Methods for producing oligonucleotides

Abstract

The present invention provides a method for producing oligonucleotide by a solid-phase synthesis technique, wherein said method for producing oligonucleotide comprises a step for reacting, in the presence of a thiol, an acid with an oligonucleotide in which the hydroxyl group at the 5' end is protected by a protection group that is removable under acidic conditions, in order to remove the protection group on the hydroxyl group at the 5' end. The present invention also provides oligonucleotide in which the content ratio of N-1-mer in the oligonucleotide is not greater than a certain amount.

Description

[Technical Field]

[0001] This patent application claims priority under the Paris Convention and the benefit of Japanese Patent Application No. 2022-172158 (filed October 27, 2022), the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a method for producing oligonucleotides using a phosphoramidite method in solid phase synthesis, in which a thiol compound is used as a cation scavenger. [Background technology]

[0003] In recent years, there has been growing interest in the application of nucleic acid molecules in the medical field, including antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are known as nucleic acid drugs.

[0004] Oligonucleotides can be synthesized using the phosphoramidite method (hereinafter referred to as the "amidite method"), which includes a step of deprotecting the hydroxyl-protecting group at the 5'-end. This step is carried out by reacting an oligonucleotide with a protected hydroxyl group at the 5'-end with an acid. This reaction is an equilibrium reaction in which the protecting group at the 5'-end hydroxyl is eliminated as a cation, and is a reversible reaction.

[0005] In liquid-phase synthesis, as the deprotection reaction proceeds, the cations of the deprotected protecting groups (e.g., 4,4'-dimethoxytrityl cations) increase in the system, inhibiting the progress of the equilibrium reaction of the elimination reaction. Therefore, a method using a cation scavenger to promote the reaction is known (see Patent Document 1). On the other hand, in solid-phase synthesis, such cations are discharged from the system without remaining in it during the synthesis process, so the equilibrium reaction proceeds smoothly and the problems described above associated with liquid-phase synthesis are known to be eliminated (see Non-Patent Document 1). Therefore, in solid-phase synthesis, it is generally not necessary to use a cation scavenger. A method has been reported in which a deprotection reaction was carried out in solid-phase synthesis using triethylsilane as a cation scavenger (see Patent Document 2). However, the effect of triethylsilane as a cation scavenger in this method was insufficient. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. 2012 / 157723 [Patent Document 2] U.S. Patent No. 5,510,476 [Non-patent literature]

[0007] [Non-Patent Document 1] J. Am. Chem. Society., 2020, 142, 16610 Summary of the Invention [Problem to be solved by the invention]

[0008] The present invention aims to provide a method for producing oligonucleotides using the phosphoramidite method in solid-phase synthesis, in which the deprotection reaction of the 5'-terminal hydroxyl group proceeds efficiently, thereby improving the yield and purity of the synthesized oligonucleotide. Another object of the present invention is to provide an oligonucleotide having a significantly low content of N-1mer in the oligonucleotide. [Means for solving the problem]

[0009] The present inventors have conducted extensive research to achieve the above-mentioned object and have found that the use of a thiol compound as a cation scavenger efficiently proceeds with the deprotection reaction of the 5'-hydroxyl protecting group, thereby improving the yield and purity of the resulting oligonucleotide.As a result, the present invention provides a method for producing an oligonucleotide by solid-phase synthesis, which includes a step of removing the 5'-terminal hydroxyl group by reacting an oligonucleotide, the 5'-terminal hydroxyl group of which is protected with a protecting group that can be removed under acidic conditions, with an acid in the presence of a thiol, and an oligonucleotide in which the content ratio of N-1mer in the oligonucleotide is a certain amount or less.

[0010] The present invention includes, but is not limited to, the following aspects. [1] A method for producing an oligonucleotide by solid phase synthesis, comprising: A method for producing an oligonucleotide (hereinafter referred to as "the production method of the present invention"), comprising the step of reacting an oligonucleotide, the 5'-terminal hydroxyl group of which is protected with a protecting group removable under acidic conditions, with an acid in the presence of a thiol to remove the protecting group of the 5'-terminal hydroxyl group. [2] The method according to [1], wherein the thiol is a C2-C20 alkylthiol or a C4-C8 cycloalkylthiol. [3] The method according to either [1] or [2], wherein the thiol is 1-dodecanethiol or cyclohexanethiol. [4] The protecting group for the hydroxyl group at the 5'-end is represented by the following formula: [ka] (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent hydrogen or an alkoxy group. The method according to any one of [1] to [3], wherein the protecting group is represented by the following formula: [5] The method according to any one of [1] to [4], wherein the protecting group for the hydroxyl group at the 5'-end is a 4,4'-dimethoxytrityl group (DMTr group). [6] The method according to any one of [1] to [5], wherein the acid is trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, or p-toluenesulfonic acid. [7] The method according to any one of [1] to [5], wherein the acid is dichloroacetic acid. [8] The method according to [7], wherein the acid is dichloroacetic acid in the presence of an aprotic inert solvent having a boiling point lower than that of dichloroacetic acid. [9] The production method according to [8], wherein the aprotic inert solvent having a boiling point lower than that of dichloroacetic acid is at least one solvent selected from dichloromethane, acetonitrile, and aromatic organic solvents.

[10] The method according to [9], wherein the aromatic organic solvent is toluene.

[11] The dichloroacetic acid is a dichloroacetic acid to formaldehyde molar ratio of 81 × 10 ―5 and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―5 The method for producing the compound according to [7], wherein the compound is dichloroacetic acid.

[12] An oligonucleotide having a hydroxyl group at the 5'-end protected with a protecting group removable under acidic conditions, the oligonucleotide being represented by the formula (1): [ka] (In the formula, G 1 represents a protecting group for a hydroxyl group, G 2 represents a protecting group for a hydroxyl group, B a each independently represents the same or different nucleobase which may be protected with a protecting group; R's may be the same or different and each independently represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position of ribose, or an ethylidene group bonded to the carbon atom at 4' position of ribose; Y's are independently the same or different and represent an oxygen atom or a sulfur atom; n represents an integer of 1 to 300, W1 represents an OZ group and X1 represents an R group, or W1 represents an OV group and X1 represents an OZ group; V represents a protecting group for a hydroxyl group; Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or more, the nucleic acid molecule represented by formula (1) may have a non-nucleotide linker incorporated between each nucleotide. is an oligonucleotide represented by The nucleotide from which the protecting group of the 5'-terminal hydroxyl group has been removed is represented by the formula (2): [ka] (In the formula, G 2 , B a , R, Y, X1, W1 and n are as defined above, and As defined in formula (1), non-nucleotide linkers may be incorporated between the nucleotides. The method according to any one of [1] to

[11] , wherein the oligonucleotide is represented by the formula:

[13] An oligonucleotide having a hydroxyl group at the 5'-end protected with a protecting group removable under acidic conditions, the oligonucleotide being represented by the formula (1'): [ka] (In the formula, G 2 , B a , R, Y, X1, W1 and n are as defined above, and R 1 , R2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group. is an oligonucleotide represented by

[12] The manufacturing method described in

[12] .

