown below. The first oligonucleotide and second oligonucleotide were purchased from Integrated DNA Technologies, Inc. The third oligonucleotide, target nucleic acid, and non-target nucleic acid used were the same as those used in Example 1. First oligonucleotide: 5'-CTCAACTTTTATAATACAAATACATTTTACGCCTGGTGCC-3' (SEQ ID NO: 9) Second oligonucleotide: 5'-CCGACCGCAGGATCCTATAAGGCGCAATCCAATAT-3' (SEQ ID NO: 10) Third oligonucleotide: 5'-GGGTTTGGGTTTTTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTATTTGGGTAGGG-3' (SEQ ID NO: 6) Target nucleic acid: 5'-TATGTTCATATTGGATTGCGCCTTTGTATTATAAAAGTTGAGATGACATT-3' (SEQ ID NO: 8) Non-target nucleic acids: 5'-TTCATATTTATCGGTTAAGCGCTTGTCGAAAAG-3' (SEQ ID NO: 7)

[0075] Preparation of target sites on a solid surface As shown in Figure 8, hemin was dropped onto the four corners of a filter paper at 20 pmol / spot and allowed to dry. Target nucleic acid (Target) was dropped onto the filter paper at 1.0 pmol / spot (leftmost column, three middle spots), 5.0 pmol / spot (second column from the left, five spots), and 10 pmol / spot (third column from the left, five spots) and allowed to dry. Non-target nucleic acid (Non-Target) was dropped onto the filter paper at 10 pmol / spot (fourth column from the left, five spots) and allowed to dry. Water (fifth column from the left, three middle spots) was dropped onto the filter paper as a buffer region and allowed to dry. A photograph of the filter paper prepared in this manner is shown in Figure 8.

[0076] The target nucleic acid was detected in the same manner as in Example 1. After spraying the luminol reaction solution, the filter paper was placed in a dark box and photographed, as shown in Figure 9A. A photograph showing the positions of each spot in Figure 9A is shown in Figure 9B. One spot (circular with a radius of approximately 1 mm and an area of ​​approximately 3.14 mm) was used. 2 The estimated amounts of the DNA nanotweezers structure and hemin per spot were the same as in Example 1, and were about 1.3 pmol / spot for the DNA nanotweezers structure and about 2.6 pmol / spot for hemin.

[0077] As shown in Figures 9A and 9B, luminol luminescence was detected more strongly with the target nucleic acid (SEQ ID NO: 8) in Example 2 than with hemin alone, whereas no luminol luminescence was detected with the non-target nucleic acid (SEQ ID NO: 7). Other points were similar to those in Example 1. Specifically, luminol luminescence was detected strongly at the 5.0 pmol / spot (second column from the left, five spots) and 10 pmol / spot (third column from the left, five spots) of target nucleic acid, whereas luminol luminescence was weakly detected at the 1.0 pmol / spot (leftmost column, three middle spots). Furthermore, luminol luminescence was not detected in the area where water was dropped as a buffer region (fifth column from the left, three middle spots).

[0078] Therefore, in this Example 2, it was found that the target nucleic acid (SEQ ID NO: 8) on a solid surface can be directly and simply detected by spraying a DNA nanotweezers structure consisting of a first oligonucleotide (SEQ ID NO: 9), a second oligonucleotide (SEQ ID NO: 10), and a third oligonucleotide (SEQ ID NO: 6) and a solution containing hemin onto a target site on the solid surface containing the target nucleic acid (SEQ ID NO: 8), then spraying a luminol reaction solution onto the target site, and detecting luminol luminescence at the target site.

[0079] A notable feature of the results of Example 2 is that the target nucleic acid (SEQ ID NO: 8) was successfully detected without using a DNA nanotweezers structure that recognizes the entire nucleic acid sequence of the target nucleic acid. More specifically, in Example 2, the target nucleic acid was successfully detected using a DNA nanotweezers structure that recognizes 70% of the nucleic acid sequence of the target nucleic acid.

[0080] As explained in Example 1, luminol luminescence may be detected as fine spots at locations other than the spotted location of the target nucleic acid. In this regard, in Example 2, fine spots of luminol luminescence were detected around the luminol luminescence of 20 pmol / spot of hemin in the lower right corner of Figure 9A. The reason for this is thought to be that, as described above, a high concentration of hemin was sprayed, or a large amount of luminol reaction solution was sprayed, or both, causing the luminol reaction of hemin alone to proceed, resulting in weakly detected luminol luminescence. However, the intensity of luminol luminescence at the spot where the target nucleic acid was spotted was clearly higher than the intensity of the fine spots of luminol luminescence, indicating that erroneous detection of the target nucleic acid is unlikely to occur.

