Liver-specific virus promoter and method of use thereof

Abstract

To provide promoters that function specifically or preferentially in the liver.SOLUTION: These promoters are capable of enhancing liver-specific expression of genes. The invention also provides expression constructs, vectors and cells comprising such liver-specific promoters, and methods of use thereof. The present invention provides adeno-associated virus (AAV) gene therapy vectors comprising the liver-specific promoters, therapeutic agents comprising the liver-specific promoters, and methods of use thereof.SELECTED DRAWING: None

Description

[Technical Field]

[0001]

[0001] Promoters that function specifically or preferentially in the liver are described herein. Adeno-associated virus (AAV) gene therapy vectors containing liver-specific promoters, therapeutic agents containing liver-specific promoters, and methods of use thereof are further disclosed herein. [Background technology]

[0002]

[0002] The following considerations are provided to assist the reader in understanding this disclosure and are not intended to describe or constitute prior art.

[0003]

[0003] Studies on the hepatic uptake of DNA molecules and vectors used in gene therapy, such as viral vectors, have shown that the liver has a high capacity to take them up from the circulation. In fact, it is well established that many viral vectors used in gene therapy, including adeno-associated virus (AAV) vectors, can be efficiently taken up by the liver, and therefore this organ is relatively easy to target compared to other organs.

[0004]

[0004] Furthermore, the liver has been a target organ for gene therapy due to its central role in the metabolism and production of serum proteins. Much of the current strong interest in the development of AAV gene therapy products targeting the liver stems from preclinical and clinical success in the field of hemophilia B. Numerous studies in classical mouse and canine models of hemophilia A and B have demonstrated compelling results from the administration of vectors, including AAV vectors encoding relevant coagulation factors, delivered to the liver for gene expression. More recently, success has also been demonstrated in human clinical trials.

[0005] However, liver targeting is not yet absolutely accurate, and off-target delivery and expression can lead to reduced efficacy or complications. Therefore, there is a need in the art for the development of robust liver-specific promoters that sufficiently and specifically or preferentially express the target gene encoded in the liver. The present disclosure meets this need.

Summary of the Invention

[0006]

[0006] Liver-specific promoters, adeno-associated virus (AAV) gene therapy vectors containing the promoters, and therapeutic agents, as well as methods and kits for using them, are described herein.

[0007]

[0007] Thus, according to some embodiments, a synthetic polynucleotide is provided that comprises nucleic acids derived from at least three promoters selected from the group consisting of (a) HNF1 / HNF3 (SEQ ID NO: 1); (b) HNF3 / HNF3 (SEQ ID NO: 2); (c) c / EBP / HNF4 (SEQ ID NO: 3); (d) HS_CRM2 / HNF3 (SEQ ID NO: 4); and (e) HS_CRM8 (SEQ ID NO: 6) or variants thereof. In some embodiments, the synthetic polynucleotide comprises at least SEQ ID NO: 3 and SEQ ID NO: 6 or variants or derivatives thereof.

[0008]

[0008] In some embodiments, variants of the HS_CRM8 sequence may be selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99 and SEQ ID NO: 100.

[0009]

[0009] In some embodiments, the synthetic polynucleotide may include at least four of the promoter-derived nucleic acids. In some embodiments, the synthetic polynucleotide may include five promoter-derived nucleic acids (a) to (e). In some embodiments, the synthetic polynucleotide may have at least 90% identity with a synthetic polynucleotide containing five promoter-derived nucleic acids (a) to (e).

[0010]

[0010] According to some embodiments, a synthetic polynucleotide is provided that has at least 90% identity with a synthetic polynucleotide comprising at least three promoter-derived nucleic acids selected from the group consisting of HNF1 / HNF3 (SEQ ID NO: 1); HNF3 / HNF3 (SEQ ID NO: 2); c / EBP / HNF4 (SEQ ID NO: 3); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or variants thereof.

[0011]

[0011] In some embodiments, the synthetic polynucleotide includes sequence numbers 1, 2, 3, 4 and 6 consecutively from 5' to 3'.

[0012]

[0012] In some embodiments, the synthetic polynucleotide further comprises at least one minimal promoter nucleic acid. In some embodiments, the sequence of the minimal promoter nucleic acid is derived from SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10), or a minimal promoter nucleic acid having at least 90% sequence identity with SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10). In some embodiments, the minimal promoter nucleic acid comprises a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 9, and 10.

[0013]

[0013] In some embodiments, the orientation of at least one of the promoter-derived nucleic acids is reversed.

[0014]

[0014] In some embodiments, the synthetic polynucleotide is any one reverse complement of the synthetic polynucleotides listed above.

[0015]

[0015] In some embodiments, the synthetic polynucleotide further comprises at least one spacer nucleic acid located between two of the promoter-derived nucleic acids. In some embodiments, the spacer may be 1 to 50 bp or 1 to 200 bp, for example, 5 to 150 bp, 10 to 100 bp, 15 to 75 bp or 20 to 50 bp, or any number of base pairs in between. In some embodiments, the synthetic polynucleotide does not contain a spacer.

[0016]

[0016] In some embodiments, the synthetic polynucleotide further comprises an operablely linked nucleic acid sequence encoding an intron. In some embodiments, the intron is derived from SV40. In some embodiments, the intron is derived from mouse minute virus (MVM). In some embodiments, the intron is a synthetic minimal intron. In some embodiments, the intron sequence has a length of less than 100 nucleotides. In some embodiments, the intron sequence may comprise one or more promoter-derived nucleic acids.

[0017]

[0017] In some embodiments, the synthetic polynucleotide has a length of less than 250 base pairs. In some embodiments, the synthetic polynucleotide has a length of less than 300 base pairs.

[0018]

[0018] In some embodiments, the polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, and 31. In some embodiments, the polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 41-45; 53-58; 67-69; 73-86.

[0019]

[0019] In some embodiments, synthetic polynucleotides promote transgene expression in the liver, preferably hepatic-specific transgene expression. In some embodiments, synthetic polynucleotides are suitable for promoting hepatic-specific transgene expression at a level at least 1.5 times higher than that of the LP1 promoter. In some embodiments, synthetic polynucleotides are suitable for promoting hepatic-specific transgene expression at a level at least 2 times higher than that of the LP1 promoter. In some embodiments, synthetic polynucleotides have a reduction in transgene expression at a level at least 4 times lower than that of the CMV promoter in non-hepatic-derived cells. In some embodiments, non-hepatic-derived cells are A549 cells. In some embodiments, synthetic polynucleotides are suitable for promoting hepatic-specific transgene expression at a level at least 1.5 times higher than that of the CMV promoter in hepatic-derived cells. In some embodiments, synthetic polynucleotides are suitable for promoting hepatic-specific transgene expression at a level at least 2 times higher than that of the CMV promoter in hepatic-derived cells. In some embodiments, synthetic polynucleotides have a reduction in transgene expression at a level at least 1.5 times lower than that of the LP1 promoter in non-hepatic-derived cells. In some embodiments, the synthetic polynucleotides exhibit a reduction in transgene expression at a level at least twice as low as that of the LP1 promoter in non-hepatic cells.

[0020]

[0020] In some embodiments, the synthetic polynucleotide further comprises operably linked nucleic acid sequences encoding post-transcriptional regulatory elements.

[0021]

[0021] In some embodiments, the synthetic polynucleotide further comprises an operablely linked nucleic acid sequence encoding a polyA element.

[0022]

[0022] In some embodiments, the synthetic polynucleotide further comprises an operablely linked transgene.

[0023]

[0023] In some embodiments, the synthetic polynucleotide further comprises an operablely linked transgene encoding AAT, AGXT, ARG, ASL, ASS, ATP7B, BCKDHA, BCKDHB, CFH, CFTF, CPS, DBT, FAH, FIX, FVIII, HAMP, HFE, JH, MUT, NAGS, OTC, PCCA, PCCB, PI, SLC40A1, TFR2, TTR, UGT1A1, urokinase, PXBP, or variants, derivatives or equivalents thereof.

[0024]

[0024] According to some embodiments, synthetic polynucleotides are provided that comprise at least three promoter-derived nucleic acids selected from the group consisting of (a) motif_44 (sequence number 12); (b) NRF2F1 (sequence number 14); (c) HNF1A (sequence number 15); (d) IA2 (sequence number 16); and (e) each of their biological equivalents.

[0025]

[0025] In some embodiments, the synthetic polynucleotide comprises the four promoter-derived nucleic acids (a) to (d) of the embodiments described immediately above. In some embodiments, the synthetic polynucleotide has at least 90% identity with the synthetic polynucleotide comprising the four promoter-derived nucleic acids (a) to (d).

[0026]

[0026] According to some embodiments, a synthetic polynucleotide is provided that has at least 90% identity with a synthetic polynucleotide comprising at least three promoter-derived nucleic acids selected from the group consisting of motif_44 (SEQ ID NO: 12); NRF2F1 (SEQ ID NO: 14); HNF1A (SEQ ID NO: 15); and IA2 (SEQ ID NO: 16).

[0027]

[0027] In some embodiments, the synthetic polynucleotide includes SEQ ID NO: 12, SEQ ID NO: 15, and SEQ ID NO: 16 consecutively from 5' to 3'. In some embodiments, SEQ ID NO: 14 is 3' relative to SEQ ID NO: 15. In some embodiments, SEQ ID NO: 14 is 5' relative to SEQ ID NO: 15.

[0028]

[0028] In some embodiments, the synthetic polynucleotide further comprises one or more sequences selected from (e) HNF1B (SEQ ID NO: 11); (f) JUN / FOS (SEQ ID NO: 17); (g) HNF4A (SEQ ID NO: 18); (h) SPI1 (SEQ ID NO: 19).

[0029]

[0029] In some embodiments, the synthetic polynucleotide comprises SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 14, SEQ ID NO: 12, and SEQ ID NO: 16, consecutively from 5' to 3'. In some embodiments, the synthetic polynucleotide has at least 90% identity with the synthetic polynucleotide comprising SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 14, SEQ ID NO: 12, and SEQ ID NO: 16, consecutively from 5' to 3'.

[0030]

[0030] In some embodiments, the synthetic polynucleotide includes, in sequence from 5' to 3', SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 12, SEQ ID NO: 15, and SEQ ID NO: 16. In some embodiments, the synthetic polynucleotide has at least 90% identity with the synthetic polynucleotide including, in sequence from 5' to 3', SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 12, SEQ ID NO: 15, and SEQ ID NO: 16.

[0031]

[0031] In some embodiments, the synthetic polynucleotide includes SEQ ID NO: 15 and / or SEQ ID NO: 16; as well as SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19. In some embodiments, the synthetic polynucleotide includes SEQ ID NO: 15 and / or SEQ ID NO: 16; as well as SEQ ID NO: 14 and SEQ ID NO: 12.

[0032]

[0032] In some embodiments, the synthetic polynucleotide further comprises at least one minimal promoter nucleic acid. In some embodiments, the sequence of the minimal promoter nucleic acid is derived from SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10), or a minimal promoter nucleic acid having at least 90% sequence identity with SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10). In some embodiments, the minimal promoter nucleic acid comprises a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 9, and 10.

[0033]

[0033] In some embodiments, the orientation of at least one of the promoter-derived nucleic acids is reversed.

[0034]

[0034] In some embodiments, the synthetic polynucleotide further comprises at least one spacer nucleic acid located between two of the promoter-derived nucleic acids.

[0035]

[0035] In some embodiments, the synthetic polynucleotide further comprises an operablely linked nucleic acid sequence encoding an intron. In some embodiments, the intron nucleic acid comprises a sequence derived from SV40. In some embodiments, the intron is derived from mouse microvirus (MVM). In some embodiments, the intron is a synthetic minimal intron. In some embodiments, the intron sequence has a length of less than 100 nucleotides. In some embodiments, the intron sequence may comprise one or more promoter-derived nucleic acids.

[0036]

[0036] In some embodiments, the synthetic polynucleotide has a length of less than 250 base pairs. In some embodiments, the synthetic polynucleotide has a length of less than 300 base pairs.

[0037]

[0037] In certain embodiments, the polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 32, 33, 34, and 35, or synthetic polynucleotides having at least 90% identity thereto. In some embodiments, the polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 32-25, SEQ ID NOs: 46-52, SEQ ID NOs: 59-66, and SEQ ID NOs: 70-72.

[0038]

[0038] In some embodiments, synthetic polynucleotides promote liver-specific transgene expression. In some embodiments, synthetic polynucleotides are suitable for promoting liver-specific transgene expression at a level at least 1.5 times higher than that of the LP1 promoter. In some embodiments, synthetic polynucleotides are suitable for promoting liver-specific transgene expression at a level at least 2 times higher than that of the LP1 promoter.

[0039]

[0039] In some embodiments, the synthetic polynucleotide further comprises an operablely linked nucleic acid sequence encoding a post-translational regulatory element.

[0040]

[0040] In some embodiments, the synthetic polynucleotide further comprises an operablely linked nucleic acid sequence encoding a polyA element.

[0041]

[0041] In some embodiments, the synthetic polynucleotide further comprises an operablely linked transgene. In some embodiments, the transgene encodes AAT, AGXT, ARG, ASL, ASS, ATP7B, BCKDHA, BCKDHB, CFH, CFTF, CPS, DBT, FAH, FIX, FVIII, HAMP, HFE, JH, MUT, NAGS, OTC, PCCA, PCCB, PI, SLC40A1, TFR2, TTR, UGT1A1, urokinase, PXBP, or variants, derivatives or equivalents thereof. In some embodiments, the transgene is a suicide gene.

[0042]

[0042] In some embodiments, the polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 36, 37, 38, 39 and 40.

[0043]

[0043] According to some embodiments, an expression cassette is provided comprising a synthetic polynucleotide according to any one of the embodiments described herein and an operablely linked polynucleotide sequence encoding a transgene, wherein the transgene encodes a therapeutic polypeptide suitable for use in the treatment of liver-related diseases or conditions.

[0044]

[0044] In some embodiments, the expression cassette further comprises nucleic acids encoding post-transcriptional regulatory elements.

[0045]

[0045] In some embodiments, the expression cassette further comprises a nucleic acid encoding a polyA element.

[0046]

[0046] According to some embodiments, gene therapy vectors are provided that include one of the synthetic polynucleotides described herein and / or an expression cassette according to one of the embodiments described herein.

[0047]

[0047] In some embodiments, the vector is a retroviral vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector (AAV). In some embodiments, the vector is an AAV vector. In some embodiments, the AAV has a serotype suitable for hepatic transduction. In some embodiments, the AAV is selected from the group consisting of AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV6.2, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV3B, and LK03.

[0048]

[0048] According to some embodiments, recombinant viral particles are provided comprising any one of the synthetic polynucleotides described herein, an expression cassette described herein, or a vector described herein.

