Autoluminescence-based single-channel sequencing method

The autoluminescent sequencing method addresses the high cost and complexity of single-channel sequencing by using bioluminescent signals to distinguish nucleotides, reducing instrument size and improving accuracy, making it more accessible and efficient.

JP7825660B2Active Publication Date: 2026-03-06QINGDAO MGI TECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2024073905
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2024-04-30
Publication Date
2026-03-06
Estimated Expiration
2039-05-15

AI Technical Summary

Technical Problem

Current single-channel sequencing technologies face challenges with high costs and complexity due to the need for external light sources and additional designs to filter background light, leading to increased instrument size and cost, while existing methods like Ion Torrent and Roche 454 suffer from high error rates and insufficient accuracy.

Method used

A sequencing method utilizing autoluminescent signals from bioluminescence or chemiluminescence to distinguish between nucleotides, eliminating the need for external light sources and additional filtering, and incorporating modified nucleotides with protected hydroxyl groups to ensure accurate sequencing.

Benefits of technology

This approach reduces sequencing costs, simplifies instrument design, and enhances sequencing accuracy by using autoluminescent signals, enabling portable and cost-effective nucleic acid sequencing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007825660000015
    Figure 0007825660000015
  • Figure 0007825660000001
    Figure 0007825660000001
  • Figure 0007825660000002
    Figure 0007825660000002
Patent Text Reader

Abstract

To provide a low-cost sequencing method that does not require external light source excitation and does not need to adopt an additional design to filter the background generated by a laser light source.SOLUTION: The present invention provides a sequencing method based on a single fluorescent dye, in which a self-luminescence signal is used to distinguish sequential incorporation of different nucleotides, thereby realizing determination of a polynucleotide sequence.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the field of nucleic acid sequencing. In particular, the present invention provides an autoluminescence-based single-channel sequencing method that uses autoluminescence signals to distinguish the sequential incorporation of different nucleotides, thereby achieving polynucleotide sequence determination. [Background technology]

[0002] DNA sequencing technology includes first-generation DNA sequencing technology, represented by the Sanger sequencing method, and second-generation DNA sequencing technology, represented by the Illumina Hiseq2500, Roche 454, ABI Solid, BGISEQ-500, etc. In 1977, Sanger invented the dideoxy end-termination sequencing method, which became the representative of first-generation sequencing technology. In 2001, the draft human genome was completed relying on first-generation sequencing technology. Sanger sequencing is characterized by simple experimental procedures, intuitive and accurate results, and short experimental time. Sanger sequencing has wide applications in clinical gene mutation detection and genotyping, which require high timeliness of detection results. However, the disadvantages of Sanger sequencing are low throughput and high cost, which limit its application in large-scale gene sequencing. To overcome the disadvantages of Sanger sequencing, second-generation sequencing technology was developed. Compared with first-generation DNA sequencing technology, second-generation DNA sequencing technology has the characteristics of high sequencing throughput, low cost, high degree of automation, and single-molecule sequencing. Taking the Hiseq2500V2 sequencing technology as an example, one experimental process can generate 10-200 gigabytes of data, with the average sequencing cost per base being less than 1 / 1000 of that of Sanger sequencing, and the obtained sequencing results can be directly processed and analyzed by computer. Therefore, second-generation DNA sequencing technology is highly suitable for large-scale sequencing.

[0003] Currently, second-generation DNA sequencing technologies being developed mainly involve sequencing by ligation (SBL) and sequencing by synthesis (SBS). Typical examples of these sequencing technologies include the SOLiD sequencing method developed by Applied Biosystems, the combinatorial probe anchor ligation (cPAL) method independently developed by Complete Genomics, the combinatorial probe anchor synthesis (cPAS) method developed by Beijing Genomics Institute (BGI), and the Illumina sequencing method jointly developed by Illumina Company and Solexa Technology Company. In these sequencing methods, Illumina and Complete Genomics employ optical signal detection methods, and typically require the use of four fluorescent dyes to label four types of bases (A, T / U, C, and G) to identify and distinguish these four types of bases. In this case, the sequencing device must be equipped with at least two monochromatic excitation light sources and at least two cameras to read the fluorescent signals carried by each base, which results in high manufacturing costs and a huge volume of the sequencing device.

[0004] Over the past decade, second-generation gene sequencing technology has gradually grown from an emerging technology to a mainstream sequencing method, gradually becoming an important testing tool in the clinical field, thereby playing an increasingly important role in the prevention and control of infectious diseases, the diagnosis of genetic diseases, and non-invasive prenatal screening. In order to further expand the sequencing market and make sequencers more accessible to the general public, the development of low-cost, compact sequencers has gradually become a development trend in the sequencing field. As classical methods of second-generation sequencing technology, the three sequencing methods based on four channels, two channels, and single channels have their own unique advantages; compared with other sequencing methods, single-channel sequencing has the advantages of fewer consumables, lower costs, easier miniaturization, and portable instrumentation, and has gradually become a development trend in the sequencing field. Currently, single-color channel-based products on the market mainly include the Ion Torrent series sequencers, 454 sequencers, and the latest Illumina Iseq100.

[0005] Among current single-channel sequencing technologies, the Ion Torrent series of instruments has a high error rate in polymer structure sequencing, limiting its use. Similarly, Roche's 454 instrument is also gradually withdrawing from the sequencing market due to insufficient sequencing accuracy and high sequencing costs. Illumina's Iseq100 is based on monochromatic fluorescence technology and semiconductor technology, which realizes miniaturization of the sequencer while maintaining high sequencing quality. However, since the optical signal is excited by a laser, the instrument is equipped with an additional laser, which increases the volume of the instrument. In addition, to avoid background values ​​generated by the excitation light, special processing must be implemented on the semiconductor chip to filter out the background generated by the excitation light, which will cause high costs and increase sequencing costs.

[0006] Therefore, there is a need in the art for a low-cost sequencing method that does not require external light source excitation and does not require the adoption of additional designs to filter the background generated by laser light sources. Summary of the Invention [Means for solving the problem]

[0007] To solve the above technical problems, the inventors of the present application have developed a new sequencing method that uses an autoluminescent signal to distinguish between four bases: A, (T / U), C, and G. Therefore, the luminescent signal used to perform the sequencing method of the present invention is derived from bioluminescence or chemiluminescence, eliminating the need for an additional laser or additional design to filter the background generated by the laser light source, thereby reducing sequencing costs. The sequencing device used in the sequencing method of the present invention can even be conveniently carried for immediate / on-site detection. In addition, the 3'-terminal hydroxyl of the deoxyribonucleotides used in the sequencing method of the present invention is modified and blocked. During the sequencing process, only one deoxyribonucleotide can be synthesized in each reaction, ensuring that only one deoxyribonucleotide is bound in each reaction, thereby improving sequencing accuracy.

[0008] In one embodiment, the present invention provides a method for sequencing a nucleic acid molecule, comprising the steps of: (1) providing a nucleic acid molecule to be sequenced linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, (T / U), C, and G, respectively, and have the ability of base-complementary pairing; and the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing a primer to the nucleic acid molecule to be sequenced and forming a support-linked duplex by using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) performing a nucleotide polymerization reaction using a polymerase under conditions that allow the polymerase to perform a nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) contacting the duplex from the previous step with two different luciferases to carry out a ligation reaction, where the two luciferases can be specifically ligated to the first molecular label and the second molecular label, respectively; then, in the presence of a substrate, the luciferases catalyze a luminescence reaction, and the emitted luminescence signal is detected; (6) removing the molecular label of each nucleotide; (7) Optionally, repeating steps (3) through (7) to obtain sequence information for the nucleic acid molecule. The present invention provides a method comprising:

[0009] In an embodiment of the present invention, the autoluminescence detection of the nucleotide to be sequenced is realized through the ligation of luciferase with a nucleotide derivative, thereby eliminating the need for an additional excitation light source.In a specific embodiment, the ligation of luciferase with a nucleotide is achieved through the specific binding of a label on the luciferase with the corresponding label on the nucleotide derivative.In a specific embodiment, the first nucleotide is ligated with a first luciferase, the second nucleotide is ligated with a second luciferase, the third nucleotide is ligated with a first luciferase and a second luciferase, and the fourth nucleotide is not ligated with any luciferase.Then, the luminescence signals of the four bases are detected by passing through the corresponding substrates of the two luciferases; when the substrate of the first luciferase is passed through, the first and third nucleotides emit light, and when the substrate of the second luciferase is passed through, the second and third nucleotides emit light, so that the bases can be identified according to the light emission of the four nucleotides.

[0010] Thus, in an exemplary embodiment, the method for sequencing a nucleic acid molecule of the present invention comprises the following steps: (1) providing a nucleic acid molecule to be sequenced linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, (T / U), C, and G, respectively, and have the ability of base-complementary pairing; and the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing a primer to the nucleic acid molecule to be sequenced and forming a support-linked duplex by using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) performing a nucleotide polymerization reaction using a polymerase under conditions that allow the polymerase to perform a nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) removing the solution phase of the reaction system from the previous step, leaving the double strand linked to the support, and adding two different luciferases to perform a ligation reaction, wherein the two luciferases can be specifically ligated to the first molecular label and the second molecular label, respectively; (6) removing unbound luciferase by using an elution buffer; (7) adding a substrate for the first luciferase and simultaneously detecting a luminescent signal; (8) removing the solution from the reaction of the previous step; (9) adding a substrate for a second luciferase and simultaneously detecting a luminescent signal; (10) removing the solution from the reaction of the previous step; (11) removing the molecular label and the 3' protecting group of each nucleotide; (12) Optionally, removing the solution from the reaction of the previous step; (13) Optionally, repeating steps (3) to (12) to obtain sequence information of the nucleic acid molecule. Includes.

