Scaevola plants with actinosymmetric flowers

Abstract

To provide Scaevola plants with radially symmetrical flowers.SOLUTION: The invention provides Scaevola plants that produce at least one flower with a floral phenotype characterized by at least one of: a fused or partially fused dorsal slit; a radially or near radially symmetrical arrangement of petals; and delayed senescence. The phenotype is a result of reduced or eliminated expression or activity of a CYCLOIDEA2 (CYC2) gene or protein, and / or the presence of a novel allele designated the FUSED allele. The invention further provides plant cells, plant parts, propagules, seeds and tissue cultures of such plants. The invention further provides methods for producing and selecting such plants, plant cells, plant parts, propagules, seeds and tissue cultures.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to horticulture, plant breeding and plant genetics. [Background technology]

[0002] The international ornamental plant market is large and diverse, and there is a constant need for new, innovative products and improvements to increase customer satisfaction and interest. One popular genera of plants sold in this market is Scaevola. Common names for Scaevola species include scaevola, fan flower, half flower, and naupaka (the Hawaiian name for the plant). For example, Scaevola aemula is an ornamental plant that can be used as a ground cover, bedding plant, potted plant, or hanging basket plant. While generally considered an annual, in mild climates it can be treated as a short-lived perennial. Scaevola aemula is commercially available in a limited range of flower colors, primarily blue shades, but also in white, pink, and pale yellow.

[0003] Plants of the genus Scaevola "have pentamerous, bilaterally symmetrical corollas with a dorsal slit opening to a fused petal-base tube between the two dorsal petals" (Gardner, AG, Fitz Gerald, JN, Menz, J., Shepherd, KA, Howarth, DG, and Jabaily, RS Characterizing Floral Symmetry in the Core Goodeniaceae with Geometric Morphometrics. PLoS ONE 11(5), 2016). The flowers are "completely dehiscent on the adaxial side, with all five petals facing ventrally, resembling a fan" (Berger, BA, Han, J., Sessa, EB, Gardner, AG, Shepherd, KA, Ricigliano, VA, Jabaily, RS, and Howarth, DG. The Unexpected Depths of Genome-Skimming Data: A Case Study Examining Goodeniaceae Floral Symmetry Genes, Applications in Plant Sciences, 5(10), 2017).

[0004] The presence of dorsal dehiscence is generally accepted as a key distinguishing feature for the genus Scaevola. For example, all Scaevola aemula cultivars in commercial production have bilaterally symmetrical corollas. The market is saturated with many breeders and similar products. The lack of diversity in flower morphology is one important factor limiting innovation in this ornamental plant category.

[0005] Therefore, it would be beneficial to provide Scaevola plants with distinctive flower morphology and methods for their production.

[0006] It is an object of the present invention to provide Scaevola plants and methods for their production that overcome one or more of the deficiencies of the prior art and / or at least provide the public with a useful choice. Summary of the Invention

[0007] The present invention provides Scaevola plants that produce flowers with actinosymmetric or near actinosymmetric petal arrangements. This unique floral phenotype is the result of partial to complete fusion of the dorsally dehiscent flower tube. In addition, these flowers also exhibit delayed senescence. After conducting a thorough prior art search, applicant is unaware of any other commercial cultivars or wild-type Scaevola plants that exhibit this phenotype.

[0008] Furthermore, the applicant has characterized the genetic determinants of a novel phenotype, which he has termed the FUSED allele. The applicant has elucidated the molecular basis of the FUSED allele, which is associated with disruption of the Scaevola CYCLOIDEA2 (CYC2) gene. Further aspects and embodiments of the present invention are based on this elucidation.

[0009] The present invention also provides plant parts and propagules (such as seeds) and methods for the production of such plants and seeds.

[0010] Plants with novel floral phenotypes In a first aspect, the present invention provides a method for producing a medicament for the treatment of a medicament comprising: a) fused or partially fused dorsal clefts; b) radially symmetrical or nearly radially symmetrical arrangement of petals, and c) delayed aging The present invention provides a Scaevola plant that produces at least one flower having a floral phenotype characterized by at least one of the following:

[0011] In one embodiment, the floral phenotype is: a) fused or partially fused dorsal clefts, and b) Radial or nearly radially symmetrical arrangement of petals It features both.

[0012] In another embodiment, the fused or partially fused dorsal dehiscence results in a radially symmetric or near radially symmetric arrangement of petals.

[0013] In one embodiment, the floral phenotype is: a) fused or partially fused dorsal clefts; b) radially symmetrical or nearly radially symmetrical arrangement of petals, and c) delayed aging It is characterized by all of the above.

[0014] In another embodiment, the flower phenotype does not exhibit an increased number of petals per flower.

[0015] In another embodiment, the floral phenotype does not exhibit an increased number of sepals per flower.

[0016] In another embodiment, the flower phenotype does not exhibit an increased number of stamens per flower.

[0017] In another embodiment, the floral phenotype does not exhibit an increased number of petals, sepals, or stamens per flower.

[0018] Reducing or eliminating CYC2 protein expression or activity In one embodiment, the plant has reduced or eliminated expression or activity of CYCLOIDEA2 (CYC2) protein.

[0019] In one embodiment, reducing or eliminating the expression or activity of a CYC2 protein results in a floral phenotype.

[0020] In one embodiment, the CYC2 protein has an amino acid sequence that comprises at least 70% identity to any one of SEQ ID NOs: 1, 2, and 3.

[0021] In one embodiment, the CYC2 protein has an amino acid sequence that comprises at least 70% identity to SEQ ID NO:1.

[0022] In another embodiment, the floral phenotype is obtained by reducing or eliminating the expression or activity of the CYCLOIDEA2 (CYC2) protein.

[0023] In one embodiment, the plant is genetically engineered to reduce or eliminate the expression or activity of CYC2 protein. A variety of genetic engineering techniques are known in the art, examples of which are described herein.

[0024] In one embodiment, the plant is genetically edited to reduce or eliminate the expression or activity of a CYC2 protein. A variety of gene editing techniques are known in the art, examples of which are described herein.

[0025] In a further embodiment, the plant comprises a mutation that results in the reduction or elimination of CYC2 protein expression or activity.

[0026] In one embodiment, the mutation is a naturally occurring mutation.

[0027] In one embodiment, the mutation is artificially induced.

[0028] In a further embodiment, the plant is not obtained exclusively by essentially biological processes.

[0029] A variety of techniques for introducing mutations are known in the art, examples of which are described herein.

[0030] Reducing or eliminating expression of the CYC2 gene In one embodiment, the plant has reduced or eliminated expression or activity of the CYCLOIDEA2 (CYC2) gene.

[0031] In one embodiment, reducing or eliminating the expression or activity of the CYC2 gene results in a floral phenotype.

[0032] In one embodiment, the CYC2 gene comprises a sequence having at least 70% identity to any one of SEQ ID NOs:4-6.

[0033] In one embodiment, the CYC2 gene comprises a coding sequence having at least 70% identity to SEQ ID NO:4.

[0034] In one embodiment, the CYC2 gene comprises a coding sequence having at least 70% identity to SEQ ID NO:5.

[0035] In one embodiment, the plant is genetically engineered to reduce or eliminate the expression or activity of the CYC2 gene.

[0036] In one embodiment, the plant has been genetically edited to reduce or eliminate the expression or activity of the CYC2 gene.

[0037] In one embodiment, the plant is transformed with a construct comprising a fragment of any one of SEQ ID NOs: 4-6, or the complement of the fragment.

[0038] Preferably, the construct is designed to target an endogenous sequence that corresponds to or includes any one of SEQ ID NOs: 4-6.

[0039] In one embodiment, the construct comprises a promoter operably linked to the fragment. Preferably, the promoter is heterologous to the fragment.

[0040] In one embodiment, the construct reduces or eliminates the expression or activity of a CYCLOIDEA2 (CYC2) protein or gene.

[0041] In one embodiment, the construct is an antisense construct.

[0042] In one embodiment, the construct is a hairpin construct.

[0043] In a further embodiment, the construct is a gene editing construct. In a further embodiment, the fragment encodes a guide RNA in the gene editing construct.

[0044] In a further embodiment, the plant comprises a mutation that results in the reduction or elimination of expression or activity of a CYC gene.

[0045] In one embodiment, the mutation creates a premature stop codon in the CYC2 gene.

[0046] In one embodiment, the mutation generates a new allele of the CYC2 gene.

[0047] In one embodiment, the allele is present in a heterozygous state.

[0048] In one embodiment, the allele is present in a homozygous state.

[0049] In one embodiment, when the allele is present in a heterozygous state, the plant will express the flower phenotype in the first few flowers that develop on the plant, with subsequent flowers having a normal (wild-type) appearance.

[0050] In another embodiment, when the allele is present in a heterozygous state, the plant expresses the floral phenotype in the first flower, preferably the first two flowers, preferably the first three flowers, preferably the first four flowers, preferably the first five flowers that develop on the plant, and subsequent flowers have a normal (wild-type) appearance.

[0051] In another embodiment, when the allele is present in a homozygous state, the plant expresses the floral phenotype in all or nearly all flowers produced.

[0052] In another embodiment, when the allele is present in a homozygous state, the plant expresses the floral phenotype in at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, more preferably 100% of the flowers produced.

[0053] FUSED allele In one embodiment, the plant comprises a FUSED allele.

[0054] In one embodiment, the floral phenotype results from the presence of a FUSED allele.

[0055] In one embodiment, the floral phenotype is produced by a plant that comprises a FUSED allele.

[0056] In one embodiment, when the allele is present in a heterozygous state, the plant will express the flower phenotype in the first few flowers that develop on the plant, with subsequent flowers having a normal (wild-type) appearance.

[0057] In one embodiment, "the first few flowers" refers to the first one, more preferably the first two, more preferably the first three, more preferably the first four, more preferably the first five, more preferably the first six, more preferably the first seven, more preferably the first eight, more preferably the first nine, more preferably the first ten flowers that appear on the plant.

[0058] In another embodiment, the "subsequent flowers" occur after the "first few flowers."

[0059] In another embodiment, when the allele is present in a homozygous state, the plant expresses the floral phenotype in all or nearly all flowers produced.

[0060] In another embodiment, when the allele is present in a homozygous state, the plant expresses the floral phenotype in at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, more preferably 100% of the flowers produced.

[0061] In one embodiment, the FUSED allele comprises a premature stop codon in the coding sequence of the CYC2 gene.

[0062] In one embodiment, the stop codon results in the elimination of production of the CYC2 protein from the FUSED allele.

[0063] In another embodiment, the stop codon results in the production of a truncated CYC2 protein from the FUSED allele.

[0064] In one embodiment, the truncated CYC2 protein has reduced activity compared to the full-length CYC2 protein.

[0065] In one embodiment, the truncated CYC2 protein is not active.

[0066] In one embodiment, the truncated CYC2 protein does not have the function of the full-length CYC2 protein.

[0067] In one embodiment, the truncated CYC2 protein is non-functional.

[0068] In another embodiment, the present invention provides a plant comprising at least one copy of the FUSED allele.

[0069] In one embodiment, the plant is heterozygous for the FUSED allele.

[0070] In another embodiment, the plant is homozygous for the FUSED allele.

[0071] In one embodiment, when the allele is present in a heterozygous state, the plant will express the flower phenotype in the first few flowers that develop on the plant, with subsequent flowers having a normal (wild-type) appearance.

[0072] In another embodiment, when the allele is present in a homozygous state, the plant expresses the floral phenotype in all or nearly all flowers produced.

[0073] In another embodiment, when the allele is present in a homozygous state, the plant expresses the floral phenotype in at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, more preferably 100% of the flowers produced.

[0074] In one embodiment, the FUSED allele comprises a sequence selected from any one of SEQ ID NOs: 7 and 8.

[0075] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:7.

[0076] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:8.

[0077] Plants produced from the deposited seeds In another embodiment, a plant of the present invention is produced from seeds deposited under Accession No. NCIMB43619.

[0078] In another embodiment, the present invention provides a plant produced from the seed deposited under Accession No. NCIMB43619.

[0079] Genetic determinants of deposited seeds In another embodiment, the floral phenotype of the plant of the present invention is due to genetic determinants present in the seed deposited under Accession No. NCIMB43619.

[0080] In one embodiment, the genetic determinant is the FUSED allele.

[0081] In one embodiment, the FUSED allele is: a) the presence of an adenine (A) at the position corresponding to nucleotide 39 of the sequence SEQ ID NO: 7; b) the presence of an adenine (A) at the position corresponding to nucleotide 39 of the sequence SEQ ID NO: 8; c) the presence of an adenine (A) at the position corresponding to nucleotide 99 of the sequence SEQ ID NO: 24 It is characterized by at least one of the following.

[0082] In a preferred embodiment, an adenine (A) is substituted for a cytosine (C) at the same position in the corresponding wild-type sequence.

[0083] In a preferred embodiment: a) SEQ ID NO: 4 is the wild-type sequence corresponding to SEQ ID NO: 7; b) SEQ ID NO: 5 is the wild-type sequence corresponding to SEQ ID NO: 8; c) SEQ ID NO: 23 is the wild-type sequence corresponding to SEQ ID NO: 24.

[0084] In one embodiment, the FUSED allele comprises a sequence selected from any one of SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:24.

[0085] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:7.

[0086] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:8.

[0087] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:24.

[0088] Plant parts and seeds In another embodiment, the present invention provides a plant cell, plant part, seed, cutting, cell culture, tissue culture, or callus of a plant of the present invention.

[0089] In one embodiment, the tissue, callus, or cell is produced from a plant part selected from the group consisting of pollen, ovule, embryo, protoplast, meristematic cell, callus, leaf, anther, cotyledon, hypocotyl, pistil, root, root tip, flower, seed, petiole, and stem.

[0090] In one embodiment, plant cells, plant parts, shoots, cuttings, cell or tissue cultures, or callus are capable of producing plants of the invention.

[0091] In one embodiment, the plant cell, plant part, seed, cutting, cell culture, tissue culture, or callus has reduced or eliminated expression or activity of a CYC2 protein.

[0092] In one embodiment, the plant cell, plant part, seed, cutting, cell culture, tissue culture, or callus has reduced or eliminated expression or activity of the CYC2 gene.

[0093] In one embodiment, the plant cell, plant part, seed, cutting, cell culture, tissue culture, or callus comprises a mutation that results in the reduction or elimination of expression or activity of the CYC2 gene.

[0094] In one embodiment, the plant cell, plant part, seed, cutting, cell culture, tissue culture, or callus comprises at least one copy of the FUSED allele.

[0095] In one embodiment, the present invention provides a Scaevola aemula plant, plant cell, plant part, seed, cutting, cell culture, tissue culture, or callus thereof, wherein the plant, plant cell, plant part, seed, cutting, cell culture, tissue culture, or callus comprises a FUSED allele.

[0096] In one embodiment, the FUSED allele is in the heterozygous state.

[0097] In another embodiment, the FUSED allele is in the homozygous state.

[0098] In one embodiment, the FUSED allele is: d) the presence of an adenine (A) at the position corresponding to nucleotide 39 of the sequence of SEQ ID NO: 7; e) the presence of an adenine (A) at the position corresponding to nucleotide 39 of the sequence SEQ ID NO: 8; f) the presence of an adenine (A) at the position corresponding to nucleotide 99 of the sequence SEQ ID NO: 24 It is characterized by at least one of the following.

[0099] In a preferred embodiment, an adenine (A) is substituted for a cytosine (C) at the same position in the corresponding wild-type sequence.