[0049]

[0049] According to some embodiments, a method for treating a genetic disorder or condition in a subject requiring treatment is realized, comprising the step of administering an expression cassette or vector containing any one of the synthetic polynucleotides described herein, thereby expressing a therapeutic peptide in the liver of the subject.

[0050]

[0050] In some embodiments, the hereditary diseases or conditions related to the liver are selected from the group including, but are not limited to, hereditary cholestasis, Wilson's disease, hereditary hemochromatosis, tyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome-1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, GSD1A type, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythroproliferative protoporphyria, Gaucher disease, hemophilia A, hemophilia B, familial hypercholesterolemia, ornithine transcarbamylase deficiency, and phenylketonuria.

[0051]

[0051] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0052]

[0052] According to some embodiments, a method for expressing a transgene in hepatocytes is realized, which includes the step of contacting the hepatocytes with an expression cassette containing any one of the synthetic polynucleotides described herein, or a vector containing an expression cassette.

[0053]

[0053] According to some embodiments, a synthetic nucleic acid sequence according to any one of the embodiments described herein, an expression cassette comprising a synthetic nucleic acid sequence according to any one of the embodiments described herein, or a vector comprising an expression cassette is provided for use in the medical treatment of a genetic disease or condition. In some embodiments, hereditary diseases or conditions related to the liver are selected from the group including, but are not limited to, hereditary cholestasis, Wilson's disease, hereditary hemochromatosis, tyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome-1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, GSD1A type, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythroproliferative protoporphyria, Gaucher disease, hemophilia A, hemophilia B, familial hypercholesterolemia, ornithine transcarbamylase deficiency, and phenylketonuria. The above general description and the following detailed description are illustrative and explanatory and are intended to illustrate further the invention. [Brief explanation of the drawing]

[0054] [Figure 1] Figure 1 shows the evaluation of GFP expression in Huh7 and HepG2 cells by fluorescence-activated cell sorting (FACS). [Figure 2] Figure 2 shows the selection of the estimated minimal promoter candidate. The estimated TATA box (shown in bold), initiator sequence (underlined), and TSS (shown in bold and double underlined) elements are shown. The SERPINA1 minimal promoter sequence does not have a conventional TATA box, and the transcription start site derived from CAGE-seq experiments is indicated by an asterisk. [Figure 3] Figure 3 shows the evaluation of minimal promoter activity in Huh7 cells. [Figure 4]Figure 4 shows the evaluation of minimal promoter activity in HepG2 cells. [Figure 5] Figure 5 shows the FACS screening of promoter libraries in Huh7 and HepG2 cells. [Figure 6] Figures 6A-C show PCR rescues of individual promoter candidates. A shows data from HepG2 and Huh7 cells. B shows data from A1-A7. C shows data from A8-A11. [Figure 7] Figure 7 shows confirmation of the activity of 11 promoters identified from library screening in HepG2 and Huh7 cells. Left bar: Huh7 cells; right bar: HepG2 cells. [Figure 8] Figures 8A and 8B show promoter activity in primary human hepatocytes. A shows relative light units (RLU). B shows the magnification change relative to LP1. [Figure 9] Figure 9 shows an example of secondary FACS screening in HepG2 cells. [Figure 10] Figures 10A and 10B show confirmation of the activity of five promoters identified from secondary library screening. A shows RLU. B shows the magnification change relative to LP1. Left bar: HepG2 cells; right bar: Huh7 cells. [Figure 11] Figures 11A and 11B show the promoter activity of selected candidates in primary human hepatocytes. A shows RLU. B shows the magnification change relative to LP1. [Figure 12] Figure 12 shows confirmation of the activity of 10 promoters identified from library screening in primary hepatocytes. [Figure 13] Figures 13A and 13B show confirmation of promoter activity in primary hepatocytes. A shows RLU. B shows the magnification change relative to LP1. [Figure 14]Figure 14 shows the activity of promoters isolated in primary hepatocytes in various cell lines. A represents RLU. B represents the magnification change relative to LP1. Left bar: HepG2 cells, right bar: Huh7 cells. [Figure 15] Figures 15A-C show the retardant activity of the complex synthesis promoter compared to LP-1 in various cell types. A shows the RLU. B shows the retardant change relative to LP1. A shows a schematic diagram of the complex synthesis promoter. Left bar: Huh7 cells; Right bar: HepG2 cells. [Figure 16] Figure 16 shows the effect of SERPINE1 on the activity of the complex enhancer. Left bar: HepG2 cells; Right bar: Huh7 cells. [Figure 17] Figure 17 shows the effect of various minimal promoters on combined enhancer activity. Left bar: Huh7 cells, middle bar: HepG2 cells, right bar: HepaRG. [Figure 18] Figure 18 shows the effect of promoter size reduction on expression intensity. Left bar: Huh7 cells, Middle bar: HepG2 cells, Right bar: HepaRG. [Figure 19] Figure 19 shows the expression levels of rationally designed promoters in primary hepatocytes. [Figure 20] Figure 20 shows the activity of a rationally designed promoter in non-hepatocytes. [Figure 21] Figure 21 shows promoter activity screened in a cell line library in non-hepatocytes. Left bar: HeLa cells, Middle bar: 293 cells, Right bar: A549 cells. [Figure 22] Figure 22 shows promoter activity in non-hepatocytes screened using a primary hepatocyte library. Left bar: 293 cells, middle bar: HeLa cells, right bar: A549 cells. [Figure 23]Figures 23A–E show a comparison of in vitro versus in vivo expression of reporter genes. These figures demonstrate that the promoter drives reporter gene expression in both in vitro and in vivo experiments. All constructs were tested in both plasmid (transfection; panels A and B) and AAV-encapsulated form (transduction; panels C and D). Clear and robust responses were observed across all assays. Two controls were included: the LP1 promoter as a reference liver promoter, and a buffer (medium) control as a negative. In panel E, the DNA copies of DNA delivered to mouse liver were clearly equivalent for all constructs, and therefore the promoter performance is effective and reliable. [Figure 24] Figures 24A-D show the transfection of the AAV plasmid into cell lines and human primary hepatocytes. A shows the RLU at 48 hours in HepG2 cells. B shows the RLU at 48 hours in Huh7 cells. C shows the RLU at 48 hours in HepaRG cells. D shows the RLU at 48 hours in human primary hepatocytes. [Figure 25] Figure 25 shows the activity of the SEQ ID NO: 26 derivative after an average of three biological replicates. Derivatives and control sequences were screened in Huh7 cells using a standard luciferase assay, and promoter activity was normalized to the SEQ ID NO: 26 promoter to determine whether the changes made to the original promoter had a positive or negative effect on promoter activity. Transfection was performed in triples, and the luciferase assay was performed in doubles; each plot shows the results from three biological replicates. [Figure 26] Figure 26 shows that the SEQ ID NO: 33 derivative and control sequences were screened in Huh7 cells using a standard luciferase assay, and promoter activity was normalized to SEQ ID NO: 33 to determine whether the changes made to the original promoter had a positive or negative effect on promoter activity. Transfection was performed in triple replication, and the luciferase assay was performed in double replication; each plot shows the results from three biological replicates. [Figure 27] Figure 27 shows the activity of the SEQ ID NO: 35 derivative as an average of three biological replicates. The derivative and control sequences were screened in Huh7 cells using a standard luciferase assay, and promoter activity was normalized to the SEQ ID NO: 35 promoter to determine whether the changes made to the original promoter had a positive or negative effect on promoter activity. Transfection was performed in triples, and the luciferase assay was performed in doubles; each plot shows the results from three biological replicates. [Figure 28] Figure 28 shows the diagram for A2 (sequence number 36). [Figure 29] Figure 29 shows the diagram for A4 (sequence number 37). [Figure 30] Figure 30 shows the diagram for A11 (sequence number 38). [Figure 31] Figure 31 shows the diagram for C13 (sequence number 39). [Figure 32] Figure 32 shows the diagram for C81 (sequence number 40). [Figure 33] Figure 33 shows a parallel comparison of the HCR-hAAT promoter and its truncated form with the LP1 and HLP promoters, respectively. Three constructs encoding codon-optimized FVIII (named GD6, GD4, and COSX) were each driven by the indicated promoter variants and transfected into Huh-7 cells. FVIII production in the culture medium was detected by measuring antigen levels by ELISA (Affinity Biologicals) on supernatant collected 2 days after transfection, and transfection efficiency was corrected based on the cotransfected sea urchin luciferase plasmid. [Modes for carrying out the invention]

[0055]

[0087] Liver-specific promoters, as well as AAV gene therapy vectors, therapeutic agents, and methods containing them, are described herein.

[0056]

[0088] The liver-specific promoters disclosed herein were derived from one of two methods: (1) a method by rationally designing a promoter, or (2) a method by screening a library of candidate promoters derived from randomized combinations of known liver-related promoter elements. As a result, we were able to develop novel promoters that are not only smaller than naturally occurring promoter sequences but also more active and specific for expression in the liver.

[0057]

[0089] The disclosed compositions and methods may not be limited to the treatment of the liver or liver disease. Rather, the disclosed compositions and methods may be beneficial in the treatment of many types of diseases in which systemic proteins (proteins present in the blood) are mutated or abnormally expressed. By subjecting a patient to the methods of the present invention, the availability of therapeutic molecules expressed by the liver may be improved, thereby enabling more efficient transduction and / or lower doses of administered AAV.

[0058]

[0090] As will be discussed in more detail below, the types of AAV gene therapy vectors used in combination with the disclosed promoters are not particularly limited and may include AAVs from various serotypes, as well as recombinant or chimeric AAVs.

[0059]

[0091] The applications of the disclosed methods and promoters are wide-ranging and may be useful in improving the safety and efficacy of many gene therapy applications, as will be discussed in more detail below.

[0060]

[0092] Throughout this application and within this application, technical documents and patent documents are referenced by reference. For any particular reference, the reference is found at the end of this application immediately preceding the claims. All publications are incorporated into this disclosure by reference to better illustrate the current art in the field to which this disclosure belongs.

[0061]

[0093] definition

[0094] Where used in the description, sections, and accompanying claims of this invention, the singular forms "a," "an," and "the" are intended to be interchangeable, including the plural forms, and to take on their respective meanings, unless the context clearly indicates otherwise. Also, where used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the enumerated items, and, when interpreted in terms of options ("or"), the absence of any combination.

[0062]

[0095] Where used herein, the term “about” is understood by those skilled in the art and varies to some extent depending on the context in which it is used. Where there is a use of the term that is not obvious to those skilled in the art who have read the context in which it is used, “about” means up to 10 percent plus or minus a particular term.

[0063]

[0096] As used herein, “administration” of an agent (e.g., synthetic polynucleotides, expression cassettes, viral particles, vectors, polynucleotides, cells, cell populations, compositions, or pharmaceutical compositions) to a subject includes any route by which the agent is introduced or delivered to the subject in order to perform the intended function of the agent. Administration may be carried out by any preferred route, including oral, intranasal, intraocular, intraocular, parenteral (intravenous, intramuscular, intraperitoneal, or subcutaneous) or topical. Administration includes self-administration and administration by another person.

[0064]

[0097] The term "cell" as used herein refers to either a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is, optionally, a eukaryotic cell obtained from the subject or a commercially available source. In some embodiments, the cell is an isolated cell.

[0065]

[0098] Where used herein, the phrase “therapeutic dose” means the dose or plasma concentration in a subject to which the disclosed AAV gene therapy vector is administered to produce a specific pharmacological effect (e.g., to express a therapeutic gene or the gene of interest in a target cell / organ). While a therapeutic dose or therapeutic level of AAV vector is considered therapeutic dose by those skilled in the art, it is emphasized that a therapeutic dose or therapeutic level of AAV vector is not always effective in treating the conditions described herein. For convenience only, exemplary doses, drug delivery amounts and therapeutic doses are given below. Those skilled in the art may adjust such amounts as required to treat a particular subject and / or condition in accordance with standard practices. Therapeutic doses may vary based on the route of administration and dosage form, the age and weight of the subject, and / or the disease or condition being treated.

[0066]

[0099] As used herein, the terms “treatment” or “to treat” mean reducing, improving or eliminating one or more signs, symptoms or effects of a disease or condition (for example, increasing the expression of coagulation factors in a subject with hemophilia, or reducing the expression of disease-related genes by, for example, inducing RNA interference).

[0067]

[0100] The terms “individual,” “subject,” and “patient” are used interchangeably herein and refer to any individual subject having a disease or condition requiring treatment. For the purposes of this disclosure, a subject may be a primate, e.g., a human primate, or another mammal, e.g., a dog, cat, horse, pig, goat, or cow.

[0068]

[0101] The terms “polynucleotide” and “oligonucleotide” are used interchangeably and refer to polymeric forms of nucleotides of any length, which are either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides may have any three-dimensional structure and may perform any known or unknown function. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. Polynucleotides may include modified nucleotides, e.g., methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be given before or after the construction of the polynucleotide. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified after polymerization, for example, by conjugation with labeling components. The term also refers to both double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the present invention that is a polynucleotide encompasses both a double-stranded form and each of two complementary single-stranded forms that are known or predicted to constitute a double-stranded form.

[0069]

[0102] "Homologie," "identity," or "similarity" refers to sequence similarity between two peptides or two nucleic acid molecules. Homologie can be determined by comparing the positions in each sequence that can be aligned for comparison purposes. If the positions in the sequences being compared are occupied by the same base or amino acid, those molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity or less than 25% identity with one of the sequences of the present invention.

[0070]

[0103] A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) is said to have a certain percentage (e.g., 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) of “sequence identity” with another sequence, meaning that when aligned, the percentage of bases (or amino acids) is the same in a comparison of the two sequences. This alignment and homology percentage or sequence identity can be determined using software programs known in the art, for example, the software programs described in Ausubel et al. (2007) Current Protocols in Molecular Biology. Preferably, default parameters are used for alignment. One alignment program is BLAST, which uses default parameters. In particular, the programs are BLASTN and BLASTP, which use the following default parameters: gene code = standard; filter = none; strand = both; cutoff = 60; prediction = 10; matrix = BLOSUM62; description = 50 sequences; classification = high score; database = non-duplicate, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR. Details of these programs can be found at the following internet address: ncbi.nlm.nih.gov / cgi-bin / BLAST.