[14] R 1 and R 2 is a methoxy group, and R 3 is a hydrogen atom.

[15] A method for producing an oligonucleotide represented by formula (2'), comprising the steps of

[12] and further comprising the steps of removing the group represented by Z from the oligonucleotide represented by formula (2) produced in the steps, and removing the protecting groups of the hydroxyl group and the nucleobase: [ka] (In the formula, Y and n are as defined above, B c are each independently the same or different and represent a nucleobase; G 4 are each independently the same or different and represent a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, R' are independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' is as defined above, and X3 and W3 each independently represent a hydroxyl group, or X3 represents an R' group and W3 represents a hydroxyl group; and As defined in formula (1), non-nucleotide linkers may be incorporated between the nucleotides. A method for producing an oligonucleotide represented by the formula:

[16] The method according to any one of

[12] to

[15] , wherein the oligonucleotide is an oligonucleotide containing ribonucleic acid (RNA).

[17] The oligonucleotide is an oligonucleotide containing ribonucleic acid (RNA), and the protecting group of the hydroxyl group at the 2'-position of the ribose is a protecting group represented by formula (6).

[12] The manufacturing method described in

[12] . Formula (6): [ka] (In the formula, q represents an integer of 0 to 5, R a and R b are each independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom; The * symbol indicates the point of attachment to the oxygen atom from the 2'-hydroxyl group of ribose, and E W represents an electron-withdrawing group.)

[18] q is 0 or 1 and R a and R b are each independently the same or different and are a methyl group or a hydrogen atom, and E w is a cyano group.

[19] The method according to any one of

[12] to

[18] , wherein n is an integer of 1 to 200.

[20] The method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 100 mer or more. [20-1] The method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 20 mer or more. [20-2] The method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 40 mer or more. [20-3] The method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 60 mer or more. [20-4] The method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 80 mer or more. [20-5] The method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 150 mer or more. [20-6] The method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 200 mer or less. [20-7] The method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 250 mer or less. [20-8] The method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 300 mer or less.

[21] The method according to any one of [1] to

[20] , wherein the molar ratio of the amount of the thiol used to the amount of the oligonucleotide in which the hydroxyl group at the 5'-end is protected with a protecting group that can be removed under acidic conditions is 1 or more.

[22] The method according to any one of [1] to

[21] , wherein the molar ratio of the amount of the thiol to the amount of the acid is 1 to 100.

[23] An oligonucleotide having a chain length of 50 mer or more and an N-1 mer content ratio in the oligonucleotide of less than 5.8%. [Effects of the Invention]

[0011] The present invention provides a method for producing oligonucleotides, characterized in that the deprotection reaction of the 5'-hydroxyl protecting group proceeds efficiently by using a thiol compound as a cation scavenger. The production method of the present invention is expected to improve the yield and purity of the produced oligonucleotides. [Brief explanation of the drawings]

[0012] [Figure 1]FIG. 1 shows Scheme A, a typical example of producing a nucleic acid molecule represented by formula (5) from a nucleic acid molecule represented by formula (1). In the figure, G1 can be any group capable of functioning as a protecting group for a hydroxyl group removed by dichloroacetic acid, and any known protecting group used in amidite compounds can be used. Each G3 is independently an alkyl group, whether identical or different, or two G3s may be bonded to each other to form a cyclic structure. Each G3 is independently an alkyl group, whether identical or different, such as a methyl group, an ethyl group, a propyl group, or an isopropyl group, and more preferably both are isopropyl groups. Other symbols are as described above. DETAILED DESCRIPTION OF THE INVENTION

[0013] According to one embodiment of the present invention, the present invention comprises: A method for producing an oligonucleotide by solid phase synthesis, comprising: The present invention relates to a method for producing an oligonucleotide, which comprises a step of reacting an oligonucleotide, the 5'-terminal hydroxyl group of which is protected with a protecting group removable under acidic conditions, with an acid in the presence of a thiol to remove the protecting group of the 5'-terminal hydroxyl group.

[0014] As used herein, the term "oligonucleotide whose 5'-terminal hydroxyl group is protected with a protecting group removable under acidic conditions" refers to an oligonucleotide containing a nucleotide whose 5'-terminal hydroxyl group in the nucleotide molecular structure is protected with a protecting group removable under acidic conditions. In this specification, "oligonucleotide" may also be referred to as "nucleic acid oligomer," and "nucleotide" may also be referred to as "nucleic acid molecule."

[0015] The term "protecting group capable of removing the hydroxyl group at the 5'-end under acidic conditions" is not particularly limited as long as it is a commonly known protecting group. Specific examples of the protecting group include those represented by the following formula: [ka] (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent hydrogen or an alkoxy group. However, there is no particular limitation as long as it can be eliminated as a cation.

[0016] In the protecting group shown in the above formula, R 1 , R 2 and R 3 Preferably, one of the groups is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group.

[0017] Specific preferred protecting groups include, for example, groups selected from a 4,4'-dimethoxytrityl group (DMTr group), a 4-monomethoxytrityl group, and a 4,4',4"-trimethoxytrityl group. The 4,4'-dimethoxytrityl group (DMTr group) is particularly preferred.

[0018] The term "thiol" as used herein specifically includes, for example, C2-C20 alkylthiol or C4-C8 cycloalkylthiol. Examples of C2-C20 alkylthiol include ethanethiol, 1-propanethiol, 2-propanethiol, 1-butanethiol, 2-butanethiol, 2-methyl-1-propanethiol (isobutyl mercaptan), 2-methyl-2-propanethiol (tert-butyl mercaptan), 1-pentanethiol, 1-hexanethiol, 1-heptanethiol, 1-octanethiol, 1-nonanethiol, 1-decanethiol, 1-undecanethiol, 1-dodecanethiol, tert-dodecanethiol, 1-tetradecanethiol, 1-pentadecanethiol, 1-hexadecanethiol, 1-octadecanethiol, and 1-eicosanethiol. Examples of C4-C8 cycloalkylthiols include cyclobutanethiol, cyclopentanethiol, cyclohexanethiol, cycloheptanethiol, and cyclooctanethiol. Preferred thiols include 1-dodecanethiol and cyclohexanethiol.

[0019] The molar ratio of the amount of the thiol used to the reaction substrate, that is, the oligonucleotide in which the 5'-terminal hydroxyl group is protected with a protecting group removable under acidic conditions, is, but is not limited to, equal to or greater than 1. The molar ratio of the amount of the thiol used to the acid is, but is not limited to, 1 to 100.

[0020] The term "acid" refers to an acid used to remove the protecting group in the phosphoramidite method, and specific examples include, but are not limited to, trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid. Dichloroacetic acid is particularly preferred.

[0021] It is preferable to use dichloroacetic acid of high purity. High-purity dichloroacetic acid means dichloroacetic acid containing impurities of a certain level or less. Impurities include formaldehyde and / or dichloroacetic anhydride, which are used in the process for producing dichloroacetic acid.