[0100] In a preferred embodiment: d) SEQ ID NO: 4 is the wild-type sequence corresponding to SEQ ID NO: 7; e) SEQ ID NO: 5 is the wild-type sequence corresponding to SEQ ID NO: 8; f) SEQ ID NO: 23 is the wild-type sequence corresponding to SEQ ID NO: 24.

[0101] In one embodiment, the FUSED allele comprises a sequence selected from any one of SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:24.

[0102] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:7.

[0103] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:8.

[0104] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:24.

[0105] seed In one embodiment, the seed is a seed.

[0106] In another embodiment, the present invention provides seeds capable of developing plants of the present invention.

[0107] In one embodiment, the seed is produced by a plant developing from the seed deposited under Accession No. NCIMB43619.

[0108] In another embodiment, the present invention provides a method for producing a composition comprising: a) fused or partially fused dorsal clefts; b) radially symmetrical or nearly radially symmetrical arrangement of petals, and c) delayed aging and providing a Scaevola plant comprising at least one recessive mutant allele that produces at least one flower having a floral phenotype characterized by at least one of: Here, a representative seed sample of a Scaevola plant containing the mutant allele that produces the flower has been deposited under accession number: NCIMB43619.

[0109] In one embodiment, the floral phenotype is conferred by the presence of a mutant allele.

[0110] In another embodiment, the mutant allele is a FUSED allele as described herein.

[0111] In another embodiment, the present invention provides a method for producing a composition comprising: a) fused or partially fused dorsal clefts; b) radially symmetrical or nearly radially symmetrical arrangement of petals, and c) delayed aging and providing a Scaevola plant that produces at least one flower having a floral phenotype characterized by at least one of: Here, the Scaevola plant is obtained by introgression of a floral phenotype from a plant grown from seed deposited at NCIMB under accession number NCIMB43619.

[0112] In one embodiment, the plant has been selected for a floral phenotype.

[0113] In another embodiment, the floral phenotype is conferred by the presence of a recessive mutant allele.

[0114] In another embodiment, the mutant allele is a FUSED allele as described herein.

[0115] In one embodiment, the FUSED allele is: g) the presence of an adenine (A) at the position corresponding to nucleotide 39 of sequence SEQ ID NO: 7; h) the presence of an adenine (A) at the position corresponding to nucleotide 39 of sequence SEQ ID NO: 8; i) the presence of an adenine (A) at the position corresponding to nucleotide 99 of the sequence SEQ ID NO: 24 It is characterized by at least one of the following.

[0116] In a preferred embodiment, an adenine (A) is substituted for a cytosine (C) at the same position in the corresponding wild-type sequence.

[0117] In a preferred embodiment: g) SEQ ID NO: 4 is the wild-type sequence corresponding to SEQ ID NO: 7; h) SEQ ID NO: 5 is the wild-type sequence corresponding to SEQ ID NO: 8; i) SEQ ID NO: 23 is the wild-type sequence corresponding to SEQ ID NO: 24.

[0118] In one embodiment, the FUSED allele comprises a sequence selected from any one of SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:24.

[0119] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:7.

[0120] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:8.

[0121] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:24.

[0122] Methods for producing Scaevola plants with novel floral phenotypes In another aspect, the present invention provides a method of producing a Scaevola plant of the present invention comprising at least one flower having a floral phenotype.

[0123] Reducing or eliminating CYC2 protein expression or activity In one embodiment, the method comprises reducing or eliminating the expression or activity of a CYC2 protein in a plant.

[0124] In another embodiment, reducing or eliminating the expression or activity of a CYC2 protein results in a floral phenotype.

[0125] In one embodiment, the method comprises genetically engineering the plant to reduce or eliminate the expression or activity of a CYC2 protein.

[0126] In one embodiment, the method includes genetically editing the plant to reduce or eliminate expression or activity of a CYC2 protein.

[0127] In another embodiment, the method comprises inducing a mutation in a plant to reduce or eliminate the expression or activity of a CYC2 protein.

[0128] Reducing or eliminating CYC2 gene expression or activity In one embodiment, the method comprises reducing or eliminating the expression or activity of the CYC2 gene.

[0129] In one embodiment, the CYC2 gene comprises a sequence having at least 70% identity to any one of SEQ ID NOs:4-6.

[0130] In one embodiment, the CYC2 gene comprises a coding sequence having at least 70% identity to SEQ ID NO:4.

[0131] In one embodiment, the CYC2 gene comprises a coding sequence having at least 70% identity to SEQ ID NO:5.

[0132] In another embodiment, reducing or eliminating the expression or activity of the CYC2 gene results in a floral phenotype.

[0133] In one embodiment, the method comprises genetically engineering the plant to reduce or eliminate the expression or activity of the CYC2 gene.

[0134] In one embodiment, the method includes genetically editing the plant to reduce or eliminate the expression or activity of the CYC2 gene.

[0135] In one embodiment, the method comprises transforming a plant with a construct comprising a fragment of any one of SEQ ID NOs: 4-6, or the complement of the fragment.

[0136] Preferably, the construct is designed to target an endogenous sequence that corresponds to or includes any one of SEQ ID NOs: 4-6.

[0137] In one embodiment, the construct comprises a promoter operably linked to the fragment. Preferably, the promoter is heterologous to the fragment.

[0138] In one embodiment, transformation of the plant with the construct results in the reduction or elimination of expression or activity of a CYCLOIDEA2 (CYC2) protein or gene.

[0139] In one embodiment, the construct is an antisense construct.

[0140] In one embodiment, the construct is a hairpin construct.

[0141] In another embodiment, the construct is a gene editing construct. In another embodiment, the fragment encodes a guide RNA in the gene editing construct.

[0142] In another embodiment, the method comprises inducing a mutation in a plant to reduce or eliminate the expression or activity of a CYC gene.

[0143] In one embodiment, the mutation creates a premature stop codon in the CYC2 gene.

[0144] In one embodiment, the mutation generates a new allele of the CYC2 gene.

[0145] In one embodiment, the allele is present in a heterozygous state.

[0146] In another embodiment, the allele is present in a homozygous state.

[0147] In one embodiment, when the allele is present in a heterozygous state, the plant will express the flower phenotype in the first few flowers that develop on the plant, with subsequent flowers having a normal (wild-type) appearance.

[0148] In another embodiment, when the allele is present in a homozygous state, the plant expresses the floral phenotype in all or nearly all flowers produced.

[0149] In one embodiment, "substantially all" means at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, more preferably 100% of the flowers produced.

[0150] Thus, in one embodiment, when the allele is present in a homozygous state, the plant expresses the floral phenotype in at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, more preferably 100% of the flowers produced.

[0151] Crossing to produce plants of the present invention In one embodiment, the method comprises crossing a plant of the invention with another plant to produce a Scaevola plant comprising at least one flower having a floral phenotype.

[0152] In one embodiment, other plants may also be plants of the present invention.

[0153] In another embodiment, the following: a) reducing or eliminating CYC2 protein expression or activity; b) reducing or eliminating CYC2 gene expression or activity; c) the presence of a mutation that disrupts CYC2 gene expression, and d) Presence of FUSED allele testing the progeny of the cross for at least one of Here, any one of a) to d) indicates that the plant produces at least one flower having a floral phenotype.

[0154] Self-pollination of the plants of the present invention In one embodiment, the method comprises the step of self-pollinating a plant of the invention.

[0155] In another embodiment, the method comprises the steps of: a) reducing or eliminating CYC2 protein expression or activity; b) reducing or eliminating CYC2 gene expression or activity; c) the presence of a mutation that disrupts CYC2 gene expression, and d) Presence of FUSED allele testing the progeny of the self-pollination for at least one of Here, any one of a) to d) indicates that the plant produces at least one flower having a floral phenotype.

[0156] Introduction of the FUSED allele In one embodiment, the method comprises introducing a FUSED allele into a plant to produce a Scaevola plant of the invention comprising at least one flower having a floral phenotype.

[0157] In one embodiment, the method comprises crossing a first plant comprising a FUSED allele with a second plant to produce a plant of the invention comprising a FUSED allele.

[0158] In one embodiment, the first plant is heterozygous for the FUSED allele.

[0159] In another embodiment, the first plant is homozygous for the FUSED allele.

[0160] In one embodiment, the second plant does not comprise a FUSED allele.

[0161] In another embodiment, the second plant is heterozygous for the FUSED allele.

[0162] In another embodiment, the second plant is homozygous for the FUSED allele.

[0163] In another embodiment, the plant of the invention resulting from the cross is heterozygous for the FUSED allele.

[0164] In another embodiment, the plants of the invention resulting from the cross are homozygous for the FUSED allele.

[0165] In another embodiment, the method comprises detecting the presence of a FUSED allele in a plant of the invention obtained from the cross.

[0166] In one embodiment, the method comprises detecting the presence of a FUSED allele in a heterozygous state.

[0167] In one embodiment, the method comprises detecting the presence of the FUSED allele in the homozygous state.

[0168] In one embodiment, the FUSED allele is detected by a polymerase chain reaction (PCR) based method.

[0169] In another embodiment, FUSED alleles are detected using the Cleaved Amplified Polymorphic Sequences (CAPS) molecular marker system.

[0170] Vegetative propagation In another embodiment, plants are produced by vegetative propagation of Scaevola plants of the present invention.

[0171] In one embodiment, a method for vegetative propagation comprises the steps of: (a) collecting tissue capable of being propagated from a Scaevola plant of the present invention; (b) cultivating the tissue to obtain a propagated shoot; and (c) rooting the propagated shoot to obtain a rooted plantlet.

[0172] In another embodiment, the present invention provides a method for producing a Scaevola plant, wherein the plant contains a FUSED allele and produces at least one flower having a floral phenotype characterized by a radial arrangement of petals, the method comprising: a) genetically engineering a plant to produce a FUSED allele in the plant; b) gene editing the plant to produce a FUSED allele in the plant; c) inducing a mutation in the plant that generates a FUSED allele; d) crossing a plant of the invention with another plant; e) self-pollinating the plant of the invention; and f) Introducing the FUSED allele into a plant Contains at least one of the following:

[0173] In one embodiment, the method includes testing the produced plants for the presence of the FUSED allele.

[0174] Plants produced by the methods of the present invention In another embodiment, the present invention provides a plant produced by the method of the present invention.

[0175] How to produce seeds In another aspect, the present invention provides a method of producing Scaevola seeds, the method comprising the steps of cultivating a Scaevola plant of the present invention and collecting the resulting seeds.

[0176] In another aspect, the present invention provides a method of producing Scaevola seeds, the method comprising the steps of crossing a Scaevola plant of the present invention with another Scaevola plant and collecting the resulting seeds.

[0177] In another aspect, the present invention provides a method of producing Scaevola seeds, the method comprising self-pollinating a Scaevola plant of the present invention and collecting the resulting seeds.

[0178] In one embodiment, a plant of the invention comprises a FUSED allele.

[0179] In another embodiment, the seeds produced comprise a FUSED allele.

[0180] Marker-assisted selection In another aspect, the present invention provides a method for identifying a Scaevola plant having a genotype exhibiting a floral phenotype of the present invention, the method comprising: a) reducing or eliminating CYC2 protein expression or activity; b) reducing or eliminating CYC2 gene expression or activity; c) the presence of a mutation that disrupts CYC2 gene expression; d) the presence of a FUSED allele, and e) The presence of a marker related to any of a) to d). testing the plant for at least one of Here, any one of a) to e) indicates that the plant produces at least one flower having a floral phenotype.

[0181] In the Scaevola genus of plants: a) reducing or eliminating CYC2 protein expression or activity; b) reducing or eliminating CYC2 gene expression or activity; c) the presence of a mutation that disrupts CYC2 gene expression; d) the presence of a FUSED allele, and e) The presence of a marker related to any of a) to d). A method for detecting at least one of the following:

[0182] In one embodiment, the detection of any one of a) to e) indicates that the plant produces at least one flower having a floral phenotype of the present invention.

[0183] Marker In another aspect, the present invention provides markers associated with the floral phenotypes of the present invention.

[0184] In another embodiment, markers can be used to detect FUSED alleles of the present invention.

[0185] In another embodiment, the marker can be used to distinguish between plants that contain the FUSED allele and those that do not.

[0186] In another embodiment, the marker is: a) a fragment of the sequence of SEQ ID NO: 7 or 8 containing an adenine (A) at the position corresponding to nucleotide 39 of SEQ ID NO: 7 or 8; b) the complement of the fragment of a); c) a fragment of the sequence of SEQ ID NO: 24 containing an adenine (A) at the position corresponding to nucleotide position 99 of SEQ ID NO: 24; d) The complement of the fragment in c) Contains at least one of the following:

[0187] In another aspect, the present invention provides markers associated with the FUSED alleles of the present invention.

[0188] Preferably, the marker is in linkage disequilibrium (LD) with the FUSED allele with a D' value of at least 0.1, more preferably at least 0.2, more preferably at least 0.3, more preferably at least 0.4, more preferably at least 0.5.

[0189] Preferably, the marker has an R of at least 0.05, more preferably at least 0.075, more preferably at least 0.1, more preferably at least 0.2, more preferably at least 0.3, more preferably at least 0.4, more preferably at least 0.5. 2 value, and is in LD with the FUSED allele.

[0190] Cultivation from seeds to plants Another embodiment relates to planting and cultivating seeds of the invention to produce plants of the invention.

[0191] In one embodiment, the plant produced comprises at least one copy of the FUSED allele.

[0192] In another embodiment, the plant is heterozygous for the FUSED allele.

[0193] In another embodiment, the plant is homozygous for the FUSED allele.

[0194] In another embodiment, the present invention provides a plant produced by the method of the present invention.

[0195] Detailed Description of the Invention In their breeding programs, applicants have produced novel Scaevola plants that produce flowers with a novel floral phenotype. This phenotype is characterized by a radially symmetrical or near-radially symmetrical arrangement of petals. While not wishing to be bound by theory, applicants believe that this petal arrangement is due to fusion or partial fusion of the floral tubes of these flowers. In addition, applicants have surprisingly discovered that flowers with the described floral phenotype also exhibit delayed senescence compared to wild-type flowers.

[0196] Applicants have shown that the novel phenotype is controlled by a mutant recessive allele, termed the FUSED allele. Applicants have further elucidated the molecular basis of the FUSED allele. Specifically, Applicants have shown that the FUSED allele is characterized by a premature stop codon in the coding sequence of the CYCLOIDEA2 (CYC2) gene. One skilled in the art would expect that other deletions or disruptions in the CYCLOIDEA2 gene / protein in Scaevola would result in the same phenotypic expression of rayed floral symmetry. Various aspects and embodiments of the present invention are based on this elucidation.

[0197] flower tube The floral tube of Scaevola flowers extends from above the ovary to the base of the corolla and in all species of Scaevola it has dorsal dehiscence.

[0198] dorsal cleavage As used herein, the term "dorsal dehiscence" refers to the opening in the floral tube of a Scaevola flower between the dorsal petals that extends from the edge of the corolla towards the ovary.

[0199] Fused dorsal cleavage According to the present invention, when the dorsal dehiscences of Scaevola flowers are fused or partially fused, this results in a floral phenotype of the present invention characterized by actinosymmetry or partial actinosymmetry, respectively.

[0200] In a preferred embodiment, the dorsal clefts are fused.

[0201] In a preferred embodiment, the floral phenotype of the present invention is characterized by radial symmetry.

[0202] radial symmetry Actinoid flowers, or flowers with radial symmetry, have multiple lines of symmetry.

[0203] In one embodiment, actinomorphism, as used herein, refers to the phenotypic arrangement of petals of Scaevola flowers resulting from the reduction or elimination of expression or activity of the CYCLOIDEA2 (CYC2) gene or protein.