[0071]

[0104] An "equivalent" or "biologically equivalent" nucleic acid, polynucleotide, oligonucleotide, or peptide is one that has at least 55% sequence identity, or at least 60% sequence identity, or at least 65% sequence identity, or at least 70% sequence identity, or at least 75% sequence identity, or at least 80% sequence identity, or at least 85% sequence identity, or at least 90% sequence identity, or at least 92% sequence identity, or at least 95% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity. In some embodiments, the equivalent includes the reverse complement of the reference nucleic acid, polynucleotide, oligonucleotide, or promoter-derived nucleic acid. In some embodiments, the biological equivalent of a reference element is a functional equivalent that has substantially the same function as the reference element. For example, the biological equivalent of a particular promoter-derived nucleic acid that functions as a recognition or binding site for a particular effector molecule may contain sequence mutations but retain the ability to be recognized or bound by the same effector molecule. Equivalent functions can be determined by any relevant means known in the art, without limitation, including electromobility shift assays (EMSA), binding assays, chromatin immunoprecipitation (ChIP), ChIP-sequencing (ChIP-seq), immunoprecipitation, and reporter gene expression systems. In a particular example, the biological equivalent of NRF2F1 is an element that can be bound by the NRF2F1 protein, which can be determined by EMSA.

[0072]

[0105] As used herein, the term “vector” refers to a non-chromosomal nucleic acid containing an intact replicon so that it can replicate when introduced into a cell, for example, by a transformation process. Vectors may be viral or nonviral. Viral vectors include retroviruses, adenoviruses, herpesviruses, baculoviruses, modified baculoviruses, parvoviruses, or otherwise modified naturally occurring viruses. Exemplary nonviral vectors for delivering nucleic acids include naked DNA; DNA alone or in combination with cationic polymers, complexed with cationic lipids; anionic and cationic liposomes; DNA-protein complexes, and particles containing DNA condensed with cationic polymers, such as heterogeneous polylysines, oligopeptides and polyethyleneimines of a specified length, and in some cases contained in liposomes; and the use of ternary complexes containing viruses and polylysine DNA.

[0073]

[0106] A "viral vector" is defined as a recombinant virus or viral particle containing polynucleotides that is delivered to a host cell in vivo, ex vivo, or in vitro. Examples of viral vectors include retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors (AAVs), and alphaviral vectors. Viral vectors suitable for therapeutic use preferably do not express any viral vector proteins; that is, the vector genome contains all the genetic elements necessary for efficient replication and packaging of the vector genome within the viral capsid / envelope, but preferably does not contain genetic elements derived from wild-type viruses that produce viral proteins, as viral proteins can be associated with pathogenicity and / or induce undesirable immune responses. Alphaviral vectors, such as Semliki forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy. See Schlesinger and Dubensky (1999) Curr. Opin. Biotechnol. 5:434~439; Ying et al. (1999) Nat. Med. 5(7):823~827.

[0074]

[0107] The term "promoter" refers to the regulatory region of a nucleic acid that initiates transcription. In some embodiments, promoters may be constitutive or inductive. A constitutive promoter is a promoter that is always active and / or always directs gene transcription above the basal level. An inductive promoter is a promoter that can be induced by a molecule or factor added to or expressed in a cell. An inductive promoter may still produce basal level transcription in the absence of induction, but induction typically results in significantly more protein production. In some embodiments, promoters are tissue-specific. Tissue-specific promoters enable transcription in a particular population of cells.

[0075]

[0108] Synthetic polynucleotides

[0109] The synthetic polynucleotides of this disclosure comprise one or more promoter-derived nucleic acids. A “promoter-derived nucleic acid” is a nucleic acid comprising (i) all or part of a known promoter sequence; or (ii) a nucleic acid sequence that has been demonstrated or is known to have at least some promoter function.

[0076]

[0110] In some embodiments, the synthetic polynucleotide contains three or more promoter-derived nucleic acids. In some embodiments, the synthetic polynucleotide contains four or more promoter-derived nucleic acids. In some embodiments, the synthetic polynucleotide contains five or more promoter-derived nucleic acids. In some embodiments, the synthetic polynucleotide contains six or more promoter-derived nucleic acids. In some embodiments, the synthetic polynucleotide contains seven or more promoter-derived nucleic acids. In some embodiments, the synthetic polynucleotide contains eight or more promoter-derived nucleic acids. In some embodiments, the synthetic polynucleotide contains nine or more promoter-derived nucleic acids. In some embodiments, the synthetic polynucleotide contains ten or more promoter-derived nucleic acids. Non-limiting, exemplary promoter elements are shown as SEQ ID NOs. 1-19 and are listed in Table 1.

[0077]

[0111] In some embodiments, one or more promoter-derived nucleic acids are combined with minimal promoter elements, such as “TATA boxes.” Since minimal promoter sequences enable transcription initiation, promoter elements do not necessarily require a transcription initiation site. Exemplary minimal promoter elements can be selected from the group consisting of APOC2 (SEQ ID NO: 9), SERPINA1_mp (SEQ ID NO: 8), SERPINE1_mp (SEQ ID NO: 7), G6PC (SEQ ID NO: 10), and their respective bioequivalents.

[0078]

[0112] According to some embodiments, synthetic polynucleotides are provided that include at least three promoter-derived nucleic acids selected from the group consisting of HNF1 / HNF3 (SEQ ID NO: 1); HNF3 / HNF3 (SEQ ID NO: 2); c / EBP / HNF4 (SEQ ID NO: 3); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or their variants.

[0079]

[0113] According to some embodiments, synthetic polynucleotides are provided that include at least four promoter-derived nucleic acids selected from the group consisting of HNF1 / HNF3 (SEQ ID NO: 1); HNF3 / HNF3 (SEQ ID NO: 2); c / EBP / HNF4 (SEQ ID NO: 3); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or their variants.

[0080]

[0114] According to some embodiments, a synthetic polynucleotide is provided comprising HNF1 / HNF3 (SEQ ID NO: 1) and at least three promoter-derived nucleic acids selected from the group consisting of HNF3 / HNF3 (SEQ ID NO: 2); c / EBP / HNF4 (SEQ ID NO: 3); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or their variants.

[0081]

[0115] According to some embodiments, a synthetic polynucleotide is provided comprising c / EBP / HNF4 (SEQ ID NO: 3) and at least three promoter-derived nucleic acids selected from the group consisting of HNF1 / HNF3 (SEQ ID NO: 1); HNF3 / HNF3 (SEQ ID NO: 2); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or their variants.

[0082]

[0116] According to some embodiments, synthetic polynucleotides are provided comprising HNF1 / HNF3 (SEQ ID NO: 1) and c / EBP / HNF4 (SEQ ID NO: 3), and at least two promoter-derived nucleic acids selected from the group consisting of HNF3 / HNF3 (SEQ ID NO: 2); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or their variants.

[0083]

[0117] In some embodiments, the synthetic polynucleotide comprises all five promoter-derived nucleic acids. In some embodiments, the complete exemplary promoter sequence may include one or more of SEQ ID NOs: 21-31.

[0084]

[0118] In some embodiments, variants of the HS_CRM8 sequence are selected from the group consisting of SEQ ID NOs. 5, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, and their respective equivalents.

[0085]

[0119] In some embodiments, a liver-specific promoter is provided that includes a variant of the HS_CRM8 sequence selected from the group consisting of SEQ ID NOs. 5, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, and their respective equivalents.

[0086]

[0120] As shown in the examples, the HS_CRM8 sequence represents a complex element, and variants have been created that, when included in a liver-specific promoter as listed above, have been shown to have substantially the same activity. Furthermore, deletion of this element resulted in a strong reduction in liver gene expression. Therefore, a liver-specific promoter according to the present invention can be defined as containing, instead of, or in addition to containing a variant of the HS_CRM8 sequence, SEQ ID NO: 101 (ACTTAGCCCCTGTTTGCTCCTCCG) and / or SEQ ID NO: 102 (TGACCTTGGTTAATATTCACCAGC), preferably SEQ ID NO: 101 and SEQ ID NO: 102. It is also understood that such a liver-specific promoter according to the present invention may contain variants of SEQ ID NO: 101 and / or SEQ ID NO: 102, or reverse complements of one or both of them. Therefore, whenever the description herein states that SEQ ID NO: 5 is included in the liver-specific promoter, the promoter may be defined, instead of SEQ ID NO: 5, as including SEQ ID NO: 101 and / or SEQ ID NO: 102, or a functional equivalent of SEQ ID NO: 101 and / or SEQ ID NO: 102, or a reverse complement of one or both of them. As shown in the examples, many functional equivalents were made from prospects of promoter activity, i.e., having very similar activity. For example, SEQ ID NO: 101 may have a sequence corresponding to SEQ ID NO: 105, which is substituted with SEQ ID NO: 107. Furthermore, SEQ ID NO: 1 may have a sequence TCCG, which is substituted with the sequence TTAG. It is also understood that the functional equivalent may instead have a sequence corresponding to SEQ ID NO: 105 as the reverse complement, and similarly the same may apply to TCCG.

[0087]

[0121] Furthermore, as shown in the examples, many of the variants derived from SEQ ID NO: 5 exhibited very similar activity, albeit slightly reduced, compared to SEQ ID NO: 5, while still retaining a substantial improvement in activity compared to LP1. Therefore, variants of HS_CRM8 also include a composite element comprising SEQ ID NO: 101 and a sequence selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 104 (TGGTTAATATTCACCAGC), and SEQ ID NO: 106 (TGACCTTGGTTAATATTCACCA); or a composite element comprising SEQ ID NO: 103 (CCCTGTTTGCTCCTCCG) and a sequence selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 104 (TGGTTAATATTCACCAGC), and SEQ ID NO: 106 (TGACCTTGGTTAATATTCACCA); or a composite element comprising SEQ ID NO: 105 (CCCTGTTTGCTCC) and the sequence TCCG and a sequence selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 104 (TGGTTAATATTCACCAGC), and SEQ ID NO: 106 (TGACCTTGGTTAATATTCACCA). It can be defined as a rement; or a composite element comprising SEQ ID NO: 105 and sequence TTAG and a sequence selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 104 (TGGTTAATATTCACCAGC), SEQ ID NO: 106 (TGACCTTGGTTAATATTCACCA); or a composite element comprising SEQ ID NO: 107 (CCCTATTTACTCC) and sequence TCCG and a sequence selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 104 (TGGTTAATATTCACCAGC), SEQ ID NO: 106 (TGACCTTGGTTAATATTCACCA); or a composite element comprising SEQ ID NO: 107 and sequence TTAG and a sequence selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 104 (TGGTTAATATTCACCAGC), SEQ ID NO: 106 (TGACCTTGGTTAATATTCACCA). The aforementioned variants of HS_CRM8 are understood to preferably have a sequence length of less than 60 nucleotides.Furthermore, it is understood that the components included in the composite elements defined herein may be substituted with the inverse complementary sequences of sequence numbers 101, 102, 103, 104, 105, 106, 107, TTAG, and TCCG.

[0088]

[0122] According to some embodiments, synthetic polynucleotides are provided that include at least a portion of a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with HS_CRM8 or wild-type CRM8.

[0089]

[0123] The use of the HS_CRM8 variants disclosed herein is not limited to synthetic polynucleotides, such as those described in the Examples section, but may also be useful in novel liver-specific promoters and / or liver-specific promoters described in the prior art that include CRM8 sequences. In the latter case, the HS_CRM8 variant sequences described herein (e.g., the listed variants including various combinations of SEQ ID NOs. 5 and 87-99, or SEQ ID NOs. 101-107) are suitably used to substitute some or all of the CRM8 sequences present in the prior art promoters. In this way, size reduction and / or increase in liver-specific gene expression and / or liver selectivity can be achieved compared to wild-type CRM8 sequences (SEQ ID NOs. 6 or SEQ ID NOs. 100).

[0090]

[0124] Accordingly, according to some embodiments of the present invention, a synthetic liver-specific promoter is provided that includes a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with any of the listed HS_CRM8 variants (e.g., the listed variants including various combinations of SEQ ID NOs. 5 and 87-99, or SEQ ID NOs. 101-107), or at least 99% identity with any of the listed HS_CRM8 variants.

[0091]

[0125] Further provided are expression cassettes, vectors (e.g., gene therapy vectors, e.g., AAV vectors), recombinant viral particles, or pharmaceutical compositions containing such HS_CRM8 variants and synthetic liver-specific promoters.

[0092]

[0126] Furthermore, a method for treating a genetic disorder or condition in a subject requiring treatment is realized, comprising the step of administering an expression cassette containing a synthetic liver-specific promoter containing such HS_CRM8 variant, or a vector containing such an expression cassette, thereby expressing a therapeutic peptide in the liver of the subject. Further optional or preferred details of such a method are provided elsewhere in this disclosure.

[0093]

[0127] Furthermore, a method for expressing a transgene in hepatocytes is realized, comprising the step of contacting the hepatocytes with an expression cassette containing a synthetic liver-specific promoter containing such HS_CRM8 variant, or a vector containing such an expression cassette. Further optional or preferred details of such a method are provided elsewhere in this disclosure.

[0094]

[0128] Furthermore, the following are provided for use in the medical treatment of hereditary diseases or conditions: expression cassettes containing such HS_CRM8 variants, synthetic liver-specific promoters containing such CRM8 variants, vectors (e.g., gene therapy vectors, e.g., AAV vectors), recombinant viral particles, and pharmaceutical compositions. Various specific diseases, as well as details of optional and preferred uses, are described elsewhere in this application.

[0095]

[0129] According to some embodiments, a synthetic polynucleotide is provided that has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with a synthetic polynucleotide comprising at least three promoter-derived nucleic acids selected from the group consisting of HNF1 / HNF3 (SEQ ID NO: 1); HNF3 / HNF3 (SEQ ID NO: 2); c / EBP / HNF4 (SEQ ID NO: 3); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or their variants. In some embodiments, a synthetic polynucleotide is provided that is a bioequivalent of a synthetic polynucleotide comprising at least three promoter-derived nucleic acids selected from the group consisting of HNF1 / HNF3 (SEQ ID NO: 1); HNF3 / HNF3 (SEQ ID NO: 2); c / EBP / HNF4 (SEQ ID NO: 3); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or their variants.

[0096]

[0130] In some embodiments, the synthetic polynucleotide comprises, in sequence from the 5' end to the 3' end, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 6, or each of their equivalents.

[0097]

[0131] In some embodiments, promoter-derived nucleic acids are operably linked.

[0098]

[0132] In some embodiments, the synthetic polynucleotide further comprises at least one minimal promoter nucleic acid. Non-limiting examples of preferred minimal promoter nucleic acids include SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10), or their respective equivalents. In some embodiments, the equivalent minimal promoter nucleic acid is a minimal promoter nucleic acid having sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10). In some embodiments, the equivalent minimal promoter nucleic acid is a bioequivalent of SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10). In some embodiments, the minimal promoter nucleic acid comprises a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 9, and 10.

