TIGIT antibody and its uses

Abstract

The present invention provides an anti-TIGIT antibody or an antigen-binding fragment thereof that specifically binds to TIGIT, a composition comprising the anti-TIGIT antibody or an antigen-binding fragment thereof, and use thereof in the diagnosis and treatment of TIGIT-related diseases.

Description

Cross-reference of related applications

[0001] This application claims priority to the Chinese PCT application filed on December 17, 2021, with application number PCT / CN2021 / 139122 and title "TIGIT antibody and its uses," the entirety of which is incorporated herein by reference. [Technical Field]

[0002] The present invention relates to a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof that specifically binds to TIGIT (a T cell immune receptor having Ig and ITIM domains), an anti-TIGIT antibody or antigen-binding fragment thereof, and uses thereof. [Background technology]

[0003] In recent years, tumor immunotherapy has made significant progress and is a promising new method in cancer treatment. In particular, therapies that block tumor immunosuppressive checkpoints, including PD-1 / PD-L1 and CTLA-4, have attracted attention. Since 2000, the FDA has successively approved the use of PD-1 / PD-L1 monoclonal antibodies for the clinical treatment of malignant tumors such as melanoma, non-small cell lung cancer, and prostate cancer, achieving good therapeutic effects. However, the clinical response rate of PD-1 / PD-L1 monoclonal antibody therapy remains limited, significantly restricting its clinical use. Therefore, the search for new immunosuppressive checkpoints has become a hot spot in research.

[0004] TIGIT is a novel immunosuppressant discovered by the Genentech team in 2009 (Nat Immunol, 2009, 10:48-57). It is a member of the PVR-like protein family. TIGIT is CD4 + T cells, CD8 +TIGIT is expressed in T cells and NK cells, including T cells and Treg cells. Generally, TIGIT expression levels are low, but when T cells and NK cells are activated, TIGIT expression increases significantly (J Immunol, 2012, 188:3869-3875, Cancer Cell 26, 923-937, Nat Immunol, 19, 723-732). TIGIT ligands discovered to date include CD155, CD112, and CD113, of which CD155 is the main ligand for TIGIT. Crystal structure analysis has shown that TIGIT and CD155 each form homodimers, and that interactions between ligands and receptors further form heterotetramers (Proc Natl Acad Sci USA 2012;109:5399-404). The binding affinity of TIGIT to CD112 or CD113 is significantly lower than that of TIGIT to CD155. CD155 is primarily expressed in dendritic cells, T cells, B cells, macrophages, and non-hematopoietic tissues (e.g., kidney, nervous system, small intestine). Like TIGIT, the activating receptors DNAM-1 and CD96 can also bind to CD155, but their affinity is weaker than that of TIGIT. In short, the ligand-receptor mechanism of TIGIT / CD155 is similar to that of the CTLA-4 / CD28 pathway. The immune response is precisely regulated by the competition between a highly affinity inhibitory receptor and a low affinity activating receptor to bind to the same ligand. TIGIT bound to CD155 can exert immunosuppressive effects by regulating DC function, suppressing effector T cell activity, interfering with DNAM-1 co-activation, and enhancing Treg suppression (Clinical and Experimental Immunology, 2020 May;200(2):108-119, Immunity 40, 569-581).

[0005] Several studies in humans and mice have shown that TIGIT is highly expressed in tumor-infiltrating lymphocytes. TIGIT is upregulated in various malignancies, including melanoma, breast cancer, non-small cell lung cancer, colon adenocarcinoma, gastric cancer, acute myeloid leukemia, and multiple myeloma (Clinical and Experimental Immunology, 2020 May;200(2):108-119). In addition, several studies have shown that TIGIT is upregulated in CD8 + It was also found to be highly expressed in T cells, tumor-infiltrating Treg cells, and NK cells. In tumor patients, tumor-infiltrating CD8 + TIGIT expression in T cells and NK cells generally coincides with high expression of other inhibitory receptors (e.g., PD-1, LAG-3, Tim-3) and low expression of DNAM-1. High TIGIT expression is generally associated with a poor prognosis in malignant tumors. High TIGIT expression in NK cells is associated with disease severity. TIGIT knockout mice show significantly reduced tumor growth and improved survival rates.