[0022] For example, the molar ratio of formaldehyde to dichloroacetic acid is 81 x 10 ―5 is less than 41 x 10 ―5 The following is preferred: 81 x 10 ―6 The molar ratio of dichloroacetic anhydride to dichloroacetic acid is preferably 20×10 or less. ―5 is less than or equal to 10 x 10 ―5 Less than 50 x 10 is preferable. ―6 The following is more preferred: Depending on the embodiment of the dichloroacetic acid used, it is preferred to use dichloroacetic acid in which the molar ratio of formaldehyde to dichloroacetic acid is equal to or less than the above-mentioned ratios and / or the molar ratio of dichloroacetic anhydride to dichloroacetic acid is equal to or less than the above-mentioned ratios.

[0023] The dichloroacetic acid may be used in the form of a liquid (e.g., a solution, suspension, or emulsion) contained in an aprotic inert solvent having a boiling point lower than that of dichloroacetic acid, which is used in the method for producing and purifying dichloroacetic acid, or may be used in the coexistence of an inert solvent by separately adding such an inert solvent to the reaction system.

[0024] Examples of the aprotic inert solvent having a boiling point lower than that of dichloroacetic acid include aprotic inert solvents having a boiling point of 181°C or lower, and specific examples include, but are not limited to, dichloromethane, acetonitrile, and aromatic organic solvents. Examples of aromatic organic solvents include toluene, xylene, monochlorobenzene, and o-dichlorobenzene, and toluene is preferred. The amount of such solvents used is not particularly limited, but is typically about 0.5 to 20 times by weight relative to the amount of dichloroacetic acid.

[0025] Furthermore, in a reaction system containing dichloroacetic acid for such a deprotection reaction, one compound having a boiling point lower than that of dichloroacetic acid, selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, may be added, if necessary, in the co-presence of an aprotic inert solvent having a boiling point lower than that of dichloroacetic acid.

[0026] Examples of aliphatic alcohols and aliphatic amines having a boiling point lower than that of dichloroacetic acid include C1-C6 aliphatic alcohols and C1-C6 aliphatic amine compounds. Examples of C1-C6 aliphatic alcohols include methanol, ethanol, n-propanol, i-propanol, n-butanol, i-butanol, sec-butanol, t-butanol, n-pentanol, and n-hexanol. Examples of aliphatic amines having a boiling point lower than that of dichloroacetic acid include C1-C6 aliphatic amine compounds. Specific examples include methylamine, ethylamine, n-propylamine, i-propylamine, n-butylamine, i-butylamine, t-butylamine, n-pentylamine, and n-hexylamine.

[0027] The amounts of the aliphatic alcohol, the aliphatic amine, and water or a mixture thereof used are not particularly limited as long as they are effective in reducing the dichloroacetic anhydride concentration to the desired range.

[0028] As used herein, the term "oligonucleotide in which the 5'-terminal hydroxyl group is protected with a protecting group removable under acidic conditions" is specifically exemplified by an oligonucleotide of formula (1): [ka] (In the formula, G 1 represents a protecting group for a hydroxyl group, G 2 represents a protecting group for a hydroxyl group, B a each independently represents the same or different nucleobase which may be protected with a protecting group; R's may be the same or different and each independently represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position of ribose, or an ethylidene group bonded to the carbon atom at 4' position of ribose; Y's are independently the same or different and represent an oxygen atom or a sulfur atom; n represents an integer of 1 to 300, W1 represents an OZ group and X1 represents an R group, or W1 represents an OV group and X1 represents an OZ group; V represents a protecting group for a hydroxyl group; Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or more, the nucleic acid molecule represented by formula (1) may have a non-nucleotide linker incorporated between each nucleotide. Examples of oligonucleotides include those represented by the formula:

[0029] According to a more preferred embodiment of the present invention, the oligonucleotide in which the 5'-terminal hydroxyl group is protected with a protecting group removable under acidic conditions is represented by the formula (1'): [ka] (In the formula, G 2 , B a , R, Y, X1, W1 and n are as defined above, and R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group. Examples of oligonucleotides include those represented by the formula:

[0030] According to a more preferred embodiment of the present invention, in the above formula (1′), R 1, R 2 , and R 3 represents a hydrogen atom.

[0031] According to an embodiment of the present invention, the nucleotide from which the protecting group of the 5'-terminal hydroxyl group has been removed is represented by the formula (2): [ka] (In the formula, G 2 , B a , R, Y, X1, W1 and n are as defined above, and As defined in formula (1), non-nucleotide linkers may be incorporated between the nucleotides. Examples of oligonucleotides include those represented by the formula:

[0032] Furthermore, according to a preferred embodiment of the present invention, the nucleotide from which the protecting group of the hydroxyl group at the 5'-terminal has been removed is a nucleotide represented by formula (2'): [ka] (In the formula, Y and n are as defined above, B c are each independently the same or different and represent a nucleobase; G 4 are each independently the same or different and represent a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, R' are independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' is as defined above, and X3 and W3 each independently represent a hydroxyl group, or X3 represents an R' group and W3 represents a hydroxyl group; and As defined in formula (1), non-nucleotide linkers may be incorporated between the nucleotides. Examples of oligonucleotides include those represented by the following formula:

[0033] The protecting group for the hydroxyl group at the 5' position of the nucleic acid molecule is the following G 1 or G 5 An example of an oligonucleotide having a protected hydroxyl group at the 5'-position is an oligonucleotide represented by the formula (1) (or including (1')). An example of a nucleotide produced by reacting an acid (e.g., dichloroacetic acid) with a thiol is an oligonucleotide represented by the formula (2) (or including (2')). In the formulas (1) and (2), Q' may be the same or different and may represent a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose. Specific examples of compounds represented by Q' in the formula (1) and (2) above include the structures represented by LNA-1, LNA-2, or LNA-3 in the following formula (7).

[0034] [ka] (In the formula, B a represents an optionally protected nucleobase.

[0035] More specifically, the group represented by Z having a structure consisting of a solid phase carrier and a linking group connecting the solid phase carrier with the oxygen atom of the hydroxyl group at the 2'- or 3'-position of ribose at the 3'-end of the nucleic acid molecule includes a structure represented by the following formula (8): [ka] In formula (8), Sp represents a spacer. The spacer (Sp) may be, for example, one having the structural formula shown in formula (9) below.

[0036] [ka]

[0037] Linker may be, for example, a structure shown in the following formula (10), or a structure in which the structure of formula (10) does not have a hexamethyleneamino group portion and an aminopropyl group is bonded to Si. Alternatively, Linker may be a structure shown in the following formula (11). [ka] (In the formula, A may be any of a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include methoxy and ethoxy groups. Examples of alkyl groups include methyl, ethyl, isopropyl, and n-propyl groups. Si indicates that it is bonded to the oxygen of a hydroxyl group on the support surface. Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG). Examples of organic resin supports include supports made of polystyrene.

