A nucleic acid aptamer that binds to galectin-7 and a tissue detection composition expressing galectin-7 containing the nucleic acid aptamer.

Abstract

To provide a nucleic acid aptamer that recognizes galectin-7, enabling a visual check of cholesteatoma (particularly, residual cholesteatoma).MEANS FOR SOLVING THE PROBLEM: A nucleic acid aptamer selection using the Cell-SELEX method acquired a nucleic acid aptamer that recognizes galectin-7. Furthermore, the nucleic acid aptamer was confirmed to specifically recognize cholesteatoma tissue, leading to the completion of the present invention.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a nucleic acid aptamer that binds to galectin-7 and a composition for detecting tissues expressing galectin-7 containing the nucleic acid aptamer.

Background Art

[0002] (cholesteatoma) Middle ear cholesteatoma is a type of chronic otitis media, in which a part of the eardrum is recessed inward and forms a mass like a pearl. As the cholesteatoma grows, it occupies the middle ear and compresses the nerves, which may lead to the onset of hearing loss, dizziness, facial nerve paralysis, etc. The main treatment method is mainly the resection surgery of the cholesteatoma.

[0003] [[ID=十七]] (Problems of cholesteatoma resection surgery) Cholesteatoma has a high recurrence rate after surgery, and it has been reported that the recurrence rate is 20-50% depending on the disease type. The cause of recurrence is the residue at the time of the first surgery. The cause of the residue is anatomical complexity, and there are sites that cannot be confirmed clearly by the surgeon.

[0004] <0000_{22}>(Prior Patent) Patent Document 1 discloses "a gene marker for determining whether a cancer tissue containing a heterogeneous cancer cell population recognizes galectin-7". However, these documents do not disclose or suggest the nucleic acid aptamer that binds to galectin-7 of the present invention.

Prior Art Documents

Patent Documents

[0005]

Patent Document 1

Non-Patent Documents

[0006] <000003_{9}>

Non-Patent Document 1

Summary of the Invention

[0007] The present inventors previously identified galectin-7, a specific marker in cholesteatoma tissue (Non-Patent Literature 1). They also investigated the rapid identification of cholesteatoma using galectin-7 staining, but confirmed safety issues related to additives in the antibody and staining solution. Therefore, the objective of the present invention is to provide a nucleic acid aptamer that recognizes galectin-7, which can be used to identify cholesteatoma (particularly residual cholesteatoma). [Means for solving the problem]

[0008] The inventors obtained a nucleic acid aptamer that recognizes galectin-7 by selecting nucleic acid aptamers using the Cell-SELEX method. Furthermore, they confirmed that this nucleic acid aptamer specifically recognizes cholesteatoma tissue, thus completing the present invention. That is, the present invention is as follows.

[0009] 1. A nucleic acid aptamer that binds to galectin-7, characterized by having one of the following base sequences. 1) X—Sequence ID 15(GTE1-M4)—Y, where X is any base sequence between 1 and 50, and Y is any base sequence between 1 and 50. 2) Sequence ID 1 (GTE1) 3) Sequence ID 2 (GTE2) 4) Sequence ID 3 (GTE3) 5) Sequence ID 4 (GTE4) 6) Sequence ID 5 (GTE5) 7) Sequence ID 6 (GTE6) 8) Sequence ID 7 (GTE7) 9) Sequence ID 8 (GTE8) 10) Sequence ID 9 (GTE9) 11) Sequence ID 10 (GTE10) 12) Sequence ID 11 (GTE11) 13) SEQ ID NO: 12 (GTE1-M1) 14) SEQ ID NO: 13 (GTE1-M2) 15) SEQ ID NO: 14 (GTE1-M3) 16) SEQ ID NO: 15 (GTE1-M4) 17) X - SEQ ID NO: 20 (GTE2-M5) - Y, where X is any base sequence of 1 to 50 bases, and Y is any base sequence of 1 to 50 bases. 18) SEQ ID NO: 16 (GTE2-M1) 19) SEQ ID NO: 17 (GTE2-M2) 20) SEQ ID NO: 18 (GTE2-M3) 21) SEQ ID NO: 19 (GTE2-M4) 22) SEQ ID NO: 20 (GTE2-M5) 2. The nucleic acid aptamer according to item 1 above, characterized in that it has any one of the following base sequences. 1) SEQ ID NO: 1 (GTE1) 2) SEQ ID NO: 2 (GTE2) 3) SEQ ID NO: 3 (GTE3) 4) SEQ ID NO: 4 (GTE4) 5) SEQ ID NO: 5 (GTE5) 6) SEQ ID NO: 6 (GTE6) F7) SEQ ID NO: 7 (GTE7) 8) SEQ ID NO: 8 (GTE8) 9) SEQ ID NO: 9 (GTE9) 10) SEQ ID NO: 10 (GTE10) 11) SEQ ID NO: 11 (GTE11) 12) SEQ ID NO: 12 (GTE1-M1) 13) SEQ ID NO: 13 (GTE1-M2) 14) SEQ ID NO: 14 (GTE1-M3) 3. The nucleic acid aptamer according to item 1 above, characterized in that it has any one of the following base sequences. 1) SEQ ID NO: 1 (GTE1) 2) SEQ ID NO: 12 (GTE1-M1) 3) SEQ ID NO: 13 (GTE1-M2) 4) SEQ ID NO: 14 (GTE1-M3) 4. A tissue detection composition expressing galectin-7, comprising the nucleic acid aptamer described in any one of items 1 to 3 above. 5. The detection composition according to item 4 above, wherein the tissue is a cholesteatoma. 6. The detection composition according to item 4 above, wherein the tissue is a middle ear cholesteatoma. [Effects of the Invention]