[0006] Due to their high molecular weight, antibody drugs targeting TIGIT generally carry immune-related adverse events (irAEs). In TIGIT knockout mice, there are no spontaneous autoimmune symptoms or hematopoietic cell developmental disorders. The incidence of autoimmune disease improves only after hybridization with mice predisposed to autoimmune disease. Animal studies have shown that the incidence of irAEs is lower during administration of anti-TIGIT mAbs compared to PD-1 and CTLA-4 mAbs (Oncoimmunology 2018;7:e1445949). Therefore, antibody drugs targeting TIGIT have a relatively low risk of side effects and are high-quality candidates as clinical anticancer agents.

[0007] As evidenced by past clinical trial results, the combination of TIGIT antibodies and PD-1 / PD-L1 monoclonal antibodies significantly increases patient response rates, improves treatment efficacy, and eliminates drug resistance in some patients (Cancers 2019;11:877, Cancer Discov,10:1086-1087(2020)). Currently, there are no monoclonal antibodies against TIGIT that have received marketing authorization worldwide, so it is necessary to develop candidate antibodies with high affinity and activity. [Overview of the project]

[0008] The inventors of this invention, after extensive testing, have developed a chromosome-transfer mouse (TC mAb) possessing the full length of the human antibody gene sequence. TM Screening using a mouse model unexpectedly yielded an antibody that specifically binds to TIGIT. This antibody exhibits excellent affinity for TIGIT and holds potential for drug discovery.

[0009] The present invention provides improved drugs and therapies for use in cancer and chronic viral infections, the improved drugs and therapies comprising an anti-TIGIT antibody or its antigen-binding fragment that specifically binds to human TIGIT (huTIGIT). This specification provides isolated antibodies, such as monoclonal antibodies, particularly human monoclonal antibodies, that specifically bind to huTIGIT and have desired functional properties, such as specific binding with high affinity to huTIGIT, binding to monkey TIGIT (e.g., cynomolgus monkey TIGIT), the ability to block the binding of TIGIT to PVR and Nectin-2, the ability to block the interaction between TIGIT and DNAM, or any combination thereof.

[0010] The present invention relates to an antibody that competes with antibodies having heavy chain and light chain variable domain sequences disclosed herein to bind to huTIGIT, and cross-blocks the binding of antibodies having heavy chain and light chain variable domain sequences disclosed herein to huTIGIT.

[0011] In some embodiments, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention enhances an anti-tumor immune response, such as an antigen-specific T cell response. In other embodiments, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention blocks inhibitory signaling mediated by TIGIT and increases killing by NK-mediated anti-tumor responses by enabling PVR / DNAM co-stimulation of NK cells. In another embodiment, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention depletes regulatory T cell populations within the tumor, which otherwise suppress the anti-tumor immune response. In another embodiment, the anti-TIGIT antibody of the present invention in IgG1 form depletes + exhausted T cells and Tregs, thereby allowing the influx of new non-exhausted CD8 + T cells. In some embodiments, the anti-TIGIT antibody of the present invention in IgG1 form increases the proportion of the CD8 + TIL population in the tumor microenvironment. In other embodiments, since the above mechanisms are not necessarily mutually exclusive, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention plays a role by one or more of the above mechanisms.

[0012] In some embodiments, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention does not bind to activated Fcγ receptors (FcγR), for example, in embodiments that rely on enhancing the anti-tumor activity of TIGIT-expressing cells. In alternative embodiments, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention binds to one or more activated FcγRs, for example, in embodiments that rely on the killing of TIGIT-expressing cells (e.g., exhausted CD8 + T cells or Tregs).

[0013] In a first aspect, the present invention provides an anti-TIGIT antibody or antigen-binding fragment thereof that specifically binds to TIGIT. The anti-TIGIT antibody or antigen-binding fragment comprises a heavy chain variable region (VH) and / or a light chain variable region (VL), and the heavy chain variable region comprises CDRH1, CDRH2, CDRH3, and the light chain variable region comprises CDRL1, CDRL2, CDRL3.