[0099]

[0133] According to some embodiments, synthetic polynucleotides are provided that have at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with synthetic polynucleotides comprising four or five different promoter-derived nucleic acids selected from the group consisting of HNF1 / HNF3 (SEQ ID NO: 1); HNF3 / HNF3 (SEQ ID NO: 2); c / EBP / HNF4 (SEQ ID NO: 3); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or their variants. Preferred minimal promoter nucleic acids include SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10). In some embodiments, a synthetic polynucleotide is provided which is a bioequivalent of a synthetic polynucleotide comprising four or five different promoter-derived nucleic acids selected from the group consisting of HNF1 / HNF3 (SEQ ID NO: 1); HNF3 / HNF3 (SEQ ID NO: 2); c / EBP / HNF4 (SEQ ID NO: 3); HS_CRM2 / HNF3 (SEQ ID NO: 4); and HS_CRM8 (SEQ ID NO: 6) or their variants. Preferred minimal promoter nucleic acids include SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10).

[0100]

[0134] In some embodiments, the orientation of at least one of the promoter-derived nucleic acids (excluding the minimal promoter element, as this element is associated with transcription initiation) is reversed. In some embodiments, the synthetic polynucleotide comprises at least one reverse complement of the promoter-derived nucleic acids described herein (excluding the minimal promoter element, as this element is associated with transcription initiation).

[0101]

[0135] In some embodiments, the synthetic polynucleotide further comprises at least one spacer nucleic acid located between two of the promoter-derived nucleic acids, or between the promoter-derived nucleic acid and the ITR. Such a spacer nucleic acid may not encode a transcription factor binding sequence and may simply be a random sequence and / or have no effect on the DNA structure, but may be a sequence that allows the two promoter-derived nucleic acids to perform their functions, i.e., both to bind to their respective transcription factors. Such a spacer nucleic acid may be one, two, three, four, or more nucleotides or base pairs. In some embodiments, the spacer nucleic acid has a length of 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 nucleotides or base pairs. In some embodiments, the space may have a length of 1 to 200, 1 to 150, 1 to 100, 1 to 50, 5 to 150, 10 to 100, 15 to 75, or 20 to 50 nucleotides or base pairs, or any number of nucleotides or base pairs in between. For example, a space may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 or more nucleotides or base pairs. Such spacer sequences are excluded from sequence identity calculations; that is, if the synthetic polynucleotide according to the present invention contains the promoter elements and minimum promoter sequences as defined herein, sequence identity is preferably calculated for the defined promoter elements and minimum promoter sequences alone, and does not include spacer elements(s).

[0102]

[0136] A non-limiting example of a synthetic polynucleotide containing spacers is found in SEQ ID NO: 26. The spacer nucleotides are underlined in SEQ ID NO: 26. In some embodiments, the bioequivalent of SEQ ID NO: 26 is a synthetic polynucleotide containing SEQ ID NO: 26, with one or more of the spacer nucleotides removed.

[0103]

[0137] In some embodiments, the synthetic polynucleotide further comprises an operablely linked nucleic acid sequence encoding an intron. In some embodiments, the intron is derived from SV40. In some embodiments, the intron is derived from MVM. In some embodiments, the intron is a synthetic intron sequence. In some embodiments, the intron sequence has a length of less than 1000, less than 900, less than 800, less than 700, less than 600, less than 500, less than 400, less than 300, less than 200, less than 100, less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, less than 10, or less than 5 nucleotides. In some embodiments, the intron sequence consists of 5 to 200 nucleotides, 5 to 150 nucleotides, 10 to 125 nucleotides, or 10 to 100 nucleotides. In some embodiments, the intron sequence may include one or more promoter-derived nucleic acids.

[0104]

[0138] In some embodiments, the polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 42 and their respective equivalents. In some embodiments, the polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 42-46; 54-59; 68-70; 74-86 and their respective equivalents.

[0105]

[0139] In some embodiments, synthetic polynucleotides promote transgene expression in the liver, preferably hepatic-specific transgene expression. In some embodiments, synthetic polynucleotides are suitable for promoting hepatic-specific transgene expression at a level at least 1.5 times higher than that of the LP1 promoter. In some embodiments, synthetic polynucleotides are suitable for promoting hepatic-specific transgene expression at a level at least 2 times higher than that of the LP1 promoter. In some embodiments, synthetic polynucleotides are suitable for promoting hepatic-specific transgene expression at a level at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50 times higher than that of the LP1 promoter, for example, when compared to LP1 with the synthetic polynucleotides of the present invention, as shown in the Examples section for Huh7 transfection and / or AAV transduction into Huh7 cells, or as determined by transgene expression in animals. In some embodiments, synthetic polynucleotides result in a reduction of transgene expression at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50 times lower than that of the LP1 promoter in non-hepatic cells. A non-limiting example of non-hepatic cells is A549 cells.

[0106]

[0140] In some embodiments, synthetic polynucleotides are suitable for promoting liver-specific transgene expression at a level at least four times higher than that of the CMV promoter. In some embodiments, synthetic polynucleotides are suitable for promoting liver-specific transgene expression at a level at least two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty, twenty-five, thirty, forty, or fifty times higher than that of the CMV promoter in liver-derived cells. In some embodiments, synthetic polynucleotides result in a reduction of transgene expression at a level at least 1.5, two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty-five, thirty, forty, or fifty times lower than that of the CMV promoter in non-liver-derived cells. A non-limiting example of non-liver-derived cells is A549 cells.

[0107]

[0141] In some embodiments, the synthetic polynucleotide further comprises an operablely linked transgene. In some embodiments, the transgene encodes AAT, AGXT, ARG, ASL, ASS, ATP7B, BCKDHA, BCKDHB, CFH, CFTF, CPS, DBT, FAH, FIX, FVIII, HAMP, HFE, JH, MUT, NAGS, OTC, PCCA, PCCB, PI, SLC40A1, TFR2, TTR, UGT1A1, urokinase, PXBP, or variants, derivatives, or equivalents thereof.

[0108]

[0142] According to some embodiments, synthetic polynucleotides are provided that include at least three promoter-derived nucleic acids selected from the group consisting of motif_44 (SEQ ID NO: 12); NRF2F1 (SEQ ID NO: 14); HNF1A (SEQ ID NO: 15); IA2 (SEQ ID NO: 16); and their respective bioequivalents.

[0109]

[0143] According to some embodiments, a synthetic polynucleotide is provided comprising at least three promoter-derived nucleic acids selected from the group consisting of motif_44 (sequence number 12); NRF2F1 (sequence number 14); HNF1A (sequence number 15); and IA2 (sequence number 16); sequence number 33; sequence number 35; and their respective bioequivalents. According to some embodiments, a synthetic polynucleotide is provided having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with the synthetic polynucleotide comprising at least three promoter-derived nucleic acids selected from the group consisting of motif_44 (sequence number 12); NRF2F1 (sequence number 14); HNF1A (sequence number 15); and IA2 (sequence number 16); sequence number 33; and sequence number 35.

[0110]

[0144] In some embodiments, the synthetic polynucleotide includes SEQ ID NO: 12, SEQ ID NO: 15, and SEQ ID NO: 16, arranged consecutively from 5' to 3'. In some embodiments, SEQ ID NO: 14 is 3' relative to SEQ ID NO: 15. In some embodiments, SEQ ID NO: 14 is 5' relative to SEQ ID NO: 15.

[0111]

[0145] In some embodiments, the synthetic polynucleotide further comprises one or more sequences selected from (e) HNF1B (SEQ ID NO: 11); (f) JUN / FOS (SEQ ID NO: 17); (g) HNF4A (SEQ ID NO: 18); (h) SPI1 (SEQ ID NO: 19) or their respective bioequivalents.

[0112]

[0146] In some embodiments, the synthetic polynucleotide includes, in sequence from 5' to 3', SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 14, SEQ ID NO: 12, and SEQ ID NO: 16. In some embodiments, the synthetic polynucleotide includes, in sequence from 5' to 3', SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 12, SEQ ID NO: 15, and SEQ ID NO: 16.

[0113]

[0147] In some embodiments, the synthetic polynucleotide further comprises at least one minimal promoter nucleic acid. In some embodiments, the sequence of the minimal promoter nucleic acid is derived from SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), G6PC (SEQ ID NO: 10), or each of their bioequivalents, or from a minimal promoter nucleic acid having sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity with SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10). In some embodiments, the minimal promoter nucleic acid comprises a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 9, and 10.

[0114]

[0148] In some embodiments, the synthetic polynucleotide comprises, sequentially from 5' to 3', SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 14, SEQ ID NO: 12, and SEQ ID NO: 16, or the synthetic polynucleotide comprises, sequentially from 5' to 3', SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 12, SEQ ID NO: 15, and SEQ ID NO: 16; followed by SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), G6PC (SEQ ID NO: 10), or each of their bioequivalents, or minimal promoter nucleic acids derived from synthetic polynucleotides having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0115]

[0149] In some embodiments, the synthetic polynucleotide further comprises operably linked nucleic acid sequences encoding introns. Non-limiting examples of introns include hCMV intron A, adenovirus tripartite leader sequence intron, SV40 intron, MVM intron, Chinese hamster EF-1 alpha gene intron 1, and intervention sequence introns. In some embodiments, the intron nucleic acid comprises sequences derived from SV40. For preferred methods and descriptions of adding intron sequences, see, for example, Xu et al. J Cell Mol Med. 2018 April;22(4):2231~2239.

[0116]

[0150] In some embodiments, the synthetic polynucleotides have lengths of approximately 20 to approximately 800 bp, approximately 40 to approximately 100 bp, approximately 50 to approximately 150 bp, approximately 60 to approximately 200 bp, approximately 80 to approximately 250 bp, approximately 90 to approximately 275 bp, approximately 100 to approximately 300 bp, approximately 50 to approximately 300 bp, approximately 100 to approximately 400 bp, approximately 100 to approximately 500 bp, approximately 100 to approximately 600 bp, approximately 100 to approximately 700 bp, approximately 200 to approximately 800 bp, or approximately 50 to approximately 1000 bp. In some embodiments, the length of the synthetic polynucleotides is less than approximately 1000, less than approximately 900, less than approximately 800, less than approximately 700, less than approximately 600, less than approximately 500, less than approximately 400, less than approximately 300, less than approximately 250, less than approximately 200 base pairs, or less than approximately 150 base pairs. In certain embodiments, the synthetic polynucleotide is less than 250 base pairs in length, or less than 300 base pairs in length.

[0117]

[0151] In certain embodiments, the polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 21-31, 41-45, 53-58, 67-69, and 73-86 or their respective bioequivalents, or synthetic polynucleotides having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with them.

[0118]

[0152] In certain embodiments, the polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 32-35, 46-52, 59-66, 70-72 or their respective bioequivalents, or synthetic polynucleotides having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with them.

[0119]

[0153] In some embodiments, the synthetic polynucleotide further comprises operably linked nucleic acid sequences encoding post-translational regulatory elements. Non-limiting examples of post-translational regulatory elements include 5'UTR, 3'UTR, and poly-A elements. In some embodiments, the synthetic polynucleotide further comprises operably linked nucleic acid sequences encoding poly-A elements.

[0120]

[0154] In some embodiments, the synthetic polynucleotide further comprises an operablely linked transgene. In some embodiments, the transgene encodes AAT, AGXT, ARG, ASL, ASS, ATP7B, BCKDHA, BCKDHB, CFH, CFTF, CPS, DBT, FAH, FIX, FVIII, HAMP, HFE, JH, MUT, NAGS, OTC, PCCA, PCCB, PI, SLC40A1, TFR2, TTR, UGT1A1, urokinase, PXBP, or variants, derivatives, or equivalents thereof.

[0121]

[0155] In some embodiments, the transgene is a suicide gene. In some embodiments, the transgene is inducible. In some embodiments, the suicide gene is herpes simplex virus thymidine kinase ("HSV-tk") (Genbank accession number AB45318.1 (nucleotides 3331-4458)). Other non-limiting examples of suicide genes include codon-optimized TK or tk30, tk75, and sr39tk, as described in Pantuck et al. (2004) Human Gene Therapy, 13(7):777-789; Black et al. (2001) Cancer Res. 61:3022-3026; and Ardiani et al. (2010) Cancer Gene Therapy 17:86-96.

[0122]

[0156] In some embodiments, the synthetic polynucleotide is encoded by DNA. In some embodiments, the synthetic polynucleotide is encoded by RNA, optionally by viral RNA. The synthetic polynucleotide may be single-stranded or double-stranded. In some embodiments, the structural form of the synthetic polynucleotide (i.e., DNA or RNA, single-stranded or double-stranded) is determined by the applicable gene therapy medium used. For example, a lentiviral vector contains a single-stranded RNA genome. An AAV vector contains either a single-stranded DNA vector genome or a double-stranded DNA vector genome, which may depend on the size and / or design of the vector genome. If the lentiviral vector genome is reverse-transcribed during transduction, the RNA sequence is converted to the corresponding DNA sequence.

[0123]

[0157] In some embodiments, the synthetic polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 36, 37, 38, 39, 40 and their respective bioequivalents, or synthetic polynucleotides having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with them.

[0124]

[0158] In some embodiments, the inclusion of the disclosed liver-specific promoter can increase the expression of a therapeutic gene or gene of interest in the liver by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, or more, compared to a known non-specific promoter (e.g., wild-type CRM8). In some embodiments, the synthetic polynucleotide increases expression by at least 1.2 to 1.8, 1.5 to 2.5, 2 to 5, 4 to 10, 5 to 20, or 10 to 100 times compared to a known promoter.

[0125]

[0159] In some embodiments, the inclusion of the disclosed liver-specific promoter can increase the expression of a therapeutic gene or gene of interest in the liver by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, or more, compared to a known liver-specific promoter (e.g., the LP-1 promoter). In some embodiments, the synthetic polynucleotide increases expression by at least 1.2 to 1.8, 1.5 to 2.5, 2 to 5, 4 to 10, 5 to 20, or 10 to 100 times compared to a known liver-specific promoter.

[0126]

[0160] Suitable nucleic acid sequences and non-limiting examples of synthetic polynucleotides for use in the synthetic polynucleotides of this disclosure are shown in Tables 1, 2, and 3 below.

[0127] [Table 1] JPEG0007832262000002.jpg189149 JPEG0007832262000003.jpg194147 JPEG0007832262000004.jpg188149 JPEG0007832262000005.jpg176147 JPEG0007832262000006.jpg201149

[0128] [Table 2] JPEG0007832262000008.jpg161147 JPEG0007832262000009.jpg204147 JPEG0007832262000010.jpg186149 JPEG0007832262000011.jpg174149 JPEG0007832262000012.jpg179149 JPEG0007832262000013.jpg166149 JPEG0007832262000014.jpg192149 JPEG0007832262000015.jpg186149 JPEG0007832262000016.jpg198149

[0129] [Table 3] JPEG0007832262000018.jpg104149 JPEG0007832262000019.jpg72149

[0130]

[0161] Expression cassette

[0162] According to some embodiments, an expression cassette is provided comprising a synthetic polynucleotide according to any one of the embodiments described herein and an operablely linked polynucleotide sequence encoding a transgene, wherein the transgene encodes a therapeutic polypeptide suitable for use in the treatment of liver-related diseases or conditions.