[0010] The present invention can provide a nucleic acid aptamer that specifically recognizes cholesteatoma tissue. [Brief explanation of the drawing]

[0011]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

[0012] (Target of this invention) The present invention relates to a nucleic acid aptamer that binds to galectin-7 and a composition for detecting tissue (particularly diseased tissue) expressing galectin-7, comprising the nucleic acid aptamer.

[0013] (The present invention's nucleic acid aptamer that binds to galectin-7) In the following embodiment, the nucleic acid aptamer of the present invention can detect tissues expressing galectin-7. Examples of tissues expressing galectin-7 (especially diseased areas) include cholesteatoma, middle ear pearl, squamous cell carcinoma, melanoma, and cervical cancer, but cholesteatoma and middle ear cholesteatoma are particularly preferred. 1) X—Sequence ID 15(GTE1-M4)—Y, where X is any base sequence (adenine, thymine, guanine, cytosine, uranine) with a number (integer) of 1 to 50, and Y is any base sequence (integer) with a number (integer) of 1 to 50. Examples of possible ranges for the number of base sequences in X and Y include 1 to 45, 10 to 20, 15 to 30, 20 to 40, 30 to 50, etc. 2) Sequence ID 1 (GTE1) 3) Sequence ID 2 (GTE2) 4) Sequence ID 3 (GTE3) 5) Sequence ID 4 (GTE4) 6) Sequence ID 5 (GTE5) 7) Sequence ID 6 (GTE6) 8) Sequence ID 7 (GTE7) 9) Sequence ID 8 (GTE8) 10) Sequence ID 9 (GTE9) 11) Sequence ID 10 (GTE10) 12) Sequence ID 11 (GTE11) 13) Sequence ID 12 (GTE1-M1) 14) Sequence ID 13 (GTE1-M2) 15) Sequence ID 14 (GTE1-M3) 16) Sequence ID 15 (GTE1-M4) 17) X—Sequence ID 20(GTE2-M5)—Y, where X is any base sequence with 1 to 50 bases, and Y is any base sequence with 1 to 50 bases. 18) Sequence ID 16 (GTE2-M1) 19) Sequence ID 17 (GTE2-M2) 20) Sequence ID 18 (GTE2-M3) 21) Sequence ID 19 (GTE2-M4) 22) Sequence ID 20 (GTE2-M5)

[0014] (A tissue detection composition containing a nucleic acid aptamer that binds to galectin-7 according to the present invention) The tissue (particularly diseased area) detection composition of the present invention, which contains a nucleic acid aptamer that binds to galectin-7, preferably contains a nucleic acid aptamer that binds to galectin-7, but also preferably contains a labeling substance for the nucleic acid aptamer (particularly a fluorescent labeling substance). Examples of labeling substances (especially fluorescent labeling substances) include well-known fluorescent dye molecules, enzymes, biotin, nanoparticles, magnetic beads, agarose, and gold colloids. Furthermore, the detection composition may contain pharmacologically or physiologically acceptable carriers, excipients, diluents, preservatives, etc. For example, the following can be cited: Sucrose, xylitol, lactose, dextrose, sorbitol, mannitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate

[0015] The disease detection composition of the present invention can be a diagnostic composition or diagnostic kit for cholesteatoma or middle ear cholesteatoma.