[0038] Nucleosides (ribose and deoxyribose) contained in the nucleic acid molecules used in the present invention include, but are not limited to, DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the above-mentioned LNA.

[0039] A method for synthesizing an oligonucleotide (nucleic acid oligomer) by solid-phase synthesis, which includes a step of deprotecting the protecting group of the 5'-terminal hydroxyl group with an acid (e.g., trichloroacetic acid) in the presence of the aforementioned thiol, typically includes the following steps: (1) deprotecting the 5'-hydroxyl group of a nucleoside whose hydroxyl group is protected and which is bound to a solid phase support via a linker; (2) a step of coupling the 5'-hydroxyl group generated in the above step with a phosphoramidite compound to obtain a phosphite triester compound; (3) a step of oxidizing the phosphite triester produced in the previous step to convert it into a phosphate triester to produce an extended nucleic acid oligomer, or an optional step of converting it into a thiophosphate triester; (4) a step of synthesizing a nucleic acid oligomer on a solid support by repeating the above steps (1) to (3), i.e., a series of reaction cycles consisting of a step of deprotecting the hydroxyl group at the 5' position of the produced nucleic acid oligomer, a step of coupling the hydroxyl group at the 5' position with an amidite compound, and a step of oxidizing the produced phosphite triester, any number of times; and (5) A step of subjecting the nucleic acid oligomer on the solid support produced in step (4) to a step of excision and deprotection to release it from the solid support, thereby producing a nucleic acid oligomer from which the protecting groups have been removed. However, the method for synthesizing a nucleic acid oligomer may include, following step (2) or (3), a step of capping the 5'-hydroxyl group that did not undergo the coupling reaction with the phosphoramidite compound, and a capping step may be added between any of the steps in the series of reaction cycles that make up step (4).

[0040] More specifically, step (5) is carried out by subjecting the nucleic acid oligomer on the solid support produced in step (4) to the following reactions in steps (5-1) and (5-2) in that order, followed by the reaction in step (5-3). The reaction in step (5-1) may be carried out arbitrarily, and the reaction in step (5-2) may be carried out using the method described in Japanese Patent No. 4705716. As a result, a nucleic acid oligomer in which the protecting group has been removed from the nucleic acid oligomer released from the solid support, or a nucleic acid oligomer in which the 5'-terminal hydroxyl group has been protected, can be produced. (5-1) a reaction for deprotecting the protecting group of the hydroxyl group at the 5' end of a nucleic acid oligomer; (5-2) a reaction of cleaving and releasing the nucleic acid oligomer from the solid phase support; and (5-3) A reaction for deprotecting the protecting group of the hydroxyl group at the 2'-position or 3'-position of the 3'-end of the ribose constituting a nucleic acid oligomer.

[0041] The scheme of steps (1) to (5) is shown in Figure 1. The deprotection reaction in step (1) or step (4) shown in Figure 1 is carried out using the above-mentioned dichloroacetic acid and thiol compound. The definitions of the substituents in the chemical formula in Scheme A are as defined above.

[0042] The nucleic acid oligomer of formula (1) can be further extended to any desired chain length using a nucleotide or non-nucleotide linker by the amidite method and used to produce the nucleic acid oligomer of formula (3). The nucleic acid oligomer bound to the solid support of formula (3) can also be excised and further deprotected to obtain the nucleic acid oligomer of formula (5). The substituents in each formula are explained in more detail below.

[0043] B a and a nucleobase optionally protected by a protecting group represented by c The nucleic acid base represented by the formula (I) is not particularly limited. Examples of the nucleic acid base include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleic acid base may also be substituted with a substituent. Examples of such substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0044] B aThe protecting group for the nucleic acid base, which may be protected by a protecting group represented by the formula (I), is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include a benzoyl group, a 4-methoxybenzoyl group, a 4-methylbenzoyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a phenylacetyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, and a (dimethylamino)methylene group, as well as combinations of two or more of these protecting groups.

[0045] B a More specifically, [ka]

[0046] (In the above formula, R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group, R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group, R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, and R 9 represents a dimethylaminomethylene group. represents a group represented by any one of the following:

[0047] B c More specifically, the above B aSpecific examples include groups obtained by removing the protecting group from the above.

[0048] G in Figure 1 1 and G 5 (G as defined in formula (I) herein) 1 ) is preferably the following group: [ka] (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group.

[0049] R 1 , R 2 and R 3 Preferably, one of G is a hydrogen atom and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group. 5 is a 4,4'-dimethoxytrityl group (DMTr group).

[0050] G 2 There are no particular limitations on the protecting group G as long as it can function as a protecting group for a hydroxyl group, and a wide range of known protecting groups used in amidite compounds can be used. 2 Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0051] G 2is preferably an electron withdrawing group (E W Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and a cyano group is preferred.

[0052] G 2 Particularly preferred as are the following groups: [ka]

[0053] R 1 , R 2 , R 3 and G 2 The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, and a hexyl group. The alkyl group moiety constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group herein.

[0054] In the method of the present invention, the amidite compound can be used in its free state or in its salt form. Examples of salts of the amidite compound include, but are not limited to, base addition salts and acid addition salts. Specific examples of base addition salts include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of acid addition salts include salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The amidite compounds also include salts, hydrates, solvates, and crystalline polymorphs.

[0055] R preferably represents a protected hydroxyl group. When R represents a protected hydroxyl group, the protecting group of the hydroxyl group represented by V may be any that can be used in the amidite method, such as a 2'-tert-butyldimethylsilyl (TBS) group, a 2'-bis (2-acetoxyethoxy) methyl (ACE) group, a 2'- (triisopropylsilyloxy) methyl (TOM) group, a 2'- (2-cyanoethoxy) ethyl (CEE) group, a 2'- (2-cyanoethoxy) methyl (CEM) group (described in WO 2006 / 022323), a 2'-para-tolylsulfonylethoxymethyl (TEM) group, a 2'-EMM group (described in WO 2013 / 027843), and a 2'-PMM group (described in WO 2019 / 208571). V is preferably a 2'-tert-butyldimethylsilyl (TBS) group. When the nucleic acid molecule produced by the method of the present invention is a ribonucleic acid (RNA), for example, and contains ribose, the protecting group shown in formula (6) is a preferred example of a protecting group for the hydroxyl group at the 2' position of the ribose. More preferably, E WAn example of such a protecting group is a protecting group represented by formula (12) having a cyano group as the electron-withdrawing group.

[0056] Formula (6): [ka] (In the formula, q represents an integer of 0 to 5, R a and R b are each independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom; The * symbol indicates the point of attachment to the oxygen atom from the 2'-hydroxyl group of ribose, and E W represents an electron-withdrawing group. Equation (12): [ka] (In the formula, q, R a and R b has the same definition as in the above formula (6). More preferably, in the group represented by formula (12), q is 1 and R a and R b and q is 1 and R a Or R b and the other is a hydrogen atom.