[0131]

[0163] In some embodiments, the expression cassette further comprises a nucleic acid encoding a post-transcriptional regulatory element. In some embodiments, the expression cassette further comprises a nucleic acid encoding a poly(A) element.

[0132]

[0164] Gene therapy vectors

[0165] According to some embodiments, a vector comprising any one of the synthetic polynucleotides described herein or an expression cassette described herein is provided.

[0133]

[0166] In some embodiments, the vector is naked DNA, a retroviral vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector (AAV). In some embodiments, the vector is an AAV vector. In some embodiments, the AAV has a serotype suitable for hepatic transduction. In some embodiments, the AAV is selected from the group consisting of AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV6.2, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV3B, and LK03.

[0134]

[0167] In some embodiments, the disclosed liver-specific promoter is incorporated into the AAV gene therapy vector. The AAV gene therapy vector may encode multiple components (e.g., capsid proteins, ITRs, etc.), which may be of the same or different serotypes, and the vector may encode one or more therapeutic genes or genes of interest.

[0135]

[0168] AAV gene therapy vectors may contain an AAV capsid and polynucleotides. Polynucleotides may encode therapeutic proteins; however, not all polynucleotides encode therapeutic proteins. In some embodiments, polynucleotides within an AAV gene therapy vector may encode a target gene (e.g., a mutated gene in the target), a target protein (e.g., a low-expression or mutated protein in the target), or therapeutic RNA (e.g., siRNA, miRNA, or shRNA that targets a mutated or overexpressed gene). Therefore, the transgene or therapeutic gene may contain a polynucleotide sequence encoding a therapeutic protein, or therapeutic RNA or a fragment thereof.

[0136]

[0169] The serotypes of AAV gene therapy vectors are not particularly limited and may include, but are not limited to, AAV serotype 1 (AAV1), AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or AAV11. In some embodiments, the AAV is chimeric, meaning that the AAV contains components from at least two AAV serotypes, e.g., the ITR of AAV2 and the capsid protein of AAV5. In some embodiments, the gene therapy may involve the administration of multiple AAV gene therapy vectors, which may be of the same serotype or different serotypes.

[0137]

[0170] In some embodiments, AAV was found in human cells or in non-human primate cells, such as rhesus monkey cells or cynomolgus monkey cells.

[0138]

[0171] In some embodiments, the AAV capsid is not a wild-type capsid but is rAAV2 / 5, which includes at least a portion of recombinant AAV (rAAV), such as AAV2 and AAV5. For example, the VP1 capsid protein may consist of a hybrid amino acid sequence between AAV2 and AAV5, while the VP2 and VP3 capsids may be derived from the AAV5 serotype (e.g., Urabe et al., Scalable generation of high-titer recombinant adeno-associated virus type 5 in insect cells. J Virol. February 2006; 80(4):1874~85). In some embodiments, the AAV is a chimeric AAV (AAV2 / 5). ch ), for example, chimeric AAV serotype 5 (AAV5 ch )

[0139]

[0172] When multiple AAV gene therapy vectors are administered to a target, at least two of the multiple AAV gene therapy vectors may be of the same type of AAV, while in some embodiments, at least two of the multiple AAV gene therapy vectors may be of different types of AAV.

[0140]

[0173] Therapeutic genes

[0174] In some embodiments, the AAV gene therapy vector includes a transgene or therapeutic gene. The transgene or therapeutic gene includes a polynucleotide sequence encoding a therapeutic protein, therapeutic RNA, or a fragment thereof.

[0141]

[0175] The therapeutic protein may be a primate protein, a non-primate protein, or a human protein. In some embodiments, the therapeutic protein may, without limitation, include factor IX (FIX), factor VIII (FVIII), and variants, derivatives, or equivalents thereof.In some embodiments, therapeutic genes include, but are not limited to, alpha-1 antitrypsin (AAT), aromatic amino acid decarboxylase (AADC), ATPase sarcoplasmic reticulum / endoplasmic reticulum Ca2+ transport 2 (ATP2A2), cystic fibrosis transmembrane conductance regulator (CTFR), glutamic acid decarboxylase 65kDa protein (GAD65), glutamic acid decarboxylase 67kDa protein (GAD67), lipoprotein lipase (LPL), nerve growth factor (NGF), neurturin (NTN), and porphobilinogen deaminase (PBGD). Deaminase, sarcoglycan alpha (SGCA), soluble fms-like tyrosine kinase-1 (sFLT-1), S100 calcium binding protein A1 (S100A1), survival of motor neuron 1 (SMN1), tripeptidyl peptidase 1 (TPP1), tumor necrosis factor receptor (TNFR)-immunoglobulin (IgG1) Fc fusion (TNFR:Fc), interferon beta (IFN-β), neuropeptide Y receptor Y2, alpha-glucosidase, C9orf72, superoxide dismutase (SOD). This may include dismutase, CFTR, alpha-galactosidase, alpha-N-acetylgalactosaminidase, uricase, chondroitinase, HexA, HexB, and modified versions thereof.

[0142]

[0176] Furthermore, the introduced gene and / or therapeutic gene may be associated with gene editing. Gene editing is a type of genetic manipulation in which DNA is inserted, deleted, or replaced in the genome of a living organism using a modified nuclease or "molecular scissors." Currently, four classes of gene editing are available, including meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems. The AAV vectors used may be modified to have transient gene-editing capabilities in order to allow endogenous genes to be edited. The nuclease creates a site-directed double-strand break (DSB) at a desired location in the genome. The induced double-strand breaks are then repaired, for example, through nonhomologous end-joining (NHEJ) or homologous recombination (HR), resulting in targeted mutations. For example, one or more AAV gene therapy vectors may encode genes that target specific gene sequences. The targeted gene may be a pathogenic gene, and the goal of the treatment is to disrupt the expression of the pathogenic gene. Another approach may aim to repair, for example, a pathogenic gene with X-linked related disease, or a dominant disease-associated gene. One or more AAV gene therapy vectors may encode gene editing sequences and DNA sequences for repairing the inserted / substituted DNA sequence and / or disease-associated gene, for example, via homologous recombination.

[0143]

[0177] In some embodiments of the above-described models, the AAV gene therapy vector may contain polynucleotides encoding interfering RNA (siRNA); microRNA (miRNA); or short hairpin RNA (shRNA). In some embodiments, the siRNA, miRNA, or shRNA targets and silences or downregulates disease-related genes. For example, target genes for silencing may include genes associated with repeat diseases (e.g., trinucleotide (i.e., polyglutamine or non-polyglutamine diseases) or hexanucleotide repeat diseases), such as the Htt gene or the C9orf72 gene. In some embodiments, the therapeutic RNA interferes with the expression of genes encoding disease-related proteins.

[0144] Therapeutic drugs

[0178] In some embodiments, the disclosed method may include one or more therapeutic agents that can be administered before, concurrently with, or after the administration of the AAV gene therapy vector.

[0145]

[0179] Those skilled in the art will understand that suitable additional therapeutic agents for the disclosed methods and kits may include conventional treatments for the diseases and conditions disclosed herein.

[0146]

[0180] Method of administration

[0181] According to some embodiments, a method for treating a genetic disorder or condition in a subject requiring treatment is realized, comprising the step of administering an expression cassette containing any one of the synthetic polynucleotides described herein, a vector containing the expression cassette, and / or recombinant viral particles, thereby expressing a therapeutic peptide in the liver of the subject.

[0147]

[0182] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0148]

[0183] According to some embodiments, a method for expressing a transgene in hepatocytes is realized, comprising the step of contacting the hepatocytes with an expression cassette containing one of the synthetic polynucleotides described herein, or a vector containing an expression cassette.

[0149]

[0184] In some embodiments, a synthetic nucleic acid sequence according to any one of the embodiments described herein, an expression cassette containing a synthetic nucleic acid sequence according to any one of the embodiments described herein, or a vector containing an expression cassette are provided for use in the medical treatment of a genetic disease or condition.

[0150]

[0185] The disclosed method includes the step of administering an AAV gene therapy vector comprising at least one of the disclosed liver-specific promoters. In some embodiments, the AAV gene therapy vector may be administered concurrently or sequentially with one or more additional therapeutic agents or with one or more saturators designed to prevent the vector from being removed by the reticuloendothelial system.

[0151]

[0186] For example, the saturator may be administered before the AAV gene therapy vector. In some embodiments, the saturator is administered at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 minutes before or earlier than the administration of the AAV gene therapy vector, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours before or earlier.

[0152]

[0187] Similarly, in some embodiments, the AAV gene therapy vector may be administered at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 minutes or earlier, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours or earlier, before the administration of one or more therapeutic agents. Alternatively, in some embodiments, the AAV gene therapy vector may be administered at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 minutes or later after administration of one or more therapeutic agents, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours or later.

[0153]

[0188] Furthermore, the duration of administration of the components of the disclosed method may vary. For example, an AAV gene therapy vector containing at least one of the disclosed liver-specific promoters can be administered via continuous intravenous infusion. Therefore, in some embodiments, administration of an AAV gene therapy vector may last for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 minutes or longer. Similarly, if the disclosed method further includes a step of administering an additional saturating agent or one or more therapeutic agents, the administration of these components may last for at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 minutes or longer.

[0154]

[0189] In some embodiments, the methods disclosed herein include the step of systemically administering an AAV gene therapy vector. Systemic administration may be enteral or parenteral. Preferred enteral administration routes may, but are not limited to, oral, sublingual, and rectal administration. Preferred enteral administration routes may, but are not limited to, inhalation, injection, and transdermal administration. For the purposes of this disclosure, preferred injection routes may include intravenous, intramuscular, subcutaneous, intra-arterial, intra-articular, intrathecal, and intradermal injection.

[0155]

[0190] In some embodiments, the performance of the methods described herein results in an increase of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, or higher, in the expression of a therapeutic gene or gene of interest in the liver compared to a known nonspecific promoter. In some embodiments, synthetic polynucleotides increase expression by at least 1.2 to 1.8, 1.5 to 2.5, 2 to 5, 4 to 10, 5 to 20, or 10 to 100 times compared to a known promoter.

[0156]

[0191] In some embodiments, the performance of the methods described herein results in an increase of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, or higher, of the therapeutic gene or gene of interest in the liver compared to a known liver-specific promoter (e.g., the LP-1 promoter). In some embodiments, the synthetic polynucleotide increases expression by at least 1.2 to 1.8, 1.5 to 2.5, 2 to 5, 4 to 10, 5 to 20, or 10 to 100 times compared to a known liver-specific promoter, e.g., the LP-1 promoter.

[0157]

[0192] Dosage and dosage form

[0193] In some embodiments, the disclosed method comprises a specific dosage of an AAV gene therapy vector comprising at least one of the disclosed liver-specific promoters. The dosage of the AAV gene therapy vector is, for example, 1×10 10 gc / kg, 5×10 10 gc / kg, 1×10 11 gc / kg, 5×10 11 gc / kg, 1×10 12 gc / kg, 2×10 12 gc / kg, 3×10 12 gc / kg, 4×10 12 gc / kg, 5×10 12 gc / kg, 6×10 12 gc / kg, 7×10 12 gc / kg, 8×10 12 gc / kg, 9×10 12 gc / kg, 1×10 13 gc / kg, 5×I0 13 gc / kg, 1×10 14 gc / kg, 5×10 14 gc / kg or 1×10 15 gc / kg or more. In some embodiments, the dosage of the AAV gene therapy vector is 1×10 13 gc / kg, 5×10 13 gc / kg, 1×10 14 gc / kg, 5×10 14 gc / kg or 1×10 15 gc / kg or less. In some embodiments, the dosage of the AAV gene therapy vector is 1×10 12 gc / kg to 1×10 14 gc / kg. In some embodiments, the dosage of the AAV gene therapy vector is 5×10 12 gc / kg to 5×10 13 gc / kg. In some embodiments, the dosage of the AAV gene therapy vector is 4×10 12 gc / kg, 4.5×10 12 gc / kg, 5×10 12 gc / kg, 5.5×10 12 gc / kg, 6×10 12gc / kg, 6.5 × 10 12 gc / kg, 7 × 10 12 gc / kg, 7.5 × 10 12 gc / kg, 8 × 10 12 gc / kg, 8.5 × 10 12 gc / kg, 8.6 × 10 12 gc / kg, 8.7 × 10 12 gc / kg, 8.8 × 10 12 gc / kg, 8.9 × 10 12 gc / kg, 9 × 10 12 gc / kg, 9.1 × 10 12 gc / kg, 9.2 × 10 12 gc / kg, 9.3 × 10 12 gc / kg, 9.4 × 10 12 gc / kg, 9.5 × 10 12 gc / kg, 9.6 × 10 12 gc / kg, 9.7 × 10 12 gc / kg, 9.8 × 10 12 gc / kg, 9.9 × 10 12 gc / kg, 1 × 10 13 gc / kg, 1.5 × 10 13 gc / kg, 2 × 10 13 gc / kg, 2.5 × 10 13 gc / kg, 3 × 10 13 gc / kg, 3.5 × 10 13 gc / kg, 4 × 10 13 gc / kg, 4.5 × 10 13 gc / kg, 5 × 10 13 gc / kg, 5.5 × 10 13 gc / kg or 6 x 10 13 gc / kg or more. In some embodiments, the dose of the AAV gene therapy vector is approximately 9.7 × 10⁻⁶. 12 gc / kg or approximately 5 x 10 13 The value is gc / kg. When two or more AAV gene therapy vectors are administered to a target, the dosages of each may be the same or different.

[0158]

[0194] In some embodiments, the dose of the AAV gene therapy vector is lower when co-administered with a saturator compared to the dose of the same AAV gene therapy vector when administered without a saturator. In some embodiments, co-administration with a saturator results in a reduction of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% of the dose of the AAV gene therapy vector compared to the dose of the AAV gene therapy vector without co-administration of a saturator.

[0159]

[0195] Indications

[0196] The disclosed treatment methods can be used to treat a variety of hereditary disorders and diseases. Hereditary diseases and disorders that can be treated by the disclosed methods include hereditary cholestasis, Wilson's disease, hereditary hemochromatosis, tyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome-1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, GSD1A type, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythrocytic protoporphyria, Gaucher disease, hemophilia A, hemophilia B, familial hypercholesterolemia, and ornithine transcarbamylase deficiency (OTC). deficiency), phenylketonuria (PKU), acute intermittent porphyria (AIP), age-related macular degeneration, amyotrophic lateral sclerosis (ALS), cystic fibrosis, paralysis, Alzheimer's disease, Parkinson's disease, Huntington's disease (HD), arthritis, Batten's disease, Canavan disease, citrullinemia type 1, rheumatoid arthritis, epilepsy, congestive heart failure, cystic fibrosis, Duchenne muscular dystrophy, dyslipidemia, glycogen storage disease type I (GSD-I), hereditary emphysema, homozygous familial hypercholesterolemia (HoFH) Hypercholesterolemia, Leber congenital monocular blindness, methylmalonic acidemia, spinal muscular atrophy, paralysis, epilepsy, Pompe disease, Tay-Sachs disease, hyperoxaluria (PH-1), spinocerebellar ataxia type 1 (SCA-1), SCA-3, u-dystrophin, Gaucher disease type II or III, arrhythmogenic right ventricular cardiomyopathy (ARVC)This includes, but is not limited to, cardiomyopathy, Fabry disease, familial Mediterranean fever (FMF), propionic acidemia, fragile X syndrome, Rett syndrome, Niemann-Pick disease, and Krabbe disease.