[0014] In some embodiments of the present invention, (a) The CDRH1 comprises the sequence of SEQ ID NO: 23, SEQ ID NO: 29, SEQ ID NO: 35, SEQ ID NO: 41, SEQ ID NO: 47, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 65, SEQ ID NO: 75, or SEQ ID NO: 81, or the CDRH1 comprises a sequence derived by adding, deleting, or substituting one or more amino acids to SEQ ID NO: 23, SEQ ID NO: 29, SEQ ID NO: 35, SEQ ID NO: 41, SEQ ID NO: 47, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 65, SEQ ID NO: 75, or SEQ ID NO: 81, (b) CDRH2 includes the sequence of SEQ ID NO: 24, SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 48, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 66, SEQ ID NO: 76 or SEQ ID NO: 82, or CDRH1 includes a sequence derived from SEQ ID NO: 24, SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 48, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 66, SEQ ID NO: 76 or SEQ ID NO: 82 by adding, deleting or substituting one or more amino acids, and (c) CDRH3 includes the sequence of SEQ ID NO: 25, SEQ ID NO: 31, SEQ ID NO: 37, SEQ ID NO: 43, SEQ ID NO: 49, SEQ ID NO: 55, SEQ ID NO: 61, SEQ ID NO: 67, SEQ ID NO: 77, or SEQ ID NO: 83, or CDRH1 includes a sequence derived by adding, deleting, or substituting one or more amino acids to SEQ ID NO: 25, SEQ ID NO: 31, SEQ ID NO: 37, SEQ ID NO: 43, SEQ ID NO: 49, SEQ ID NO: 55, SEQ ID NO: 61, SEQ ID NO: 67, SEQ ID NO: 77, or SEQ ID NO: 83.

[0015] In some other embodiments of the present invention, (a) The CDRL1 includes the sequence of SEQ ID NO: 20, SEQ ID NO: 26, SEQ ID NO: 32, SEQ ID NO: 38, SEQ ID NO: 44, SEQ ID NO: 50, SEQ ID NO: 56, SEQ ID NO: 62, SEQ ID NO: 72 or SEQ ID NO: 78, or the CDRH1 includes a sequence derived by adding, deleting or substituting one or more amino acids to SEQ ID NO: 20, SEQ ID NO: 26, SEQ ID NO: 32, SEQ ID NO: 38, SEQ ID NO: 44, SEQ ID NO: 50, SEQ ID NO: 56, SEQ ID NO: 62, SEQ ID NO: 72 or SEQ ID NO: 78, (b) The CDRL2 includes the sequence of SEQ ID NO: 21, SEQ ID NO: 27, SEQ ID NO: 33, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 51, SEQ ID NO: 57, SEQ ID NO: 63, SEQ ID NO: 73 or SEQ ID NO: 79, or the CDRH1 includes a sequence derived by adding, deleting or substituting one or more amino acids to SEQ ID NO: 21, SEQ ID NO: 27, SEQ ID NO: 33, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 51, SEQ ID NO: 57, SEQ ID NO: 63, SEQ ID NO: 73 or SEQ ID NO: 79, and (c) The CDRL3 includes the sequence of SEQ ID NO: 22, SEQ ID NO: 28, SEQ ID NO: 34, SEQ ID NO: 40, SEQ ID NO: 46, SEQ ID NO: 52, SEQ ID NO: 58, SEQ ID NO: 64, SEQ ID NO: 74 or SEQ ID NO: 80, or the CDRH1 includes a sequence derived by adding, deleting or substituting one or more amino acids to SEQ ID NO: 22, SEQ ID NO: 28, SEQ ID NO: 34, SEQ ID NO: 40, SEQ ID NO: 46, SEQ ID NO: 52, SEQ ID NO: 58, SEQ ID NO: 64, SEQ ID NO: 74 or SEQ ID NO: 80.

[0016] In some other embodiments of the present invention, (a) The CDRH1 includes a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 29, SEQ ID NO: 35, SEQ ID NO: 41, SEQ ID NO: 47, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 65, SEQ ID NO: 75 and SEQ ID NO: 81, (b) The CDRH2 includes a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NO: 24, SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 48, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 66, SEQ ID NO: 76, and SEQ ID NO: 82, and (c) The CDRH3 includes a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 31, SEQ ID NO: 37, SEQ ID NO: 43, SEQ ID NO: 49, SEQ ID NO: 55, SEQ ID NO: 61, SEQ ID NO: 67, SEQ ID NO: 77, and SEQ ID NO: 83, and / or (d) The CDRL1 includes a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 26, SEQ ID NO: 32, SEQ ID NO: 38, SEQ ID NO: 44, SEQ ID NO: 50, SEQ ID NO: 56, SEQ ID NO: 62, SEQ ID NO: 72, and SEQ ID NO: 78, (e) The CDRL2 includes a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 27, SEQ ID NO: 33, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 51, SEQ ID NO: 57, SEQ ID NO: 63, SEQ ID NO: 73, and SEQ ID NO: 79, and (f) The CDRL3 includes a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NO: 22, SEQ ID NO: 28, SEQ ID NO: 34, SEQ ID NO: 40, SEQ ID NO: 46, SEQ ID NO: 52, SEQ ID NO: 58, SEQ ID NO: 64, SEQ ID NO: 74, and SEQ ID NO: 80.