[0011] In specific embodiment, the ligation of two kinds of luciferase and nucleotide can be carried out separately.For example, firstly add the first luciferase that is labeled, and allow the first luciferase to undergo the ligation reaction with the nucleotide labeled with the first molecule, then use elution buffer to remove the first luciferase that is not bound, add the substrate of the first luciferase, and simultaneously detect luminescence signals; then add the second luciferase that is labeled secondly, and allow the second luciferase to undergo the ligation reaction with the nucleotide labeled with the second molecule, then use elution buffer to remove the second luciferase that is not bound, add the substrate of the second luciferase, and simultaneously detect luminescence signals.Specifically, the present invention provides a method for sequencing nucleic acid molecules, comprising the following steps: (1) providing a nucleic acid molecule to be sequenced linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, (T / U), C, and G, respectively, and have the ability of base-complementary pairing; and the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing a primer to the nucleic acid molecule to be sequenced and forming a support-linked duplex by using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) performing a nucleotide polymerization reaction using a polymerase under conditions that allow the polymerase to perform a nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) removing the solution phase of the reaction system from the previous step, leaving the double strand linked to the support, and adding a first luciferase to carry out a ligation reaction, wherein the first luciferase can specifically bind to the first molecular label; (6) removing unbound first luciferase by using an elution buffer; (7) adding a substrate for the first luciferase and simultaneously detecting a luminescent signal; (8) removing the solution from the reaction of the previous step; (9) adding a second luciferase to perform a ligation reaction, wherein the second luciferase can specifically bind to the second molecular label; (10) removing unbound second luciferase by using an elution buffer; (11) adding a substrate for a second luciferase and simultaneously detecting a luminescent signal; (12) removing the solution from the reaction of the previous step; (13) optionally removing the molecular label and 3' protecting group of each nucleotide; (14) Optionally, repeating steps (3) to (13) or (3) to (11) one or more times to obtain sequence information of the nucleic acid molecule. The present invention provides a method comprising:

[0012] In specific embodiments, two luciferases can be the same, and the two luciferases can be specifically linked to the first molecular label and the second molecular label, respectively; that is, only one luciferase and substrate are used, and the first luciferase that is first labeled and the second luciferase that is second labeled are separately ligated to nucleotide.For example, the first luciferase that is first labeled is first added, and the first luciferase is allowed to undergo the ligation reaction with the nucleotide labeled with the first molecular label, then the elution buffer is used to remove the unbound first luciferase, and the luciferase substrate is added, and luminescence signals are detected simultaneously;Then the second luciferase that is second labeled is added, and the second luciferase is allowed to undergo the ligation reaction with the nucleotide labeled with the second molecular label, then the elution buffer is used to remove the unbound second luciferase, and the luciferase substrate is added, and luminescence signals are detected simultaneously. Specifically, the present invention provides a method for sequencing a nucleic acid molecule, comprising the steps of: (1) providing a nucleic acid molecule to be sequenced linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, (T / U), C, and G, respectively, and have the ability of base-complementary pairing; and the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing a primer to the nucleic acid molecule to be sequenced and forming a support-linked duplex by using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) performing a nucleotide polymerization reaction using a polymerase under conditions that allow the polymerase to perform a nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) removing the solution phase of the reaction system from the previous step, leaving the double strand linked to the support, and adding a first luciferase to perform a ligation reaction, wherein the first luciferase can specifically bind to the first molecular label; (6) removing unbound first luciferase by using an elution buffer; (7) adding a luciferase substrate and simultaneously detecting a luminescent signal; (8) removing the solution from the reaction of the previous step; (9) adding a reagent for denaturing luciferase; (10) removing the solution from the reaction of the previous step; (11) adding a second luciferase to perform a ligation reaction, wherein the second luciferase can specifically bind to a second molecular label; (12) removing unbound second luciferase by using an elution buffer; (13) adding a luciferase substrate and simultaneously detecting a luminescent signal; (14) Optionally, removing the solution from the reaction of the previous step; (15) optionally removing the molecular label and 3' protecting group of each nucleotide; (16) Optionally, repeating steps (3) to (15) or (3) to (13) one or more times to obtain sequence information of the nucleic acid molecule. The present invention provides a method comprising:

[0013] In another aspect, the present invention provides a kit for sequencing a polynucleotide, comprising: (a) four compounds, each of which is a derivative of nucleotide A, (T / U), C, and G, and has the ability of base-complementary pairing; the hydroxyl (—OH) at the 3′ position of the ribose or deoxyribose of each of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; four compounds, wherein the fourth compound is not linked to any molecular label; and (b) two luciferases, each capable of specifically binding to a first molecular label and a second molecular label, and the two luciferases may be the same or different; The present invention also relates to a kit comprising:

[0014] In some preferred embodiments, the kits of the present invention further comprise reagents and / or equipment for extracting nucleic acid molecules from a sample; reagents for pre-treating nucleic acid molecules; a support for linking nucleic acid molecules to be sequenced; reagents for linking (e.g., covalently or non-covalently linking) nucleic acid molecules to be sequenced to a support; primers for initiating nucleotide polymerization reactions; a polymerase for performing nucleotide polymerization reactions; one or more buffer solutions; one or more wash solutions; or any combination thereof. [Brief explanation of the drawings]

[0015] [Figure 1] 1 shows the conjugation of an antibody to Nluc, where the enzyme in the diagram refers to Nluc and the antibody in the diagram refers to digoxigenin antibody. DETAILED DESCRIPTION OF THE INVENTION

[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. All patents, applications, and other publications mentioned herein are incorporated by reference in their entirety. In the event that a definition set forth herein conflicts or is inconsistent with a definition set forth in a patent, application, or other publication incorporated herein by reference, the definition set forth herein shall control.

[0017] As used herein, the term "polynucleotide" refers to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or analogs of deoxyribonucleic acid and ribonucleic acid. Polynucleotides can be single-stranded, double-stranded, or contain both single- and double-stranded sequences. Polynucleotide molecules can be derived from double-stranded form of DNA (dsDNA) (e.g., genomic DNA, PCR and amplification products, etc.), or from single-stranded form of DNA (ssDNA) or RNA and converted to dsDNA, or vice versa. The exact sequence of a polynucleotide molecule can be known or unknown. The following are illustrative examples of polynucleotides: a gene or gene fragment (e.g., a probe, primer, EST or SAGE tag), genomic DNA, a genomic DNA fragment, an exon, an intron, messenger RNA (mRNA), transfer RNA, ribosomal RNA, a ribozyme, a cDNA, a recombinant polynucleotide, a synthetic polynucleotide, a branched polynucleotide, a plasmid, a vector, an isolated DNA of any sequence, an isolated RNA of any sequence, and a nucleic acid probe, primer, or amplified copy of any of the above sequences.

[0018] A polynucleotide may comprise nucleotides or nucleotide analogs. Nucleotides typically comprise a saccharide (i.e., ribose or deoxyribose), a base, and at least one phosphate group. Nucleotides can be abasic (i.e., containing no base). Nucleotides include deoxyribonucleotides, modified deoxyribonucleotides, ribonucleotides, modified ribonucleotides, peptide nucleotides, modified peptide nucleotides, modified saccharide-phosphate backbone nucleosides, and mixtures thereof. Examples of nucleotides include, for example, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), deoxyadenosine monophosphate (dAMP), deoxyadenosine monophosphate (dAMP), deoxyadenosine tri ... monophosphate (dAMP), deoxyadenosine triphosphate (dAMP), deoxyadenosine monophosphate (dAMP), deoxyadenosine monophosphate Nucleotide analogs include cyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxycytidine triphosphate (dCDP), deoxycytidine triphosphate (dCTP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), and deoxyuridine triphosphate (dUTP). Nucleotide analogs containing modified bases can also be used in the methods described herein.Exemplary modified bases that may be included in a polynucleotide, regardless of whether the modified base has a natural backbone or a similar structure, include, for example, inosine, xanthine, hypoxanthine, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5-hydroxymethylcytosine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propylguanine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halogenated uracil, 15-halogenated cytosine, 5-propynyluracil, 5-propynylcytosine. nucleotides, such as 5-uracil, 4-thiouracil, 8-halogenated adenines or guanines, 8-aminoadenine or guanine, 8-thioadenine or guanine, 8-thioalkyladenines or guanines, 8-hydroxyadenine or guanine, 5-halogenated uracil or cytosine, 7-methylguanine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, etc. As is known in the art, certain nucleotide analogs, such as adenosine 5'-phosphoryl sulfate, cannot be incorporated into a polynucleotide.

[0019] Generally speaking, a nucleotide includes the nucleotides A, C, G, T, or U. As used herein, the term "nucleotide A" refers to a nucleotide containing adenine (A), such as ATP or dATP, or a modified or analogue thereof. "nucleotide G" refers to a nucleotide containing guanine (G), such as GTP or dGTP, or a modified or analogue thereof. "nucleotide C" refers to a nucleotide containing cytosine (C), such as CTP or dCTP, or a modified or analogue thereof. "nucleotide T" refers to a nucleotide containing thymine (T), such as TTP or dTTP, or a modified or analogue thereof. "nucleotide U" refers to a nucleotide containing uracil (U), such as UTP or dUTP, or a modified or analogue thereof.