[0204] In one embodiment, radial symmetry, as used herein, is the phenotypic arrangement of petals of Scaevola flowers resulting from the presence of a FUSED allele.

[0205] Partial fusion of dorsal clefts and partial radial symmetry In one embodiment, when the FUSED allele is homozygous, the flower phenotype is characterized by a completely fused dorsal dehiscence. Preferably, when the FUSED allele is homozygous, nearly all flowers exhibit this phenotype. Preferably, when the FUSED allele is homozygous, all flowers exhibit this phenotype.

[0206] In one embodiment, when the FUSED allele is homozygous, the flower phenotype is characterized by complete radial symmetry. Preferably, when the FUSED allele is homozygous, almost all flowers exhibit this phenotype. Preferably, when the FUSED allele is homozygous, all flowers exhibit this phenotype.

[0207] In some embodiments, when the FUSED allele is heterozygous, the flower phenotype is characterized by partially fused dorsal dehiscence. In one embodiment, when the FUSED allele is heterozygous, one or more flowers exhibit this phenotype. In one embodiment, when the FUSED allele is heterozygous, the first few flowers exhibit fully fused dorsal dehiscence, and subsequent flowers exhibit partially fused dorsal dehiscence.

[0208] In one embodiment, when the FUSED allele is heterozygous, the flower phenotype is characterized by partial actinosymmetric. In one embodiment, when the FUSED allele is heterozygous, one or more flowers exhibit this phenotype. In one embodiment, when the FUSED allele is heterozygous, the first few flowers exhibit complete actinosymmetric, and subsequent flowers exhibit partial actinosymmetric.

[0209] Delayed aging Applicant has demonstrated that actinomorphic flowers of the present invention have delayed senescence compared to normal Scaevola aemula flowers. Normal Scaevola aemula flowers senesce within 24 hours of cross-pollination. Applicant has demonstrated that the flowers of the present invention persist for a substantially longer period before senescence, which he claims is due to the structure of the actinomorphic flower. Specifically, Applicant claims that the unique corolla structure limits pollinator access to the stigma and pollen, thereby reducing the chance of cross-pollination and thereby extending the shelf life of the product. This unexpected advantage is commercially desirable.

[0210] In one embodiment, senescence of a flower having a floral phenotype of the present invention is delayed by at least 3 hours, preferably at least 6 hours, more preferably at least 12 hours, more preferably at least 18 hours, more preferably at least 24 hours, more preferably at least 36 hours, more preferably at least 48 hours, more preferably at least 60 hours, more preferably at least 72 hours, more preferably at least 84 hours, more preferably at least 96 hours, more preferably at least 108 hours, 120 hours compared to that of a control plant.

[0211] CYCLOIDEA (CYC) The term CYCLOIDEA and the abbreviation CYC refer to members of the transcription factor gene family, which belong to the TCP family and play a specific role in specifying dorsal identity in the corolla and stamens of bilaterian flowers (Han, J., 2018. PhD Thesis: Duplications and expression of CYCLOIDEA-like genes in Goodeniaceae, St. John's University, New York; Fambrini, M, Salvini, M, Basile, A, and Pugliesi, C. 2014. Transposon-dependent induction of Vincent van Gogh's sunflowers: Exceptions revealed, Genesis 52:315-327).

[0212] CYCLOIDEA2 (CYC2) protein In one embodiment, the CYCLOIDEA2 (CYC2) protein of the present invention has a sequence selected from any one of SEQ ID NOs: 1, 2 and 3 or variants thereof.

[0213] Preferably, the CYCLOIDEA2 (CYC2) protein of the present invention has a sequence that comprises at least 70% identity to any one of SEQ ID NOs: 1, 2 and 3.

[0214] In one embodiment, the CYCLOIDEA2 (CYC2) protein of the present invention has the sequence of SEQ ID NO: 1, or a variant thereof.

[0215] Preferably, the CYCLOIDEA2 (CYC2) protein of the present invention has a sequence that contains at least 70% identity to the protein of SEQ ID NO:1.

[0216] In one embodiment, the CYC2 protein contains all of motifs 1 to 14 as described in Chen, J., Shen, C, Guo, Y and Rao, G 2018, Patterning the Asteraceae capitulum: Duplications and differential expression of the flower symmetry CYC2-like genes. Frontiers in Plant Science, April 25, Volume 9, Article 551.

[0217] In one embodiment, the CYC2 protein contains all of motifs 1, 2, and 4 as described in Chen, et al. 2018. These motifs are present in all CYC2-like proteins from the Asterales order, as described by the authors.

[0218] Applicants identified motifs in the Scaevola sequence that correspond to motifs 1, 3, and 4, as described in Chen, et al., 2018.

[0219] These motifs are summarized in a sequence overview and displayed in Figure 14 .

[0220] In one embodiment, the CYC2 protein comprises motif 1 having a sequence selected from any one of SEQ ID NOs: 9-14.

[0221] In one embodiment, the CYC2 protein comprises motif 1 having the sequence of SEQ ID NO:9.

[0222] In one embodiment, the CYC2 protein comprises motif 1 having the sequence of SEQ ID NO:10.

[0223] In one embodiment, the CYC2 protein comprises motif 1 having the sequence of SEQ ID NO:11.

[0224] In one embodiment, the CYC2 protein comprises motif 1 having the sequence of SEQ ID NO:12.

[0225] In one embodiment, the CYC2 protein comprises motif 1 having the sequence of SEQ ID NO:13.

[0226] In one embodiment, the CYC2 protein comprises motif 1 having the sequence of SEQ ID NO:14.

[0227] In one embodiment, the CYC2 protein comprises motif 2 having a sequence selected from any one of SEQ ID NOs: 15-19.

[0228] In one embodiment, the CYC2 protein comprises motif 2 having the sequence of SEQ ID NO:15.

[0229] In one embodiment, the CYC2 protein comprises motif 2 having the sequence of SEQ ID NO:16.

[0230] In one embodiment, the CYC2 protein comprises motif 2 having the sequence of SEQ ID NO:17.

[0231] In one embodiment, the CYC2 protein comprises motif 2 having the sequence of SEQ ID NO:18.

[0232] In one embodiment, the CYC2 protein comprises motif 2 having the sequence of SEQ ID NO:19.

[0233] In one embodiment, the CYC2 protein comprises motif 4 having a sequence selected from any one of SEQ ID NOs: 20-22.

[0234] In one embodiment, the CYC2 protein comprises motif 4 having the sequence of SEQ ID NO:20.

[0235] In one embodiment, the CYC2 protein comprises motif 4 having the sequence of SEQ ID NO:21.

[0236] In one embodiment, the CYC2 protein comprises motif 4 having the sequence of SEQ ID NO:22.

[0237] In a further embodiment, the CYC2 protein comprises motif 1, motif 2 and motif 4 selected from those described above.

[0238] In one embodiment, the CYCLOIDEA2 (CYC2) protein of the present invention has a sequence selected from any one of SEQ ID NOs: 1, 2 and 3.

[0239] In one embodiment, the CYCLOIDEA2 (CYC2) protein of the present invention has the sequence of SEQ ID NO:1.

[0240] CYCLOIDEA2 (CYC2) DNA In one embodiment, the CYCLOIDEA2 (CYC2) gene of the present invention has a sequence selected from any one of SEQ ID NOs: 4, 5 and 6 or variants thereof.

[0241] Preferably, the CYCLOIDEA2 (CYC2) gene of the present invention has a sequence that comprises at least 70% identity to a sequence selected from any one of SEQ ID NOs: 4, 5 and 6.

[0242] In one embodiment, the CYCLOIDEA2 (CYC2) gene of the present invention has the sequence of SEQ ID NO: 4, or a variant thereof.

[0243] Preferably, the CYCLOIDEA2 (CYC2) gene of the present invention has a sequence that contains at least 70% identity to the sequence of SEQ ID NO:4.

[0244] In one embodiment, the CYCLOIDEA2 (CYC2) gene of the present invention has the sequence of SEQ ID NO: 5, or a variant thereof.

[0245] Preferably, the CYCLOIDEA2 (CYC2) gene of the present invention has a sequence that contains at least 70% identity to the sequence of SEQ ID NO:5.

[0246] In one embodiment, the CYCLOIDEA2 (CYC2) gene of the present invention has the sequence of SEQ ID NO: 6, or a variant thereof.

[0247] Preferably, the CYCLOIDEA2 (CYC2) gene of the present invention has a sequence that contains at least 70% identity to the sequence of SEQ ID NO:6.

[0248] In one embodiment, the CYCLOIDEA2 (CYC2) gene of the present invention has the sequence of SEQ ID NO:4.

[0249] In one embodiment, the CYCLOIDEA2 (CYC2) gene of the present invention has the sequence of SEQ ID NO:5.

[0250] In one embodiment, the CYCLOIDEA2 (CYC2) gene of the present invention has the sequence of SEQ ID NO:5.

[0251] FUSED allele In one embodiment, the FUSED allele is characterized by a mutation in the coding sequence of the CYC2 gene.

[0252] In another embodiment, the stop codon results in the production of a truncated CYC2 protein.

[0253] In another embodiment, the stop codon eliminates production of the CYC2 protein.

[0254] In another embodiment, the stop codon eliminates activity of the CYC2 protein.

[0255] In another embodiment, a premature stop codon is generated by a cytosine (C) to adenine (A) substitution at a position corresponding to nucleotide position 39 of SEQ ID NO:4.

[0256] In another embodiment, the stop codon is a thymidine, adenine, adenine (TAA) stop codon at positions corresponding to nucleotide positions 37, 38, and 39, respectively, in SEQ ID NO:4, where the second adenine (A) is generated by a cytosine (C) to adenine (A) substitution at the position corresponding to nucleotide position 39 in SEQ ID NO:4.

[0257] In another embodiment, the FUSED allele is characterized by the presence of an adenine (A) at a position corresponding to nucleotide position 39 of SEQ ID NO:4.

[0258] In another embodiment, the sequence of the FUSED allele is as displayed in FIG.

[0259] In one embodiment, the FUSED allele comprises a sequence selected from SEQ ID NOs: 7, 8 and 24.

[0260] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:7.

[0261] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:8.

[0262] In one embodiment, the FUSED allele comprises the sequence of SEQ ID NO:24.

[0263] Methods for identifying alleles Methods for detecting the presence of polymorphisms and mutations are well known to those skilled in the art, including DNA sequencing, polymerase chain reaction (PCR)-based methods, allele-specific PCR, hybridization-based methods, hybridization using oligonucleotide probes, restriction fragment length polymorphism, and oligonucleotide ligation assays (Ibrahim, A, Bakir, M, Khan, H and Shobrak, M. 2010, A Brief Review of Molecular Techniques to Assess Plant Diversity, International Journal of Molecular Sciences 11(5): 2079-2096).

[0264] CAPS method Cleaved Amplified Polymorphic Sequences (CAPS) polymorphisms are restriction fragment length differences resulting from mutations that create or eliminate restriction endonuclease recognition sites in PCR amplicons generated by locus-specific oligonucleotide primers.

[0265] According to the present invention, the CAPS molecular marker system can be used to distinguish plants heterozygous or homozygous for the FUSED allele from plants that do not contain the allele (Agarwal, M, Shrivastava, N and Padh, H. 2008. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Reports 27: 617-631).

[0266] Marker-assisted selection Marker-assisted selection (MAS) is an approach often used to identify plants with a particular trait using one or more genetic markers associated with that trait. MAS is thought to enable breeders to identify and select plants at the seedling stage, and is particularly useful for traits that are difficult to measure at the seedling stage. The best markers for MAS are the causative mutations, but if these are not available, markers that are in strong linkage disequilibrium with the causative mutations can also be used. Such information is useful in commercial breeding programs because it can be used to accelerate genetic gain or reduce the cost of trait measurement.

[0267] Marker-assisted selection methods are well known to those skilled in the art, for example, (Collard, BCY and DJ Mackill, 2008. Marker-assisted selection: an approach for precision plant breeding in the 21st century. Philosophical Transactions of the Royal Society B-Biological Sciences. 363(1491): p. 557-572.).

[0268] Marker Markers used in the methods of the invention may include nucleic acid markers, such as single nucleotide polymorphisms (SNPs), simple sequence repeats (SSRs or microsatellites), insertions, substitutions, indels and deletions. Preferably, the markers are in linkage disequilibrium (LD) with the floral phenotype.

[0269] Preferably, the marker is in LD with the floral phenotype with a D' value of at least 0.1, more preferably at least 0.2, more preferably at least 0.3, more preferably at least 0.4, more preferably at least 0.5.

[0270] Preferably, the marker has an R of at least 0.05, more preferably at least 0.075, more preferably at least 0.1, more preferably at least 0.2, more preferably at least 0.3, more preferably at least 0.4, more preferably at least 0.5. 2 value, and is in LD with the floral phenotype.

[0271] As used herein, the term "linkage disequilibrium" or LD refers to a derived statistical measure of the strength of association or co-occurrence of two independent genetic markers. Various statistical methods can be used to summarize linkage disequilibrium (LD) between two markers, but in practice, D' and R 2 Only two, called

[0272] Markers associated with a trait can be of any type, including but not limited to SNPs, substitutions, insertions, deletions, indels or simple sequence repeats (SSRs).

[0273] Scaevola The Scaevola genus of plants belongs to the Goodeniaceae family, which has 12 recognized genera and approximately 420 species (Carolin RC, Rajput MTM, Morrison P. Goodeniaceae. In: George AS, editor, Flora of Australia Volume 35. Canberra: Australian Government Publishing Service; 1992. pp. 4-300). Scaevola is one of 12 genera, with approximately 100 species currently listed in the genus.

[0274] In one embodiment, the Scaevola plant is selected from any one of the following species: Scaevola acacioides, Scaevola aemula, Scaevola albida, Scaevola amblyanthera, Scaevola anchusifolia, Scaevola angulata, Scaevola angustata, Scaevola archeriana, Scaevola argentea, Scaevola auriculata, Scaevola balansae, Scaevola balansae, Scaevola ballajupensis, Scaevola basedowii, Scaevola beckii, Scaevola brookeana, Scaevola browniana, Scaevola bursariifolia, Scaevola calendulacea, Scaevola calliptera, Scaevola canescens, Scaevola chamissoniana, Scaevola chanii, Scaevola chrysopogon chrysopogon, Scaevola coccinea, Scaevola collaris, Scaevola collina, Scaevola coriacea, Scaevola crassifolia, Scaevola cuneiformiscuneiformis, Scaevola cunninghamii, Scaevola cylindrica, Scaevola densifolia, Scaevola enantophylla, Scaevola eneabba, Scaevola floribunda, Scaevola gaudichaudiana, Scaevola gaudichaudii, Scaevola glabra, Scaevola glabrata, Scaevola glandulifera glandulifera, Scaevola globosa, Scaevola globulifera, Scaevola glutinosa, Scaevola gracilis, Scaevola graminea, Scaevola hainanensis, Scaevola hamiltonii, Scaevola hobdyi, Scaevola hookeri, Scaevola humifusa, Scaevola humilis, Scaevola calophila kallophylla, Scaevola kilaueae, Scaevola laciniata, Scaevola lanceolata, Scaevola linearis, Scaevola macrophylla, Scaevola macrostachiamacrostachya, Scaevola microphylla, Scaevola micrantha, Scaevola mollis, Scaevola montana, Scaevola muluensis, Scaevola myrtifolia, Scaevola nitida, Scaevola nubigena, Scaevola obovata, Scaevola oldfieldii, Scaevola oppositifolia, Scaevola ovalifolia, Scaevola oxyclona, ​​Scaevola paludosa, Scaevola parvibarbata, Scaevola parviflora, Scaevola parvifolia, Scaevola phlebopetala, Scaevola pilosa, Scaevola platyphylla, Scaevola plumieri, Scaevola porocarya, Scaevola procera, Scaevola pulchella pulchella, Scaevola pulvinaris, Scaevola ramosissima, Scaevola repens, Scaevola restiacea, Scaevola revoluta, Scaevola sericophyllasericophylla, Scaevola socotraensis, Scaevola spicigera, Scaevola spinescens, Scaevola striata, Scaevola subcapitata, Scaevola taccada, Scaevola tahitensis, Scaevola tenuifolia, Scaevola thesioides, Scaevola tomentosa, Scaevola tortuosa, Scaevola verticillata In another embodiment, the Scaevola plant is of the species Scaevola aemula. In another embodiment, the Scaevola plant is a hybrid of any of the above-listed species.