[0081] The principle of the target nucleic acid detection method using the DNA nanotweezers structure of Example 2 is the same as that of Example 1. Specifically, although not shown, the nucleic acid sequence "CTCAACTTTTATAATACAAA" of the first target recognition site of the DNA nanotweezers structure of Example 2 is complementary to the nucleic acid sequence "TTTGTATTATAAAAGTTGAG" at one end of the target nucleic acid (SEQ ID NO: 8), resulting in binding to each other. Furthermore, the nucleic acid sequence "GGCGCAATCCAATAT" of the second target recognition site of the DNA nanotweezers structure is complementary to the nucleic acid sequence "ATATTGGATTGCGCC" at the other end of the target nucleic acid, resulting in binding to each other. This structural change causes the DNA nanotweezers structure to transition to a closed state. As a result, the split G-quadruplex regions located at both ends of the tweezers structure approach each other, restoring the structure's ability to bind to hemin and exhibiting peroxidase activity. This promotes the luminol reaction, resulting in stronger luminol luminescence than that detected with hemin alone, indicating successful detection of the target nucleic acid. On the other hand, the DNA nanotweezers structure used in Example 2 does not have a sequence complementary to the non-target nucleic acid (SEQ ID NO: 7). Therefore, the DNA nanotweezers structure cannot change its structure to a closed state and does not exhibit peroxidase activity. As a result, the luminol reaction does not proceed, and therefore no luminol luminescence is detected or is detected weakly, and it can be determined that the target nucleic acid has not been detected.

[0082] As described above, according to the present invention, a DNA nanotweezers structure can be fabricated by self-assembling a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, and various types of target nucleic acids can be directly and easily detected using the structure, hemin, and a luminol reaction solution. Furthermore, by designing and fabricating a DNA nanotweezers structure so that it can recognize the nucleic acid sequence of the target nucleic acid, it was demonstrated that various types of target nucleic acids can be specifically detected.

[0083] The amounts of DNA nanotweezers structure and hemin in one spot on the filter paper when the spray solution was sprayed in Examples 1 and 2 were determined by carrying out the experiments in Reference Examples 1 and 2 described in detail below.

[0084] Reference example 1 (Investigation of the optimal amount of DNA nanotweezers structure) In Reference Example 1, the amount of hemin on the filter paper was fixed at 20 pmol / spot, and the following experiment was conducted to determine the optimal amount of DNA nanotweezers on the filter paper when sprayed with a spray solution. Furthermore, in Reference Example 1, the spray volume of the luminol reaction solution was fixed at 750 μL. In the target nucleic acid detection method according to this example, the intensity of luminol luminescence varies depending on the spray volume of the luminol reaction solution, so it is preferable to fix the spray volume of the luminol reaction solution. First, a DNA nanotweezers solution was prepared using a first oligonucleotide (SEQ ID NO: 4), a second oligonucleotide (SEQ ID NO: 5), and a third oligonucleotide (SEQ ID NO: 6) in the same manner as in Example 1. A target nucleic acid solution was also prepared using the target nucleic acid (SEQ ID NO: 7), and this was mixed with the DNA nanotweezers solution to prepare a mixed solution of 200 nM DNA nanotweezers and target nucleic acid. A 2 μM hemin solution (in DMSO) was also prepared. The mixed solution and the hemin solution were mixed in the ratios shown in Table 1 below to prepare the following solutions of Samples 1 to 6.

[0085] [Table 1]

[0086] Each of the solutions for Samples 1–6 was stirred at room temperature for 30 minutes, and approximately 10 μL of each of Sample Solutions 1–6 was dropped onto the filter paper in multiple batches. The solid surface was then prepared by repeatedly applying the drops to five vertical positions on the filter paper and drying. Each sample was dropped into five vertical positions: Sample 1 in the leftmost column, Sample 2 in the second column, Sample 3 in the third column, Sample 4 in the fourth column, Sample 5 in the fifth column, and Sample 6 in the sixth column. Next, approximately 750 μL of luminol reaction solution (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) prepared according to the manufacturer's instructions was sprayed onto the filter paper from a distance of approximately 300 mm using a simple sprayer of the same model. Within 5 seconds of spraying the luminol reaction solution, the filter paper was placed in a dark box and photographed from a distance of approximately 110 mm using a digital camera SONY DSC-TX30 (manufactured by Sony Corporation) at ISO 12800, an aperture value (F-number) of 3.5, and an exposure time of 1 second. The photographs are shown in Figure 10. Each spot (circular with a radius of 1 mm and an area of ​​approximately 3.14 mm) 2 The estimated amounts of DNA nanotweezers structures and hemin on the nanotweezers are shown in Table 2.