[0160]

[0197] In some embodiments, AAV gene therapy vectors may be used for the treatment of lysosomal storage disorders, metabolic disorders, and coagulation disorders.

[0161]

[0198] Lysosomal storage disorders can result from a deficiency in specific enzymes that break down certain lipids (fats) or carbohydrates (sugars) in somatic cells. Because the body cannot break down and regenerate the targeted fats or carbohydrates, they accumulate in cellular lysosomes, interfering with normal function and leading to lysosomal storage disorders. Lysosomal disorders include Faber's disease, Krabbe's disease (infancy-onset or late-onset), galactosialidosis, Fabry's disease (alpha-galactosidase A), Schindler's disease (alpha-galactosidase B), beta-galactosidase / GM1 gangliosidosis, GM2 gangliosidosis, Gaucher's disease types I, II, and III, sphingomyelinase deficiency, lysosomal acid lipase deficiency, Niemann-Pick disease types A and B, sulfatidosis, saposin B deficiency, multiple sulfatase deficiencies, mucopolysaccharidosis type I (Harler / Schey), type II (Hunter), and type III. This may include types 1 (Sanfilippo), 4 (Morquio), 6 (Maroto), 7 (Sly), and 9 (hyaluronidase deficiency), mucolipidosis types 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, Wolmann disease, alpha-mannose disease, beta-mannose disease, aspartylglucosamiuria, fucosidosis, lysosomal transport disease, cystinosis, concentrated dysostosis, Salah disease, infantile free sialic acid storage disease, glycogen storage diseases such as Pompe disease and Danon disease, and cholesterol ester storage diseases.

[0162]

[0199] Metabolic disorders may include ornithine transcarbamylase deficiency, phenylketonuria, propionic acidemia, methylmalonic acidemia, and primary hyperoxaluria.

[0163]

[0200] Coagulation disorders may include deficiencies in coagulation factors VII, VIII, IX and X, XI, V, XII, II, von Willebrand factor, simultaneous factor V / VIII deficiency, and tetracholastic anemia.

[0164]

[0201] For example, in some embodiments, hemophilia A or B can be treated using the disclosed method by administering to a subject an AAV gene therapy vector encoding FIX or a variant thereof. In some embodiments, the AAV gene therapy vector may be an AAV5 serotype, and the therapeutic gene (i.e., the gene encoding FIX) may be under the control of one of the disclosed liver-specific promoters. Furthermore, in some embodiments, the therapeutic FIX protein may contain one or more insertions, deletions, or substitutions. [Examples]

[0165]

[0202] The following embodiments are provided to illustrate the present disclosure. However, it should be understood that the present invention should not be limited to the specific conditions or details described in the embodiments.

[0166] Example 1 - Identification of a constitutive promoter element

[0203] A meta-analysis of hepatocyte datasets was performed to identify candidate genes for cis-element selection. Microarray and NGS datasets, along with scientific literature, were reviewed to identify genes expressed at very high levels in target cell types.

[0167] Example 2 - Selection of cis-regulatory elements for inclusion in a hepatocyte synthesis promoter library

[0204] A suitable set of liver-related genes was identified, and then the promoter regions of the selected genes were analyzed to identify cis-regulatory elements (CREs) and other features responsible for transcriptional regulation in the selected promoters. Three methods were used to identify cis-elements that should be incorporated into the construction of synthetic promoter libraries, resulting in the selection of at least SEQ ID NOs: 1–19.

[0168]

[0205] Separate libraries were created using each of the identified cis-elements. Relevant complex elements for regulating liver-specific genes were identified through the Liver Specific Gene Promoter Database (LSGPD) and literature searches. Subsequently, novel synthetic promoters were designed using these complex elements.

[0169] Example 3 - Creation of a liver-specific synthetic promoter library screening vector

[0206] The screening vector is based on the pUC19 backbone (synthetic promoter library + core promoter element + GFP). The synthetic promoter library is cloned upstream of the minimal promoter sequence. This sequence contains the elements necessary to recruit the RNA polymerase II complex and includes the transcription start site. The minimal promoter sequence exhibits basal transcriptional activity, and the library sequence cloned upstream is designed to enhance its activity and specificity.

[0170] Example 4 - Determination of transfection efficiency in target cell types Before investigating the activity of various screening vectors, the conditions required for optimal transfection of two selected hepatocyte lines (HepG2 and Huh7) were established. The gene expression efficiency of firefly luciferase from the CMV immediate early (CMVIE) promoter (SEQ ID NO: 108) was measured in HepG2 and Huh7 cells. All cell lines were grown and maintained according to the cell bank's recommendations.

[0171]

[0207] Cell transfection with pCMVIE_Luc was performed using various transfection reagents, including Fugene HD transfection reagent (Promega E2311) (DNA:Fugene HD ratio of 1:1.1). Luciferase activity was measured 24 hours after transfection. Cells were washed with phosphate-buffered saline (PBS), dissolved in 100 μl of passive lysis buffer (Promega E194A), and stored overnight at -80°C. Luciferase activity was quantified using a 96-well flat-bottom pure white Fluoro Nunc microplate (ThermoFisher 236105) with 10 μl of solubilizer, and a luciferase reporter 1000 assay system (Promega E4550) according to the manufacturer's guidelines, by quantifying luminescence with a FLUOstar Omega plate reader (BMG Labtech). In selected hepatocyte lines, Fugene HD mediated optimal transfection efficiency and was therefore selected as the transfection reagent of choice for all subsequent experiments.

[0172]

[0208] Next, to identify liver-specific promoters with maximum activity in all cell types in vitro, all promoter libraries were screened in various hepatocyte types. Screening for hepatocyte type selection was performed using fluorescence-activated cell sorting (FACS). Promoters were operably ligated to green fluorescent protein (GFP), and GFP expression in Huh7 and HepG2 cells was assessed using FACS analysis. Figure 1 shows an example related to a construct expressing GFP under the CMV promoter (Figure 1). This data demonstrates that both Huh7 and HepG2 cells were efficiently transfected with the GFP-expressing construct, and activity was assessed using FACS. Expression efficiency was measured 24 hours after transfection, and it was found that over 15% of cells expressed GFP.

[0173] Example 5 - Testing of minimal promoter activity and selection of screening vectors for use in library screening.

[0209] Based on detailed analysis of various native promoters that drive the expression of known liver-specific genes, a minimal promoter sequence was selected for insertion into a synthetic promoter screening vector (Figure 2). The putative TATA box (shown in bold), initiator sequence (underlined), and TSS (shown in bold and double underlined) elements are shown. The screening vector was designed so that cis-regulatory element combinations could be cloned in random combinations upstream of the selected minimal promoter sequence.

[0174]

[0210] Next, the transcriptional activity of each individual minimal promoter sequence was evaluated with a view to selecting the optimal minimal promoter for use in library screening (Figure 3). Each minimal promoter showed basal level transcriptional activity in Huh7 cells and was therefore a suitable candidate for inclusion in synthetic promoter library screening vectors.

[0175]

[0211] Transcriptional activity was monitored in HepG2 cells (Figure 4). Transcriptional activity was somewhat higher in HepG2 cells compared to Huh7 cells. G6PC and SERPINE1 had the lowest basal activity and were therefore identified as optimal candidates for minimal promoters to be included in the screening vector.

[0176] Example 6 - Construction of a screening library and screening vector for transfection of hepatocytes

[0212] Three distinct synthetic libraries were created using three distinct sets of liver-specific transcription factor binding sites (or cis-elements).

[0177]

[0213] Subsequently, each of the three synthetic promoter libraries was cloned immediately upstream of the G6PC minimal promoter in the screening vector. GFP is present downstream of the minimal promoter in the screening vector. The complexity of each obtained synthetic promoter library is shown in Table 4.

[0178] [Table 4]

[0179]

[0214] To create promoters smaller than 250 bp, derivative libraries were prepared from each meta-analysis, and each library was size-sorted so that each potential promoter candidate was smaller than 300 bp. The complexity of these size-sorted libraries is shown in Table 5.

[0180] [Table 5]

[0181]

[0215] Based on meta-analysis, the exemplary library SYN_L1_UNQ was selected for additional screening in various hepatocytes.

[0182] Example 7 - Evaluation of promoter candidate activity from hepatocyte library using FACS analysis

[0216] Subsequently, a liver-specific synthetic promoter library was transfected into both Huh7 and HepG2 cells using Fugene HD reagent. After 24 hours, GFP expression was assessed by FACS, and cells were isolated if they showed a fluorescence intensity higher than 10⁴ units (Figure 5). The isolated cells were then lysed, and the candidate promoters were rescued by PCR. Figure 6 illustrates promoters rescued from HepG2 cells (A1-A7, panel B) and promoters rescued from Huh7 cells (A8-A11; panel C). Promoter sizes ranged from 200 to 700 bp.

[0183]

[0217] Eleven promoter candidates (A1-A11) rescued from FACS screening of transfected HepG2 and Huh7 cells were subcloned upstream of the firefly luciferase gene in pGL4.10, and their activity was subsequently confirmed by luciferase assay (Figure 7). In this example, the most superior isolated promoter candidate was consistently more active in Huh7 cells, regardless of the cell type in which the promoter was screened (i.e., derived from HepG2 compared to Huh7).

[0184]

[0218] The activity of candidate promoters in primary human hepatocytes was evaluated. After determining the optimal transfection conditions for these cells, the inventors transfected primary hepatocytes with candidate promoters A2, A4, and A11, and monitored expression using a luciferase reporter system (Figure 8). The LP-1 promoter showed limited activity in primary hepatocytes, while synthetic promoters A2 and A4 were up to 5 times more active in this cell type. Figures of A2, A5, and A11 are shown in Figures 28-30.

[0185]

[0219] The results from PCR rescue (Figure 6A) demonstrate that we were able to rescue a wide range of promoters from preliminary screening. Rather than attempting to isolate individual clones from this range of promoters, we performed a secondary screening by recloning all fragments from the PCR rescue into a screening vector and re-screening in both Huh7 and HepG2 cells (Figure 9).

[0186]

[0220] Subsequently, individual promoter candidates rescued from secondary screening were inserted upstream of the firefly luciferase gene in pGL4.10, and the expression levels mediated by each promoter were determined by luciferase assay (Figure 10). Promoter B1 was isolated from both primary and secondary screening in HepG2 cells, promoters B2, B3, and B4 were isolated from primary screening in Huh7 cells and secondary screening in HepG2 cells, while promoter B5 was isolated from both primary and secondary screening in Huh7 cells. From this secondary screening, only promoter B4 was more active than the LP-1 promoter, being 3 times more active in HepG2 cells and 7 times more active in Huh7 cells.

[0187]

[0221] The activity of promoter B4 was compared with that of the LP-1 promoter in human primary hepatocytes (Figure 11). Promoter candidate B4 was determined to be 2.5 times more active. When B4 was compared with other promoter candidates, B4 was as active as A5 in human primary hepatocytes, but showed half the activity of A2.

[0188]

[0222] The original liver-specific synthetic promoter library was screened in primary human hepatocytes using the FACS-based screening and PCR rescue techniques described above. Hepatocytes were transfected with the library using Fugene HD, gated according to the same gating method used in hepatocyte lines, and the fractionated cells were lysed and the promoters rescued as previously described. Individual promoters were then cloned into pGL4.10 and luciferase expression was monitored (Figure 12). Screening results in primary hepatocytes revealed that promoters C13, C14, and C81 were considerably more active than the LP-1 promoter (Figure 12). To confirm this observation, this transfection was repeated, and from this transfection, promoter C14 was found to be consistently more active than LP-1, and it was 12-fold more active (Figure 13).

[0189]

[0223] To monitor how promoter activity varies across cell types, the activity of promoters C13, C14, and C81 was investigated in hepatocyte lines HepG2 and Huh7 (Figure 14). In this example, all promoters isolated from primary hepatocytes were more active in HepG2 cells compared to Huh7 cells (C81 was nearly 50 times more active in HepG2 cells than LP-1). Promoter C14 was consistently more active than the LP-1 promoter in primary hepatocytes, HepG2 cells, and Huh7 cells. Table 6 summarizes the expression activity of selected promoter candidates isolated from various library screenings across different hepatocyte types.

[0190] [Table 6]

[0191]

[0224] In this example, promoters B4 and C14 were consistently more active across all cell types and in various experiments. Promoters C13 and C81 showed significant variability in activity in hepatocytes in various experiments, but also exhibited high levels of expression across various cell types. Figures of C13 and C81 are shown in Figures 31 and 32.

[0192] Example 8 - Rational design of a promoter candidate

[0225] In addition to the random shuffling techniques for preparing promoter candidates described in Examples 1-7, the inventors further employed rational design techniques to prepare additional novel promoter candidates. Several cis- and trans-acting elements (CREs) containing clusters of evolutionarily conserved transcription factor binding site motifs are known, and CRM8 has been identified as particularly potent for expression in the liver. Therefore, the -137 / -37 fragment from SERPINA1 was used as a starting point for the rational design of variants of HS_CRM8 (De Simone et al., "Cis- and trans-acting elements responsible for the cell-specific expression of the human α1-antitrypsin gene," The EMBO Journal, vol. 6, no. 9, pp. 2759-2766, 1987). Based on bioinformatics predictions, a shorter sequence with putative TSS activity was selected and placed at the 3' end of a synthetic cis-regulatory module (CRM). The orientation and position of CRE were determined based on bioinformatics predictions, and the hierarchy of positive and negative interactions between liver-specific transcription factors was inferred from an extensive literature review. The activity of this rationally designed CRM (also known as a complex enhancer element) was tested in various different hepatocyte types.

[0193]

[0226] The activity of a rationally designed CRM was investigated in various hepatocyte types. The first repeat of this liver-specific CRM showed significant transcriptional activity (Figure 15).

[0194]

[0227] The data show that CRM, alone (i.e., without a activatably linked minimal promoter), was as active as the LP-1 promoter in HepG2 cells and five times more active in Huh7 cells.