[0057] The protecting group represented by formula (6) (including formula (12)) can be synthesized, for example, according to the description in WO 2013 / 027843 and WO 2019 / 208571, and an amidite compound having such a protecting group can be used for producing a nucleic acid compound. For the nucleic acid extension reaction, an amidite compound represented by formula (13) shown in Scheme A of FIG. 1 is used.

[0058] Examples of non-nucleotide linkers include linkers consisting of an amino acid backbone (for example, linkers consisting of an amino acid backbone described in WO 2006 / 022323 or WO 2013 / 027843). Specific, non-limiting examples include linkers represented by formula (A14-1), (A14-2), or (A14-3) (for example, as described in WO 2019 / 074110). In addition to these linkers, examples include linkers described in WO 2012 / 005368, WO 2018 / 182008, or WO 2019 / 074110. [ka] (In the formula, Y is as defined above.)

[0059] Nucleotides and amidites in which the R group in formula (13) and the R′ group in formula (5) are substituents other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, JP 2014-221817 A, and known methods cited therein, or can be produced using commercially available products in accordance with the methods described in the Examples below or by methods with appropriate modifications to these methods.

[0060] G 4represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of alkali metal ions include sodium ions and lithium ions. Specific examples of alkyl groups in alkylammonium ions include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl groups. More specific examples include diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Specific examples of hydroxyalkyl ammonium ions include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl. More specific examples of hydroxyalkylammonium ions include trishydroxymethylammonium ions. G 4 preferably represents a hydrogen atom.

[0061] G 5 represents a hydrogen atom or a protecting group for the hydroxyl group, and when representing a protecting group, 1 represents the same protecting group. 5 is a hydrogen atom when deprotected, and the nucleotide compound in this state is also subjected to a series of steps in a nucleic acid elongation reaction.

[0062] Y is preferably an oxygen atom.

[0063] W1 and X1 are preferably such that W1 represents an OZ group and X1 represents an R group.

[0064] W2 and X2 are preferably such that W2 represents a hydroxyl group and X2 represents an R group.

[0065] Preferably, W3 and X3 each independently represent a hydroxyl group.

[0066] R' is preferably a hydroxyl group.

[0067] In the synthesis of nucleic acid oligomers by the amidite method in steps (1) to (5) above, nucleic acid extension reactions can be carried out according to generally known methods (e.g., the methods described in the aforementioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881), except for the deprotection step related to the present invention in step (1) or step (5) in the scheme of Figure 1. Each step will be described below.

[0068] (Nucleic acid extension reaction) As used herein, the term "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially linked via phosphodiester bonds to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the general procedure of the phosphoramidite method. The nucleic acid extension reaction may also be carried out using an automatic nucleic acid synthesizer that employs the phosphoramidite method.

[0069] The chain length (N) of the nucleic acid molecule can be, for example, 20 mer or more (i.e., n≧19), 40 mer or more (i.e., n≧39), 50 mer or more (i.e., n≧49), 60 mer or more (i.e., n≧59), 80 mer or more (i.e., n≧79), 100 mer or more (i.e., n≧99), 200 mer or more (i.e., n≧199), 2 to 300 mers (i.e., 1≦n≦299), 2 to 250 mers (i.e., 1≦n≦249), 2 to 200 mers (i.e., 1≦n≦199), 10 ...10 to 300 mers (i.e., 1≦n≦299), 10 to 300 mers (i.e., 1≦n≦299), 10 to 300 mers (i.e., 1≦n≦299), 10 to 300 mers (i.e., 1≦n≦299), 10 to 300 It may be a 300-mer (i.e., 9≦n≦299), a 10-250-mer (i.e., 9≦n≦249), a 10-200-mer (i.e., 9≦n≦199), a 10-150-mer (i.e., 9≦n≦149), a 15-300-mer (i.e., 14≦n≦299), a 15-250-mer (i.e., 14≦n≦249), a 15-200-mer (i.e., 14≦n≦199), a 15-150-mer (i.e., 14≦n≦149), or a 15-110-mer (i.e., 14≦n≦109).

[0070] The deprotection step of step (1) is a step of deprotecting the protecting group of the 5'-hydroxyl group at the end of the oligonucleotide chain supported on the solid phase support. Common protecting groups include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0071] The condensation step of step (2) is a reaction in which a nucleoside phosphoramidite represented by the following formula (13) described in Scheme A of Figure 1 is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected in the deprotection step. Examples of phosphoramidites used for nucleic acid elongation include formula (13), the uridine EMM amidite described in Example 2 of WO 2013 / 027843, the cytidine EMM amidite described in Example 3, the adenosine EMM amidite described in Example 4, and the guanosine EMM amidite described in Example 5, and the uridine PMM amidite, cytidine PMM amidite, adenosine PMM amidite, and guanosine PMM amidite described in WO 2019 / 208571. Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-bis(2-acetoxyethoxy)methyl (ACE), 2'-(triisopropylsilyloxy)methyl (TOM), 2'-(2-cyanoethoxy)ethyl (CEE), 2'-(2-cyanoethoxy)methyl (CEM), 2'-para-tolylsulfonylethoxymethyl (TEM), 2'-H, and 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl. The nucleoside phosphoramidite used has its 5' hydroxyl protected with a protecting group (e.g., DMTr). The condensation step can be carried out using an activating agent or condensing agent that activates the nucleoside phosphoramidite. Examples of activating agents or condensing agents include 5-benzylthio-1H-tetrazole (BTT) (also referred to as 5-benzylmercapto-1H-tetrazole), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0072] The nucleoside phosphoramidite (hereinafter referred to as amidite) represented by formula (13) in Scheme A of FIG. 1 is as follows: formula: [ka] (In the formula, G 1 , G 2 , G 3 , B a and R is as defined above.

[0073] After the condensation step, any unreacted 5' hydroxyl groups may be capped, if desired, using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0074] The oxidation step (3) is a step of converting the phosphite group formed in the condensation step into a phosphate group or a thiophosphate group. This step is a reaction of converting trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting the oxidizing agent with an oligonucleic acid derivative supported on a solid phase carrier. When converting a phosphorous group to a phosphate group, for example, iodine can be used as an "oxidizing agent." The oxidizing agent can be prepared to a concentration of 0.005 to 2 M. Water can be used as the oxygen source for oxidation, and pyridine, N-methylimidazole (NMI), N-methylmorpholine, triethylamine, or the like can be used as a base to promote the reaction. The solvent is not particularly limited as long as it is not involved in the reaction, and examples include acetonitrile, tetrahydrofuran (THF), and mixed solvents of these in any ratio. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The appropriate reaction time is usually 1 to 30 minutes. The amount of reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, per 1 mol of the compound supported on the solid phase support.

[0075] When converting a phosphite triester group to a thiophosphate triester group, examples of the "oxidizing agent" that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.001 to 2 M before use. The solvent used in the reaction is not particularly limited as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, pyridine, and mixed solvents of these in any ratio. The oxidation step may be performed after the capping step, or conversely, the capping step may be performed after the oxidation step; the order is not limited.