[0016] The present invention will be described in detail below with specific examples, but the present invention is not limited to these examples. The following examples have been approved by the Ethics Committee of Ehime University School of Medicine (1409004), and informed consent was obtained from all patients for the implementation of the research protocol in accordance with the Declaration of Helsinki. [Examples]

[0017] (Materials and Methods) 〇Patient Cholesteatoma and surrounding mucosal tissue were collected from patients with middle ear cholesteatoma. Fresh specimens were stored at 4°C and promptly used for xenograft experiments. Specimens for freezing were embedded in OCT compound and frozen at -80°C for use in immunohistochemical analysis, etc.

[0018] Establishment of a xenograft-based model of cholesteatoma otitis media The animal experiment protocol was approved by the Ehime University Animal Experiment Committee (05K12616) and was conducted in accordance with the guidelines of the Ehime University Animal Welfare Committee. Excised tissue from cholesteatoma otitis media was transplanted into male NOD / ShiJic-scid mice (NOD / SCID) (CLEA Japan, Tokyo, Japan). The mice were anesthetized with 1% isoflurane vaporized in air, and after exposing the subcutaneous tissue, the external abdominal muscles were scraped with a scalpel until bleeding occurred. Next, the excised cholesteatoma otitis media tissue (5-8 mm in diameter) was transplanted onto the muscles at the level of the 4th-6th lumbar vertebrae of the mice. Finally, the skin incisions were sutured and the mice recovered.

[0019] Identification of cholesteatoma using fluorescence imaging in xenograft cholesteatoma models Xenografted mice, 8 weeks post-transplantation, were used to visualize cholesteatoma. The mice were deeply anesthetized, fixed with exposed subcutaneous tissue, and placed on a microscope stage. A blocking solution containing 0.1 mg / ml yeast RNA and 0.1 mg / ml salmon sperm DNA was applied to the exposed cholesteatoma membrane for 10 minutes, followed by three washes with saline. Aptamer solution (1 μM) was applied to the cholesteatoma tissue at 5, 10, or 15 minutes, followed by three washes with saline. Images of the transplantation site were acquired using a Zeiss fluorescence microscope.

[0020] 〇Cell culture Human embryonic kidney cell line HEK-293T cells and human keratinocyte cell line PSVK1 cells, prepared from human foreskin and with pSV40-ori-(minus)DNA sheared, were obtained from the JCRB cell bank. HEK-293T cells were cultured in Dulbecco's Minimum Essential Medium containing 10% fetal bovine serum. PSVK1 cells were cultured in KGM TM Gold Keratinocyte Growth Medium BulletKit TMCells were propagated using LonzaGroup Ltd. (Basel, Switzerland). All cells were cultured at 37°C in a humid incubator with 5% CO2. Cells from passages 3 to 26 were used in this example. The expression plasmid pCMV6-AC-GFP-galeectin-7 (NM-001042507) (Origene, Rockville, MD, USA) was transplanted into HEK-293T cells using Lipofectamine 3000 (Invitrogen) to establish a stable cell line overexpressing Galectin-7. GFP-positive cells were regularly selected every two weeks using a BD FACSAria cell sorter (BD Biosciences, Franklin Lakes, NJ, USA).

[0021] Selection using the Cell-SELEX method A random sequence library (3'-ATGACCATGACCCTCCACAC(40N)TCAGACTGTGGCAGGGAAAC-5') was applied to 293T cells at 37°C for 1 hour as a negative selection. The supernatant was collected and incubated with galectin-7 expressing 293T cells at 37°C for 1 hour as a positive selection. After selection, cells were harvested, incubated at 95°C for 10 minutes, and then immediately cooled on ice for 10 minutes. ssDNA was extracted and amplified by PCR (forward primer: 3'-ATGACCATGACCCTCCAC-5', reverse primer: 3'-GTTTCCCTGCCACAGTCTGA-Biotin-5). The entire PCR product was separated on a 4% agarose gel, and the band around 80 bp was excised. DNA was extracted from the excised gel according to the instructions of the NuceloSpin Gel and PCR Clean-up kit (TaKaRa Bio. Tokyo, Japan). The purified DNA product was attached to high-volume streptavidin beads (Thermo Fisher, Waltham, MA, USA) and eluted with 0.1 M NaOH at room temperature for 5 minutes. Finally, the ss-DNA was concentrated by ethanol precipitation and used for the next selection. The conditions for positive selection were made more stringent by gradually decreasing the incubation temperature and reaction time. After 28 selections, the concentrated aptamer pool was cloned into a sequencing vector according to the instructions for the TOPO TA Cloning Kit (Thermo Fisher). These aptamer candidates were used for the following binding screening.