[0275] Cultivation of Scaevola and plant tissue culture Methods for Scaevola aemula pollination and seed germination are known in the art (Sweeney, K 1999. Application of in vitro breeding techniques for the improvement of the Australian native fan flower, Scaevola. Masters' thesis, University of Melbourne; Howell, GJ 1995. Reproductive biology and horticultural development of Scaevola. PhD thesis University of Melbourne; Luo, S, 2005. Genetic variation and interspecific hybridization in the genus Scaevola. PhD thesis, University of Sydney, p69 and p72). Scaevola aemula plants are easily cultivated (Scaevola. Hamrick, D (Ed), 2003 Ball Red Book, Volume 2, Ball Publishing) and amenable to tissue culture (Wong, CE and Bhalla, PL 2010. Chapter 22, "In vitro propagation of the Australian native ornamental plant Scaevola," in: Jain SM and Ochatt, SJ Protocols for in vitro propagation of ornamental plants, Methods in Molecular Biology vol. 589), and methods for their cultivation, maintenance, propagation, and production are known in the literature and the state of the art. Such information is readily available on breeder websites (e.g., www.suntoryflowers.com, www.danzigeronline.com, www.syngentaflowers.eu).

[0276] Control plants Those skilled in the art will know what constitutes a suitable control plant. A suitable control plant is one of the same species or variety as the "test" Scaevola plant. Suitable control plants include Scaevola plants of the same age or developmental stage as the test plant. Suitable plants may be selected from wild-type plants, plants that have not been genetically modified according to the present invention, plants that have not been gene-edited according to the present invention, plants transformed with a control construct, plants transformed with an empty vector construct, plants that have not been mutated according to the present invention, and plants that do not contain a FUSED allele.

[0277] Mutants As used herein, the term "variant" refers to a polynucleotide or polypeptide sequence that differs from a specifically identified sequence, in which one or more nucleotides or amino acid residues are deleted, substituted, or added. Variants may be naturally occurring allelic variants or non-naturally occurring variants. Variants may be from the same or other species and may include homologs, paralogs, and orthologs. In certain embodiments, polypeptides and polypeptide variants of the invention have the same or similar biological activity as the polypeptides or polypeptides of the invention. With respect to polypeptides and polypeptides, the term "variant" encompasses all forms of polypeptides and polypeptides as defined herein.

[0278] Protein variants - percent identity With respect to polypeptides, the term "variant" encompasses naturally occurring polypeptides, recombinantly and synthetically produced polypeptides. Variant polypeptide sequences preferably have a similarity to a sequence of the invention that is at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more preferably at least and most preferably at least 99% identity. The identity is found over a comparison window of at least 20 amino acid positions, preferably at least 50 amino acid positions, more preferably at least 100 amino acid positions, and most preferably over the entire length of the polypeptide of the invention.

[0279] Polypeptide sequence identity can be determined as follows: Compare the subject polypeptide sequence to the candidate polypeptide sequence using BLASTP (from the BLAST suite of programs, version 2.2.5 [Nov 2002]) in bl2seq, publicly available from the NCBI website at World Wide Web: ftp: / / ftp.ncbi.nih.gov / blast / . Use the default parameters of bl2seq, except that filtering of low complexity regions should be turned off.

[0280] Polypeptide sequence identity can also be calculated over the entire length of overlap between candidate and subject polynucleotide sequences using a global sequence alignment program. As discussed above, EMBOSS-Needle (available at http: / / www.ebi.ac.uk / emboss / align / ) and GAP (Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235.) are also suitable global sequence alignment programs for calculating polypeptide sequence identity.

[0281] A preferred method for calculating percent polypeptide sequence identity is based on the alignment of the sequences being compared using Clustal X (Jeanmougin et al., 1998, Trends Biochem. Sci. 23, 403-5.).

[0282] DNA variants - percent identity With respect to polynucleotides, the term "variant" encompasses naturally occurring polynucleotides, recombinantly and synthetically produced polynucleotides. Variant polynucleotide sequences preferably resemble at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more preferably at least 74%, more preferably at least 75%, more preferably at least 76%, more preferably at least 77%, more preferably at least 78%, more preferably at least 79%, more preferably at least 80%, more preferably at least 81%, more preferably at least 82%, more preferably at least 83%, more preferably at least 84%, more preferably at least 85%, more preferably at least 86%, more preferably at least 87%, more preferably at least 88%, more preferably at least 89%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 100%, more preferably at least 101%, more preferably at least 102%, more preferably at least 103%, more preferably at least 104%, more preferably at least 105%, more preferably at least 106%, more preferably at least 107%, more preferably at It exhibits at least 74%, more preferably at least 75%, more preferably at least 76%, more preferably at least 77%, more preferably at least 78%, more preferably at least 79%, more preferably at least 80%, more preferably at least 81%, more preferably at least 82%, more preferably at least 83%, more preferably at least 84%, more preferably at least 85%, more preferably at least 86%, more preferably at least 87%, more preferably at least 88%, more preferably at least 89%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity.Identity is found over a comparison window of at least 20 nucleotide positions, preferably at least 50 nucleotide positions, more preferably at least 100 nucleotide positions, and most preferably over the entire length of the polynucleotide of the invention.

[0283] Polynucleotide sequence identity can be determined as follows: A subject polynucleotide sequence is compared to a candidate polynucleotide sequence using BLASTN (BLAST program suite, version 2.2.5 [Nov 2002]) in bl2seq, publicly available from the NCBI website at World Wide Web: ftp: / / ftp.ncbi.nih.gov / blast / (Tatusova, T. and Madden, T. 1999. Blast 2 sequences, a new tool for comparing protein and nucleotide sequences, Federation of European Microbiological Societies, Microbiological Letters 174(2):247-250). Default parameters can be used.

[0284] Polynucleotide sequence identity can also be calculated over the entire length of overlap between candidate and subject polynucleotide sequences using a global sequence alignment program (e.g., Needleman, S. and Wunsch, C. 1970. A general method applicable to the search for similarities in the amino acid sequence of two proteins. Journal of Molecular Biology 48(3), 443-453). A complete implementation of the Needleman-Wunsch global alignment algorithm is found in the Needle program in the EMBOSS package (Rice, P. Longden, I. and Bleasby, A. 2000. EMBOSS: The European Molecular Biology Open Software Suite, Trends in Genetics, 16(6): 276-277), which is available on the World Wide Web at: http: / / www.hgmp.mrc.ac.uk / Software / EMBOSS / . The European Bioinformatics Institute server also provides the means to perform an online EMBOSS-Needle global alignment between two sequences at http: / www.ebi.ac.uk / emboss / align / .

[0285] Alternatively, the GAP program, which calculates the optimal global alignment of two sequences without terminal gap penalties, can be used. GAP is described in the following paper: Huang, X., 1994. On Global Sequence Alignment. Bioinformatics 10(3): 227-235.

[0286] A preferred method for calculating percent polynucleotide sequence identity is based on alignment of the sequences to be compared using Clustal X (Jeanmougin, F, Thompson, J, Gouy, M, Higgins, D and Gibson, T. 1998. Multiple sequence alignment with Clustal X. Trends in Biochemical Sciences 23(10): 403-405.).

[0287] Polynucleotide Variants - Hybridization Alternatively, a variant polynucleotide of the invention, or for use in the methods of the invention, hybridizes under stringent conditions to a designated polynucleotide sequence, or its complement.

[0288] The term "hybridize under stringent conditions," and its grammatical equivalents, refers to the ability of a polynucleotide molecule to hybridize to a target polynucleotide molecule (e.g., a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern or Northern blot) under defined conditions of temperature and salt concentration. The ability to hybridize under stringent hybridization conditions can be determined by initially hybridizing under less stringent conditions and then increasing the stringency to the desired stringency.

[0289] For polynucleotide molecules greater than about 100 bases in length, typical stringent hybridization conditions are only 25-30°C (e.g., 10°C) lower than the melting temperature (Tm) of the native double helix (for general information, see Sambrook, J. 1989. Molecular Cloning: A Laboratory Manual. 2nd Edition, Cold Spring Harbor Laboratory Press; Ausubel, F, Brent, R, Kingston, R, Moore, D, Seidman, J, Smith, J, Struhl, K (Eds). 1987. Current Protocols in Molecular Biology, Greene Publishing). The Tm of a polynucleotide molecule longer than about 100 bases can be calculated by the formula: Tm = 81.5 + 0.41% (G + C - log(Na + )) (Sambrook 1989; Bolton, E and McCarthy, B, 1962. A general method for the isolation of RNA complementary to DNA. Proceedings of the National Academy of Science, USA 48(8):1390-1397). Typical stringent conditions for polynucleotides longer than about 100 bases are, for example, prewashing with a solution of 6x SSC, 0.2% SDS; hybridization overnight at 65°C, 6x SSC, 0.2% SDS; followed by two washes at 65°C, 1x SSC, 0.1% SDS for 30 minutes each; and two washes at 65°C, 0.2x SSC, 0.1% SDS for 30 minutes each.

[0290] definition In the following description and tables, a number of terms are used. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided:

[0291] Accession. As used herein, accession is a term used to describe a non-commercialized, proprietary, individual, unique plant genotype (variety).

[0292] Radial symmetry. As used herein, radial symmetry is a term used to describe a radially symmetric flower that has multiple planes of symmetry.

[0293] Allele. As used herein, the term allele means any of one or more alternative forms of a gene.

[0294] Asexual propagation / asexual reproduction. As used herein, the terms asexual propagation or asexual reproduction refer to any type of plant propagation other than sexual seed. Examples of asexual propagation include, but are not limited to, scioning, grafting, division, apomixis, or tissue culture regeneration.

[0295] Backcrossing. As used herein, backcrossing is the process by which a breeder repeatedly crosses hybrid progeny back to one of the parents, e.g., a first-generation hybrid F1 that has one of the parent genotypes of the F1 hybrid.

[0296] Cell. As used herein, cell includes plant cells, whether isolated, in tissue culture, or incorporated into a plant or plant part.

[0297] As used herein, the term crossing refers to the pollination of the female flowers of a plant, which may result in the production of seeds from the flowers.

[0298] Cross-pollination. As used herein, the term cross-pollination means fertilization by the union of two gametes from different plants.

[0299] Scion. As used herein, the term scion means an original part of a plant, such as a stem, leaf, or root, that is removed from the plant for the purpose of propagating a new plant, such as by rooting or grafting.

[0300] Dominant Inheritance. As used herein, the term dominant inheritance refers to an inheritance pattern in which the phenotype of a particular characteristic or trait is determined by a dominant allele.

[0301] F2. As used herein, the designation "F2" refers to progeny resulting from self-pollination or sib-mating of members of the first generation, i.e., the F1 generation.

[0302] Gamete. As used herein, the term gamete means a cell or nucleus capable of participating in reproductive fusion to form a zygote.

[0303] Gene. As used herein, a gene refers to a segment of endogenous genomic DNA, including regulatory elements such as promoters and terminators.

[0304] Genetic transformation. As used herein, genetic transformation refers to the process of incorporating polynucleotides into plants to create genetically modified organisms.

[0305] Genetically Modified Organism (GMO). As used herein, a GMO is an organism that has been genetically modified through genetic transformation.

[0306] Heterozygous. As used herein, heterozygous refers to a genetic constitution in which corresponding alleles at a particular genetic locus differ.

[0307] Homozygous. As used herein, homozygous refers to a genetic constitution in which corresponding alleles at particular genetic loci are identical.

[0308] Inbreeding. As used herein, the term inbreeding refers to the production of offspring by the fusion of gametes that are genetically closely related.

[0309] Inflorescence. As used herein, the term inflorescence refers to a flower.

[0310] Locus. As used herein, the term locus is the location or position of a gene on a chromosome.

[0311] Molecular Marker. As used herein, the term molecular marker refers to DNA sequences and / or segments that are closely associated with genetic loci and / or morphological or other characteristics of a plant, allowing such segments to be detected and visualized by molecular techniques.

[0312] Monogenic inheritance. As used herein, the term monogenic inheritance refers to an inheritance pattern in which the phenotype of a particular characteristic or trait is determined by a single gene.

[0313] Mutant allele. As used herein, the term mutant allele refers to an allele that arises by the action of a mutation.

[0314] Mutation. As used herein, a mutation is a change in the DNA sequence of a cell's genome, resulting from mutagens such as radiation or chemicals, as well as naturally occurring errors during DNA replication.

[0315] Normal Flowers. As used herein, the terms "normal," "typical," "standard," "regular," "hand-shaped," "fan-shaped," "wild-type," and "conventional" flowers are used interchangeably and refer to wild-type Scaevola plants and commercially available cultivars, all of which have dorsal dehiscence.

[0316] Outbreeding. Also known as outcrossing, and described herein as the production of offspring by the fusion of distantly related gametes. Outbreeding is the opposite of inbreeding.

[0317] Peloric Plants. As used herein, the term peloric plants refers to rare plants with radial floral symmetry that usually occur in species with bilateral symmetry.

[0318] Phenotype. The term phenotype refers to all observable characteristics and traits of a plant, such as flower color, flower morphology, plant size, etc.

[0319] Plant. As used herein, the term plant includes reference to the entire plant, immature or mature, including plants from which the seeds or anthers have been removed. The seed or embryo from which the plant is produced is also considered a plant.

[0320] Plant Cell. As used herein, plant cell includes plant cells whether isolated, in tissue culture, or incorporated into a plant or plant part.

[0321] Plant hormone composition. As used herein, plant hormone composition refers to chemicals that regulate plant growth. For example, indole-3-butyric acid, N 6 -benzyladenine, and gibberellic acid.

[0322] Plant Part. As used herein, the term "plant part" includes protoplasts, leaves, stems, roots, root tips, anthers, pistils, seeds, embryos, pollen, ovules, cotyledons, hypocotyls, shoots, tissues, petioles, cells, and meristematic cells, etc.

[0323] Pollination. As used herein, the term pollination is the process by which pollen is transferred into a plant, thereby allowing fertilization and sexual reproduction.

[0324] Polynucleotide. As used herein, the term "polynucleotide" means a single- or double-stranded deoxyribonucleotide or ribonucleotide polymer of any length, but preferably at least 15 nucleotides, including, by non-limiting example, coding and non-coding sequences of genes, sense and antisense sequence complements, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polypeptides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers, and fragments.

[0325] Polynucleotide Fragment. A "fragment" of a polynucleotide sequence described herein is a subsequence of contiguous nucleotides.

[0326] Preferably, the fragment is at least 5, more preferably at least 6, more preferably at least 7, more preferably at least 8, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, more preferably at least 15, more preferably at least 16, more preferably at least 17, more preferably at least 18, more preferably at least 19, more preferably at least 20, more preferably at least 21, more preferably at least 22, more preferably at least 23, more preferably at least 24, more preferably at least 25, more preferably at least 26, more preferably at least 27, more preferably at least 28, more preferably at least 29, more preferably at least 30, more preferably at least 35, more preferably at least 40, more preferably at least 45, more preferably at least 50 nucleotides in length.