[0076] In step (5-1), the protecting group for the 5'-hydroxyl group of the nucleotide introduced at the end of elongation may be used for column purification using the protecting group for the 5'-hydroxyl group as a tag after cleavage from the solid phase support and deprotection of the protecting group, as described below, or the protecting group for the 5'-hydroxyl group may be deprotected after column purification.

[0077] In step (5-2), after the synthesis of a nucleic acid having a desired sequence is completed, an amine compound is reacted with the nucleic acid to remove the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine, which is described in Japanese Patent No. 4705716.

[0078] In step (5-2), the nucleic acid molecule that has been elongated to a desired chain length on the solid phase carrier is usually excised from the solid phase carrier using concentrated aqueous ammonia as an excision agent.

[0079] Furthermore, the oligonucleotide chain is cleaved from the solid support and recovered using ammonia or an amine compound, etc. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0080] In step (5-3), the protecting group of the hydroxyl group at the 2' or 3' position of the ribose of the nucleic acid oligomer (4) cleaved from the solid support in step (5-2) can be removed according to the methods described in WO 2006 / 022323, WO 2013 / 027843, or WO 2019 / 208571, to obtain a deprotected nucleic acid molecule (5).

[0081] Nucleic acid oligomers (oligonucleotides) that can be produced using the production method of the present invention include, but are not limited to, nucleic acid molecules in which the nucleosides contained therein are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, or 2'-F, and LNA. Examples of various nucleosides include those described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. Preferably, the nucleic acid oligomer produced by the method of the present invention is ribonucleic acid (RNA). More preferably, the nucleic acid oligomer produced by the method of the present invention is ribonucleic acid (RNA), and the protecting group for the hydroxyl group at the 2'-position of the ribose is a protecting group represented by formula (6).

[0082] In one embodiment, the production method of the present invention can be used to produce an oligonucleotide having a reduced content of nucleotide deletions (also referred to as N-1mers). Here, the content of N-1mer in an oligonucleotide relative to the full length product (FLP (Full Length Product)) in the oligonucleotide, i.e., the content (%) of N-1mer when the content of full length product (FLP) in the oligonucleotide is taken as 100%, is defined as the "N-1mer content ratio." Specific examples of the N-1mer content ratio in the oligonucleotide include less than 5.8%, 5.7% or less, 5.5% or less, 5% or less, 4.5% or less, 4% or less, 3.5% or less, 3% or less, 2.5% or less, 2.3% or less, 2.3%, 2.1% or less, and 2.1%, as well as more than 0%, 0.001% or more, 0.01% or more, and 0.1% or more, but are not limited to these. Specific examples of oligonucleotides include, but are not limited to, the following: An oligonucleotide having an N-1 mer content ratio of less than 5.8%. An oligonucleotide having an N-1 mer content of 5.7% or less. An oligonucleotide having an N-1 mer content of 5.5% or less. An oligonucleotide having an N-1 mer content of 5% or less. An oligonucleotide having an N-1 mer content of 4.5% or less. An oligonucleotide having an N-1 mer content of 4% or less. An oligonucleotide having an N-1 mer content of 3.5% or less. An oligonucleotide having an N-1 mer content of 3% or less. An oligonucleotide having an N-1 mer content of 2.5% or less. An oligonucleotide having an N-1 mer content of 2.3% or less. An oligonucleotide having an N-1 mer content of 2.1% or less. An oligonucleotide having a chain length of 50 mer or more and a content ratio of N-1 mer in the oligonucleotide of less than 5.8%. An oligonucleotide having a chain length of 50 mer or more and an N-1 mer content ratio of 5.7% or less in the oligonucleotide. An oligonucleotide having a chain length of 50 mer or more and an N-1 mer content ratio of 5.5% or less in the oligonucleotide. An oligonucleotide having a chain length of 50 mer or more and a content ratio of N-1 mer in the oligonucleotide of 5% or less. An oligonucleotide having a chain length of 50 mer or more and an N-1 mer content ratio of 4.5% or less in the oligonucleotide. An oligonucleotide having a chain length of 50 mer or more and an N-1 mer content ratio of 4% or less in the oligonucleotide. An oligonucleotide having a chain length of 50 mer or more and an N-1 mer content ratio of 3.5% or less in the oligonucleotide. An oligonucleotide having a chain length of 50 mer or more and a content ratio of N-1 mer in the oligonucleotide of 3% or less. An oligonucleotide having a chain length of 50 mer or more and an N-1 mer content ratio in the oligonucleotide of 2.5% or less. An oligonucleotide having a chain length of 50 mer or more and an N-1 mer content ratio in the oligonucleotide of 2.3% or less. An oligonucleotide having a chain length of 50 mer or more and an N-1 mer content ratio in the oligonucleotide of 2.1% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of less than 5.8%. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5.7% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5.5% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 4.5% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 4% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 3.5% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 3% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.5% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.3% or less. An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.1% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of less than 5.8%. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5.7% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5.5% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 4.5% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 4% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 3.5% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 3% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.5% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.3% or less. An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.1% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of less than 5.8%. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5.7% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5.5% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 4.5% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 4% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 3.5% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 3% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.5% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.3% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.1% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of less than 5.8%. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5.7% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5.5% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 5% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 4.5% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 4% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 3.5% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 3% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.5% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.3% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1 mer content ratio in the oligonucleotide of 2.1% or less.

[0083] Typical examples of nucleic acid molecules that can be used in the production method of the present invention are shown below in addition to the examples described in the Examples, but are not limited to these. In the following explanation of the sequences, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine. Examples include nucleic acid molecules having the following sequences (A) and (B) described in International Publication No. 2019 / 060442. Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (based on ST.25 format) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (based on ST.26 format)) (Antisense) (SEQ ID NO: 1) 21mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (based on ST.25 format) (5'-GTmAACmCmAAGAGTmATmTmCmCmATmdTdT-3' (based on ST.26 format)) (Sense) (SEQ ID NO: 2) 21mer In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Cm represents 2'-O-methylcytidine, and dT represents thymidine. Unless otherwise specified, the abbreviations in the sequences herein apply to both the ST.25 format and the ST.26 format.

[0084] Examples include the nucleic acid molecule described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid molecule having the following sequence (C): Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (based on ST.25 format) (5'-AGAGCCAGCCTTCTTATTGTTTTAGAGCTATGCTGT-3' (based on ST.26 format)) (SEQ ID NO: 3) 36mer

[0085] An example is a nucleic acid molecule having the following sequence (D), which is described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (D): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (based on ST.25 format) (5'-ACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3' (based on ST.26 format)) (SEQ ID NO: 4) 67mer

[0086] An example is a nucleic acid molecule having the following sequence (E), which is described on page 173 of JP-A-2015-523856. Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (based on ST.25 format) (5'-GTTTTCCCTTTTCAAAGAAATCTCCTGGGCACCTATCTTCTTAGGTGCCCTCCCTTGTTTAAACCTGACCAGTTAACCGGCTGGTTAGGTTTT-3' (based on ST.26 format)) (SEQ ID NO: 5) 94mer

[0087] Examples include the nucleic acid molecules described in JP-A-2017-537626. Typical examples include nucleic acid molecules having the following sequences (F), (G), (H), and (J). Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (based on ST.25 format) (5'-AGTCCTCATCTCCCTCAAGCGTTTTAGAGCTAGTAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (based on ST.26 format)) (SEQ ID NO: 6) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-GCAGATGTAGTGTTTCCACAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 7) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 8) 113mer In sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (based on ST.25 format) (5'-AmsGmsTmsCCTCATCTCCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (based on ST.26 format)) (SEQ ID NO: 9) 113mer In sequence (J), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification. [Example]

[0088] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0089] Measurement method First, the various measurement methods used in the following tests are shown below.