[0022] Flow cytometry We customized and synthesized Alexa-Fluor 594-tagged aptamer candidates, and screened their binding ability and specificity using flow cytometry. Galectin-7-expressing 293T cells, 293T cells, or PSVK1 cells (3 x 10⁻¹⁰ 5The cells were blocked and incubated with the aptamer candidate at the specified concentration at 4°C for 1 hour. After washing, the cells were resuspended in binding buffer and BD FACSCalibur was used. TM Fluorescence signals were analyzed using a flow cytometer (BD Biosciences).

[0023] ○ In silico binding of aptamer galectin-7 Two-dimensional structure prediction of selected aptamers was performed using mfold (http: / / www.unafold.org / mfold / applications / dna-folding-form.php). The default settings were linear DNA structure, prediction conditions of 37°C and 0.15 M sodium concentration. The parameters used for prediction assumed physiological extracellular fluid conditions. Other settings were left at their default values. From the obtained results, the one predicted to have the most stable molecular energy was selected. The Vienna format file was downloaded and edited into RNA format using a text editor. For example, "T" for tyrosine was replaced with "U" for uracil and saved. When this information was entered into RNAComposer (http: / / rnacomposer.cs.put.poznan.pl / ), the primary predicted three-dimensional structure of the aptamer could be obtained in PDB format. The obtained PDB format was displayed using PyMol (Ver.2.3.0, Open Source, https: / / pymol.org / 2 / ). The nucleic acid mutation was converted to uracil and tyrosine using the nucleic acid mutation editing wizard. The file was opened in UCSF Chimera (Ver. 1.15, https: / / www.cgl.ucsf.edu / chimera / ) and hydrogen atoms and charges were added. After editing, the file was saved in PDB file format, and hydrogen atoms and charges were added again in UCSF Chimera and saved. The created file was opened again in PyMol, and the "Optimize" add-in was used to obtain the energetically most stable structure prediction. Next, we obtained the PDB file of the crystal structure of galectin-7 from the RCSB protein data bank (https: / / www.rcsb.org / structure / 1BKZ). We added hydrogen atoms and charges to the obtained file using UCSF Chimera. We performed energetic minimization and aptamer preparation using a PyMol add-in. Using the prepared aptamer and galectin structural data, we conducted in silico binding experiments using Hdocklite (Yan et al. 2017) on the HPC SHIROKANE (https: / / gc.hgc.jp / lead / , The University of Tokyo).

[0024] 〇Statistical analysis All examples were designed in a fully randomized multifactor format. Results are expressed as mean ± SEM. One-to-one comparisons were performed using two-sided Student's t-tests. For comparisons of high-throughput fluorescence screening results, a two-way ANOVA followed by Scheffé's F-test was used. A p-value < 0.05 was considered statistical significance. [Examples]