[0327] Probe. The term "probe" refers to a short polynucleotide used to detect a polynucleotide sequence complementary to the probe in a hybridization-based assay. A probe may consist of a "fragment" of a polynucleotide as defined herein. A probe may further comprise a label for detection of the probe. Suitable labels are well known to those of skill in the art.

[0328] Primer. The term "primer" refers to a short polynucleotide, typically having a free 3' OH group, that is hybridized to a template and used to prime the polymerization of a polynucleotide complementary to a target. A primer may consist of a "fragment" of a polynucleotide as defined herein. A primer may further include a label for detection of the primer. Suitable labels are well known to those skilled in the art.

[0329] Progeny. As used herein, progeny includes an F1 Scaevola plant produced from the cross of two Scaevola aemula plants. Progeny further includes, but is not limited to, subsequent F2, F3, F4, F5, F6, F7, F8, F9, F10, F11, F12, F13, F14, F15, F16, F17, F18, F19, F20, F21, F22, F23, F24, F25, F26, F27, F28, F29, F30, F31, F32, F33, F34, F35, F36, F37, F38, F39, F40, F41, F42, F43, F44, F45, F46, F47, F48, F49, F50, F51, F52, F53, F54, F55 6、 F 7、 F 8、 This includes cross-generational breeding such as F9.

[0330] Recessive Inheritance. As used herein, recessive inheritance refers to an inheritance pattern in which the phenotype of a particular characteristic or trait is determined by a recessive allele.

[0331] Recessive mutation. As used herein, the phenotype of a recessive mutation can only be seen in the homozygous genotype.

[0332] Self-pollination. As used herein, the term self-pollination refers to the method of collecting pollen from a plant and applying the pollen to the stigma of the same plant.

[0333] Sexual propagation / sexual reproduction. As used herein, the term sexual propagation / sexual reproduction refers to the propagation of plants from seed.

[0334] Somatic Cell. As used herein, the term somatic cell is any cell of a plant other than a spore, gamete, or their precursors.

[0335] Stop codons. There are three stop codons in the genetic code - TAG, TAA, and TGA. The corresponding codons in mRNA are UAG, UAA, and UGA. These codons signal the end of a polypeptide chain during translation. These codons are also known as nonsense codons or termination codons because they do not code for amino acids. In one embodiment, the stop codon of the present invention is TAA, which can be used interchangeably with the RNA stop codon UAA.

[0336] TCP domain. As used herein, the term TCP domain refers to a relatively conserved DNA sequence encoding transcription factors (activation and regression) involved in multiple developmental processes in plants, primarily related to cell development and growth, namely TEOSINTE BRANCHED 1 (Zea mays), CYCLOIDEA (Antirrhinum majus), and PROLIFERATING CELL FACTOR 1 AND 2 (Oryza sativa) proteins (TCP). (Danisman, S, 2016. TCP transcription factors at the interface between environmental challenges and the plants growth responses. Frontiers in Plant Sciences, Vol. 7, pp. 1-13; Fambrini, M, Salvini, M, and Pugliesi, C. 2014. Transposon-dependent induction of Vincent van Gogh's sunflowers: Exceptions revealed, Genesis 52:315-327).

[0337] Variety. As used herein, the term variety, as used by those skilled in the art of plant breeding, means a plant classification within a single plant taxon of the lowest known order that can be defined by the expression of characteristics resulting from a given genotype or combination of genotypes, which is distinguished from any other plant classification by the expression of at least one of said characteristics and is considered a unit with respect to its suitability to be invariably propagated (as defined below: International convention for the protection of new varieties of plants, Chapter 1, Article 1 (vi) https: / / www.upov.int / upovlex / en / conventions / 1991 / act1991.html#_1). Plant varieties are commercialized and not proprietary (the term "accession" is used to refer to non-commercialized varieties).

[0338] Bilateral symmetry. As used herein, the term bilateral symmetry means a bilaterally symmetrical flower with a single plane of symmetry.

[0339] General molecular biology and plant molecular biology methods Methods for isolating or producing polynucleotides The polynucleotides of the present invention can be isolated using a variety of techniques well known to those skilled in the art. By way of example, such polypeptides can be isolated using the polymerase chain reaction (PCR) as described in Mullis, K, Francois, F and Gibbs, R (Eds). 1994. The Polymerase Chain Reaction, Birkhauser (incorporated herein by reference). The polypeptides of the present invention can be amplified using primers derived from the polynucleotide sequences of the present invention, as described herein.

[0340] Further methods for isolating polynucleotides of the present invention include using all or part of a polypeptide having a sequence described herein as a hybridization probe. This technique, in which a labeled polynucleotide probe is hybridized to a polynucleotide immobilized on a solid support such as a nitrocellulose filter or nylon membrane, can be used to screen genomic or cDNA libraries. Exemplary hybridization and washing conditions are as follows: hybridization in 5.0x SSC, 0.5% sodium dodecyl sulfate, 1x Denhardt's solution at 65°C for 20 hours; washing in 1.0x SSC, 1% (w / w) sodium dodecyl sulfate (three washes of 20 minutes each at 55°C), and optionally, one wash (20 minutes) in 0.5x SSC, 1% (w / w) sodium dodecyl sulfate at 60°C. An optional additional wash (20 minutes) can be performed in 0.1x SSC, 1% (w / w) sodium dodecyl sulfate at 60°C.

[0341] Polynucleotide fragments of the present invention can also be generated by techniques known in the art, such as restriction endonuclease digestion, oligonucleotide synthesis, and PCR amplification.

[0342] Partial polynucleotide sequences can be used by methods known in the art to identify the corresponding full-length polynucleotide sequence. These methods include PCR-based methods, 5'RACE (Frohman MA, 1995, Rapid amplification of complementary DNA ends for generation of full-length complementary DNAs: Thermal RACE. In: Recombinant DNA Methodology - Selected Methods in Enzymology p655-671, Academic Press), hybridization-based methods, and computer / database-based methods. Furthermore, by way of example, inverse PCR allows for the acquisition of unknown sequences flanking the polynucleotide sequences disclosed herein and initiated with primers based on known regions (Triglia et al., 1998, A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences, Nucleic Acids Research 16(16), 8186, incorporated herein by reference). This method uses several restriction enzymes to generate suitable fragments within the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template. Branched primers are designed from the known region. Standard molecular biology approaches can be used to physically assemble full-length clones (Sambrook et al., 1989).

[0343] Methods for identifying mutants physical method Variant polypeptides can be identified using PCR-based methods (Mullis et al., 1994). Typically, the polynucleotide sequences of primers useful for amplifying variants of the polynucleotide molecules of the invention by PCR can be based on sequences encoding conserved regions of the corresponding amino acid sequences.

[0344] Alternatively, library screening methods well known to those skilled in the art may be used (Sambrook et al., 1989). When identifying variants of the probe sequence, hybridization and / or washing stringency will typically be reduced compared to when searching for an exact sequence match.

[0345] Polypeptide variants can also be identified by physical methods, such as screening expression libraries with antibodies raised against the polypeptides of the invention (Sambrook et al., 1989), or by using such antibodies to distinguish the polypeptide from natural sources.

[0346] Computer-Based Methods Variant sequences of the present invention, including both polynucleotide and polypeptide variants, can also be identified by computer-based methods well known to those skilled in the art using public domain sequence alignment algorithms and sequence similarity search tools for searching sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR, etc.). See, for example, the following for online resources: Baxevanis, A. 2001. The molecular biology database collection: an updated compilation of biological database resources. Nucleic Acids Research 29(1): 1-10; Wheeler, D., Church, D., Lash, A., Leipe, D., Madden, T. 2001. Database resources of the National Centre for Biotechnology Information. Nucleic Acids Research 29(1): 11-16. Similarity searches involve retrieving and aligning target sequences for comparison with the sequence to be analyzed (i.e., the query sequence). Sequence comparison algorithms use a scoring matrix to assign an overall score to each alignment.

[0347] An exemplary group of programs useful for identifying variants in sequence databases is the BLAST suite of programs (version 2.2.5 [Nov 2002]), including BLASTN, BLASTP, BLASTX, tBLASTN, and tBLASTX, which are publicly available from (ftp: / / ftp.ncbi.nih.gov / blast / ) or from the National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894 USA. NCBI also provides means to use the programs to screen other publicly available sequence databases. BLASTN compares a nucleotide query sequence to a nucleotide sequence database. BLASTP compares an amino acid query sequence to a protein sequence database. BLASTX compares a nucleotide query sequence translated in all reading frames to a protein sequence database. tBLASTN compares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames. tBLASTX compares the six-frame translation of a nucleotide query sequence against the six-frame translation of a nucleotide sequence database. The BLAST programs can be used with draft parameters, or the parameters can be modified as needed to refine the screen.

[0348] Use of the BLAST suite of algorithms, including BLASTN, BLASTP, and BLASTX, is described in the publication Altschul, S., Madden, T., Schaffer, A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25(17): 3389-3402.

[0349] "Hits" to one or more database sequences by a query sequence generated by BLASTN, BLASTP, BLASTX, tBLASTN, tBLASTX, or similar algorithms align and identify similar portions of sequences. These hits are ranked by the degree of sequence similarity and the length of sequence overlap. Hits to database sequences generally represent overlap over only a portion of the sequence length of the query sequence.

[0350] The BLASTN, BLASTP, BLASTX, tBLASTN, and tBLASTX algorithms also generate an "expectation" value for an alignment. Expectation (E) refers to the number of hits one "expects" to find by chance when searching a database of the same size containing random contiguous sequences. Expectation is used as a significance threshold to determine whether a hit to a database represents true similarity. For example, an E value of 0.1 assigned to a polynucleotide hit is interpreted to mean that one would expect to find 0.1 matches by pure chance across the aligned portions of sequences with similar scores in a database the size of the selected database. For sequences with an E value of 0.01 or less across the aligned, matched portions, the probability of finding a match in that database by chance using the BLASTN, BLASTP, BLASTX, tBLASTN, or tBLASTX algorithm is 1% or less.

[0351] Multiple sequence alignment of a group of related sequences can be performed using CLUSTALW (Thompson, J., Higgins, D., and Gibson, T., 1994. CLUSTALW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties, and weight matrix choice. Nucleic Acids Research, 22: 4673-4680) or T-COFFEE (Notredame, C., Higgins, G., and Heringa, J., 2000. T-COFFEE: A novel method for fast and accurate multiple sequence alignment. Journal of Molecular Biology 302: 205-217) or progressive, pairwise alignment (Feng, D and Doolittle, R. 1987. Progressive sequence alignment as a prerequisite to correct phylogenetic trees. Journal of Molecular Evolution 25, This can be done using PILEUP using the PILEUP (pp. 351-360).

[0352] Pattern recognition software applications are available for finding motif or signature sequences. For example, MEME (Multiple Em for Motif Elicitation) searches for motif and signature sequences in a set of sequences, and MAST (Motif Alignment and Search Tool) uses these motifs to identify similar or identical motifs in a query sequence. MAST results are presented as a series of alignments with appropriate statistical data and a visual overview of the motifs found. MEME and MAST were developed at the University of California, San Diego.

[0353] PROSITE (Bairoch, A and Bucher, P. 1994. PROSITE: recent developments. Nucleic Acids Research 22(17): 3583-3589; Hofmann, K., Bucher, P., Falquet, L., and Bairoch, A. 1999. The PROSITE database its status in 1999. Nucleic Acids Research 27(1): 215-219) is a method for identifying the function of uncharacterized proteins translated from genomic or cDNA sequences. The PROSITE database (www.expasy.org / prosite) contains biologically significant patterns and profiles that are designed to be used, together with appropriate computational tools, to assign new sequences to known families of proteins or to determine which known domains are present in the sequence (Falquet, L., Pagni, M., Bucher, P., Hulo, N., Sigrist, J., Hofmann, K and Bairoch, A. 2002. The PROSITE database, its status in 2002 Nucleic Acids Research 30(1): 235-238). Prosearch is a tool that can search the SWISS-PROT and EMBL databases for a given sequence pattern or signature.

[0354] Methods for isolating polypeptides Polypeptides of the invention or used in the methods of the invention, including mutant polypeptides, can be prepared using peptide synthesis methods known in the art, such as direct peptide synthesis using solid-phase techniques (e.g., Stewart, J and Young, J. 1969. Thesis, Solid-Phase Peptide Synthesis, WH Freeman Co, San Francisco California), or automated synthesis, for example, using an Applied Biosystems 431A Peptide Synthesizer (Foster City, California). Mutant forms of the polypeptides can also be generated during such synthesis processes.

[0355] The polypeptides and variant polypeptides of the present invention, or the polypeptides and variant polypeptides used in the methods of the present invention, can also be purified from natural sources using various techniques known in the art (e.g., Deutscher, M. (Ed) 1990. Methods in Enzymology, Vol. 182, Guide to Protein Purification,).

[0356] Alternatively, the polypeptides and variant polypeptides of the invention, or for use in the methods of the invention, may be recombinantly expressed in a suitable host cell and then isolated from the cell as discussed below.

[0357] Methods for generating constructs and vectors A genetic construct of the present invention comprises one or more polynucleotide sequences of the present invention and / or a polynucleotide encoding a polypeptide of the present invention and may be useful, for example, for transforming bacterial, fungal, insect, mammalian or plant organisms. Genetic constructs of the present invention are intended to include expression constructs as defined herein.

[0358] Methods for producing and using genetic constructs and vectors are known in the art and are reviewed in Sambrook et al., 1989; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing, 1987).

[0359] Methods for generating plant cells and plants containing constructs and vectors The present invention further provides plant cells comprising a genetic construct of the invention, and plant cells modified to alter expression of a polynucleotide or polypeptide of the invention, or for use in a method of the invention. Plants comprising such cells also form an aspect of the invention.

[0360] Methods for transforming plant cells, plants, and parts thereof with polypeptides are described in the following references: Draper, J., Scott, R., Armitage, P., and Walden, R. 1988. Plant Genetic Transformation and Gene Expression. A Laboratory Manual. Blackwell Scientific Publishers, Oxford; Potrykus, I., and Spangenburg, G. 1995. Gene Transfer to Plants. Springer-Verlag, Berlin; and Gelvin, S., Schilperoort, R. 2000. Plant Molecular Biology Manual. Kluwer Academic Publishers, Dordrecht. A review of transgenic plants, including transformation techniques, is provided in Galun and Breiman, 1997, Transgenic Plants. Imperial College Press, London.

[0361] Methods for genetically manipulating plants Several plant transformation strategies are available (e.g., Birch, 1997, Ann Rev Plant Phys Plant Mol Biol, 48, 297; Hellens et al., 2000, Plant Mol Biol 42: 819-32; Hellens et al., Plant Meth 1: 13). For example, strategies can be designed to increase expression of a polynucleotide / polypeptide in plant cells, organs, and / or at particular developmental stages if / when it is normally expressed, or to ectopically express a polynucleotide / polypeptide in plant cells, tissues, organs, and / or at particular developmental stages if / when it is not normally expressed. The expressed polynucleotide / polypeptide may be derived from the plant species to be transformed or from a different plant species.

[0362] Transformation strategies can be designed to reduce the expression of a polynucleotide / polypeptide in a plant cell, tissue, organ, or at a particular developmental stage where it is / is normally expressed. Such strategies are known as gene silencing strategies.

[0363] Genetic constructs for the expression of genes in transgenic plants typically include a promoter to drive expression of one or more cloned polynucleotides, a terminator, and a selectable marker sequence for the purpose of detecting the presence of the genetic construct in the transformed plant.