[0090] (Measurement Method 1: Measurement of FLP Purity and N-1 Mer Content in Oligonucleotides) Oligonucleotide purity was measured using HPLC. FLP stands for Full Length Product. The HPLC measurement conditions are shown in Table 1 below. [Table 1]

[0091] The N-1 mer content refers to the N-1 mer content (area percentage) in the obtained oligonucleotide, determined by analyzing the obtained oligonucleotide using Measurement Method 1. The FLP purity refers to the FLP content (area percentage) in the obtained oligonucleotide, determined by analyzing the obtained oligonucleotide using Measurement Method 1.

[0092] (Measurement Method 2: Measurement of Oligonucleotide Yield) The OD of the crude product 260 The OD was measured. 260 represents the absorbance of UV260nm per 10mm path length in 1mL solution (pH=7.5). Generally, for RNA, 1OD is 260 = 40 μg, 260 The yield was calculated based on the measured values.

[0093] Solid-phase synthesis of oligonucleotides Sequence (I): 5'-Um ... (5'-TmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTm TmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTm-3' (according to ST.26 format)) (SEQ ID NO: 10) 50mer In sequence (I), Um represents 2'-O-methyluridine (ST.25 format), and Tm represents 2'-O-methyluridine (ST.26 format). Unless otherwise specified, abbreviations in sequences herein apply to both the ST.25 format and the ST.26 format.

[0094] The sequence (I) has the following structural formula (16): [ka]

[0095] The oligonucleotide (I) was synthesized from the 3' to 5' end by phosphoramidite solid-phase synthesis using Controlled Pore Glass (CPG) as the solid support and an NTS M-4MX-E (Nihon Techno Service Co., Ltd.) nucleic acid synthesizer. The synthesis was carried out on an approximately 1 μmol scale. The synthesis used 2'-OMe-U amidite represented by formula (18), a high-purity dichloroacetic acid toluene solution as the deblocking solution, a 5-benzylthio-1H-tetrazole solution as the condensing agent, an iodine solution as the oxidizing agent, and a phenoxyacetic anhydride solution and an N-methylimidazole solution as the capping solution.

[0096] Next, specific examples of oligonucleotides produced by the method of the present invention will be described. In the following examples, the oligonucleotides produced by the method of the present invention are oligonucleotides having the sequence (I) shown in SEQ ID NO: 10.

[0097] Furthermore, the CPG carrying a 2'-OMe-U derivative described in the following Examples and Comparative Examples refers to the compound represented by the following formula (17), where the circle shown in formula (17) is a schematic representation of the CPG. [ka]

[0098] Example 1 The oligonucleotide shown in sequence (I) was synthesized automatically from the 3' to the 5' end using a controlled pore glass (CPG) loaded with 1.01 μmol of 2'-OMe-U derivative and the 2'-OMe-U amidite shown in formula (18) on an NTS M-4MX-E (Nihon Techno Service Co., Ltd.). The automated synthesis procedure began with a deblocking solution (1-dodecanethiol:dichloroacetic acid:toluene = 0.5:3.0:96.5) being pumped through the CPG to deprotect the trityl protecting group at the 5' position. Next, the 2'-OMe-U amidite and 5-benzylmercapto-1H-tetrazole condensation agent were pumped through the CPG, allowing a coupling reaction to proceed with the hydroxyl group at the 5' position. An oxidation solution containing 50 mM iodine was then pumped through the CPG to convert the phosphite group to a phosphate group. Next, 0.1 M phenoxyacetic anhydride in acetonitrile and 10% N-methylimidazole / 10% 2,6-lutidine in acetonitrile were used as capping solutions to cap any reaction sites where coupling did not proceed. After repeating this process a total of 49 times, the protecting group (DMTr group) at the 5'-terminal base was deprotected with a deblocking solution (1-dodecanethiol / dichloroacetic acid / toluene = 0.5 / 3.0 / 96.5), and the oligonucleotide shown in sequence (I) was synthesized on the CPG support. Then, 750 μL of 28% aqueous ammonia and 250 μL of ethanol were added to the CPG support loaded with 1.01 μmol of oligonucleotide, and the mixture was incubated at 40 °C for 4 hours to release the oligonucleotide from the solid support. The solid support was then removed by filtration, and the aqueous ammonia and ethanol were removed by drying under reduced pressure, yielding the desired oligonucleotide as a dry solid. The oligonucleotide purity of the resulting product was measured using the method described in Measurement Method 1 above, and the N-1 mer content was 1.5% and the FLP purity was 71.3%. The yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and was found to be 12.6 mg, which corresponds to a yield of 12.5 mg per CPG carrying 1.00 μmol of 2'-OMe-U derivative. The results are shown in Table 2.

[0099] The 2'-OMe-U amidite represented by formula (18) has the following structure. [ka]

[0100] Example 2 The oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that the deblocking solution was cyclohexanethiol / dichloroacetic acid / toluene (0.5 / 3.0 / 96.5). The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the N-1 mer content was 1.6% and the FLP purity was 70.4%. The yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and the yield was 12.6 mg, which corresponds to 12.5 mg per CPG carrying 1.00 μmol of 2'-OMe-U derivative. The results are shown in Table 2.

[0101] Comparative Example 1 The oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.00 μmol of 2'-OMe-U derivative-loaded CPG and a deblocking solution of dichloroacetic acid / toluene (3.0 / 97.0) were used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the N-1mer content was 4.9% and the FLP purity was 62.8%. The yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and was found to be 12.2 mg. The results are shown in Table 2.

[0102] Comparative Example 2 The oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that a CPG loaded with 0.96 μmol of the 2'-OMe-U derivative and a deblocking solution consisting of triethylsilane, dichloroacetic acid, and toluene (3.0 / 3.0 / 94.0) were used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the N-1 mer content was 3.8% and the FLP purity was 65.7%. The yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and was found to be 11.7 mg, which corresponds to 12.2 mg per CPG loaded with 1.00 μmol of the 2'-OMe-U derivative. The results are shown in Table 2.

[0103] Comparative Example 3 The oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that a CPG loaded with 1.03 μmol of the 2'-OMe-U derivative and a deblocking solution consisting of methanol, dichloroacetic acid, and toluene (0.5:3.0:96.5) were used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the N-1 mer content was 9.6% and the FLP purity was 63.5%. The yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and was found to be 12.7 mg, which corresponds to 12.3 mg per CPG loaded with 1.00 μmol of the 2'-OMe-U derivative. The results are shown in Table 2.