[0017] In some other embodiments of the present invention, (a) CDRH1 includes a sequence selected from the group consisting of SEQ ID NOs: 23, 29, 35, 41, 47, 53, 59, 65, 75, and 81, (b) The CDRH2 includes a sequence selected from the group consisting of SEQ ID NOs: 24, 30, 36, 42, 48, 54, 60, 66, 76, and 82, (c) The CDRH3 includes a sequence selected from the group consisting of SEQ ID NOs: 25, 31, 37, 43, 49, 55, 61, 67, 77, and 83. (d) The CDRL1 includes a sequence selected from the group consisting of SEQ ID NOs. 20, 26, 32, 38, 44, 50, 56, 62, 72, and 78, (e) The CDRL2 includes a sequence selected from the group consisting of SEQ ID NOs: 21, 27, 33, 39, 45, 51, 57, 63, 73, and 79, and (f) The CDRL3 includes a sequence selected from the group consisting of SEQ ID NOs: 22, 28, 34, 40, 46, 52, 58, 64, 74, and 80.

[0018] In some other embodiments of the present invention, the heavy chain variable region includes CDRH1, CDRH2, CDRH3, and (a) CDRH1 includes the sequence shown in sequence number 23, CDRH2 includes the sequence shown in sequence number 24, and CDRH3 includes the sequence shown in sequence number 25. (b) CDRH1 includes the sequence shown in sequence number 29, CDRH2 includes the sequence shown in sequence number 30, and CDRH3 includes the sequence shown in sequence number 31. (c) CDRH1 includes the sequence shown in sequence number 35, CDRH2 includes the sequence shown in sequence number 36, and CDRH3 includes the sequence shown in sequence number 37. (d) CDRH1 includes the sequence shown in sequence number 41, CDRH2 includes the sequence shown in sequence number 42, and CDRH3 includes the sequence shown in sequence number 43. (e) CDRH1 includes the sequence shown in sequence number 47, CDRH2 includes the sequence shown in sequence number 48, and CDRH3 includes the sequence shown in sequence number 49, (f) CDRH1 includes the sequence shown in sequence number 53, CDRH2 includes the sequence shown in sequence number 54, and CDRH3 includes the sequence shown in sequence number 55. (g) CDRH1 includes the sequence shown in sequence number 59, CDRH2 includes the sequence shown in sequence number 60, and CDRH3 includes the sequence shown in sequence number 61. (h) CDRH1 includes the sequence shown in sequence number 65, CDRH2 includes the sequence shown in sequence number 66, and CDRH3 includes the sequence shown in sequence number 67. (i) CDRH1 includes the sequence of sequence number 75, CDRH2 includes the sequence of sequence number 76, and CDRH3 includes the sequence of sequence number 77, or (j) CDRH1 includes the sequence of sequence number 81, CDRH2 includes the sequence of sequence number 82, and CDRH3 includes the sequence of sequence number 83.