[0364] Suitable promoters for use in the constructs of the present invention are functional in cells, tissues, or organs of monocotyledonous or dicotyledonous plants and include cell-specific, tissue-specific, and organ-specific promoters, cell cycle-specific promoters, transient promoters, inducible promoters, constitutive promoters active in most plant tissues, and recombinant promoters. The choice of promoter can vary depending on the desired temporal and spatial expression of the cloned polynucleotide. The promoter may be one normally associated with the transgene of interest or a promoter derived from other plant, viral, and plant pathogen and fungal genes. Those skilled in the art will be able to select suitable promoters for use in modifying and regulating plant characteristics using genetic constructs containing the polynucleotide sequences of the present invention without undue experimentation. Examples of constitutive plant promoters include the CaMV 35S promoter, the nopaline synthase promoter, the octopine synthase promoter, and the Ubi 1 promoter from maize. Plant promoters active in specific tissues in response to internal developmental signals or external abiotic or biotic stresses have been described in the scientific literature. Exemplary promoters are described, for example, in WO 02 / 00894 and WO 2011 / 053169, which are incorporated herein by reference.

[0365] Exemplary terminators commonly used in plant transformation gene constructs include, for example, the cauliflower mosaic virus (CaMV) 35S terminator, the Agrobacterium tumefaciens nopaline synthase terminator or octopine synthase terminator, the maize (Zea mays) zein gene terminator, the rice (Oryza sativa) ADP glucose pyrophosphorylase terminator, and the potato (Solanum tuberosum) PI-II terminator.

[0366] Selectable markers commonly used in plant transformation include the neomycin phosphotransferase II gene (NPT II) for kanamycin resistance, the aaA gene for specinomycin and streptomycin resistance, the phosphinothricin acetyltransferase (bar gene) for Ignite (AgrEvo) and Basta (Hoechst) resistance, and the hygromycin phosphotransferase gene (hpt) for hygromycin resistance.

[0367] Methods for reducing or eliminating gene / protein expression or activity in plants Gene silencing Transformation strategies can be designed to reduce the expression of a polynucleotide / polypeptide in a plant cell, tissue, organ, or at a particular developmental stage where it is / is normally expressed. Such strategies are known as gene silencing strategies.

[0368] Gene silencing strategies can focus on the gene itself or on regulatory elements that affect the expression of the encoded polypeptide. The term "regulatory element" is used herein in the broadest possible sense and includes other genes that interact with the gene of interest. Preferably, the regulatory element is part of the gene.

[0369] Genetic constructs designed to reduce or suppress expression of polynucleotides / polypeptides of the invention comprise an antisense copy of a polynucleotide of the invention, in which the polynucleotide is positioned in an antisense orientation relative to the promoter and terminator.

[0370] An "antisense" polynucleotide is one in which the transcript produced is an antisense polynucleotide that is an antisense to the mRNA transcript of a gene, e.g., 5'GATCTA 3' (coding strand) 3'CTAGAT 5' (antisense strand) 3'CUAGAU 5'(mRNA) 5'GAUCUA 3' (antisense RNA) is obtained by inverting a polynucleotide or a segment of a polynucleotide so that it is complementary to

[0371] Gene constructs designed for gene silencing may also include inverted repeats. An "inverted repeat" is a repeated sequence in which the second half of the repeat sequence is located in the complementary strand, e.g., 5'-GATCTA...TAGATC-3' 3'-CTAGAT...ATCTAG-5' It's inside.

[0372] The resulting transcript can undergo complementary base pairing to form a hairpin structure. A spacer of at least 3-5 bp between the repeat regions is usually required to allow hairpin formation. Constructs containing such inverted repeat sequences can be used for RNA interference (RNAi), and are therefore referred to as RNAi constructs.

[0373] Another silencing approach involves the use of small antisense RNA molecules targeted to transcripts equivalent to miRNA (Llave, C., Xie, Z., Kasschau, K and Carrington, J. 2002. Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297(5589): 2053-2056).The use of such antisense RNA corresponding to the polynucleotide of the present invention is clearly considered.

[0374] The term genetic construct as used herein also includes small antisense RNA and other such polypeptides that effect gene silencing.

[0375] As defined herein, transformation with an expression construct can also achieve gene silencing through a process known as sense suppression (e.g., Napoli, C., Lemieux, C. and Jorgensen, R. 1990. Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. The Plant Cell 2: 279-289;). In some cases, sense suppression can involve overexpression of all or part of the coding sequence, but can also involve expression of non-coding regions of a gene, such as introns or 5' or 3' untranslated regions (UTRs). Chimeric partial-sense constructs can be used to coordinately suppress multiple genes (Abbott, J., Barakate, A., Pincon, G., Legrand, M., Lapierre, C., Mila, I., Schuch, W. and Halpin, C. 2002. Simultaneous suppression of multiple genes by single transgenes. Down-regulation of three unrelated lignin biosynthetic genes in tobacco. Plant Physiology 128(3): 844-53; Jones, C., Scothern, G., Lycett, G. and Tucker, G. 1998. The effect of chimeric transgene architecture on coordinated gene silencing. Planta 204: 499-505). The use of such sense suppression strategies to suppress expression of the polynucleotides of the present invention is also contemplated.

[0376] Polynucleotide inserts in genetic constructs designed for gene silencing may correspond to coding and / or non-coding sequences of the corresponding gene, such as promoter and / or intron and / or 5' and / or 3' UTR sequences.

[0377] Other gene suppression strategies include dominant-negative approaches and the use of ribozyme constructs (McIntyre, C and Manners, J. 1996. Strategies for the suppression of peroxidase gene expression in tobacco. I. Designing efficient ribozymes. Transgenic Research 5: 257-262).

[0378] Pre-transcriptional repression can be brought about by mutations in the gene itself or in its regulatory elements, including point mutations, frameshifts, insertions, deletions and substitutions.

[0379] Methods for editing endogenous plant genomes Some embodiments of the present invention include modifying the genome of a Scaevola plant to reduce or eliminate the expression or activity of the CYC2 gene and protein, thereby producing the desired floral phenotype of the present invention in the plant.

[0380] Methods for modifying endogenous genomic DNA sequences of plants are well known to those skilled in the art, and may involve the use of sequence-specific nucleases to generate targeted double-stranded DNA breaks in the gene of interest. Examples of such methods used in plants include zinc finger nucleases (Curtin, S., Zhang, F., Sander, J., Haun, W., Starker, C., Baltes, N., Reyon, D., Dahlborg, E., Goodwin, M., Coffman, A., Dobbs, D., Joung, J., Voytas, D. and Stupar, R. 2011. Targeted mutagenesis of duplicated genes in soybean with zinc-finger nucleases. Plant Physiology 156: 466-473;), transcription activator-like effector nucleases or "TALENs" (Cermak, T, Doyle, E., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J., Somia, N. and Bogdanove, A. 2011. Targeted mutagenesis of duplicated genes in soybean with zinc-finger nucleases. Plant Physiology 156: 466-473;). 2011. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Research 39(12): e82;Mahfouz , M., Li, L., Shamumuzzaman, M., Wibowo, A., Fang, X and Zhu, J. 2011. De novo-engineered transcription activator-like effector (TALE) hybrid Nuclease with novel DNA binding specificity creates double -strand breaks.Proceedings of the National Academy of Science USA 108(6): 2623-2628; Li, T., Spalding, M., Weeks, D and Yang, B. 2012. High efficiency TALEN-based gene editing produces disease-resistant rice. Nature Biotechnology 30: 390-392), and LAGLIDADG homing endonucleases, also known as "meganucleases" (Tzfira, T., Weinthal, D., Marton, I., Zeevi, V., Zuker, A. and Vainstein, A. 2012. Genome modifications in plant cells by custom-made restriction enzymes. Plant Biotechnology 10:373-389).

[0381] Targeted genome editing using artificial nucleases, such as regularly interspaced short palindromic repeats (CRISPR) technology, is an important new approach for creating RNA-guided nucleases with customizable specificity, such as Cas9. Genome editing mediated by these nucleases has been used to rapidly, easily, and efficiently modify endogenous genes in a wide variety of biomedically important cell types and organisms that have traditionally been difficult to genetically manipulate. Modified versions of the CRISPR-Cas9 system have been developed to recruit heterologous domains that can regulate endogenous gene expression or mark specific genomic loci in living cells (Sander, J and Joung, J. 2014. CRISPR-Cas systems for editing, regulating and targeting genomes. Nature Biotechnology 32: 347-355. The system is applicable to plants and can be used to regulate expression of target genes. (Bortesi, L. and Fischer, R. 2015. The CRISPR / Cas9 system for pant genome editing and beyond. Biotechnology Advances 33(1): 41-52).

[0382] In certain embodiments of the present invention, genome editing techniques (e.g., TALENs, zinc finger nucleases, or CRISPR-Cas9 technology) can be used to modify one or more base pairs in a targeted endogenous CYC2 to reduce or eliminate the expression or activity of the CYC2 gene and protein, thereby producing a plant of the present invention with a desired floral phenotype.

[0383] How to regenerate Scaevola plants Methods for regenerating Scaevola plants are known in the art and include, for example, those disclosed in: Wang, Y. and Bhalla P. 2004. Somatic embryogenesis from leaf explants of Australian fan flower, Scaevola aemula R. Br. Plant Cell Reports 22: 408-414, and Bhalla, P. and Xu, H. 1999. Plant Regeneration from Callus of Australian Fan Flower, Scaevola. Journal of Plant Physiology, 154(3): 374-378.

[0384] How to mutate plant genomes Mutation breeding, sometimes called "mutation breeding," is the process of exposing plants, plant parts, reproductive material, seeds, cells, cuttings, etc. to chemicals or radiation to create mutants with desirable traits.

[0385] Various types of mutation breeding are well known to those skilled in the art and include approaches such as using chemical mutagens such as ethyl methanesulfonate and dimethyl sulfate, radiation, or transposons to create mutants. Mutation breeding is commonly used to create traits in crops and ornamental plants.

[0386] Such methods are described, for example, in: Shu, Q., Forster, B. and Nakagawa, H. (Eds) 2011. Plant mutation breeding and biotechnology, Joint FAO / IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Vienna Austria. Ceccarelli, SE, Guimaraes, E. and Weltzien, E. (Eds). 2009. Plant breeding and farmer participation, Chapter 8. Methodologies for generating variability. Part 4: Mutation techniques., Publisher: Food and Agriculture Organization of the United Nations, Editors: pp. 159-194; and Sikora, P. et al, 2011, Mutagenesis as a Tool in Plant Genetics, Functional Genomics, and Breeding. Volume 2011 |Article ID 314829, International Journal of Plant Genomics.

[0387] Methods for determining reduced or eliminated expression or activity Methods for measuring reduced or eliminated expression of plant genes or proteins are well known to those skilled in the art and include, but are not limited to, nucleic acid-based methods such as Northern analysis, RT-PCR and dot-blot analysis (Sambrook et al., 1989), and protein-based methods such as ELISA (Kemeny, 1991, A Practical Guide to ELISA, NY Pergamon Press) and Western blot analysis (Towbin & Gordon, 1994, J Immunol Methods, 72, 313).

[0388] seed deposit Seeds of Scaevola accessions 20-61 have been deposited at NCIMB Limited, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA as follows:

[0389] [Table 1]

[0390] The deposit receipt and viability instructions are posted on the following page.

[0391] [ka]

[0392] [ka]

[0393] The present invention describes a novel mutant allele in Scaevola aemula, termed "FUSED." The FUSED allele is phenotypically expressed in flowers, resulting in a fused or partially fused flower tube, which confers the phenotypic appearance of actinosymmetric or near-actinosymmetric petals within the corolla. The present invention also relates to Scaevola seeds, plants, and plant parts containing the novel FUSED allele. The present invention also relates to methods for introgressing the FUSED allele into a wide range of different Scaevola genotypes to generate novel actinosymmetric flowering plants.

[0394] The FUSED allele of the present invention can be introduced into any Scaevola plant. It can be easily transferred into any Scaevola plant that lacks the allele. The alleles and methods described herein can be used to modify the inflorescence of any Scaevola plant.

[0395] One method involves hybridization by cross-pollination using a parent carrying the FUSED allele as the pollen or ovule parent. Another method involves self-pollination of a plant carrying the FUSED allele.

[0396] The FUSED allele can be used to modify the appearance of the corolla of any Scaevola cultivar intended for commercial production.

[0397] Plants of the present invention can be obtained by crossing plants either heterozygous or homozygous for the claimed mutant allele with any Scaevola cultivar lacking this allele. Further breeding can then be carried out to incorporate other genes of interest into the breeding program. Plants heterozygous for the FUSED allele can be positively selected for use in introgressing the allele based on phenotypic markers that result in early development of flowers expressing the actinomorph phenotype.

[0398] The new mutant alleles can be introduced into varieties with other desirable genetic traits, such as compact plant habit, creeping habit, upright habit, early flowering, drought tolerance, unique flower colors such as yellow, pink, white, blue and combinations thereof, pest and disease resistance, ease of crossbreeding, and any other desired characteristics.

[0399] The present invention was developed as part of a mutation breeding program in which proprietary accessions were subjected to gamma-irradiation. According to the present invention, mutations can also be generated by other mutagens or by gene editing. Examples of other mutagens include X-rays, UV irradiation, ethyl methanesulfonate (EMS), and methyl methanesulfonate (MMS). Examples of gene editing systems include CRISPR / Cas9, ZFN, and TALENs (Mao, Y, Botella, JR, Liu, Y, and Zhu, J. 2019. Gene editing in plants: progress and challenges. National Science Review 6:421-437).

[0400] Therefore, one of ordinary skill in the art would expect that other deletions or disruptions to the CYCLOIDEA2 gene in Scaevola may result in the same ray floral symmetry phenotypic expression.

[0401] The Scaevola mutant FUSED allele of the present invention was introgressed into multiple genetically diverse Scaevola aemula lines by cross-pollination, producing a series of Scaevola aemula plants containing the mutant allele.

[0402] When expressed homozygously, the FUSED allele results in the production of nearly all flowers of a plant with fused dorsal clefts. When expressed heterozygously, the FUSED allele can be phenotypically expressed with fused dorsal clefts evident in the first few flowers, but subsequent flowers revert to the normal wild-type phenotype. The mutant allele is a recessive nonsense mutation (a single-base change that introduces a stop codon) within the CYCLOIDEA2 coding region.

[0403] Applicants developed a CAPS marker system to reliably identify plants containing the mutant allele. The codominant CAPS marker accurately identified all plants carrying the FUSED allele in either the homozygous or heterozygous state.

[0404] Although peloric plants are known in the art of horticulture, they are extremely rare. The basic mechanisms for the development of such plants vary greatly depending on the species. In the case of Scaevola aemula, after an extensive prior art search, to the inventor's knowledge, peloric plants have never been reported.

[0405] In other plant species, peloric plants are found, in some cases involving either loss or increased expression of CYCLOIDEA genes (of which there are many), and often involving other genes or genetic mechanisms as well.

[0406] For example, in Antirrhinum, both the CYC and DICH genes were disabled, resulting in peroric Antirrhinum plants, which in turn had extra petals, sepals, and stamens (six each in the mutant and five each in the wild-type plants) (Luo, D., Carpenter, R., Vincent, C., Copsey, L. and Coen, E. 1995. Origin of Floral Symmetry in Antirrhinum, Nature 383:794-799).