[0087] [Table 2]

[0088] The results in Figure 10 indicate that in Sample 1, which contains only hemin, no or very weak luminol luminescence was detected. On the other hand, the results of Samples 2 to 6 confirmed that, when the amount of DNA nanotweezers structures was 0.1 pmol / spot, 0.5 pmol / spot, 1.0 pmol / spot, 1.5 pmol / spot, and 2.0 pmol / spot, the luminol luminescence detected was stronger than the luminol luminescence of hemin alone (Sample 1, background). Therefore, by increasing the amount of DNA nanotweezers structures to 0.1 pmol / spot or more, it was possible to clearly distinguish the luminol luminescence from the luminol luminescence of hemin alone (Sample 1, background). Furthermore, it was shown that when the amount of DNA tweezers structures recognizing the target was within the range of 0.1 pmol / spot to 2.0 pmol / spot, the amount of luminescence varied depending on the degree of target nucleic acid recognition.

[0089] Reference example 2 (Consideration of the optimal amount of hemin) In Reference Example 2, the following experiment was conducted to determine the optimal amount of hemin on filter paper when sprayed with the spray solution. Furthermore, in Reference Example 2, considering the overall low intensity of luminol luminescence in the results of Reference Example 1 (Figure 10), the optimal amount of hemin was determined when the spray volume of the luminol reaction solution was increased from 750 μL to 1 mL to obtain a reasonably sufficient amount of luminescence. As shown in Figure 11, hemin solution was dropped onto filter paper at four locations to achieve a concentration of 4 pmol / spot or 20 pmol / spot of hemin on the filter paper, and the filter paper was allowed to dry (a total of eight locations were prepared). Figure 11 shows a photograph of the filter paper after drying. Next, approximately 1 mL of luminol reaction solution (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) prepared according to the manufacturer's instructions was sprayed using the same type of simple sprayer. Within 5 seconds of spraying the luminol reaction solution, the filter paper was placed in a dark box and photographed using a digital camera, SONY DSC-TX30 (manufactured by Sony Corporation), at ISO 12800, an f-stop of 3.5, and an exposure time of 1 second. The photographs are shown in Figure 12.

[0090] The results in Figures 11 and 12 show that luminol luminescence was not detected or was very weak at the 4 pmol / spot of hemin, confirming its usefulness as a background signal when the luminol reaction solution was sprayed at 1 mL. In terms of the spray solution, a hemin concentration of 2 μM allows for uniform spraying of approximately 4 pmol / spot of hemin onto the target area. Therefore, it was found that a hemin concentration of 2 μM or less is preferable. On the other hand, luminol luminescence was relatively strong at the 20 pmol / spot of hemin, making it difficult to use as a background signal when the luminol reaction solution was sprayed at 1 mL. However, it was also found that 20 pmol / spot of hemin could be used as a standard. Based on these results, we determined that the amount of hemin below 4.0 pmol / spot provides a sufficiently low background signal, even when the amount of luminol reaction solution is increased.

[0091] Based on the results of Reference Examples 1 and 2, the amounts of DNA nanotweezers structures and hemin in one spot on the filter paper when the spray solution was sprayed in Examples 1 and 2 were set. The settings were made under conditions where the spray volume of the luminol reaction solution was 1 mL. Specifically, the amounts on the filter paper when the spray solution was sprayed were set to 1.3 pmol / spot for the DNA nanotweezers structures and 2.6 pmol / spot for hemin. Furthermore, in order to spray these amounts onto the filter paper, the concentration of the DNA nanotweezers structures in the spray solution was set to 1 μM, and the concentration of hemin was set to 2 μM. [Explanation of symbols]

[0092] 1. DNA nanotweezers structure 2. First Oligonucleotide 3. Second Oligonucleotide 4. Third Oligonucleotide 5 First target recognition site 6 First binding site 7 Second target recognition site 8 Second binding site 9 Third binding site 10 4th binding site 11 Bend area 12 split guanine quadruplex sites 13 Target nucleic acid 14 Nucleic acid sequence at one end 15 Nucleic acid sequence at the other end 16 Hemin 17 Sprayer 18 DNA nanotweezers structure and solution containing hemin 19 Solid surfaces 20 target site 21 Luminol reaction solution