[0019] In some other embodiments of the present invention, the light chain variable region includes CDRL1, CDRL2, CDRL3, and (a) CDRL1 includes the sequence shown in sequence number 20, CDRL2 includes the sequence shown in sequence number 21, and CDRL3 includes the sequence shown in sequence number 22. (b) CDRL1 includes the sequence shown in sequence number 26, CDRL2 includes the sequence shown in sequence number 27, and CDRL3 includes the sequence shown in sequence number 28. (c) CDRL1 includes the sequence shown in sequence number 32, CDRL2 includes the sequence shown in sequence number 33, and CDRL3 includes the sequence shown in sequence number 34. (d) CDRL1 includes the sequence shown in sequence number 38, CDRL2 includes the sequence shown in sequence number 39, and CDRL3 includes the sequence shown in sequence number 40. (e) CDRL1 includes the sequence indicated by sequence number 44, CDRL2 includes the sequence indicated by sequence number 45, and CDRL3 includes the sequence indicated by sequence number 46, (f) CDRL1 includes the sequence indicated by sequence number 50, CDRL2 includes the sequence indicated by sequence number 51, and CDRL3 includes the sequence indicated by sequence number 52. (g) CDRL1 includes the sequence shown in sequence number 56, CDRL2 includes the sequence shown in sequence number 57, and CDRL3 includes the sequence shown in sequence number 58. (h) CDRL1 includes the sequence shown in sequence number 62, CDRL2 includes the sequence shown in sequence number 63, and CDRL3 includes the sequence shown in sequence number 64. (i) CDRL1 includes the sequence of sequence number 72, CDRL2 includes the sequence of sequence number 73, and CDRL3 includes the sequence of sequence number 74, or (j) CDRL1 includes the sequence of sequence number 78, CDRL2 includes the sequence of sequence number 79, and CDRL3 includes the sequence of sequence number 80.

[0020] In some other embodiments of the present invention, (a) CDRH1 includes the sequence shown in sequence number 23, CDRH2 includes the sequence shown in sequence number 24, and CDRH3 includes the sequence shown in sequence number 25, and CDRL1 includes the sequence shown in sequence number 20, CDRL2 includes the sequence shown in sequence number 21, and CDRL3 includes the sequence shown in sequence number 22, (b) CDRH1 includes the sequence shown in sequence number 29, CDRH2 includes the sequence shown in sequence number 30, and CDRH3 includes the sequence shown in sequence number 31, and CDRL1 includes the sequence shown in sequence number 26, CDRL2 includes the sequence shown in sequence number 27, and CDRL3 includes the sequence shown in sequence number 28, (c) CDRH1 includes the sequence shown in sequence number 35, CDRH2 includes the sequence shown in sequence number 36, and CDRH3 includes the sequence shown in sequence number 37, and CDRL1 includes the sequence shown in sequence number 32, CDRL2 includes the sequence shown in sequence number 33, and CDRL3 includes the sequence shown in sequence number 34, (d) CDRH1 includes the sequence shown in sequence number 41, CDRH2 includes the sequence shown in sequence number 42, and CDRH3 includes the sequence shown in sequence number 43, and CDRL1 includes the sequence shown in sequence number 38, CDRL2 includes the sequence shown in sequence number 39, and CDRL3 includes the sequence shown in sequence number 40, (e) CDRH1 includes the sequence shown in sequence number 47, CDRH2 includes the sequence shown in sequence number 48, and CDRH3 includes the sequence shown in sequence number 49, and CDRL1 includes the sequence shown in sequence number 44, CDRL2 includes the sequence shown in sequence number 45, and CDRL3 includes the sequence shown in sequence number 46, (f) CDRH1 includes the sequence shown in sequence number 53, CDRH2 includes the sequence shown in sequence number 54, and CDRH3 includes the sequence shown in sequence number 55, and CDRL1 includes the sequence shown in sequence number 50, CDRL2 includes the sequence shown in sequence number 51, and CDRL3 includes the sequence shown in sequence number 52, (g) CDRH1 includes the sequence shown in SEQ ID NO: 59, CDRH2 includes the sequence shown in SEQ ID NO: 60, and CDRH3 includes the sequence shown in SEQ ID NO: 61, and CDRL1 includes the sequence shown in SEQ ID NO: 56, CDRL2 includes the sequence shown in SEQ ID NO: 57, and CDRL3 includes the sequence shown in SEQ ID NO: 58, (h) CDRH1 includes the sequence shown in sequence number 65, CDRH2 includes the sequence shown in sequence number 66, and CDRH3 includes the sequence shown in sequence number 67, and CDRL1 includes the sequence shown in sequence number 62, CDRL2 includes the sequence shown in sequence number 63, and CDRL3 includes the sequence shown in sequence number 64, (i) CDRH1 includes the sequence of sequence number 75, CDRH2 includes the sequence of sequence number 76, and CDRH3 includes the sequence of sequence number 77, and CDRL1 includes the sequence of sequence number 72, CDRL2 includes the sequence of sequence number 73, and CDRL3 includes the sequence of sequence number 74, or (j) CDRH1 includes the sequence of sequence number 81, CDRH2 includes the sequence of sequence number 82, and CDRH3 includes the sequence of sequence number 83, and CDRL1 includes the sequence of sequence number 78, CDRL2 includes the sequence of sequence number 79, and CDRL3 includes the sequence of sequence number 80.