[0407] In the present Scaevola flower phenotype of the present invention, there is no increase in petals, sepals, and stamens, and no mutation in one specific CYC gene (CYC2 gene) (rather than two different genes) was required to develop actinomorphic flowers. Therefore, the prior art on Antirrhinum would never lead a skilled artisan to the present invention on Scaevola.

[0408] Dong et al. (2018) (Dong, Y., Liu, J., Li, P., Li, C., Lu, T., Yang, X. and Wang, Y. 2018. Evolution of Darwin's peloric Gloxinia (Sinningia speciosa) is caused by a null mutation in a pleiotropic TCP gene, Molecular Biology and Evolution 38(8): 1901-1915) suggested that the evolution of peloric gloxinia (Gloxinia) involved a diploid mechanism. A 10-bp deletion resulted in the loss of function of the SsCYC protein, which in turn further disrupted the autoregulatory loop of SsCYC, leading to the complete loss of dorsal-specific expression. Their analysis showed that this mutation not only resulted in peloric flowers, but also altered flower orientation by suppressing the gibbous structure at the base of the flower. Furthermore, in the case of Gloxinia, the flowers do not have dorsal dehiscence, so again, the prior art relating to Antirrhinum would never have led a person skilled in the art to the present invention relating to Scaevola, where fusion of the dorsal dehiscences results in actinomorphic flowers, which was an unexpected and surprising result.

[0409] In African violet (Hsu, H., He, C., Kuo, E., Hsin, K., Lu, J., Pan, Z. and Wang, C. 2018. Genetic analysis of floral symmetry transition in African Violet suggests the involvement of trans-acting factor for CYCLOIDEA expression shifts, Frontiers in Plant Science 9: 1-19), the CYC2 gene was not found, and only varieties of the CYC1 gene family were found. The CYC2 gene of the present invention was not present in the plants examined in the African violet study by Hsu et al. 2018.

[0410] In an extensive study of the pea family (Zhao, Z., Hu, J., Chen, S., Luo, Z., Luo, D., Wen, J., Tu, T., Zhang, D. 2019. Evolution of CYCLOIDEA-like genes in Fabales: Insights into duplication patterns and the control of floral symmetry, Molecular Phylogenetics and Evolution 132: 81-89), the authors argue that "the diversification patterns of both CYC1 and CYC2 genes are unrelated to floral symmetry in non-papilionoid Fabales groups, but gene duplication and functional divergence of CYC2 are essential for floral bilateral symmetry in Papilionoideae." Furthermore, (page 87) the authors say, "Many non-Leguminosae species, despite differences in symmetry morphology, have only one copy of the CYC2 gene, whereas some others with actinomorphic flowers have two copies, suggesting that the CYC2 gene duplication event is not associated with floral symmetry in these organisms." This study shows how difficult it is to pinpoint exactly which gene (if any) is responsible for floral symmetry, and that a particular CYC2 gene in one part of a family can have a different effect in another part of the family.

[0411] In the legume Cadia, a rare transition from bilateral to radial symmetry is characterized by a change in the expression pattern of CYC genes. One expression pattern of CYC genes expanded from the adaxial surface of the corolla to the lateral and abaxial regions, suggesting that Cadia's radial flowers were dorsalized, resulting in a homeotic transformation in which all petals acquired dorsal identity, without a reversal to radial symmetry (Citerne, H., Pennington, R., Cronk, Q. 2006. An apparent reversal in floral symmetry in the legume Cadia is a homeotic transformation, Proceedings of the National Academy of Sciences of the United States of America, 103(32): 12017-12020). This rare change in expression results in a completely different inflorescence, thereby achieving the radial symmetry found in the present invention.

[0412] In the case of sunflower (Helianthus annuus), Fambrini et al. (Fambrini, M., Salvini, M., Basile, A., and Pugliesi, C. 2014. Transposon-dependent induction of Vincent van Gogh's sunflowers: Exceptions revealed, Genesis 52:315-327) investigated flower mutants with actinomorphic ray flowers. Conventional sunflowers have bilaterally symmetrical ray flowers and actinomorphic discoid florets. Molecular analysis of the turf (disk-shaped flower) mutant sunflower revealed a non-autonomous transposable element (TE) insertion in the TCP domain of the HaCYC2 gene, which causes the ray flowers to change from bilateral to actinomorphic. Another mutant, known as Chrys, is characterized by a change from actinomorphic discoid flowers to bilaterally symmetrical petals. A single semi-dominant major gene controls this trait, which results from a 999 bp insertion upstream of the start codon of a CYCLOIDEA-like gene (HaCYC2) within the promoter region. In the present invention, no transposable elements were involved.

[0413] In the case of Linaria (Cubas, P., Vincent, C. and Coen, E., 1999. An epigenetic mutation responsible for natural variation in floral symmetry, Nature 40: 157-161), the authors demonstrated that the change from bilateral to radial symmetry was due to extensive methylation of the LCYC gene, which rendered the gene transcriptionally silent. This method of changing from bilateral to radial symmetry is also different from that found in the subject of the present invention; furthermore, the LCYC gene is not present in Scaevola.

[0414] As already noted, the present invention is the first example of producing actinomorphic flowers in Scaevola. Thus, there was no precedent showing that such flowers could be produced in Scaevola. Rather, applicants have surprisingly produced Scaevola plants in their commercial breeding programs that have the floral phenotype of the present invention.

[0415] Furthermore, given the several diverse mechanisms involved in the change from bilateral to radial floral symmetry within various plant families, and the unrelatedness of these species to Scaevola, one skilled in the art could not have predicted a similar mechanism resulting in actinosymmetric flowers in Scaevola, as provided herein by the present invention.

[0416] The novel altered floral phenotype conferred by the FUSED allele results in a fused floral tube, which contains a dorsal dehiscence normally located between the dorsal petals extending from the edge of the corolla to the ovary. This fusion of the floral tube limits the ability of insects to enter and pollinate the flower. Unexpectedly, when grown outdoors, plants with the altered phenotype exhibit significantly slower seed production resulting from insect pollination compared to normal Scaevola aemula plants. Unexpectedly, this attribute also increases the length of the floral presentation, unexpectedly rendering the flowers less accessible to insect pollination. Successfully pollinated normal Scaevola aemula flowers cease corolla growth within one day of pollination. Scaevola aemula plants with longer shelf life and flower presentation may be considered more desirable by plant retailers and consumers due to their longer ornamental appeal, and thus the plants developed from this invention have improved commercial utility and novelty.

[0417] Applicant has further demonstrated that artificial pollination of plants carrying the FUSED allele can be used to successfully produce seeds, with similar amounts of seeds produced per cross-pollination as plants lacking the mutant allele can be cross-pollinated with each other.

[0418] Applicants have successfully produced thousands of seeds using Scaevola plants carrying the FUSED allele from cross-flowering, self- and open-pollination with numerous unrelated Scaevola genotypes.

[0419] The present invention further provides methods for developing Scaevola plants in plant breeding programs using plant breeding techniques such as parental selection and hybridization, recurrent selection, backcrossing, pedigree breeding, CAPS marker-assisted selection, transformation, and gene editing. Seeds, Scaevola aemula plants, and plant parts produced by such breeding methods are also part of the present invention.

[0420] The present invention also relates to a method for producing a Scaevola plant containing one or more transgenes in its genetic material, and to a transgenic Scaevola plant produced by this method, wherein the transgene is preferably the mutant allele FUSED or a cDNA of the mutant allele FUSED.

[0421] The present invention also relates, in part, to the development of unique Scaevola plants. A transferable allele, designated FUSED, that transmits modified floral phenotypic characteristics has been isolated and integrated into other genetic backgrounds. The alleles of the invention are also expressed in many different genetic backgrounds.

[0422] The novel modified Scaevola plants of the present invention are generally genetically stable, as demonstrated by the stability of the modified phenotype through successive rounds of asexual propagation and the transmission of the trait to progeny through extensive genetic diversity through sexual crosses.

[0423] Prior to the present invention, the development of Scaevola plants with floral actinosymmetry was not achievable by methods obvious to those skilled in the art. By reliably and predictably incorporating this novel trait into diverse genetic backgrounds of Scaevola, new varieties can be created regardless of whether the male or female parent of an inter-crossing combination possesses the allele.

[0424] Where reference is made herein to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the present invention. Unless otherwise expressly stated, reference to such external documents should not be construed as an admission that such documents, or such sources of information, are prior art or form part of the common general knowledge in the art in any jurisdiction.

[0425] As used herein, the term "comprising" means "consisting at least in part of." In interpreting each statement herein that includes the term "comprising," features other than the one or more that begin with this term may be present. Related terms such as "comprise" and "comprises" should be interpreted similarly. In some embodiments, the term "comprising" (and related terms such as "comprise" or "comprises") can be replaced with "consisting of" (and related terms such as "consist" or "consists").

[0426] All publications cited in this application are hereby incorporated by reference.

[0427] BRIEF DESCRIPTION OF THE DRAWINGS The following drawings, which are incorporated in and form a part of this specification, illustrate some, but not the only or exclusive, example embodiments and / or features and should be construed as illustrative and non-limiting in scope. [Brief explanation of the drawings]

[0428] [Figure 1] Shown are the normal "wild-type" fan flower morphology of Scaevola aemula (bottom) and our novel "radiate" flower morphology (top) with dorsal, lateral and ventral petals labeled. [Figure 2] Shown is the fused dorsal dehiscence characteristic of the present invention (left) compared to a normal flower (right) that exhibits a dorsal dehiscence extending from the edge of the corolla to the ovary. [Figure 3] An example of a mature plant of the invention homozygous for the FUSED allele (left) and a normal wild-type Scaevola aemula plant that does not have the FUSED allele (right) are shown. [Figure 4] 1 shows a variety of flower colors and sizes of the present invention exhibiting radial floral symmetry, including blue, white, yellow, pink, a combination of pink and yellow, and a combination of purple and yellow. [Figure 5] Self-pollinated progeny from accession 11361 are shown, demonstrating that the actinomorphic flower trait is homozygous and that 100% of the progeny exhibit actinomorphism. [Figure 6] 1 shows the floral progeny produced from the cross of 10 radially symmetric flowering lines from Example 5, which have 100% actinomorphic flower trait. [Figure 7] The CYC2 cDNA sequences of accessions 7482, 7952, and 11361 are shown, showing the single-base TAA (stop) codon mutation in actinomorphic 11361 and the mutant allele in initially actinomorphic, then normal-flowering 7952 (red box). [Figure 8] A diagrammatic representation of the mutation resulting in actinomorphic flower morphology from accession 11361 is shown. [Figure 9]CYC2 expression patterns in petals of accessions 7482, 7952 and 11361 are shown. [Figure 10] Southern blot to determine the copy number of CYC2 in Scaevola aemula accessions used in genetic studies. [Figure 11] A diagrammatic representation of the CAPS marker system for identification of mutant alleles is shown. [Figure 12] CAPS marker results for accessions 7482 (normal), 7952 (heterozygous for the FUSED allele), and 11361 (homozygous for the FUSED allele) are shown. [Figure 13] Electrophoresis gel images of CAPS marker analysis for Table 3 are shown. [Figure 14] Figure 1 shows a CLUSTAL O(1.2.4) multiple sequence alignment of CYC2 proteins from Scaevola aemula (SamCyC2 - SEQ ID NO: 1), Scaevola taccada (StaCyC2 - SEQ ID NO: 2), and Scaevola sericea (SseCYC2 - SEQ ID NO: 3). The positions of Scaevola CYC2 corresponding to motifs 1, 2, and 4 are highlighted in gray shading, as described by the authors of Chen et al. 2018. Motifs 1, 2, and 4 are present in all Asterales CYC2-like morphologies, as described by the authors of Chen et al. 2018. [Figure 15] Figure 14 shows the % identity between the aligned CYC2 protein forms of Scaevola aemula (SamCyC2 - SEQ ID NO: 1), Scaevola taccada (StaCyC2 - SEQ ID NO: 2) and Scaevola sericea (SseCYC2 - SEQ ID NO: 3). [Figure 16]Alignment of the following sequences is shown: wild-type Scaevola aemula CYCLOIDEA2-"7482" coding sequence (SEQ ID NO:23), Scaevola aemula CYCLOIDEA2-FUSED ALLELE-"11361" coding sequence (SEQ ID NO:24), wild-type Scaevola taccada CYCLOIDEA2 "Scaevola_taccada" coding sequence (SEQ ID NO:25), and wild-type Goodenia pilosa CYCLOIDEA-like gene "Goodenia_pilosa" coding sequence (SEQ ID NO:26). The adenine (A) at nucleotide position 99 in "11361" (SEQ ID NO:24), which is unique to the FUSED allele, is highlighted with a white box. The other three wild-type sequences have a cytosine (C) at the corresponding position. DETAILED DESCRIPTION OF THE INVENTION

[0429] Example In addition to the exemplary aspects and embodiments described above, further aspects and embodiments will become apparent upon detailed reading of the following non-limiting examples.

[0430] The following examples are provided to further illustrate the present invention. These examples should not be construed as limiting the scope of the present invention in any way beyond the limitations set forth in the appended claims. Many variations and modifications can be made and still fall within the spirit and scope of the present invention.

[0431] Example 1. Creation of early mutant actinomorphic flowering plants A commercial Scaevola aemula breeding program was initiated in 1997 to produce new varieties for the international ornamental horticultural market. From 1997 to 2013, approximately 27,486 seedlings were generated from various cross- and open-pollinated inoculations originating from up to 67 wild-collected and commercially available cultivars. Seedlings were carefully selected for commercially viable traits. No actinomorphic flowers were observed. The first modified flower phenotype (accession 7952) was observed in the proprietary plant population in 2014 as a result of a cross involving a gamma-irradiated accession in 2013. However, this plant only had actinomorphic flowers in the first few flowers grown during the production period. Subsequent flowers displayed the normal floral phenotype of Scaevola aemula. Further selection and breeding resulted in one fully stable actinomorphic flowering plant selected in 2016. This plant was designated accession 11361. This accession homogeneously and stably expressed the novel actinomorphic flower phenotype through multiple generations of asexual propagation and cultivation under highly diverse environmental conditions throughout all seasons of the year in Yellow Rock, NSW Australia, and Higashiomi City, Shiga Prefecture, Japan.

[0432] Example 2. Self-pollination of an early mutant actinomorphic flowering plant (accession 11361) Scaevola aemula plants have been known in the art to be self-incompatible (Luo, 2005; Sweeney, 1999; Howell, 1995). However, the new Scaevola aemula accession 11361 was considered self-compatible. Self-pollination was performed manually with a small paintbrush in a screened greenhouse during the summer in Yellow Rock, Australia, according to published methods.

[0433] The first early stable actinomorph flowering plant (accession 11361) was self-pollinated (100 hand-pollinated self-pollinations using a small paintbrush), and unexpectedly, 69 seeds were produced. From these seeds, 53 plants were grown and grown to flowering. All 53 plants had the actinomorph flower trait in all flowers on all plants, indicating that this line was homozygous for the actinomorph flower trait (Figure 5). In addition, this experiment showed that the white color of the flowers in this line was also a homozygous trait. Evidence of inbreeding depression (slow, weak growth, and late flowering) was observed in this population. After self-pollination of accession 11361, the maximum number of seeds that could be produced in a Scaevola aemula fruit was two, resulting in a fruit set rate of 34.5% (Table 1).