[0025] (Selection of aptamers with galectin-7 binding ability) In this example, nucleic acid aptamers with galectin-7 binding ability were selected using the Cell-SELEX method (see Figure 1). We obtained nucleic acid aptamers with the following galectin-7 binding ability. 〇GTE1 (Sequence ID 1) ATGACCATGACCCTCCACACCAGTCTCTCCTGACGGAAGCAGCAGATTAGCACCCCGGGTTCAGACTGTGGCAGGGAAAC 〇GTE2 (Sequence ID 2) ATGACCATGACCCTCCACACGTCCAGTCCCACCAACACCCATTAGCCTATGCGCTGATACTCAGACTGTGGCAGGGAAAC 〇GTE3 (Sequence ID 3) ATGACCATGACCCTCCACACTTGACTAGCAATCTTGACTTGACTACATGGGAGTGAGACATCAGACTGTGGCAGGGAAAC 〇GTE4 (Sequence ID 4) ATGACCATGACCCTCCACACACAGTCCGCAGTTACGAAGAGGTATAGTTACAAGTACATGTCAGACTGTGGCAGGGAAAC GTE 5 (Sequence ID 5) ATGACCATGACCCTCCACACATCGTGCAGAGTACCGGCTTAGATCTTGAAACGGGTGACATCAGACTGTGGCAGGGAAAC 〇GTE 6 (Sequence ID 6) ATGACCATGACCCTCCACACGTCAGGAGGCCTATGCGAGGAGTTAAGTCGATGGAATCAATCAGACTGTGGCAGGGAAAC 〇GTE7 (Sequence ID 7) ATGACCATGACCCTCCACACCCCTATTCGATGTTATTAGGGAGCTCCGCATGGGCTCGGGTCAGACTGTGGCAGGGAAAC 〇GTE8 (Sequence ID 8) ATGACCATGACCCTCCACACCGCTAATATCTCATCGGAGTGGGTCCCCTGCGGGCGAACCTCAGACTGTGGCAGGGAAAC 〇GTE9 (Sequence ID 9) ATGACCATGACCCTCCACACCTACGTTACAGGGGAGATGTGCTCCGACATTTGAGAAAGCTCAGACTGTGGCAGGGAAAC 〇GTE10 (Sequence ID 10) ATGACCATGACCCTCCACACTCCTGGAAGCTTCGCACGCTCGTATGCAGGCAGAATCGATTCAGACTGTGGCAGGGAAAC 〇GTE11 (Sequence ID 11) ATGACCATGACCCTCCACACGAAAGCACGGTCTTGTGGTAACTCGCGTCTAAATCAAGATTCAGACTGTGGCAGGGAAAC [Examples]

[0026] (Confirmation of the binding ability of selected aptamers possessing galectin-7 binding ability) In this example, the galectin-7 binding capacity of GTE1, GTE2, GTE3, and GTE11 obtained in Example 2 was detected by flow cytometry, and further, the EC was determined by concentration-reaction curves. 50 We made that decision. As is clear from Figure 2(1), we confirmed that GTE1 and GTE2 possess galectin-7 binding ability. As is clear from Figure 2(2), it was confirmed that GTE1, GTE2, and GTE3 possess galectin-7 binding ability. [Examples]

[0027] (Confirmation of the specificity of selected galectin-7 binding nucleic acid aptamers) In this example, the galectin-7 binding specificity of GTE1 and GTE2 obtained in Example 2 was confirmed by cell binding experiments. As shown in the results in Figure 3, GTE1 and GTE2 were confirmed to have high galectin-7 binding specificity. More specifically, GTE1 had higher binding ability but lower specificity compared to GTE2. [Examples]

[0028] (Optimization of aptamers with galectin-7 binding ability) In this example, the aptamers obtained in the example, GTE1 and GTE2, were optimized by in silico coupling experiments. The aptamers with optimized galectin-7 binding ability are as follows (common nucleotide sequences are underlined).

[0029] 〇GTE1 ATGACCATGACCCTCCACACCAGTCTC TCCTGACGGAAGCAGCAGATTAGCACCCCGGGT TCAGACTGTGGCAGGGAAAC 〇GTE1-M1 (Sequence ID 12) ACACGTCCAGTCCCACCAACACCCATTAGCCTATGCGCTGATACTCAGACTGTG 〇GTE1-M2 (Sequence ID 13) CCCTCCACACCAGTCTC TCCTGACGGAAGCAGCAGATTAGCACCCCGGGT TCAGACTGTGGCAGGG 〇GTE1-M3 (Sequence ID 14) AGTCTC TCCTGACGGAAGCAGCAGATTAGCACCCCGGGT TCAGACT 〇GTE1-M4 (Sequence No. 15) TCCTGACGGAAGCAGCAGATTAGCACCCCGGGT

[0030] 〇GTE2 ATGACCATGACCCTCCACACGT CCAGTCCCACCAACACCCATTAGCCTATGCGCTGATACTCAGACTG TGGCAGGGAAAC 〇GTE2-M1 (Sequence ID 16) ATGACCATGACCCTCCACACGT CCAGTCCCACCAACACCCATTAGCCTATGCGCTGATACTCAGACTG TGGCAGGG 〇GTE2-M2 (Sequence ID 17) ATGACCATGACCCTCCACACGT CCAGTCCCACCAACACCCATTAGCCTATGCGCTGATACTCAGACTG TGGCAGGG 〇GTE2-M3 (Sequence ID 18) CCCTCCACACGT CCAGTCCCACCAACACCCATTAGCCTATGCGCTGATACTCAGACTG TGGCAGGG 〇GTE2-M4 (Sequence No. 19) CCACACGT CCAGTCCCACCAACACCCATTAGCCTATGCGCTGATACTCAGACTG TGG 〇GTE2-M5 (Sequence ID 20) CCAGTCCCACCAACACCCATTAGCCTATGCGCTGATACTCAGACTG [Examples]