[0020] Nucleotide labeling The present invention relates to labeling nucleotides with various labels, either individually or in combination, so that various luciferases can be ligated to the nucleotides. As used herein, the molecular labels for labeling nucleotides and the labels that specifically bind to the molecular labels can be any paired molecules that can specifically bind to each other. Specific binding between the paired members allows the ligation of the nucleotide to the luciferase. Exemplary pairing members include, but are not limited to, (a) haptenic or antigenic compounds combined with corresponding antibodies or binding portions or fragments thereof, such as digoxigenin-digoxigenin antibody, N3G-N3G antibody, FITC-FITC antibody, etc.; (b) nucleic acid aptamers and proteins; (c) non-immune binding pairs (e.g., biotin-avidin, biotin-streptavidin, biotin-neutravidin); (d) hormone-hormone binding protein; (e) receptor-receptor agonist or antagonist; (f) lectin-carbohydrate; (g) enzyme-enzyme cofactor; (h) enzyme-enzyme inhibitor; and (i) pairs of complementary oligonucleotides or polynucleotides capable of forming a nucleic acid duplex.

[0021] In a specific embodiment, the first and second molecular labels are small molecule labels selected from biotin, digoxigenin, N3G, or FITC. Two luciferases can specifically bind to the first and second molecular labels, respectively. For example, in a specific embodiment, the first molecular label is biotin, and the first luciferase can be a streptavidin-labeled luciferase; the second molecular label is digoxigenin, and the second luciferase can be a digoxigenin-antibody-labeled luciferase different from the first luciferase, or the second luciferase can also be a digoxigenin-antibody-labeled luciferase that is the same as the first luciferase. Sources of luciferase include, but are not limited to, fireflies, Gaussia, Renilla, and other organisms. For example, the streptavidin-labeled luciferase may be SA-Gluc:streptavidin-Gaussia princeps luciferase from Adivity Company, and the digoxigenin antibody-labeled luciferase may be digoxigenin antibody-Gluc or digoxigenin antibody-Nluc.

[0022] As used herein, the phrase "a first compound is linked to a first molecular label" means that the entire first compound is linked to the first molecular label, or that a portion of the first compound is linked to the first molecular label, while the remainder of the first compound is not linked to a molecular label. Similarly, the phrase "a second compound is linked to a second molecular label" means that the entire second compound is linked to the second molecular label, or that a portion of the second compound is linked to the second molecular label, while the remainder of the second compound is not linked to a molecular label. The phrase "a third compound is linked to a first molecular label and a second molecular label" means that the entire third compound is linked to the first molecular label and a second molecular label, or that a portion of the third compound is linked to the first molecular label and a second molecular label, while the remainder of the third compound is not linked to a molecular label.

[0023] Polynucleotide sequencing Preferably, the nucleotide ligated with various luciferases of the present invention is suitable for synthetic sequencing.The synthetic sequencing method used herein is the synthetic sequencing of various types well known in the art.Basically, synthetic sequencing involves first hybridizing the nucleic acid molecule to be sequenced with sequencing primer, and then polymerizing the nucleotide ligated with various luciferases described herein at the 3' end of sequencing primer by using the nucleic acid molecule to be sequenced as template in the presence of polymerase.After polymerization, the nucleotide is identified by detecting the luminescence signal emitted by luciferase.After removing luciferase from labeled nucleotide, the next polymer sequencing cycle is carried out.

[0024] A method for determining the sequence of a target polynucleotide can be performed as follows: the target polynucleotide sequence is denatured, the target polynucleotide is contacted with various nucleotides to form complements of the target nucleotides, and the incorporated nucleotides are detected. The method utilizes polymerization, which allows a polymerase to extend the complementary strand by incorporating the correct nucleotide complementary to the target. The polymerization reaction also requires a special primer to initiate polymerization.

[0025] For each round of reaction, nucleotide incorporation is performed by a polymerase, and then the incorporation events are measured. Many different polymerases exist, and it is easy for a person skilled in the art to determine the most appropriate polymerase. Preferred enzymes include DNA polymerase I, Klenow fragment, DNA polymerase III, T4 or T7 DNA polymerase, Taq polymerase, or vent polymerase. It is also possible to use polymerases engineered to have specific properties.

[0026] The sequencing method is preferably performed on target polynucleotides disposed on a solid support. Multiple target polynucleotides can be immobilized on the solid support or attached to particles such as microspheres through linker molecules, which can also be attached to the solid support material.

[0027] Polynucleotides can be attached to solid supports by a variety of methods, including the use of biotin-streptavidin interactions. Methods for immobilizing polynucleotides on solid supports are well known in the art and include lithography techniques and spotting individual polynucleotides at specific locations on the solid support. Suitable solid supports are known in the art and include glass slides and beads, ceramic and silicon surfaces, and plastic materials. The support is typically flat, although microbeads (microspheres) can also be used, and the latter can be attached to other solid supports by known methods. Microspheres can have any suitable size, with microsphere diameters typically ranging from 10 to 100 nanometers. In a preferred embodiment, polynucleotides are directly attached to a flat surface, preferably a flat glass surface. Linkage is preferably in the form of a covalent bond. The arrays used are preferably single-molecule arrays, containing polynucleotides located in unique, optically analyzable regions, as described, for example, in WO 00 / 06770.

[0028] The conditions required for polymerization are well known to those skilled in the art. To carry out a polymerization reaction, a primer sequence must usually first be annealed to the target polynucleotide. The primer sequence is recognized by the polymerase and serves as an initiation site for subsequent extension of the complementary strand. The primer sequence may also be added to the target polynucleotide as an independent component. In addition, the primer and target polynucleotide may each be part of a single-stranded molecule, and the primer portion and the target portion form an intramolecular duplex, i.e., a hairpin loop structure. The structure may be immobilized to a solid support through any position of the molecule. Other conditions required for a polymerase reaction are well known to those skilled in the art, and these conditions include temperature, pH, and buffer composition.

[0029] The labeled nucleotides of the invention are then contacted with the target polynucleotide and allowed to polymerize. The nucleotides can be added sequentially, i.e., each type of nucleotide (A, C, G, or T / U) is added separately or simultaneously.

[0030] The polymerization step is allowed to proceed for a time sufficient to incorporate one nucleotide.

[0031] Unincorporated nucleotides are then removed, for example, by removing the solution phase of the reaction in the previous step, leaving the duplex attached to the support.

[0032] Then, two luciferases containing different luciferases can be added to carry out ligation reaction.The two luciferases can be specifically bound to the molecular labels for labeling nucleotides, thereby realizing the ligation of luciferase to the incorporated nucleotide.Then, by adding the corresponding substrate of luciferase and detecting luminescence signals, the identification of the incorporated nucleotide can be achieved.Two luciferases containing the same luciferase can also be added to carry out ligation reaction.Then, by adding the corresponding substrate of luciferase and detecting luminescence signals, the identification of the incorporated nucleotide can be achieved.

[0033] In a specific embodiment, the four deoxyribonucleotide analogs are labeled with different small molecule labels, i.e., biotin (abbreviated as B) and digoxigenin (abbreviated as D). For example, nucleotide A is labeled with B, nucleotide C is labeled with B and D, nucleotide T is labeled with D, and nucleotide G is unlabeled. The 3'-terminal hydroxyl groups of the four deoxyribonucleotide analogs labeled with different small molecules are all blocked to ensure that only one deoxyribonucleotide is attached during each sequencing reaction. During the sequencing reaction, a mixture of the four labeled deoxyribonucleotide analogs and a sequencing polymerase is first introduced under the action of the polymerase, and one deoxyribonucleotide analog is incorporated into the 3'-end of the growing nucleic acid chain according to the principle of base-complementary pairing. Unattached deoxyribonucleotide analogs can be removed by removing the solution phase of the reaction system in the previous step and leaving the duplex attached to the support. Then, two kinds of luciferases containing different luciferases are added, the first luciferase is labeled with streptavidin, and the first luciferase labeled with streptavidin binds to nucleotide A or nucleotide C labeled with small molecule B; the second luciferase is labeled with digoxigenin antibody, and the second luciferase labeled with digoxigenin antibody binds to nucleotide C or nucleotide T labeled with small molecule D. After using an elution buffer to remove unbound luciferase, the substrate of the first luciferase is added, and the nucleotide ligated with the first luciferase emits light, and the signal is detected by a detector; the substrate of the second luciferase is added, and the nucleotide ligated with the second luciferase emits light, and the signal is detected by a detector, thereby obtaining the luminescence shown in the following table, and the base can be identified.

[0034] [Table 1]

[0035] In a specific embodiment, the ligation of two luciferases containing different luciferases to the labeled nucleotide and the signal detection can be performed separately. First, a first luciferase is added, and the first luciferase is labeled with streptavidin and binds to nucleotide A or nucleotide C labeled with small molecule B. After removing unbound first luciferase using an elution buffer, a substrate for the first luciferase is added, and the ligated nucleotide with the first luciferase emits light, and the signal is detected by a detector. After removing the reaction solution, a second luciferase labeled with a digoxigenin antibody is added, and the second luciferase labeled with a digoxigenin antibody binds to nucleotide C or nucleotide T labeled with small molecule D. Then, using an elution buffer, the unbound second luciferase is removed, and a substrate for the second luciferase is added. The nucleotide ligated with the second luciferase emits light, and the signal is detected by a detector. Thus, the luminescence shown in the table above is obtained, and base identification can be performed.