[0195]

[0228] Next, we cloned CRM upstream of the SERPINE1 minimal promoter to determine whether CRM could act as a transcriptional enhancer. We then investigated its expression level (Figure 16).

[0196]

[0229] Adding a minimal promoter downstream of CRM increased its expression intensity, resulting in 9 times higher activity than LP-1 in Huh7 cells and 2 times higher activity than LP-1 in HepG2 cells.

[0197]

[0230] Next, the effects of each minimal promoter on CRM activity were investigated in three different hepatocyte lines: HepG2, Huh7, and HepaRG (Figure 17). All minimal promoters mediated similar increases in expression intensity, but SERPINA1 mediated the highest increase in CRM expression intensity.

[0198]

[0231] Considering the importance of promoter size for selecting a promoter suitable for further in vivo analysis, the promoter derived from the G6PC minimal promoter was further modified to monitor the effect of size reduction on promoter activity by reducing its overall size by removing the spacer element. By removing the spacer element and reducing the size from 307 bp to 241 bp, we were able to slightly increase the promoter activity. Further reducing the size to 226 bp had a negative effect on expression intensity in Huh7 and HepG2 cells, but a positive effect on intensity in HepaRG cells. Figure 18 shows the activity and size of all reasonably designed promoters in various cell types.

[0199]

[0232] The activity of rationally designed promoters was investigated in primary human hepatocytes. Primary cells grown in 2% FBS were transfected with a synthetic promoter construct expressing firefly luciferase using Fugene HD under the conditions described herein. The transfection results are shown in Figure 19. Expression levels in hepatocytes mediated by the rationally designed promoters were considerably higher than those mediated by the LP-1 promoter. The expression profile was similar to that observed in hepatocyte lines, with SERPINA1 mediated the highest levels of protein expression compared to other minimal promoter constructs.

[0200]

[0233] Table 7 summarizes the doubling of LP-1 promoter expression for each rationally designed promoter, as evaluated in various cell types.

[0201] [Table 7]

[0202]

[0234] In this example, the LP-1 promoter was found to be most active in HepG2 and HepaRG cells, and least active in Huh7 and human primary hepatocytes. This means that when the activity of various synthetic promoter candidates was compared to LP-1, a higher doubling was demonstrated in Huh7 and human primary hepatocytes. The very limited activity of LP-1 in primary cells is surprising and suggests that this may be a result of how the promoter was designed and selected.

[0203] Example 9 - Testing of hepatocyte promoter sequences in parallel with cell lines to demonstrate specificity and activity under a profile equivalent to that of the LP1 promoter.

[0235] The activity of various promoter candidates was evaluated in cell lines derived from other tissues. With a view to determining the level of specificity each promoter has for hepatocytes, HeLa (ovarian cancer), 293 (human fetal kidney), and A549 (lung adenocarcinoma) cells were transfected with all identified synthetic promoter candidates.

[0204]

[0236] Subsequently, the promoter activity was compared to the activity of expression mediated by the CMVIE promoter in each cell type. Figure 20 shows that the LP-1 promoter had 5% of the activity of CMVIE in A549 cells, but no activity in the other two cell types. Of the synthetic promoters, G6PC_COMP_V1, G6PC_COMP_V3, and APOC2_COMP all mediated similar expression levels in A549. On the other hand, SERPINA1_COMP, SERPINE1_COMP, and G6PC_COMP mediated higher expression levels in these cells. In this example, none of the promoter constructs showed any measurable activity in 293 and HeLa cells.

[0205]

[0237] Next, the activity of the library-screened promoters was evaluated in various non-hepatocyte lines. Of the promoters screened in hepatocyte lines Huh7 and HepG2, A2, A5, and B4 showed a similar level of specificity to that shown by the LP-1 promoter; that is, they did not mediate expression in 293 and HeLa cells, and mediated less than 5% of CMV expression in A549 cells (Figure 21). Promoter A11 showed a significantly higher expression level in A549 cells (more than 15% of CMV expression) compared to the other promoter candidates.

[0206]

[0238] The specificity of promoters derived from a library screened in hepatocytes was tested in three selected non-hepatocyte cell lines (Figure 22). In this experiment, the LP-1 promoter mediated nearly four times the expression level previously observed in A549 cells (18% of CMVIE). In general, activity in A549 cells was higher than previously observed. In particular, promoters C14 (60% of CMVIE) and C81 (90% of CMVIE) mediated high levels of expression in A549, while C13 (22% of CMVIE) mediated levels of expression similar to those seen with the LP-1 promoter. As observed with all other promoters, the promoter candidates derived from primary hepatocyte screening showed no measurable activity in 293 and HeLa cells.

[0207]

[0239] The selected promoter sequences used in Figures 7-14 and 21-22 correspond to sequence numbers 36 (A2), 37 (A4), 38 (A11), 39 (C13), 40 (C81), 32 (B4), and 34 (C14). The selected promoter sequences used in Figures 15-20 correspond to sequence numbers 23 (COMP), 30 (SERPINE1_COMP), 29 (SERPINA1_COMP), 21 (APOC2_COMP), 25 (G6PC_COMP), 26 (G6PC_COMP_v1), and 28 (G6PC_COMP_v3).

[0208]

[0240] The following table lists exemplary characteristics of each promoter.

[0209] [Table 8]

[0210] Example 10 - Shortening and modification of liver-specific promoter sequences G6PC_COMP_v1, B4, and C14.

[0241] To reduce the size of the promoter sequences generated up to this point, cloning adapter and accessory sequences were deleted from the original promoter design. At the end of the design process, 16 combinations of promoter sequences, including the original and size-reduced versions, were further studied in reporter constructs on the AAV plasmid backbone. These 16 candidates are listed in Table 1 as SEQ ID NOs. 21–35, and each contains the original construct and size-reduced synthetic polynucleotides (all derived from the composite promoter sequence and sequences B4 (SEQ ID NO. 32) and C14 (SEQ ID NO. 34)). Figure 23 shows exemplary results obtained with these constructs. Briefly, Figure 23A shows data from in vitro transfection with plasmid DNA encoding the promoter and reporter. Figure 23B shows the activity of the same promoter and reporter introduced into cells by AAV infection. Figures 23C and 23D show blood obtained from mice injected with the AAV vector at 2 and 6 weeks, respectively. Figure 23E shows the number of AAV genomes per 1 μg of DNA in the liver of mice 6 weeks after administration of the AAV promoter-reporter.

[0211]

[0242] For in vivo experiments, mice were injected with the disclosed synthetic promoter construct in a recombinant AAV2 capsid containing an expression cassette (SEAP) driven by one of the synthetic promoters. Mice (C57BL / 6J) were injected with 5 × 10⁶ mice per mouse. 12 One whole genome copy was injected into the tail vein of five mice, with the medium serving as a control. Blood was collected from facial vein hemorrhage at weeks 1, 2, 4, and 6 of life. Six weeks after injection, the mice were killed, and the liver and selected peripheral organs were collected for in vivo distribution analysis. SEAP activity was analyzed in the mouse serum using a chemiluminescent SEAP reporter assay kit (Roche).

[0212]

[0243] Further included mutations were promoter sequences in which promoter elements were reversed, shuffled, or deleted. The SEQ ID NO: 6 element is a composite element, and the elements contained within it were further modified to identify possible further size reduction and / or possible improvement of gene expression in relation to the promoter G6PC_COMP_v1. Further variants are listed in Tables 1 and 2 and correspond to derivatives of SEQ ID NO: 26 (G6PC_COMP_v1) (i.e., SEQ ID NOs: 41-45, 53-58, 67-69, 73-85) and derivatives of SEQ ID NOs: 33 and 35 (i.e., SEQ ID NOs: 46-52, 59-66, and 70-72). SEQ ID NOs: 41-85 were screened as shown in Figures 25-27, and these figures show exemplary results for these constructs. The constructs tested in Figure 25 were normalized to SEQ ID NO: 26, and SEQ ID NO: 30 was used as a positive target. The construct tested in Figure 26 was normalized to Sequence ID No. 33, and the construct tested in Figure 27 was normalized to Sequence ID No. 35.

[0213]

[0244] As explained, the SEQ ID NO: 5 element is a composite element, and the elements contained within it were further modified to identify possible further size reductions and / or possible improvements in gene expression. In addition, deletion of SEQ ID NO: 5 strongly reduced gene expression (see Figure 29, 01), indicating that this composite element is important for expression. Using the G6PC_COMP_v1 promoter as a starting point, the SEQ ID NO: 5 sequence was modified by introducing mutations, introducing deletions, inverting elements, and comparing it to a larger element (SEQ ID NO: 100) that contains SEQ ID NO: 5. The larger sequence of SEQ ID NO: 100 was found to have the same activity as SEQ ID NO: 5 (data not shown). From all modifications tested, it was confirmed that SEQ ID NO: 5 tolerates a wide range of mutations, allows for deletion of spacer elements for further size reductions, and also tolerates mutations in the elements contained within SEQ ID NO: 5, as well as inversion of the elements contained within it. Therefore, extensive modifications to Sequence ID No. 5 appear permissible, thereby confirming that this sequence represents a composite element, and that it is not required to maintain its full-length sequence, but that it can be split into further elements and still contribute to liver-specific gene expression. Judging from in vitro experiments, the first two nucleotides and the last three nucleotides of Sequence ID No. 5 do not appear to be important and can be further deleted from Sequence ID No. 5 while maintaining substantially the same activity as the promoter containing Sequence ID No. 5. Also, the 10-nucleotide spacer sequence contained in Sequence ID No. 5 results in a promoter with substantially the same activity. Combining the deletions of these sequences further reduces the size while maintaining activity (i.e., ultimately resulting in a 51-nucleotide sequence). Furthermore, the functional elements contained in Sequence ID No. 5 of the liver-specific promoter may be reversed or modified, indicating that these elements do not need to be oriented in the same way or located proximal to each other.Therefore, based on the results, a preferred G6PC_COMP_v1 promoter or any variant thereof can be defined as containing one or more of SEQ ID NOs: 101 (ACTTAGCCCCTGTTTGCTCCTCCG) and SEQ ID NOs: 102 (TGACCTTGGTTAATATTCACCAGC), preferably SEQ ID NOs: 101 and SEQ ID NOs: 102. It is also understood that such a liver-specific promoter may contain variants of SEQ ID NOs: 101 and / or SEQ ID NOs: 102, or the reverse complement of one or both of them. Therefore, whenever SEQ ID NOs: 5 is included in a liver-specific promoter in the description herein, instead of SEQ ID NOs: 5, the promoter can be defined as containing SEQ ID NOs: 101 and / or SEQ ID NOs: 102, or functional equivalents of SEQ ID NOs: 101 and / or SEQ ID NOs: 102.

[0214]

[0245] Furthermore, as shown in Figure 26, many of the variants derived from Sequence ID No. 5 have very similar activity, albeit slightly reduced, compared to Sequence ID No. 5, and still result in promoters that retain substantial activity improvements compared to LP1. Therefore, variants of the composite element of Sequence ID No. 5 include a composite element comprising Sequence ID No. 101 and a sequence selected from the group consisting of Sequence ID No. 102, Sequence ID No. 104 (TGGTTAATATTCACCAGC), and Sequence ID No. 106 (TGACCTTGGTTAATATTCACCA); or a composite element comprising Sequence ID No. 103 (CCCTGTTTGCTCCTCCG) and a sequence selected from the group consisting of Sequence ID No. 102, Sequence ID No. 104 (TGGTTAATATTCACCAGC), and Sequence ID No. 106 (TGACCTTGGTTAATATTCACCA); or a composite element comprising Sequence ID No. 105 (CCCTGTTTGCTCC) and sequence TCCG and a sequence selected from the group consisting of Sequence ID No. 102, Sequence ID No. 104 (TGGTTAATATTCACCAGC), and Sequence ID No. 106 (TGACCTTGGTTAATATTCACCA). A composite element can be defined as: a composite element; or a composite element comprising SEQ ID NO: 105 and sequence TTAG and a sequence selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 104 (TGGTTAATATTCACCAGC), and SEQ ID NO: 106 (TGACCTTGGTTAATATTCACCA); or a composite element comprising SEQ ID NO: 107 (CCCTATTTACTCC) and sequence TCCG and a sequence selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 104 (TGGTTAATATTCACCAGC), and SEQ ID NO: 106 (TGACCTTGGTTAATATTCACCA); or a composite element comprising SEQ ID NO: 107 and sequence TTAG and a sequence selected from the group consisting of SEQ ID NO: 102, SEQ ID NO: 104 (TGGTTAATATTCACCAGC), and SEQ ID NO: 106 (TGACCTTGGTTAATATTCACCA). The composite element is understood to preferably have a sequence length of less than 60 nucleotides. It is also understood that the components of the composite element may instead be their inverse complementary sequences, as shown in the examples.

[0215]

[0246] The modified promoters remained more active than LP1; some modifications reduced activity compared to the original construct, while others improved to even higher activity. Element deletions had a more pronounced effect on activity, supporting the effect of element combinations rather than the strength of individual elements.

[0216] Example 13 - Testing of AAV construct in human primary hepatocytes

[0247] Reporter constructs were screened not only by infection in primary human hepatocytes, but also by infection in Huh-7, HepG2, and HepaRG. Reporter constructs were evaluated by transfection, and the correlation of promoter activity with respect to the plasmid backbone against the AAV genome was checked. SEAP was used as the reporter.

[0217]

[0248] In transfection experiments, SEAP was assayed 48 hours after transfection. SEAP activity was assayed 24, 48, and / or 72 hours after infection in some cell lines to optimize assay timing; the results showed a perfect correlation independent of the time the assay was performed.

[0218]

[0249] Transfection reporter construct: The promoter candidates were synthesized in GeneArt and cloned into the pVDX vector (UNQ). The reporter constructs were tested by transfection in Huh7, HepG2 and HepaRG cells. SEQ ID NOs: 23 and 24 showed lower activity than LP1 in all cell lines tested (Figure 24). These promoters consist of regulatory elements that have been shown to be liver-specific, but this was expected since they are derived from the original COMP fragment lacking the reference minimal promoter sequence at the 3' end. The remaining reporter constructs showed activity equal to or higher than LP1 in all cell lines tested. SEQ ID NOs: 27 and 28 were among the best of all cell lines tested. In human primary hepatocytes, all reporter constructs tested by transfection showed higher activity than LP1 (Figure 24).

[0219]

[0250] Transduction by AAV: UNQ has produced viral preparations (serotype AAV2) for mouse studies, and these preparations were also tested in Huh7, HepaRG and human primary hepatocytes (MOI 10 5 AAV genome / cell). HepaRG and human primary hepatocytes were proven to be very difficult to transduce by AAV infection under the assay conditions.