[0031] (Confirmation of the binding ability of nucleic acid aptamers with optimized galectin-7 binding ability) In this example, the galectin-7 binding ability of GTE1 and GTE1-M1~M3 obtained in Example 5 was confirmed. As shown in the results in Figure 4, the common sequence " TCCTGACGGAAGCAGCAGATTAGCACCCCGGGT We confirmed that GTE1 and GTE1-M1~M2, which possess the (Sequence ID 15) gene, have galectin-7 binding ability. In particular, we confirmed that the binding ability of GTE1-M1 and GTE1-M3 is higher than that of GTE1. That is, we confirmed that we have succeeded in optimizing GTE1. This results in the common array " TCCTGACGGAAGCAGCAGATTAGCACCCCGGGT GTE1 and GTE1-M1~M3, which have (Sequence ID 15), possess galectin-7 binding ability. Similarly, the common array " CCAGTCCCACCAACACCCATTAGCCTATGCGCTGATACTCAGACTG GTE2 and GTE2-M1~M5, which have (Sequence ID 20), are thought to possess galectin-7 binding ability. [Examples]

[0032] (Detection of patient-derived cholesteatoma tissue using aptamers with galectin-7 binding ability) In this example, we confirmed whether fluorescently labeled GTE-1 can specifically detect cholesteatoma tissue. As is clear from the results in Figure 5, GTE-1 fluorescence was not detected in normal mucosal tissue, but was detected only in cholesteatoma tissue. As a result, the aptamer having galectin-7 binding ability of the present invention can specifically recognize cholesteatoma tissue. [Examples]

[0033] (In vivo detection of patient-derived cholesteatoma tissue using aptamers with galectin-7 binding ability) In this example, we confirmed whether fluorescently stained GTE-1 could detect cholesteatoma tissue transplanted in vivo. As is clear from the results in Figure 6, we confirmed that GTE-1 can detect cholesteatoma tissue transplanted in vivo. In particular, we confirmed that it can be detected visually. As a result, the aptamer having galectin-7 binding ability of the present invention can detect cholesteatoma tissue in vivo (especially during surgery). Furthermore, no adverse events were observed in mice stained with the aptamer possessing galectin-7 binding ability according to the present invention. This confirms that the aptamer possessing galectin-7 binding ability according to the present invention is safe.

[0034] (General Overview) In this example, we created a specific DNA aptamer targeting galectin-7, which is specifically expressed in human cholesteatoma. Molecular imaging using the galectin-7 aptamer successfully allowed observation of the resection margins of cholesteatoma tissue and surrounding normal tissue in a xenografted cholesteatoma model. Galectin-7-targeted aptamers are useful for molecular imaging, allowing clinicians to not only detect the location of cholesteatoma in the middle ear during surgery but also evaluate the responsiveness of the expression profile to postoperative treatment. [Industrial applicability]

[0035] This invention provides a nucleic acid aptamer that specifically recognizes cholesteatoma tissue.

Claims

1. A nucleic acid aptamer that binds to galectin-7 and contains one of the following base sequences. 1) Sequence ID 1 2) Sequence ID 2 3) Sequence ID 3 4) Sequence ID 4 5) Sequence ID 5 6) Sequence ID 6 7) Sequence ID 7 8) Sequence ID 8 9) Sequence ID 9 10) Sequence ID 10 11) Sequence ID 11 12) Sequence ID 12 13) Sequence ID 13 14) Sequence ID 14

2. The nucleic acid aptamer is characterized by comprising any one of the following base sequences, claim The nucleic acid aptamer described in item 1. 1) Sequence ID 1 2) Sequence ID 12 3) Sequence ID 13 4) Sequence ID 14

3. A tissue detection composition expressing galectin-7, comprising the nucleic acid aptamer described in claim 1 or 2.

4. The composition according to claim 3, wherein the tissue is a cholesteatoma.

5. The detection composition according to claim 3, wherein the tissue is a middle ear cholesteatoma.

Images