[0036] In another specific embodiment, the ligation of two luciferases containing the same luciferase to labeled nucleotides and signal detection are performed separately. First, a first luciferase is added, which is labeled with streptavidin and binds to nucleotide A or nucleotide C labeled with small molecule B. After removing unbound first luciferase using an elution buffer, a luciferase substrate is added, and the ligated nucleotide to the first luciferase emits light, and the signal is detected by a detector. Then, a reagent for denaturing the first luciferase is added; after removing the reaction solution, a second luciferase is added, which is labeled with a digoxigenin antibody and binds to nucleotide C or nucleotide T labeled with small molecule D; then, by using an elution buffer, the unbound second luciferase is removed, and a luciferase substrate is added; the base ligated with the second luciferase emits light, and the signal is detected by a detector. Thus, the luminescence shown in the table above is obtained, and the base can be identified.

[0037] Fluorescent signal detection The means for detecting fluorescent signals are well known in the art.For example, detecting fluorescent signals can be realized by a device that detects the wavelength of fluorescence.Such devices are well known in the art.For example, such a device can be a confocal scanning microscope that scans the surface of solid support with a laser to image the fluorophores that are directly bound to the nucleic acid molecules to be sequenced.In addition, a highly sensitive 2-D detector, such as a charge-coupled detector (CCD), can be used to observe each signal that is generated.For example, other techniques, such as scanning near-field optical microscope (SNOM), can also be used.

[0038] Removal of signs After detection, appropriate conditions can be used to remove the label attached to the nucleotide.

[0039] In specific embodiments, the labeled nucleotide of the invention also has a 3'-protecting group. In some embodiments of the invention, the protecting group and the label are typically two different groups on the 3'-blocked labeled nucleotide, although in other embodiments, the protecting group and the label can also be the same group.

[0040] As used herein, the term "protecting group" refers to a group that prevents a polymerase (which incorporates a nucleotide containing the group into a polynucleotide chain being synthesized) from continuously catalyzing the incorporation of another nucleotide after the nucleotide containing the group has been incorporated into the polynucleotide chain being synthesized. Such protecting groups are also referred to herein as 3'-OH protecting groups. A nucleotide containing such a protecting group is also referred to herein as a 3'-blocked nucleotide. A protecting group can be any suitable group that can be added to a nucleotide, so long as it can prevent additional nucleotide molecules from being incorporated into a polynucleotide chain and can be easily removed from the saccharide portion of the nucleotide without damaging the polynucleotide chain. In addition, a nucleotide modified with a protecting group should be resistant to a polymerase or other suitable enzyme that incorporates the modified nucleotide into a polynucleotide chain. Therefore, an ideal protecting group exhibits long-term stability, can be efficiently incorporated by a polymerase, prevents secondary or further incorporation of nucleotides, and can be removed under mild conditions, preferably aqueous conditions, that do not damage the structure of the polynucleotide.

[0041] The prior art describes a variety of protecting groups that meet the above requirements. For example, International Publication No. 91 / 06678 discloses that 3'-OH protecting groups include esters and ethers, -F, -NH, -OCH, -N, -OPO, -NHCOCH, 2-nitrophenyl carbonate, 2,4-hyposulfonyldinitro, and tetrahydrofuran ether. Metzker et al. (Nucleic Acids Research, 22(20):4259-4267, 1994) disclose the synthesis and application of eight 3'-modified 2-deoxyribonucleoside 5'-triphosphates (3'-modified dNTPs). International Publication No. 2002 / 029003 describes the use of an allyl protecting group to cap the 3'-OH group of a growing DNA chain in a polymerase reaction. Preferably, various protecting groups reported in WO2014139596 and WO2004 / 018497 may be used, including, for example, those 3'-hydroxyl protecting groups (i.e., protecting groups) illustrated in Figure 1A of WO2014139596 and those defined in the claims, as well as those illustrated in Figures 3 and 4 of WO2004 / 018497 and those defined in the claims. All of the above references are incorporated herein by reference in their entirety.

[0042] Those skilled in the art will understand how to attach an appropriate protecting group to the ribose ring to block interactions with the 3'-OH. The protecting group can be attached directly to the 3' position or can be attached to the 2' position (the protecting group has sufficient size or charge to block interactions at the 3' position). In addition, protecting groups can be attached at the 3' and 2' positions and cleaved to expose the 3'-OH group.

[0043] After successfully incorporating a 3'-blocked nucleotide into a growing nucleic acid chain, sequencing protocols require the removal of the protecting group to create a 3'-OH site available for subsequent chain synthesis. The reagents used herein that can remove the protecting group from a modified nucleotide depend largely on the protecting group used. For example, removal of an ester protecting group from a 3'-hydroxyl group is usually achieved by alkaline hydrolysis. The ease of removing a protecting group varies greatly; generally, the greater the electronegativity of the substituent on the carbonyl carbon, the greater the ease of removal. For example, the highly electronegative trifluoroacetate group can be rapidly cleaved from a 3'-hydroxyl group in methanol at pH 7 (Cramer et al., 1963), and therefore, the trifluoroacetate group is unstable during polymerization at this pH. Phenoxyacetate groups are cleaved within less than one minute, but a significantly higher pH is required, for example, by using NH- / methanol (Reese and Steward, 1968). Various hydroxy protecting groups can be selectively cleaved using chemical methods other than alkaline hydrolysis. The 2,4-dinitrophenylthio group can be rapidly cleaved by treatment with nucleophiles such as thiophenol and thiosulfate (Letsinger et al., 1964). Allyl ethers can be cleaved by treatment with Hg(II) in acetone / water (Gigg and Warren, 1968). Tetrahydrothianyl ethers can be removed under neutral conditions using Ag(I) or Hg(II) (Cohen and Steele, 1966; Cruse et al., 1978). Photochemical deblocking can be used with photochemically cleavable protecting groups. There are several protecting groups that can be used in this method. The use of o-nitrobenzyl ether as a protecting group for the 2'-hydroxyl functionality of ribonucleosides is known and documented (Ohtsuka et al., 1978); o-nitrobenzyl ether is removed by irradiation at 260 nm. The alkyl carbonate o-nitrobenzyl carbonate protecting group is also removed by irradiation at pH 7 (Cama and Christensen, 1978).Enzymatic deblocking of the 3'-OH protecting group is also possible. It has been demonstrated that T4 polynucleotide kinase can convert 3'-phosphate ends to 3'-hydroxyl ends, which can then be used as primers for DNA polymerase I (Henner et al., 1983). This 3'-phosphatase activity is used to remove the 3' protecting group of those dNTP analogs that contain phosphate as the protecting group.

[0044] Other reagents capable of removing protecting groups from 3'-blocked nucleotides include, for example, phosphines (e.g., tris(hydroxymethyl)phosphine (THP)) capable of removing azide-containing 3'-OH protecting groups from nucleotides (for this application of phosphines, see, for example, the description in WO2014139596, the entire contents of which are incorporated herein by reference).Other reagents capable of removing protecting groups from 3'-blocked nucleotides also include, for example, the corresponding reagents described on pages 114-116 of WO2004 / 018497 for removing 3'-allyl, 3,4-dimethoxybenzyloxymethyl, or fluoromethoxymethyl groups used as 3'-OH protecting groups.

[0045] In an embodiment of the present invention, the label of the nucleotide is preferably removed together with the protecting group after detection.

[0046] In certain embodiments, the label may be incorporated into a protecting group, thereby allowing the label to be removed along with the protecting group after the 3' blocked nucleotide is incorporated into the nucleic acid strand.

[0047] In other embodiments, the label can be attached to the nucleotide using a linking group and a protecting group separately. Such a label can be attached, for example, to the purine or pyrimidine base of the nucleotide. In certain embodiments, the linking group used is cleavable. The use of a cleavable linking group ensures that the label can be removed after detection, and the removal of the label avoids any signal interference with any subsequently incorporated labeled nucleotide. In other embodiments, a non-cleavable linking group can be used because, after the labeled nucleotide is incorporated into the nucleic acid chain, no subsequent nucleotide incorporation is required, and therefore it is not necessary to remove the label from the nucleotide.

[0048] In other embodiments, the label and / or linking group may have a size or structure sufficient to block incorporation of other nucleotides into a polynucleotide chain (i.e., the label itself may act as a blocking group). Blocking may be due to steric hindrance, or blocking may be due to a combination of size, charge, and structure.

[0049] Cleavable linking groups are well known in the art, and can be attached to nucleotide bases and labels using conventional chemical methods. The linking group can be attached to any position of the nucleotide base, provided that Watson-Crick base pairing can still occur. For purine bases, the linking group is preferably attached through the 7-position of a purine or a preferred deazapurine analog, through an 8-modified purine, through an N-6 modified adenine, or through an N-2 modified guanine. For pyrimidines, the linking group is preferably attached through the 5-position of cytosine, thymine, and uracil, and through the N-4 position of cytidine.

[0050] Use of the term "cleavable linker" does not imply that the entire linker must be removed (e.g., from the nucleotide base). If the label is attached to the base, the nucleoside cleavage site may be placed at a position on the linker that will ensure that a portion of the linker remains attached to the nucleotide base after cleavage.