Claims

1. A method for detecting a target nucleic acid, comprising: spraying a solution containing a DNA nanotweezer structure and hemin onto a target site containing a target nucleic acid on a solid surface; spraying a luminol reaction solution onto the target site; detecting luminol luminescence at the target site; the DNA nanotweezer structure comprises a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide; the first oligonucleotide includes a first target recognition site having a sequence complementary to a nucleic acid sequence on one end of the target nucleic acid, and a first binding site for binding to the third oligonucleotide; the second oligonucleotide includes a second target recognition site having a sequence complementary to the nucleic acid sequence at the other end of the target nucleic acid, and a second binding site for binding to the third oligonucleotide; The method is characterized in that the third oligonucleotide comprises a third binding site having a sequence complementary to the first binding site, a fourth binding site having a sequence complementary to the second binding site, a bending site provided between the third binding site and the fourth binding site, and split G-quadruplex sites positioned on the opposite side of the bending site in the third binding site and the fourth binding site, respectively.

2. the first oligonucleotide comprises a nucleic acid sequence of 5'-[first target recognition site]-TACATTTTACGCCTGGTGCC (SEQ ID NO: 1)-3'; the second oligonucleotide comprises the nucleic acid sequence 5'-CCGACCGCAGGATCCTATAA (SEQ ID NO: 2)-[second target recognition site]-3'; 2. The method of claim 1, wherein the third oligonucleotide comprises the nucleic acid sequence: 5'-[first split G-quadruplex site]-TTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTA (SEQ ID NO: 3)-[second split G-quadruplex site]-3'.

3. 3. The method of claim 2, wherein the third oligonucleotide comprises the nucleic acid sequence 5'-GGGTTGGGTTTTTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTATTTGGGTAGGG (SEQ ID NO: 6)-3'.

4. 4. The method according to claim 1, wherein the step of detecting luminol luminescence is a step of photographing the target site with an imaging device and detecting the luminol luminescence.

5. The amount of the sprayed DNA nanotweezers structure at the target site was 0.1 pmol / 3.14 mm ２ More than 2.0 pmol / 3.14 mm ２ and the amount of hemin at the sprayed target site is 1 pmol / 3.14 mm or less. ２ More than 20 pmol / 3.14 mm ２ The method according to any one of claims 1 to 4, wherein:

6. A kit for detecting a target nucleic acid, comprising: a solution containing a DNA nanotweezers structure and hemin to be sprayed onto a solid surface on which the target nucleic acid is present; and a luminol reaction solution, the DNA nanotweezer structure comprises a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide; the first oligonucleotide includes a first target recognition site having a sequence complementary to a nucleic acid sequence on one end of the target nucleic acid, and a first binding site for binding to the third oligonucleotide; the second oligonucleotide includes a second target recognition site having a sequence complementary to the nucleic acid sequence at the other end of the target nucleic acid, and a second binding site for binding to the third oligonucleotide; the third oligonucleotide includes a third binding site having a sequence complementary to the first binding site, a fourth binding site having a sequence complementary to the second binding site, a bending site provided between the third binding site and the fourth binding site, and split G-quadruplex sites located on opposite sides of the bending site in the third binding site and the fourth binding site, respectively; A kit for detecting a target nucleic acid at a target site on a solid surface.

7. the first oligonucleotide comprises a nucleic acid sequence of 5'-[first target recognition site]-TACATTTTACGCCTGGTGCC (SEQ ID NO: 1)-3'; the second oligonucleotide comprises the nucleic acid sequence 5'-CCGACCGCAGGATCCTATAA (SEQ ID NO: 2)-[second target recognition site]-3'; The kit of claim 6, wherein the third oligonucleotide comprises a nucleic acid sequence of 5'-[first split G-quadruplex site]-TTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTA (SEQ ID NO: 3)-[second split G-quadruplex site]-3'.

8. 8. The kit of claim 7, wherein the third oligonucleotide comprises the nucleic acid sequence 5'-GGGTTGGGTTTTTATAGGATCCTGCGGTCGGAGGCACCAGGCGTAAAATGTATTTGGGTAGGG (SEQ ID NO: 6)-3'.

9. When a solution containing the DNA nanotweezers structure and hemin was sprayed onto the target site, the amount of the DNA nanotweezers structure on the target site was 0.1 pmol / 3.14 mm ２ More than 2.0 pmol / 3.14 mm ２ and the amount of hemin on the target site is 1 pmol / 3.14 mm ２ More than 20 pmol / 3.14 mm ２ The kit according to any one of claims 6 to 8, wherein:

Images