[0434] [Table 2]

[0435] Example 3. Crossing seven actinomorphic flowering accessions to assess transmission of actinomorphic floral traits Accession 11361 was used to cross-pollinate and conduct open pollination between numerous accessions displaying normal flowers. The progeny from these crosses were also crossed by direct or open pollination. From these breeding results, seven accessions that stably displayed the symmetrical flower trait were selected. Cross-pollination was conducted manually and randomly among the seven accessions that stably displayed the actinomorphic flower trait. These seven lines were genetically diverse and had flower colors including dark blue, pink, pumpkin, yellow, spotted pink, spotted dark pink, and spotted dark blue. All seven lines were crossed using bulk pollen collected from all seven lines. 1,367 pollinations were performed, 262 fruits were collected, and 225 seeds were sown, resulting in 71 plants. Of these 71 plants, 54 reached flowering (17 were weak and did not flower). All 54 plants that reached flowering stage displayed the actinomorphic floral trait. A variety of flower colors and combinations were evident in the progeny. This study demonstrated that the actinomorphic floral trait can be transmitted between different genotypes of Scaevola aemula.

[0436] Example 4. Crossing of 10 actinomorphic flowering accessions to assess transmission of actinomorphic floral traits Using the 10 different accessions in Example 3, cross-pollination was performed manually and randomly among the 10 accessions stably displaying the actinomorphic flower trait. These 10 lines were genetically diverse and had flower colors including the following: yellow and blue, yellow and pink, blue with a white center, white, dark yellow and pink, and blue and light blue. All 10 lines were crossed using bulk pollen collected from all 10 lines. Pollination was performed, 621 fruits were harvested, and 629 seeds were sown, resulting in 421 plants that reached flowering stage. All 421 plants that reached flowering stage stably displayed the actinomorphic flower trait. Various flower colors and combinations were evident in the progeny (Figure 6). Examples 2, 3, and 4 demonstrated that the actinomorphic flower trait was homozygous in plants stably displaying the trait.

[0437] Example 6. Determining the genetic mechanism of actinosymmetric flower traits Recent floral morphology studies on the Goodeniaceae (Berger et al. 2017, Gardner et al. 2016, and Han 2018) suggest that members of the CYCLOIDEA-like gene family are responsible for variations in petal arrangement in this family. These genes are transcription factors that regulate DNA-to-RNA transcription, ensuring correct gene expression at the correct time and in the correct location in the plant. Han explains that floral symmetry can be influenced by the asymmetric expression and duplication of these transcription factors. In Scaevola aemula, Han 2018 (pp. 59–62) found three copies of CYC: CYC1, CYC2, and CYC3, with two copies within CYC3: CYC3A and CYC3B. These different copies were differentially expressed in leaves, flower buds, and lateral and / or ventral petals. Han found that the degree of bilateral symmetry exhibited by flowers of Scaevola aemula was affected by subtle changes in the expression levels of multiple CYC-like genes (p. 67). Han noted that in actinomorph groups, CYC2 clade members were either not expressed in corolla tissue or were ubiquitously expressed (underlined) (see Howarth et al. 2011 and Zhang et al. 2013). This statement clearly demonstrates the ambiguity surrounding the CYC2 gene and the difficulty of predicting in advance the possible effects of extra copies and / or deletions.

[0438] Prior to the present invention, it was unclear what genetic mechanism, if any, could be responsible for the actinosymmetric floral symmetry of Scaevola aemula. In fact, actinosymmetric flowering plants of Scaevola aemula have not been reported in the available literature. Therefore, one skilled in the art would recognize at this point that there were many possible causes for the actinosymmetric floral trait of Scaevola aemula. Various theories were considered, and experiments were performed.

[0439] Because it was not possible to predict a priori that this would be the mechanism controlling floral symmetry in accession 11361, experiments were conducted to determine whether the CYCLOIDEA gene was responsible for this novel morphology. Three proprietary accessions were selected for analysis (Table 2).

[0440] [Table 3]

[0441] Experimental studies involved cloning the CYCLOIDEA 2 gene. Primers were designed to amplify the Scaevola aemula CYC2 gene using the Scaevola taccada CYC2 sequence (accession number MG593372.1) deposited in GenBank. These primers (St-cysF1: TCCATGTCTGCCCTCCTTCT [SEQ ID NO: 27] and St-cysR1: TTACACGCATCACCCTGCTG [SEQ ID NO: 28]) generated approximately 1 kb amplicons from cDNAs from accessions 7482, 7952, and 11361. cDNA was generated using total RNA prepared from flower buds using ReverTra Ace reverse transcriptase (Toyobo). PCR was performed using Tks gflex polymerase (Takara Bio) for 35 cycles of 15 seconds at 98°C, 20 seconds at 60°C, and 30 seconds at 68°C. These amplicons were cloned using TArget clone-plus- (Toyobo) and then sequenced using a 3500 Genetic Analyzer (Applied Biosystems).

[0442] Figure 7 shows the nucleotide sequences of three Scaevola aemula accessions: 7482, 7952, and 11361. All sequences obtained from 11361 contained a C-to-A point mutation, generating a stop codon (TAA) and a truncated, presumably nonfunctional protein (Figures 7 and 8). Two of the six sequences obtained from 7952 contained the same C-to-A point mutation, indicating that 7952 was a heterozygous mutant.

[0443] Further alignments of the following sequences are shown in Figure 16: wild-type Scaevola aemula, CYCLOIDEA2-"7482" coding sequence (SEQ ID NO: 23), Scaevola aemula, CYCLOIDEA2-FUSED ALLELE-"11361" coding sequence (SEQ ID NO: 24), wild-type Scaevola taccada CYCLOIDEA2 "Scaevola_taccada" coding sequence (SEQ ID NO: 25) and wild-type Goodenia pilosa, Cycloidea-like gene "Goodenia_pilosa" coding sequence (SEQ ID NO: 26). The adenine (A) at nucleotide position 99 in "11361" (SEQ ID NO: 24), which is unique to the FUSED allele, is highlighted with a white box. The other three wild-type sequences have a cytosine (C) at the corresponding position.

[0444] Quantitative RT-PCR was performed to determine the expression level of CYC2 in the petals of Scaevola aemula flowers. Total RNA was isolated separately from the dorsal, lateral, and ventral petals of 1 cm, 1.5 cm, and 2 cm flower buds using the RNeasy Plant Mini Kit (Qiagen). cDNA was generated from the total RNA using ReverTra Ace reverse transcriptase (Toyobo). Quantitative PCR was performed using PowerUp SYBR Green Master Mix (Applied Biosystems) and the StepOnePlus real-time PCR system (Applied Biosystems). The primers for CYC2 qPCR were CYC2rt-F (GGCAAGAGCAAGAGCTAGGG) - SEQ ID NO: 29 and CYC2rt-R (AGGTTGGGCTTACGTGACAG) - SEQ ID NO: 30. CYC2 expression levels were normalized to actin expression levels. Primers for actin qPCR are actrt-F(GCCTGATGGGCAGGTAATCA)-SEQ ID NO: 31 and actrt-R(TACCAGCAGCTTCCATTCCG)-SEQ ID NO: 32. The results are shown in Figure 10. Accessions 7482, 7952 and 11361 show essentially the same CYC2 expression pattern.

[0445] Southern blot analysis was performed to determine the copy number of CYC2 in Scaevola aemula accessions 7482, 7952, and 11361. Genomic DNA was extracted from leaf tissue using the NucleoSpin Plant II Kit (Macherey-Nagel). Approximately 15 μg of genomic DNA was digested with Afl II or Hinc II (New England Biolabs), electrophoresed on a 0.8% agarose gel, and transferred to a positively charged nylon membrane (GE Healthcare). A portion of the CYC2 cDNA sequence, excluding the region conserved among all Cycloidea genes, was labeled with digoxigenin using DIG-High Prime (Roche). Hybridization and detection were performed according to the manufacturer's instructions.

[0446] Southern blot analysis using AflII showed a single band in all three cultivars. Southern blot analysis using HincII showed a single band in 11361, but two bands in 7482 and 7952. We hypothesized that 7482 has two normal alleles of the same CYC2 gene, one of which has a separate HincII site adjacent to the CYC2 gene; 7952 has one mutant allele and one normal allele with a separate HincII site; and 11361 has two mutant alleles. These results suggest that Scaevola aemula may have at least one copy of the CYC2 gene, which is consistent with the results of Han 2018.

[0447] Example 7. Development of a CAPS marker system to identify heterozygous and homozygous CYC2 mutants DNA extraction was performed using NucleoSpin Plant II (MACHEREY-NAAGEL). The following PCR primers and conditions were used to generate a 151-bp fragment, followed by Msel digestion and electrophoresis to distinguish between normal actinosymmetric (homozygous) and initially actinosymmetric plants that later developed into normal flowering (heterozygous) plants. PCR primers for the CAPS marker system were CYC2-2F (CCATGTCTGCCCTCCTTCT) - SEQ ID NO: 33 and CYC2-152R (AACATTCTCCATAACCTGAGGA) - SEQ ID NO: 34. PCR was performed using Tks gflex DNA polymerase (Takara Bio) for 30 cycles of 98°C for 15 seconds, 60°C for 20 seconds, and 68°C for 30 seconds.

[0448] FIG. 11 shows a diagrammatic representation of the CAPS marker system, and FIG. 12 shows the CAPS marker results for these three accessions: 7482, 7952, and 11361.

[0449] Example 8. Application of the CAPS marker system to commercial and proprietary accessions Using the constructed CAPS marker system, 20 Scaevola aemula cultivars and 19 Scaevola aemula accessions were evaluated, and the results are shown in Table 3 and Figure 14.

[0450] [Table 4]

[0451] Example 9. Introgression of FUSED mutant alleles into a wide range of Scaevola aemula genetic backgrounds by cross-pollination The homozygous FUSED mutant accession 11361, which exhibits floral actinomorphism, was crossed as both male and female parents with several different Scaevola aemula accessions (genotypes normal / normal = NN, mutant / normal = NM, or mutant / mutant = MN). The resulting F1 progeny were evaluated phenotypically for the presence of the mutant FUSED allele, and heterozygotes were identified by testing a large number of plants using the CAPS molecular marker system.

[0452] [Table 5]

[0453] Example 10. Crossing FUSED heterozygotes to determine segregation ratios of the FUSED trait Six accessions were selected based on their ability to produce at least one actinomorph flower during the early flowering stage. This phenotypic characteristic has been shown to correlate with a heterozygous genotype for the mutant FUSED allele. The six accessions were randomly crossed by hand pollination using bulk pollen collected from all six accessions. Seeds were collected and germinated, yielding 133 plants that were grown to flowering maturity. The resulting segregation was as expected, with 25% actinomorph flowering mature plants and 75% plants of normal phenotype reported.

[0454] [Table 6]

[0455] The observed ratio of normal:FUSED mutant plants was 2.8:1, whereas the expected ratio was 3:1. Based on this data, and in agreement with the molecular data presented above, the FUSED allele can be considered a recessive gene.

[0456] [Table 7]

[0457] [Table 8]

[0458] [Table 9]

Claims

1. A Scaevola aemula plant comprising a mutant CYC2 allele characterized by elimination of expression of the CYC2 gene and / or reduced or eliminated activity of the CYC2 protein, wherein the Scaevola aemula plant produces at least one flower having a floral phenotype characterized by actinomorphic arrangement of petals as a result of the plant comprising the mutant CYC2 allele.

2. The flower phenotype is: a) fused dorsal cleavages, and b) Delayed aging The plant of claim 1 further characterized by at least one of:

3. 2. The plant of claim 1, wherein the allele is present in a heterozygous state and the plant expresses the floral phenotype in the first few flowers that develop on the plant, with subsequent flowers having a wild-type appearance.

4. 2. The plant of claim 1, wherein the allele is present in a homozygous state and the plant expresses the floral phenotype in all or nearly all flowers produced.

5. The mutant CYC2 allele is: a) the presence of an adenine (A) at the position corresponding to nucleotide 39 of the sequence of SEQ ID NO: 7; b) the presence of an adenine (A) at the position corresponding to nucleotide 39 of the sequence of SEQ ID NO: 8; c) the presence of an adenine (A) at the position corresponding to nucleotide 99 of the sequence of SEQ ID NO: 24 The plant according to claim 1, characterized by at least one of the following:

6. 6. The plant of claim 5, wherein the adenine (A) is generated by substitution of a cytosine (C) at the same position in the corresponding wild-type sequence.

7. a) SEQ ID NO: 4 is the wild-type sequence corresponding to SEQ ID NO: 7; b) SEQ ID NO:5 is the wild-type sequence corresponding to SEQ ID NO:8; c) SEQ ID NO: 23 is the wild-type sequence corresponding to SEQ ID NO: 24; The plant according to claim 6.

8. The plant or the mutant CYC2 allele comprises: a) SEQ ID NO: 7, b) SEQ ID NO: 8, and c) SEQ ID NO: 24 The plant of claim 1, comprising any one of the sequences:

9. 2. The plant of claim 1, produced from or derived from seeds deposited under accession number: NCIMB 43619.

10. 2. A plant cell, plant part, seed, cutting, cell culture, tissue culture, or callus of or capable of producing the plant of claim 1.

11. below: a) the plant cell, plant part, seed, cutting, cell culture, or callus is produced from the seed deposited under accession number NCIMB 43619; and / or b) The plant cell, plant part, seed, cutting, cell culture, tissue culture, or callus of claim 10, wherein the seed has been deposited under accession number NCIMB43619.

12. 1. A method for producing a Scaevola aemura plant that produces at least one flower having a floral phenotype characterized by a radial arrangement of petals, said method comprising: a) genetically engineering a Scaevola aemura plant to generate a mutant CYC2 allele in said plant, characterized by the elimination of expression of the CYC2 gene and / or the reduction or elimination of the activity of the CYC2 protein; b) gene editing a Scaevola aemura plant to produce the mutant CYC2 allele in the plant; c) inducing a mutation in said plant that generates said mutant CYC2 allele; d) crossing the Scaevola aemura plant of claim 1 or a Scaevola aemura plant containing the mutant CYC2 allele with another plant; e) self-pollinating the Scaevola aemura plant of claim 1 or a plant comprising said mutant CYC2 allele; f) introducing the mutant CYC2 allele into the plant; and g) vegetatively propagating the Scaevola aemura plant of claim 1 or the Scaevola aemura plant containing the mutant CYC2 allele. The method includes at least one of the following:

13. 13. The method of claim 12, comprising testing the produced plant for the presence of the mutant CYC2 allele.

14. 10. A method of producing seeds, said method comprising cultivating the plant of claim 1 and collecting the seeds produced by the grown plant.

15. 1. A method for identifying a Scaevola aemura plant having a genotype that exhibits the production of at least one flower having a floral phenotype characterized by radial arrangement of petals, said method comprising: a) the presence of a mutant CYC2 allele characterized by the elimination of expression of the CYC2 gene and / or the reduction or elimination of the activity of the CYC2 protein; and b) the presence of a marker associated with said mutant CYC2 allele. testing the plant for at least one of wherein any one of a) to b) indicates that the plant produces at least one flower having the above-mentioned floral phenotype.

16. 1. A method for identifying plants having a Scaevola aemura floral phenotype characterized by actinomorphic arrangement of petals, comprising detecting the presence of a marker associated with a mutant CYC2 allele characterized by the elimination of expression of the CYC2 gene and / or the reduction or elimination of the activity of the CYC2 protein, said marker comprising: (i) a nucleotide fragment having the sequence of SEQ ID NO: 7 or 8, which contains an adenine (A) at a position corresponding to nucleotide position 39 of SEQ ID NO: 7 or 8; (ii) a nucleotide fragment having a complementary sequence to the nucleotide fragment of item (i); (iii) a nucleotide fragment having the sequence of SEQ ID NO: 24, including an adenine (A) at a position corresponding to nucleotide position 99 of SEQ ID NO: 24; and / or (iv) a nucleotide fragment having a complementary sequence to the nucleotide fragment of item (iii); The method is selected from the following:

Images