[0051] Suitable linking groups include, but are not limited to, disulfide linkers, acid-labile linkers (including dialkoxybenzyl, Sieber, indole, and tert-butyl Sieber linkers), electrophilic cleavable linkers, nucleophilic cleavable linkers, photocleavable linkers, linkers that can be cleaved under reductive and oxidative conditions, safety-catch linkers, and linkers that can be cleaved through elimination mechanisms. Suitable linkers can be modified with standard chemical protecting groups, as disclosed in the following documents: Greene & Wuts, "Protecting Groups in Organic Synthesis," John Wiley & Sons. Guillier et al. disclosed other suitable cleavable linkers for solid-phase synthesis (Chem. Rev. 100:2092-2157, 2000).

[0052] Linking groups can be cleaved by any suitable method, including exposure to acids, bases, nucleophiles, electrophiles, free radicals, metals, reducing or oxidizing reagents, light, temperature, enzymes, etc. Suitable methods for cleaving various cleavable linking groups will be exemplarily described below. Generally, cleavable linking groups can be cleaved under the same conditions as those of protecting groups, thereby requiring only one treatment to remove the label and protecting group.

[0053] Linking groups for electrophilic cleavage are typically cleaved by protons, including acid-sensitive cleavage. Suitable electrophilic cleavable linking groups include modified benzyl systems such as trityl, p-hydrocarbonyloxybenzyl esters, and p-hydrocarbonyloxybenzyl amides. Other suitable linking groups include tert-butoxycarbonyl (Boc) groups and acetal systems. To prepare suitable linking molecules, it is also possible to consider the use of sulfophilic metals such as nickel, silver, or mercury in cleaving thioacetals or other sulfur-containing protecting groups. Linking groups for nucleophilic cleavage include groups that are unstable in water (i.e., easily cleaved at alkaline pH), such as esters, and groups that are labile to non-aqueous nucleophiles. Fluoride ions can be used to cleave the silicon-oxygen bond in groups such as triisopropylsilane (TIPS) or tert-butyldimethylsilane (TBDMS). Photocleavable linking groups are widely used in saccharide chemistry. Preferably, the light required to activate cleavage does not affect other components in the modified nucleotide. For example, if a fluorophore is used as a label, it is preferable that the fluorophore absorbs light at a different wavelength than the light required to cleave the linking molecule. Suitable linking groups include those based on O-nitrobenzyl compounds and nitroveratryl compounds. Linking groups based on benzoin chemistry can also be used (Lee et al., J. Org. Chem. 64:3454-3460, 1999). A variety of linking groups susceptible to reductive cleavage are known. Catalytic hydrogenation using a palladium-based catalyst has been used to cleave benzyl and benzyloxycarbonyl groups. Disulfide bond reduction is also known in the art. Oxidation-based methods are well known in the art. These methods include oxidation of hydrocarbonyloxybenzyl groups and oxidation of sulfur- and selenium-based linking groups. It is also within the scope of the present invention to use aqueous iodine to cleave disulfide and other sulfur- or selenium-based linking groups. Safety-catch linkers are those that are cleaved in two steps. In the preferred system, the first step is the generation of a reactive nucleophilic center, followed by a second step involving intramolecular cyclization that results in cleavage.For example, a levulinate linkage can be treated with hydrazine or photochemical methods to release an activated amine, which then cyclizes and cleaves an ester elsewhere in the molecule (Burgess et al., J. Org. Chem. 62:5165-5168, 1997). Elimination reactions can also be used to cleave linking groups. Base-catalyzed elimination of groups such as fluorenylmethoxycarbonyl and cyanoethyl, as well as palladium-catalyzed reductive elimination of allylic systems, can be used.

[0054] In certain embodiments, the linking group may comprise a spacer unit. The length of the linking group is not critical, so long as the label and nucleotide are kept at a sufficient distance so as not to interfere with the interaction between the nucleotide and the enzyme.

[0055] In certain embodiments, the linking group may comprise a functional group similar to the 3'-OH protecting group. This would allow only a single treatment to be required to remove the label and the protecting group. Particularly preferred linking groups are azide-containing linking groups that can be cleaved with phosphines.

[0056] The reagent that can remove the label from the modified nucleotide used herein depends largely on the label that is used.For example, if the label incorporates a protecting group, the reagent for removing the protecting group described above is used to remove the label.Alternatively, if the label is attached to the base of the nucleotide through a cleavable linking group, the reagent for cleaving the linking group described above is used to remove the label.In a preferred embodiment, for example, if the linking group is made up of the same functional group as the 3'-OH protecting group, the same reagent is used to remove the label and the protecting group from the modified nucleotide.

[0057] kit The present invention provides (a) four compounds, each of which is a derivative of nucleotides A, (T / U), C, and G, and has the ability of base-complementary pairing; and the hydroxyl (—OH) at the 3′ position of the ribose or deoxyribose of each of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; a fourth compound that is not linked to any molecular label; and (b) two different luciferases, each capable of specifically binding to a first molecular beacon and a second molecular beacon, Also provided is a kit for sequencing a polynucleotide, comprising:

[0058] In a specific embodiment, the molecular beacons used to label the four compounds and the labels used to label the two luciferases are as defined above.

[0059] In some preferred embodiments, the kits of the present invention further comprise reagents and / or equipment for extracting nucleic acid molecules from a sample; reagents for pretreating nucleic acid molecules to be sequenced; a support for linking nucleic acid molecules to be sequenced; reagents for linking (e.g., covalently or non-covalently linking) nucleic acid molecules to be sequenced to a support; primers for initiating nucleotide polymerization reactions; a polymerase for performing nucleotide polymerization reactions; one or more buffer solutions; one or more wash solutions; or any combination thereof.

[0060] In some preferred embodiments, the kit of the present invention further comprises a reagent and / or device for extracting nucleic acid molecules from a sample. Methods for extracting nucleic acid molecules from a sample are well known in the art. Therefore, various reagents and / or devices for extracting nucleic acid molecules, such as a reagent for disrupting cells, a reagent for precipitating DNA, a reagent for washing DNA, a reagent for dissolving DNA, a reagent for precipitating RNA, a reagent for washing RNA, a reagent for dissolving RNA, a reagent for removing protein, a reagent for removing DNA (for example, when the target nucleic acid molecule is RNA), a reagent for removing RNA (for example, when the target nucleic acid molecule is DNA), and any combination thereof, can be configured in the kit of the present invention as needed.

[0061] In some preferred embodiments, the kit of the present invention further comprises a reagent for pretreating nucleic acid molecules. In the kit of the present invention, the reagent used for pretreating nucleic acid molecules is not subject to additional restrictions and can be selected according to actual needs. Reagents used for pretreating nucleic acid molecules include, for example, a reagent for fragmenting nucleic acid molecules (e.g., DNase I), a reagent for complementing the ends of nucleic acid molecules (e.g., DNA polymerases such as T4 DNA polymerase, Pfu DNA polymerase, Klenow DNA polymerase, etc.), a linker molecule, a tag molecule, a reagent for linking linker molecules to target nucleic acid molecules (e.g., ligases such as T4 DNA ligase), a reagent for repairing nucleic acid nicks (e.g., DNA polymerases that lack 3'-5' exonuclease activity but exhibit 5'-3' exonuclease activity), a reagent for amplifying nucleic acid molecules (e.g., DNA polymerase, primer, dNTP), a reagent for separating and purifying nucleic acid molecules (e.g., chromatography column), and any combination thereof.

[0062] In some preferred embodiments, the kits of the present invention further comprise a support for ligating the nucleic acid molecules to be sequenced. The support may have any of the technical characteristics described in detail above for the support, and any combination thereof.

[0063] For example, in the present invention, the support may be made of a variety of suitable materials. Such materials include, for example, inorganic materials, natural polymers, synthetic polymers, and any combination of inorganic materials, natural polymers, and synthetic polymers. Specific examples include, but are not limited to, cellulose, cellulose derivatives (e.g., nitrocellulose), acrylic resins, glass, silica gel, polystyrene, gelatin, polyvinylpyrrolidone, vinyl-acrylamide copolymers, and polystyrene cross-linked with, for example, divinylbenzene (see, for example, Merrifield Biochemistry 1964, 3, 1385-1390), polyacrylamide, latex, dextran, rubber, silicone, plastic, natural sponge, metallic plastic, cross-linked dextran (e.g., Sephadex™), agarose gel (Sepharose™), and other supports known to those skilled in the art.

[0064] In some preferred embodiments, the support used to link the nucleic acid molecules to be sequenced may be a solid support, including an inert substrate or matrix (e.g., a glass slide, polymer beads, etc.). The inert substrate or matrix is ​​functionalized, for example, by applying an intermediate material containing reactive groups that allow for covalent attachment of biomolecules, such as polynucleotides. Examples of such supports include, but are not limited to, polyacrylamide hydrogels supported on an inert substrate such as glass, particularly the polyacrylamide hydrogels described in International Publication No. WO 2005 / 065814 and U.S. Patent Application Publication No. 2008 / 0280773, the contents of which are incorporated herein by reference in their entireties. In such embodiments, biomolecules (e.g., polynucleotides) may be covalently attached directly to the intermediate material (e.g., a hydrogel), or the intermediate material itself may be noncovalently attached to the substrate or matrix (e.g., a glass substrate). In some preferred embodiments, the support is a glass slide or silicon wafer whose surface has been modified with avidin, amino, acrylamide silane, or aldehyde-based chemical groups.