[0021] In some other embodiments of the present invention, (a) The sequence of CDRH1 is shown in sequence number 23, the sequence of CDRH2 is shown in sequence number 24, the sequence of CDRH3 is shown in sequence number 25, the sequence of CDRL1 is shown in sequence number 20, the sequence of CDRL2 is shown in sequence number 21, and the sequence of CDRL3 is shown in sequence number 22. (b) The sequence of CDRH1 is shown in sequence number 29, the sequence of CDRH2 is shown in sequence number 30, the sequence of CDRH3 is shown in sequence number 31, the sequence of CDRL1 is shown in sequence number 26, the sequence of CDRL2 is shown in sequence number 27, and the sequence of CDRL3 is shown in sequence number 28. (c) The sequence of CDRH1 is shown in sequence number 35, the sequence of CDRH2 is shown in sequence number 36, the sequence of CDRH3 is shown in sequence number 37, the sequence of CDRL1 is shown in sequence number 32, the sequence of CDRL2 is shown in sequence number 33, and the sequence of CDRL3 is shown in sequence number 34. (d) The sequence of CDRH1 is shown in sequence number 41, the sequence of CDRH2 is shown in sequence number 42, the sequence of CDRH3 is shown in sequence number 43, the sequence of CDRL1 is shown in sequence number 38, the sequence of CDRL2 is shown in sequence number 39, and the sequence of CDRL3 is shown in sequence number 40. (e) The sequence of CDRH1 is shown in sequence number 47, the sequence of CDRH2 is shown in sequence number 48, the sequence of CDRH3 is shown in sequence number 49, the sequence of CDRL1 is shown in sequence number 44, the sequence of CDRL2 is shown in sequence number 45, and the sequence of CDRL3 is shown in sequence number 46. (f) The sequence of CDRH1 is shown in sequence number 53, the sequence of CDRH2 is shown in sequence number 54, the sequence of CDRH3 is shown in sequence number 55, the sequence of CDRL1 is shown in sequence number 50, the sequence of CDRL2 is shown in sequence number 51, and the sequence of CDRL3 is shown in sequence number 52. (g) The sequence of CDRH1 is shown in sequence number 59, the sequence of CDRH2 is shown in sequence number 60, the sequence of CDRH3 is shown in sequence number 61, the sequence of CDRL1 is shown in sequence number 56, the sequence of CDRL2 is shown in sequence number 57, and the sequence of CDRL3 is shown in sequence number 58. (h) The sequence of CDRH1 is shown in sequence number 65, the sequence of CDRH2 is shown in sequence number 66, the sequence of CDRH3 is shown in sequence number 67, the sequence of CDRL1 is shown in sequence number 62, the sequence of CDRL2 is shown in sequence number 63, and the sequence of CDRL3 is shown in sequence number 64. (i) The sequence of CDRH1 is shown in sequence number 75, the sequence of CDRH2 is shown in sequence number 76, and the sequence of CDRH3 is shown in sequence number 77, and the sequence of CDRL1 is shown in sequence number 72, the sequence of CDRL2 is shown in sequence number 73, and the sequence of CDRL3 is shown in sequence number 74, or (j) The sequence of CDRH1 is shown in sequence number 81, the sequence of CDRH2 is shown in sequence number 82, the sequence of CDRH3 is shown in sequence number 83, the sequence of CDRL1 is shown in sequence number 78, the sequence of CDRL2 is shown in sequence number 79, and the sequence of CDRL3 is shown in sequence number 80.

[0022] In some other embodiments of the present invention, the heavy chain variable region includes sequences selected from the group consisting of SEQ ID NOs. 5, SEQ ID NOs. 7, SEQ ID NOs. 9, SEQ ID NOs. 11, SEQ ID NOs. 13, SEQ ID NOs. 15, SEQ ID NOs. 17, SEQ ID NOs. 19, SEQ ID NOs. 69, and SEQ ID NOs. 71.

[0023] In some other embodiments of the present invention, the light chain variable region includes an array selected from the group consisting of SEQ ID NOs: 4, SEQ ID NOs: 6, SEQ ID NOs: 8, SEQ ID NOs: 10, SEQ ID NOs: 12, SEQ ID NOs: 14, SEQ ID NOs: 16, SEQ ID NOs: 18, SEQ ID NOs: 68, and SEQ ID NOs: 70.