[0104] Comparative Example 4 The oligonucleotide of sequence (I) was obtained by the same method as in Example 1, except that a CPG loaded with 1.04 μmol of 2'-OMe-U derivative and a deblocking solution of isopropyl alcohol / dichloroacetic acid / toluene (0.5 / 3.0 / 96.5) were used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the N-1 mer content was 12.5% ​​and the FLP purity was 59.2%. The yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and the yield was 12.4 mg, which corresponds to 11.9 mg per CPG loaded with 1.00 μmol of 2'-OMe-U derivative. The results are shown in Table 2.

[0105] The results of Examples 1 and 2 and Comparative Examples 1 to 4 are shown in Table 2. [Table 2]

[0106] In Table 2, N-1mer content refers to the content (area percentage) of N-1mer in the obtained oligonucleotide, determined by analyzing the obtained oligonucleotide using the above-mentioned Measurement Method 1. Furthermore, FLP purity refers to the content (area percentage) of FLP in the obtained oligonucleotide, determined by analyzing the obtained oligonucleotide using the above-mentioned Measurement Method 1. "N-1mer / FLP" refers to the content ratio of N-1mer when the content of FLP in the obtained oligonucleotide is taken as 100%, and is calculated by the following formula. "N-1mer / FLP" (%) = N-1mer content / FLP purity x 100 [Industrial Applicability]

[0107] The present invention provides an efficient deprotection reaction of a 5'-hydroxyl protecting group using a thiol compound as a cation scavenger, and is expected to improve the yield and purity of oligonucleotides produced by the oligonucleotide production method. [Sequence List Free Text]

[0108] SEQ ID NOs: 1 to 10 in the sequence listing represent the base sequences of oligonucleotides produced according to the method for producing oligonucleotides of the present invention.

Claims

1. A method for producing an oligonucleotide by solid phase synthesis, comprising: The method comprises the step of reacting an oligonucleotide, the hydroxyl group of which is protected with a protecting group removable under acidic conditions, with an acid in the presence of a thiol to remove the protecting group of the hydroxyl group at the 5'-terminus; The protecting group for the hydroxyl group at the 5'-end is represented by the following formula: 【Chemistry 1】 (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent hydrogen or an alkoxy group.) is a protecting group represented by the acid is dichloroacetic acid in the presence of an aprotic inert solvent having a boiling point lower than that of dichloroacetic acid, The method for producing an oligonucleotide, wherein the thiol is a C2-C20 alkylthiol or a C4-C8 cycloalkylthiol.

2. The method according to claim 1, wherein the thiol is 1-dodecanethiol or cyclohexanethiol.

3. The method according to claim 1, wherein the protecting group for the hydroxyl group at the 5'-end is a 4,4'-dimethoxytrityl group (DMTr group).

4. 2. The production method according to claim 1, wherein the aprotic inert solvent having a boiling point lower than that of dichloroacetic acid is at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and aromatic organic solvents.

5. The method according to claim 4, wherein the aromatic organic solvent is toluene.

6. An oligonucleotide having a hydroxyl group at the 5'-end protected with a protecting group removable under acidic conditions is represented by the formula (1'): 【Chemistry 2】 (In the formula, R 1 , R 2 and R 3 are as defined in claim 1 ; G2 represents a protecting group for a hydroxyl group; B ａ each independently represents the same or different nucleobase which may be protected with a protecting group; R's may be the same or different and each independently represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position of ribose, or an ethylidene group bonded to the carbon atom at 4' position of ribose; each Y is independently the same or different and represents an oxygen atom or a sulfur atom; n represents an integer of 1 to 300, W １ represents an OZ group, and X １ represents an R group, or W １ represents an OV group, and X １ represents an OZ group, When R represents a protected hydroxyl group, the protecting group and V are a 2'-tert-butyldimethylsilyl (TBS) group, a 2'-bis(2-acetoxyethoxy)methyl (ACE) group, a 2'-(triisopropylsilyloxy)methyl (TOM) group, a 2'-(2-cyanoethoxy)ethyl (CEE) group, or a group represented by formula (6): 【Transformation 3】 (In the formula, q represents an integer of 0 to 5, R a and R b are independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom; The * symbol indicates the point of attachment to the oxygen atom derived from the hydroxyl group at the 2' position of ribose, and E W represents an electron-withdrawing group. represents a protecting group represented by Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or more, the nucleic acid molecule represented by formula (1') may have a non-nucleotide linker incorporated between each nucleotide. is an oligonucleotide represented by The nucleotide from which the protecting group of the 5'-terminal hydroxyl group has been removed is represented by the formula (2): 【Chemistry 4】 (In the formula, G ２ , B ａ , R, Y, X １ , W １ and n is as defined above, and As defined in formula (1'), a non-nucleotide linker may be incorporated between the nucleotides. The method according to any one of claims 1 to 5, wherein the oligonucleotide is represented by the formula:

7. R １ and R ２ is a methoxy group, and R ３ The method according to claim 6 , wherein is a hydrogen atom.

8. The method according to claim 6, further comprising a step of removing a group represented by Z from the oligonucleotide represented by formula (2) produced in the step, and a step of removing protecting groups for hydroxyl groups and nucleic acid bases, to produce an oligonucleotide represented by formula (2'): 【Transformation 5】 (In the formula, Y and n are as defined above, B ｃ are each independently the same or different and represent a nucleobase; G ４ are each independently the same or different and represent a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, R' are each independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q′ is as defined above, and X ３ and W ３ each independently represents a hydroxyl group, or X ３ represents an R' group, and W ３ represents a hydroxyl group, and As defined in formula (1'), a non-nucleotide linker may be incorporated between the nucleotides. A method for producing an oligonucleotide represented by the formula:

9. The oligonucleotide is an oligonucleotide containing ribonucleic acid (RNA), and the protecting group for the hydroxyl group at the 2'-position of the ribose is a protecting group represented by formula (6). The method of claim 6. Formula (6): 【Transformation 6】 (In the formula, q represents an integer of 0 to 5, R ａ and R ｂ are each independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom; The * symbol indicates the point of attachment to the oxygen atom derived from the hydroxyl group at the 2' position of ribose, and E Ｗ represents an electron-withdrawing group.)

10. q is 0 or 1, and R ａ and R ｂ are each independently the same or different and are a methyl group or a hydrogen atom, and E ｗ The method according to claim 9 , wherein is a cyano group.

11. The method according to any one of claims 1 to 5, wherein the obtained oligonucleotide is an oligonucleotide of 100 mer or more.

12. The method according to any one of claims 1 to 5, wherein the molar ratio of the amount of the thiol used to the amount of the oligonucleotide in which the hydroxyl group at the 5'-end is protected with a protecting group removable under acidic conditions is 1 or more.

13. The method according to any one of claims 1 to 5, wherein the molar ratio of the amount of the thiol to the amount of the acid is 1 to 100.

Images