[0065] In the present invention, the support or solid support is not limited in size, shape, and configuration. In some embodiments, the support or solid support is a planar structure such as a slide, a chip, a microchip, and / or an array. The surface of such a support may be in the form of a planar layer. In some embodiments, the support or its surface, for example, the inner or outer surface of a tube or a container, is non-planar. In some embodiments, the support or solid support comprises a microsphere or bead. In certain preferred embodiments, the support used to link the nucleic acid molecules to be sequenced is an array of beads or wells.

[0066] In some preferred embodiments, the kit of the present invention further comprises a reagent for linking (e.g., covalently or non-covalently) the nucleic acid molecule to be sequenced to the support. Such reagents include, for example, reagents that activate or modify the nucleic acid molecule (e.g., its 5' end), such as phosphate, thiol, amine, carboxylic acid, or aldehyde; reagents that activate or modify the surface of the support, such as aminoalkoxysilanes (e.g., aminopropyltrimethoxysilane, aminopropyltriethoxysilane, 4-aminobutyltriethoxysilane, etc.); succinic anhydride, phenyldiisothiocyanate (Guo et al., 1994), maleic anhydride (Yang et al., 1998), 1-ethyl-3-(3-dimethylamino)-2-propanol ( ... crosslinkers such as N-(aminopropyl)-carbodiimide hydrochloride (EDC), meta-maleimidobenzoic acid-N-hydroxysuccinimide ester (MBS), N-succinimidyl[4-iodoacetyl]aminobenzoate (SIAB), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), N-γ-maleimidobutyryloxy-succinimide ester (GMBS), succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB); and any combination thereof.

[0067] In certain preferred embodiments, the kit of the present invention further comprises a primer for initiating a nucleotide polymerization reaction. In the present invention, the primer is not subject to any additional restrictions as long as it can specifically anneal to a region of a target nucleic acid molecule. In some exemplary embodiments, the length of the primer may be 5 to 50 bp, such as 5 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, 40 to 45, or 45 to 50 bp. In some exemplary embodiments, the primer may comprise naturally occurring or non-naturally occurring nucleotides. In some exemplary embodiments, the primer comprises naturally occurring nucleotides or consists of naturally occurring nucleotides. In some exemplary embodiments, the primer comprises a modified nucleotide such as a locked nucleic acid (LNA). In certain preferred embodiments, the primer comprises a universal primer sequence.

[0068] In certain preferred embodiments, the kit of the present invention further comprises a polymerase for carrying out a nucleotide polymerization reaction. A variety of suitable polymerases can be used in the present invention. In some exemplary embodiments, the polymerase can synthesize a new DNA strand using DNA as a template (e.g., DNA polymerase). In some exemplary embodiments, the polymerase can synthesize a new DNA strand using RNA as a template (e.g., reverse transcriptase). In some exemplary embodiments, the polymerase can synthesize a new RNA strand using DNA or RNA as a template (e.g., RNA polymerase). Thus, in certain preferred embodiments, the polymerase is selected from the group consisting of DNA polymerase, RNA polymerase, and reverse transcriptase.

[0069] In certain preferred embodiments, the kits of the present invention further comprise one or more buffer solutions. Such buffers include, but are not limited to, a buffer solution for DNase I, a buffer solution for DNA polymerase, a buffer solution for ligase, a buffer solution for eluting nucleic acid molecules, a buffer solution for dissolving nucleic acid molecules, a buffer solution for performing a nucleotide polymerization reaction (e.g., PCR), and a buffer solution for a ligation reaction. The kits of the present invention may comprise any one or more of the above buffer solutions.

[0070] In certain preferred embodiments, the kits of the present invention further comprise one or more washing solutions. Examples of such washing solutions include, but are not limited to, phosphate buffer, citrate buffer, Tris-HCl buffer, acetate buffer, carbonate buffer, etc. The kits of the present invention may comprise any one or more of the above washing solutions. [Effects of the invention]

[0071] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: (1) The method of the present invention uses only two molecular labels to realize the labeling of four nucleotides, and uses luciferase to realize autoluminescence. Therefore, the sequencing device used in the sequencing method of the present invention does not need to be equipped with an excitation light source, and the sequencing device does not need to adopt an additional design to filter the background generated by the laser light source. On the one hand, the manufacturing cost of the sequencing device is greatly reduced, which is useful for the promotion and application of the sequencing device and the sequencing method; on the other hand, the volume of the sequencing device is significantly reduced, making the sequencing device lighter and easier to carry. (2) The 3'-hydroxyl group of the deoxyribonucleotides used in the sequencing method of the present invention is modified and blocked to ensure that only one deoxyribonucleotide can be synthesized and incorporated per reaction during the sequencing process, thereby improving the accuracy of sequencing.

[0072] Although specific embodiments of the present invention have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the details according to all the teachings disclosed, and these changes will fall within the protection scope of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof. [Example]

[0073] Example 1 1. Sequencing Library Construction (1) The following DNA sequence (SEQ ID NO: 1) was designed.

[0074]

number

[0075] For library construction, oligo sequences (bold font) were added to the two ends of the sequence, a linker sequence of BGISEQ-500 (shaded part) was inserted in the middle part, and the bold part in italics indicates the first 10 bp of the sequence to be sequenced. The above sequence was synthesized by GenScript Biotechnology Company, and for unrestricted use of the sequence, the synthesized sequence was inserted into pUC57 vector and transformed into E. coli cells.

[0076] (2) An appropriate amount of E. coli containing the known library was cultured, the plasmid extracted, and the following pair of primers: GATATCTGCAGGCAT (SEQ ID NO: 2, Primer 1) and GATATCACAGGCTGA (SEQ ID NO: 3, Primer 2) were designed to amplify the known sequence according to the following system (Table 1) and steps (Table 2). The PCR product was purified using magnetic beads. The purified PCR product was then added to a split oligo (ATGCCTGCAGATATCGATATCACAGGCTGA, SEQ ID NO: 4) for subsequent use in circularization and library construction according to the instructions and steps of the BGISEQ-500 SE50 Circularization Library Construction Kit (MGI).

[0077] [Table 2]

[0078] [Table 3]

[0079] 2. Amplification of Library Sequences A streptavidin-coated 96-well plate was purchased from Thermo Fisher Company. 100 μl of 1 μM 5′-end biotin-modified primer GCCATGTCGTTCTGTGAGCCAAGG (SEQ ID NO: 5) was incubated in one of the wells at room temperature for 30 minutes. The reaction solution was discarded, and 6 ng of the library constructed in Section 1 above and 20 μl of DNB preparation buffer I (manufactured by MGI) in the BGISEQ-500 kit were added. Primer hybridization with the above biotin-modified primer was carried out at 60°C for 5 minutes. 40 μl of DNB polymerase I (manufactured by MGI) and 4 μl of DNB polymerase II in the BGISEQ-500 sequencing kit were added, and the reaction was carried out at 30°C for 60 minutes. The reaction was terminated after heating to 65°C, and the reaction solution was carefully discarded. 100 μl of 5 μM sequencing primer GCTCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 6) was added, hybridization was carried out at room temperature for 30 minutes, and the reaction solution was carefully discarded.

[0080] 3. Sequencing (1) The four dNTPs shown below were synthesized by Acme Bioscience as an outsourced company.

[0081] [ka]

[0082] [ka]

[0083] [ka]

[0084] [ka]

[0085] (2) Preparation of two types of luciferase: a. SA-Gluc (purchased from Adivity company) b. Antibody (purchased from Abcam) conjugated with Nluc (purchased from Avidity) to prepare Ab-Nluc

[0086] A protein coupling kit was purchased from Thermo, and conjugation of the antibody with Nluc was performed according to the instructions and the procedure shown in Figure 1 .

[0087] (3) Preparation of reagents: Preparation of other reagents required in the sequencing reaction Polymerization reaction solution: 50 mM Tris-HCl, 50 mM NaCl, 10 mM (NH4)2SO4, 0.02 mg / ml polymerase BG9 (BGI), 3 mM MgSO4, 1 mM EDTA, 1 μM each of the four dNTPs Elution buffer: 5× SSC, 0.05% Tween-20; Enzyme binding reaction solution: the above two enzymes were diluted in TBST buffer, and the final concentration of each of the two enzymes was 2 μg / ml; Substrate 1 reaction solution: 50 mM tris-HCl 0.5 mM Nacl buffer was prepared, and 50× coelenterazine (nanolight) was diluted to 1×; Substrate 2 reaction solution: 50 mM tris-HCl 0.5 mM Nacl buffer was prepared, and 50× NLuc FLASH substrate (nanolight) was diluted to 1×; Cutting buffer: 20mM THPP, 0.5M NaCl, 50mM Tris-HCl, pH9.0, 0.05% tween-20;

[0088] (4) Sequencing reaction: Sequencing process: a. Polymerization: 100 μl of polymerase reaction solution was added to each well of the amplified library, and the temperature of the microplate reader was raised to 55°C. The reaction was carried out for 3 minutes to polymerize the four dNTPs onto the amplified library. After carefully discarding the reaction solution, 100 μl of elution reaction solution was added and gently pipetted several times to remove the elution reaction solution; b. Luciferase ligation: 100 μl of enzyme binding reaction solution was added and incubated at 35°C for 30 minutes to allow SA-gluc to ligate to biotin-labeled dCTP and dATP derivatives, and Ab-Nluc to ligate to digoxigenin-labeled dCTP and dTTP derivatives. The reaction solution was discarded, and elution solution was added. The elution solution was then gently pipetted several times to remove the elution solution; c. Enzyme 1 signal detection: set appropriate microplate reader parameters, add Substrate 1 reaction solution, perform Enzyme 1 signal detection, and record the highest signal value; d. Enzyme 2 signal detection: Remove substrate reaction solution 1, set appropriate microplate reader parameters, add substrate 2 reaction solution, perform enzyme 2 signal detection, and record the highest signal value; e. Excision: Remove the substrate 2 reaction solution, add 200 μl of elution buffer, gently pipette several times, then discard the elution buffer, add 100 μl of excision reaction solution, perform the reaction at 55 °C for 3 minutes, and discard the excision reaction solution; add 200 μl of elution buffer for washing, and repeat the washing three times; f. Repeat steps a-e for the next cycle of sequencing; a total of 10 bp has been sequenced.