[0220]

[0251] When tested with the AAV genome, an increase in the performance of some of the promoter candidates was observed. This effect was quite dramatic in the case of the promoter G6PC_COMP_v1 (SEQ ID NO: 26) when compared to the results from transfection experiments using standard luciferase reporter plasmids (pGL4.10 from Promega and SYNP reporter vector). In previous transfection experiments in Huh7 using luciferase as the transcriptional reporter and LP1 lacking the SV40 intron as a reference, G6PC_COMP_v1 showed an activity approximately 10-fold higher than LP1. When tested by transfection in Huh7 with respect to the AAV backbone, G6PC_COMP_v1 shows more than 50-fold the activity of the full-length form of the LP1 promoter (including the SV40 intron). See Figure 25 (SEQ ID NO: 20 = LP1, and SEQ ID NO: 26 = G6PC_COMP_v1). The promoter activities tested by transfection of the AAV reporter plasmid and transduction of AAV particles are well correlated in Huh7.

[0221] <..."Reference Example 14 - Comparison of the Performance of HCR-hAAT, LP1, and HLP Promoters

[0252] The well-known HCR-hAAT promoter (Nathwani et al. Blood 2006;107(7):2653 - 2661), and its truncated forms including LP1 (Nathwani et al. 2006 supra) and HLP (McIntosh et al. Blood. 2013;121(17):3335 - 44) were tested in vitro by their ability to drive FVIII protein expression by transfection of Huh-7 cells.

[0222] Materials and methods

[0253] Transfection Assay and Cells

[0254] Three constructs encoding various codon-optimized FVIII coding sequences (named GD6, GD4, and COSX, respectively) were transfected into Huh-7 cells using the lipofectamine 3000 reagent. A sea urchin luciferase plasmid was co-transfected to correct for transfection efficiency. FVIII production in the culture medium was detected by measuring antigen levels using ELISA (Affinity Biologicals) on supernatant collected 2 days after transfection.

[0223] result

[0255] The efficacy of the HCR-hAAT promoter was compared to its truncated LP1 and HLP1 promoters by transfecting Huh-7 cells with plasmids encoding FVIII driven by various promoter variants at different concentrations. FVIII protein expression in the supernatant was determined using ELISA. Various codon-optimized FVIII constructs, named GD6, GD4, and COSX, were tested. The results in Figure 33 show that the original-size HCR-hAAT promoter was the most efficient in driving FVIII gene expression for all constructs, followed by the LP1 promoter. At least when used at the highest concentrations, the LP1 promoter was consistently more effective in driving FVIII expression in vitro compared to the HLP promoter (GD4 vs. GD6).

[0224]

[0256] Equivalents

[0257] Although the present invention has been described in relation to the embodiments described above, it should be understood that the above description and examples are intended to illustrate, and not limit, the scope of the invention. Other aspects, advantages and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains.

[0225]

[0258] In addition, if any feature or aspect of the present invention is described in relation to the Markush group, a person skilled in the art will recognize that the present invention is also described in relation to any individual member or subgroup of a member of the Markush group.

[0226]

[0259] All publications, patent applications, patents, and other references cited herein are incorporated by reference as explicitly as they are incorporated by reference individually. In case of any conflict, including definitions, this specification shall prevail. Throughout this specification, technical references are referenced by author citation, and complete citation details for such references are given below. [Note] The present invention includes the following embodiments. 1. (a) HNF1 / HNF3 (Sequence ID 1); (b) HNF3 / HNF3(Sequence ID 2); (c)c / EBP / HNF4(sequence number 3); (d)HS_CRM2 / HNF3(sequence number 4); and (e) HS_CRM8 (sequence number 6) or its variant A synthetic polynucleotide comprising at least three promoter-derived nucleic acids selected from the group consisting of, The synthetic polynucleotide preferably comprises at least SEQ ID NO: 3 and SEQ ID NO: 6 or their variants. The variant of the HS_CRM8 sequence is preferably selected from the group consisting of SEQ ID NOs. 5, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, and 100. More preferably, the synthetic polynucleotide comprises at least four of the promoter-derived nucleic acids, or (f) Motif_44 (Sequence No. 12); (g)NRF2F1(Sequence ID 14); (h)HNF1A(sequence number 15); and (i) IA2 (Sequence ID 16) A synthetic polynucleotide comprising at least three promoter-derived nucleic acids selected from the group consisting of the following, Alternatively, a synthetic polynucleotide having a sequence selected from the group consisting of SEQ ID NOs. 36, 37, 38, 39, and 40, or a synthetic polynucleotide having at least 90% identity with such a sequence. 2. A synthetic polynucleotide according to Embodiment 1 comprising five promoter-derived nucleic acids (a) to (e), or a synthetic polynucleotide having at least 90% identity with a synthetic polynucleotide comprising five promoter-derived nucleic acids (a) to (e), Preferably, a synthetic polynucleotide comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 6 consecutively from the 5' end to the 3' end. 3. Further comprising at least one minimal promoter nucleic acid, Preferably, the sequence of the minimal promoter nucleic acid is derived from SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10), or a minimal promoter nucleic acid having at least 90% sequence identity with SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), or G6PC (SEQ ID NO: 10). More preferably, the minimal promoter nucleic acid comprises a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 9, and 10, according to Embodiment 1 or 2 of the synthetic polynucleotide. 4. i) at least one spacer nucleic acid located between two of the promoter-derived nucleic acids; and ii) A operably linked nucleic acid sequence encoding an intron, preferably the intron being derived from SV40. A synthetic polynucleotide according to any one of embodiments 1 to 3, further comprising at least one of the following. 5. A synthetic polynucleotide according to any one of Embodiments 1 to 4, having a length of less than 250 base pairs, preferably less than 300 base pairs. 6. A synthetic polynucleotide according to any one of Embodiments 1 to 5, having a sequence selected from the group consisting of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or a sequence selected from the group consisting of SEQ ID NOs: 41-45, 53-58, 67-69, and 73-86. 7. i) The synthetic polynucleotide promotes transgene expression in the liver, preferably liver-specific transgene expression; ii) The synthetic polynucleotide is suitable for promoting liver-specific transgene expression at a level at least 1.5 times higher than that of the LP1 promoter, preferably at a level at least 2 times higher than that of the LP1 promoter; iii) The synthetic polynucleotide has a reduction in transgene expression at a level at least four times lower than that of the CMV promoter in non-hepatic cells, preferably the non-hepatic cells are A549 cells; iv) The synthetic polynucleotide is suitable for promoting liver-specific transgene expression in liver-derived cells at a level at least 1.5 times higher than that of the CMV promoter, preferably at a level at least 2 times higher than that of the CMV promoter in liver-derived cells; and v) The synthetic polynucleotide has a reduction in transgene expression at a level at least 1.5 times lower than that of the LP1 promoter in non-hepatic cells, preferably at a level at least 2 times lower than that of the LP1 promoter in non-hepatic cells. A synthetic polynucleotide according to any one of embodiments 1 to 6, which is at least one of the above. 8. i) A operably linked nucleic acid sequence encoding a post-transcriptional regulatory element; ii) A operably linked nucleic acid sequence encoding a poly(A) element; and iii) An introduced gene that is operably linked, preferably encoding AAT, AGXT, ARG, ASL, ASS, ATP7B, BCKDHA, BCKDHB, CFH, CFTF, CPS, DBT, FAH, FIX, FVIII, HAMP, HFE, JH, MUT, NAGS, OTC, PCCA, PCCB, PI, SLC40A1, TFR2, TTR, UGT1A1, urokinase, PXBP or a variant, derivative or equivalent thereof. The synthetic polynucleotide according to any one of Embodiments 1 to 7, further comprising at least one of the above. 9. An expression cassette comprising the synthetic polynucleotide according to any one of Embodiments 1 to 8 and a polynucleotide sequence operably linked to encode an introduced gene, wherein the introduced gene encodes a therapeutic polypeptide suitable for use in the treatment of liver-related diseases or conditions, preferably, the expression cassette i) a nucleic acid encoding a post-transcriptional regulatory element; and ii) a nucleic acid encoding a polyA element The expression cassette further comprising at least one of the above. 10. A gene therapy vector comprising the synthetic polynucleotide according to any one of Embodiments 1 to 8 or the expression cassette according to Embodiment 9, preferably, a retroviral vector, a lentiviral vector, an adenoviral vector or an adeno-associated virus vector (AAV). 11. An AAV vector having a serum type suitable for liver transduction, preferably, the AAV is selected from the group consisting of AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV6.2, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV3B and LK03, the gene therapy vector according to Embodiment 10. 12. Recombinant viral particles comprising a synthetic polynucleotide described in any of Embodiments 1 to 8, an expression cassette described in Embodiment 9, or a vector described in Embodiment 10 or 11. 13. A synthetic polynucleotide according to any of Embodiments 1 to 8, an expression cassette according to Embodiment 9, a vector according to Embodiment 10 or 11, or a recombinant viral particle according to Embodiment 12, for use in the medical treatment of a genetic disease or condition. Preferably, the hereditary disease or condition related to the liver is selected from the group including hereditary cholestasis, Wilson's disease, hereditary hemochromatosis, tyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome-1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, GSD1A type, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythroproliferative protoporphyria, Gaucher disease, hemophilia A, hemophilia B, familial hypercholesterolemia, ornithine transcarbamylase deficiency, and phenylketonuria, and is a synthetic polynucleotide, expression cassette, vector, or recombinant viral particle. 14. A method for treating a genetic disorder or condition in a person requiring treatment, The method includes administering a synthetic polynucleotide described in any of Embodiments 1 to 8, an expression cassette described in Embodiment 9, a vector described in Embodiment 10 or 11, or recombinant virus particles described in Embodiment 12 to the subject, thereby causing the therapeutic transgene to be expressed in the liver of the subject. Preferably, the subject is a mammal, A more preferable method in which the mammal is a human. 15. The method according to Embodiment 14, wherein the hereditary disease or condition relating to the liver is selected from the group including hereditary cholestasis, Wilson's disease, hereditary hemochromatosis, tyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome-1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, GSD1A type, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythrocytic protoporphyria, Gaucher disease, hemophilia A, hemophilia B, familial hypercholesterolemia, ornithine transcarbamylase deficiency, and phenylketonuria. 16. An ex vivo or in vitro method for expressing a transgene in hepatocytes, A method comprising the step of contacting the liver cells with a synthetic polynucleotide according to any of Embodiments 1 to 8, an expression cassette according to Embodiment 9, a vector according to Embodiment 10 or 11, or recombinant viral particles according to Embodiment 12.

Claims

1. (a) HNF1 / HNF3 (SEQ ID NO: 1); (b) HNF3 / HNF3 (SEQ ID NO: 2); (c) c / EBP / HNF4 (SEQ ID NO: 3); (d) HS_CRM2 / HNF3 (SEQ ID NO: 4); and (e) HS_CRM8 (SEQ ID NO: 6) or its variant An expression cassette comprising a synthetic polynucleotide containing nucleic acids, The variant of the HS_CRM8 sequence is an expression cassette selected from the group consisting of SEQ ID NOs: 5, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, and 100.

2. The expression cassette according to Claim 1, wherein the synthetic polynucleotide comprises, in a continuous sequence from the 5' end to the 3' end, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 6 or a variant thereof, and the variant of the HS_CRM8 sequence is selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, and SEQ ID NO:

100.

3. The expression cassette according to claim 2, wherein the synthetic polynucleotide further comprises at least one minimal promoter nucleic acid, the sequence of the minimal promoter nucleic acid comprising a sequence selected from the group consisting of SERPINE1 (SEQ ID NO: 7), SERPINA1 (SEQ ID NO: 8), APOC2 (SEQ ID NO: 9), and G6PC (SEQ ID NO: 10).

4. The synthetic polynucleotide is i) at least one spacer nucleic acid located between two of the nucleic acids; and ii) A operably linked nucleic acid sequence encoding an intron An expression cassette according to any one of claims 1 to 3, further comprising at least one of the following.

5. The expression cassette according to any one of claims 1 to 4, wherein the synthetic polynucleotide is less than 300 bases in length.

6. The expression cassette according to any one of claims 1 to 5, wherein the synthetic polynucleotide has a sequence selected from the group consisting of SEQ ID NOs: 25, 26, 27, 28, 29, 30, 31, 53-58, and 67-69.

7. i) The synthetic polynucleotide promotes transgene expression in the liver; ii) The synthetic polynucleotide is suitable for promoting liver-specific transgene expression at a level at least 1.5 times higher than that of the LP1 promoter; iii) The synthetic polynucleotide has a reduction in transgene expression at least four times lower than that of the CMV promoter in non-hepatic cells; iv) The synthetic polynucleotide is suitable for promoting liver-specific transgene expression in liver-derived cells at a level at least 1.5 times higher than that of the CMV promoter; and v) The synthetic polynucleotide has a reduction in transgene expression at a level at least 1.5 times lower than that of the LP1 promoter in non-hepatic cells. An expression cassette according to any one of claims 1 to 6, wherein the expression cassette is at least one of the following.

8. The synthetic polynucleotide is i) A operably linked nucleic acid sequence encoding a post-transcriptional regulatory element; ii) A operably linked nucleic acid sequence encoding a poly(A) element; and iii) Operable linked transgene An expression cassette according to any one of claims 1 to 7, further comprising at least one of the following.

9. The expression cassette according to claim 8, wherein the introduced gene encodes a therapeutic polypeptide suitable for use in the treatment of liver-related diseases or conditions.

10. A gene therapy vector comprising an expression cassette according to any one of claims 1 to 9, Gene therapy vectors that are retroviral vectors, lentiviral vectors, adenovirus vectors, or adeno-associated virus (AAV) vectors.

11. This AAV vector has a serotype suitable for hepatic transduction. The gene therapy vector according to claim 10, wherein the AAV is selected from the group consisting of AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV6.2, AAVrh. 64R1, AAVhu. 37, AAVrh. 8, AAVrh. 32.33, AAV3B, and LK03.

12. Recombinant virus particles comprising an expression cassette according to any one of claims 1 to 9, or a vector according to claim 10 or 11.

13. An expression cassette according to any one of claims 1 to 9, a vector according to claim 10 or 11, or a recombinant viral particle according to claim 12, for use in the medical treatment of a genetic disorder or condition.

14. The expression cassette, vector, or recombinant viral particle according to claim 13, wherein the hereditary disease or condition relating to the liver is selected from the group including hereditary cholestasis, Wilson's disease, hereditary hemochromatosis, tyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome-1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, GSD type 1A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythroproliferative protoporphyria, Gaucher disease, hemophilia A, hemophilia B, familial hypercholesterolemia, Fabry disease, ornithine transcarbamylase deficiency, and phenylketonuria.

15. An ex vivo or in vitro method for expressing a transgene in hepatocytes, A method comprising the step of contacting the hepatocytes with an expression cassette according to any one of claims 1 to 9, a vector according to claim 10 or 11, or recombinant virus particles according to claim 12.

Images