[0089] (5) Sequencing results a. The signal values ​​of the two types of luminescence were as follows:

[0090] [Table 4]

[0091] b. Analysis of sequencing results: According to the luminescence signal values, only cycle 1 and cycle 7 had signals when substrate 2 was introduced, which allowed us to conclude that biotin-dTTP was polymerized in these two cycles, and the first and seventh bases of the tested library were T bases; For cycle 2, cycle 4, cycle 5, and cycle 8, signals were observed only when substrate 1 was introduced, which allowed us to conclude that digoxigenin dATP polymerized in these four cycles, and the second, fourth, fifth, and eighth bases of the tested library were A bases; For cycle 3, cycle 6, and cycle 9, signals were observed when substrate 1 and substrate 2 were introduced, which allowed us to conclude that biotin-digoxigenin dCTP was polymerized in these three cycles, and the third, sixth, and ninth bases of the tested library were C bases; For cycle 10, no light emission was observed when the two substrates were introduced, which allowed us to conclude that a cold G was polymerized in this cycle and the tenth base in the library was a G base.

[0092] In summary, the first 10 bases of the sequence tested were: TACAACTACG (SEQ ID NO: 7), which was 100% identical to the first 10 bp base sequence TACAACTACG (SEQ ID NO: 7) of the library tested.

[0093] Example 2 Construction of the sequencing library and amplification of the library sequences were the same as described in Example 1.

[0094] Sequencing: (1) Four dNTPs: as shown in Example 1 (2) Preparation of luciferase and related proteins a. SA-Gluc (purchased from Adivity company) b. Antibody (purchased from Abcam), the antibody was labeled with biotin label according to the instructions of thermo fisher NHS-ss-biotin to obtain antibody-ss-biotin.

[0095] (3) Preparation of reagents Preparation of other reagents required in the sequencing reaction Polymerization reaction solution: 50 mM Tris-HCl, 50 mM NaCl, 10 mM (NH4)2SO4, 0.02 mg / ml polymerase BG9 (BGI), 3 mM MgSO4, 1 mM EDTA, 1 μM each of the four dNTPs Elution buffer: 5× SSC, 0.05% Tween-20; Enzyme binding reaction solution: the above two proteins, SA-Gluc and antibody-ss-biotin, were diluted in TBST buffer, respectively, and the final concentration of each of the two proteins was 2 μg / ml; Substrate reaction solution: 50 mM Tris-HCl 0.5 mM NaCl buffer was prepared, and 50× coelenterazine (nanolight) was diluted to 1×; Enzyme inactivation buffer: 5 mM DTT, 50 mM Tris-HCl, pH 9.0; Excision buffer: 20 mM THPP, 50 mM Tris-HCl, pH 9.0, 0.5 M NaCl, 0.05% Tween-20;

[0096] (4) Sequencing reaction a. Polymerization: 100 μl of polymerase reaction solution was added to each well of the amplified library, the temperature of the microplate reader was raised to 55°C, and the reaction was carried out for 3 minutes to polymerize the four dNTPs onto the amplified library, the reaction solution was carefully removed, 100 μl of elution reaction solution was added, and the mixture was gently pipetted several times, and the elution reaction solution was removed; b. Luciferase ligation: 100 μl of luciferase SA-Gluc binding reaction solution was added, and the mixture was incubated at 35°C for 30 minutes to allow SA-gluc to ligate to biotin-labeled dCTP and dATP derivatives. The reaction solution was removed, and elution solution was added, followed by gentle pipetting several times, and the elution solution was removed; c. First signal detection: set appropriate microplate reader parameters, add substrate reaction solution, perform signal detection, and record the highest signal value; d. Enzyme inactivation: Remove the substrate reaction solution, add enzyme inactivation buffer, incubate at 35°C for 10 minutes, remove the reaction solution, and then add elution buffer for elution; e. Second ligation of luciferase: Add antibody-ss-biotin reaction solution and incubate at 35°C for 30 minutes to allow antibody-ss-biotin to ligate to digoxigenin-labeled dCTP and dTTP derivatives; remove the reaction solution; add elution buffer; gently pipette several times; remove the elution solution; add 100 μl of SA-Gluc binding reaction solution; incubate at 35°C for 30 minutes; remove the reaction solution; add elution buffer; and remove the elution buffer after the elution is complete; f. Second signal detection: set appropriate microplate reader parameters, add substrate reaction solution, perform signal detection, and record the highest signal value; g. Excision: Remove the substrate 2 reaction solution, add 200 μl of elution buffer, gently pipette several times, remove the elution buffer, add 100 μl of excision reaction solution, carry out the reaction at 55 °C for 3 minutes, remove the excision reaction solution; add 200 μl of elution buffer for washing, and repeat the washing three times; h. Repeat steps a-g for the next cycle of sequencing; a total of 10 bp has been sequenced.

[0097] (5) Sequencing results a. The results of 10 bp signal detection were as follows:

[0098] [Table 5]

[0099] b. Analysis of sequencing results: For cycle 1 and cycle 7, signal values ​​were obtained only in the second detection, which allowed us to conclude that biotin-dTTP was polymerized in these two cycles, and therefore the first and seventh bases of the tested library were T; For cycle 2, cycle 4, cycle 5, and cycle 8, signals were observed only in the first detection, which allowed us to conclude that digoxigenin dATP polymerized in these four cycles, and therefore the second, fourth, fifth, and eighth bases of the tested library were A bases; For cycle 3, cycle 6, and cycle 9, signals were produced in both the first and second detections, which allowed us to conclude that biotin-digoxigenin dCTP was polymerized in these two cycles, and therefore the 3rd, 6th, and 9th bases of the tested library were C bases; For cycle 10, no light was emitted in the two signal detections, which allowed us to conclude that a cold G was polymerized in this cycle, and therefore the tenth base of this library was a G base.

[0100] In summary, the first 10 bases of the sequence tested were: TACAACTACG (SEQ ID NO: 7), which was 100% identical to the first 10 bp base sequence TACAACTACG (SEQ ID NO: 7) of the library tested. Further embodiments are as follows: [Embodiment 1] 1. A method for sequencing a nucleic acid molecule, comprising the steps of: (1) providing a nucleic acid molecule to be sequenced linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, (T / U), C, and G, respectively, and have the ability to form base-complementary pairings; and the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced and forming a duplex linked to the support by using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) performing the nucleotide polymerization reaction using the polymerase under conditions that allow the polymerase to perform the nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) contacting the duplex from the previous step with two different luciferases to perform a ligation reaction, where the two luciferases can specifically ligate to the first molecular label and the second molecular label, respectively; then, in the presence of a substrate, the luciferases catalyze a luminescence reaction, and detecting the emitted luminescence signal; (6) removing the molecular label of each nucleotide; (7) optionally repeating steps (3) to (6) or (3) to (5) one or more times to obtain sequence information of the nucleic acid molecule. A method comprising: [Embodiment 2] 2. The method of embodiment 1, wherein in step (5), the duplex is contacted with the two different luciferases in a one-step reaction and undergoes the ligation reaction; or in step (5), the duplex is contacted with the two luciferases sequentially and undergoes the ligation reaction. [Embodiment 3] Follow these steps: (1) providing a nucleic acid molecule to be sequenced linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, (T / U), C, and G, respectively, and have the ability to undergo base-complementary pairing; and the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced and forming a duplex linked to the support by using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) performing the nucleotide polymerization reaction using the polymerase under conditions that allow the polymerase to perform the nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) removing the solution phase of the reaction system in the previous step, keeping the double strand linked to the support, and adding two different luciferases to perform the ligation reaction, wherein the two luciferases can be specifically ligated to the first molecular label and the second molecular label, respectively; (6) removing unbound luciferase by using an elution buffer; (7) adding a substrate for the first luciferase and simultaneously detecting a luminescent signal; (8) removing the solution from the reaction of the previous step; (9) adding a substrate for a second luciferase and simultaneously detecting a luminescent signal; (10) removing the solution from the reaction of the previous step; (11) removing the molecular label and the 3' protecting group of each nucleotide; (12) Optionally, removing the solution from the reaction of the previous step; (13) optionally repeating steps (3) to (12) or (3) to (9) one or more times to obtain sequence information of the nucleic acid molecule. 3. The method of embodiment 1 or 2, comprising: [Embodiment 4] Follow these steps: (1) providing a nucleic acid molecule to be sequenced linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, (T / U), C, and G, respectively, and have the ability to undergo base-complementary pairing; and the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced and forming a duplex linked to the support by using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) performing the nucleotide polymerization reaction using the polymerase under conditions that allow the polymerase to perform the nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) removing the solution phase of the reaction system in the previous step, leaving the double strand linked to the support, and adding a first luciferase to carry out a ligation reaction, wherein the first luciferase is capable of specifically binding to the first molecular label; (6) removing unbound first luciferase by using an elution buffer; (7) adding a substrate for the first luciferase and simultaneously detecting a luminescent signal; (8) removing the solution from the reaction of the previous step; (9) adding a second luciferase to perform a ligation reaction, wherein the second luciferase is capable of specifically binding to the second molecular label; (10) removing unbound second luciferase by using an elution buffer; (11) adding a substrate for the second luciferase and simultaneously detecting a luminescent signal; (12) removing the solution from the reaction of the previous step; (13) optionally, removing the molecular label of each nucleotide; (14) Optionally, repeating steps (3) to (13) or (3) to (11) one or more times to obtain sequence information of the nucleic acid molecule. 3. The method of embodiment 1 or 2, comprising: [Embodiment 5] 5. The method of embodiment 3 or 4, wherein the first luciferase and the second luciferase comprise different luciferases. [Embodiment 6] Follow these steps: (1) providing a nucleic acid molecule to be sequenced linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, (T / U), C, and G, respectively, and have the ability to undergo base-complementary pairing; and the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced and forming a duplex linked to the support by using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) performing the nucleotide polymerization reaction using the polymerase under conditions that allow the polymerase to perform the nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) removing the solution phase of the reaction system in the previous step, keeping the duplex linked to the support, and adding a first luciferase to perform a ligation reaction, wherein the first luciferase can specifically bind to the first molecular label; (6) removing unbound first luciferase by using an elution buffer; (7) adding a substrate for the luciferase and simultaneously detecting a luminescent signal; (8) removing the solution from the reaction of the previous step; (9) adding a reagent to denature the luciferase; (10) removing the solution from the reaction of the previous step; (11) adding a second luciferase to perform a ligation reaction, wherein the second luciferase is capable of specifically binding to the second molecular label; (12) removing unbound second luciferase by using an elution buffer; (13) adding a substrate for the luciferase and simultaneously detecting a luminescent signal; (14) Optionally, removing the solution from the reaction of the previous step; (15) optionally removing the molecular label and the 3' protecting group of each nucleotide; (16) Optionally, repeating steps (3) to (15) or (3) to (13) one or more times to obtain sequence information of the nucleic acid molecule. 3. The method of embodiment 1 or 2, comprising: [Embodiment 7] 7. The method of embodiment 6, wherein the first luciferase and the second luciferase may comprise the same luciferase. [Embodiment 8] 8. The method of any one of embodiments 1 to 7, wherein the first molecular label and the second molecular label are selected from the group consisting of biotin, digoxigenin, N3G, or FITC, and the first luciferase and the second luciferase are labeled with streptavidin, a digoxigenin antibody, an N3G antibody, or an FITC antibody, respectively. [Embodiment 9] 1. A kit for sequencing a polynucleotide, comprising: (a) four compounds, each of which is a derivative of nucleotides A, (T / U), C, and G, and has the ability of base-complementary pairing; and the hydroxyl (—OH) at the 3′ position of the ribose or deoxyribose of each of the four compounds is protected with a protecting group; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; four compounds, wherein the fourth compound is not linked to any molecular label; and (b) two different luciferases, each capable of specifically binding to the first molecular beacon and the second molecular beacon, respectively; Kit including: [Embodiment 10] 10. The kit of embodiment 9, wherein the two different luciferases may comprise the same luciferase or different luciferases. [Embodiment 11] 11. The kit of embodiment 9 or 10, wherein the first molecular label and the second molecular label are selected from the group consisting of biotin, digoxigenin, N3G, or FITC, and the first luciferase and the second luciferase are labeled with streptavidin, a digoxigenin antibody, an N3G antibody, or an FITC antibody, respectively. [Embodiment 12] 12. The kit of any one of embodiments 9 to 11, further comprising: reagents and / or equipment for extracting nucleic acid molecules from a sample; reagents for pre-treating the nucleic acid molecules; a support for linking the nucleic acid molecules to be sequenced; reagents for linking (e.g., covalently or non-covalently linking) the nucleic acid molecules to be sequenced to the support; primers for initiating a nucleotide polymerization reaction; a polymerase for carrying out the nucleotide polymerization reaction; one or more buffer solutions; one or more wash solutions; or any combination thereof.

Claims

1. 1. A method for sequencing a nucleic acid molecule, comprising the steps of: (1) providing a nucleic acid molecule to be sequenced immobilized on a support, or immobilizing a nucleic acid molecule to be sequenced on a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, T, C, and G, respectively, and have the ability of base-complementary pairing; and the hydroxyl groups at the 3'-positions of ribose or deoxyribose of the four compounds are protected with protecting groups; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced and using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced to form a duplex immobilized on the support; (4) performing the nucleotide polymerization reaction using the polymerase under conditions that allow the polymerase to perform the nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3'-end of the growing nucleic acid strand; (5) contacting the duplex from the previous step with two different luciferases to carry out a binding reaction, the two different luciferases consisting of a first luciferase and a second luciferase, the first luciferase specifically binding to the first molecular label, and the second luciferase specifically binding to the second molecular label; then, in the presence of a substrate, the two different luciferases catalyze a luminescence reaction, and detecting the emitted luminescence signal; (6) removing the molecular label of each nucleotide; and (7) repeating steps (4) to (6) or (4) to (5) one or more times to obtain sequence information of the nucleic acid molecule. Including, the nucleic acid molecule is DNA; the first molecular label and the second molecular label are different; In step (5), the duplex is contacted with the two different luciferases in a one-step reaction to undergo the binding reaction.

2. A method for sequencing a nucleic acid molecule, comprising the steps of: (1) providing a nucleic acid molecule to be sequenced immobilized on a support, or immobilizing a nucleic acid molecule to be sequenced on a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for carrying out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; the four compounds are derivatives of nucleotides A, T, C, and G, respectively, and have the ability to undergo base-complementary pairing; and the hydroxyl groups at the 3′-positions of ribose or deoxyribose of the four compounds are protected with protecting groups; the first compound is linked to a first molecular beacon; the second compound is linked to a second molecular beacon; the third compound is linked to the first molecular label and the second molecular label, or a portion of the third compound is linked to the first molecular label and another portion of the third compound is linked to the second molecular label; the fourth compound is not linked to any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced and using the primer as a priming nucleic acid strand together with the nucleic acid molecule to be sequenced to form a duplex immobilized on the support; (4) performing the nucleotide polymerization reaction using the polymerase under conditions that allow the polymerase to perform the nucleotide polymerization reaction, thereby incorporating one of the four compounds at the 3'-end of the growing nucleic acid strand; (5) removing the solution phase of the reaction system in the previous step, keeping the double strand immobilized on the support, and adding two different luciferases to carry out a binding reaction, wherein the two different luciferases consist of a first luciferase and a second luciferase, and the first luciferase specifically binds to the first molecular label and the second luciferase specifically binds to the second molecular label; (6) removing unbound luciferase by using an elution buffer; (7) adding a substrate for the first luciferase and simultaneously detecting a luminescent signal; (8) removing the solution from the reaction of the previous step; (9) adding a substrate for a second luciferase and simultaneously detecting a luminescent signal; (10) removing the solution from the reaction of the previous step; (11) removing the molecular label and the 3' protecting group of each nucleotide; (12) removing the solution of the reaction of step (11); and (13) Repeating steps (4) to (12) or (4) to (9) one or more times to obtain sequence information of the nucleic acid molecule. Including, the nucleic acid molecule is DNA; the first molecular label and the second molecular label are different; In step (5), the duplex is contacted with the two different luciferases in a one-step reaction to undergo the binding reaction.

3. The method of claim 1 or 2, wherein the support is a flat surface or a microbead.

4. 3. The method of claim 1, wherein the support is a glass, ceramic, silicon, or plastic material.

5. The method according to claim 1 or 2, wherein the support is a flat glass surface or a silicon surface.

6. The method of claim 1 or 2, wherein the support is a glass slide or a silicon wafer.

7. 3. The method of claim 1 or 2, wherein the support is a glass slide or a silicon wafer whose surface is modified with a layer of avidin, amino, acrylamide silane or aldehyde-based chemical groups.

8. 3. The method of claim 1, wherein the support is silicon dioxide.

9. 9. The method of claim 1, wherein the first molecular label and the second molecular label are selected from the group consisting of biotin, digoxigenin, and FITC, and the first luciferase and the second luciferase are labeled with streptavidin, a digoxigenin antibody, or a FITC antibody, respectively.

10. The method according to any one of claims 1 to 9, wherein the four compounds are compounds represented by formula I, formula II, formula III and formula IV. 【Chemistry 1】 【Chemistry 2】 【Transformation 3】 【Chemistry 4】

Citation Information

Patent Citations

  • Methods and compositions for nucleic acid sequencing

    US20130079232A1

  • Compositions, systems, and methods for detecting the presence of polymer subunits using chemiluminescence

    WO2016040607A1

  • Single fluorescent dye based sequencing method

    WO2018121587A1