[0024] In some other embodiments of the present invention, (a) The heavy chain variable region includes the sequence shown in Sequence ID No. 5, and the light chain variable region includes the sequence shown in Sequence ID No. 4, (b) The heavy chain variable region includes the sequence shown in Sequence ID 7, and the light chain variable region includes the sequence shown in Sequence ID 6, (c) The heavy chain variable region includes the sequence shown in sequence number 9, and the light chain variable region includes the sequence shown in sequence number 8, (d) The heavy chain variable region includes the sequence shown in sequence number 11, and the light chain variable region includes the sequence shown in sequence number 10, (e) The heavy chain variable region includes the sequence shown in sequence number 13, and the light chain variable region includes the sequence shown in sequence number 12, (f) The heavy chain variable region includes the sequence shown in sequence number 15, and the light chain variable region includes the sequence shown in sequence number 14, (g) The heavy chain variable region includes the sequence shown in Sequence ID No. 17, and the light chain variable region includes the sequence shown in Sequence ID No. 16, or (h) The heavy chain variable region includes the sequence shown in sequence number 19, and the light chain variable region includes the sequence shown in sequence number 18.

[0025] In some other embodiments of the present invention, (a) The arrangement of the heavy chain variable region is shown in sequence number 5, and the arrangement of the light chain variable region is shown in sequence number 4, (b) The arrangement of the heavy chain variable region is shown in sequence number 7, and the arrangement of the light chain variable region is shown in sequence number 6, (c) The arrangement of the heavy chain variable region is shown in sequence number 9, and the arrangement of the light chain variable region is shown in sequence number 8, (d) The arrangement of the heavy chain variable region is shown in sequence number 11, and the arrangement of the light chain variable region is shown in sequence number 10, (e) The arrangement of the heavy chain variable region is shown in sequence number 13, and the arrangement of the light chain variable region is shown in sequence number 12, (f) The arrangement of the heavy chain variable region is shown in sequence number 15, and the arrangement of the light chain variable region is shown in sequence number 14, (g) The arrangement of the heavy chain variable region is shown in sequence number 17, and the arrangement of the light chain variable region is shown in sequence number 16, (h) The arrangement of the heavy chain variable region is shown in sequence number 19, and the arrangement of the light chain variable region is shown in sequence number 18, (i) The heavy chain variable region includes the sequence of sequence number 69, and the light chain variable region includes the sequence of sequence number 68, or (j) The heavy chain variable region includes the sequence of sequence number 71, and the light chain variable region includes the sequence of sequence number 70.

[0026] In some other embodiments of the present invention, the anti-TIGIT antibody or its antigen-binding fragment comprises a heavy chain variable region (VH) and / or a light chain variable region (VL), and (a) The VH includes CDRH1, CDRH2 and CDRH3 of VH shown in Sequence ID No. 5, and / or the VL includes CDRL1, CDRL2 and CDRL3 of VL shown in Sequence ID No. 4, (b) The VH includes CDRH1, CDRH2 and CDRH3 of VH shown in Sequence ID No. 7, and / or the VL includes CDRL1, CDRL2 and CDRL3 of VL shown in Sequence ID No. 6, (c) The VH includes CDRH1, CDRH2 and CDRH3 of VH shown in Sequence ID No. 9, and / or the VL includes CDRL1, CDRL2 and CDRL3 of VL shown in Sequence ID No. 8, (d) The VH includes CDRH1, CDRH2 and CDRH3 of VH shown in Sequence ID No. 11, and / or the VL includes CDRL1, CDRL2 and CDRL3 of VL shown in Sequence ID No. 10, (e) The VH includes CDRH1, CDRH2 and CDRH3 of VH shown in Sequence ID No. 13, and / or the VL includes CDRL1, CDRL2 and CDRL3 of VL shown in Sequence ID No. 12, (f) The VH includes CDRH1, CDRH2 and CDRH3 of VH shown in Sequence ID No. 15, and / or the VL includes CDRL1, CDRL2 and CDRL3 of VL shown in Sequence ID No. 14, (g) The VH includes CDRH1, CDRH2 and CDRH3 of VH shown in Sequence ID No. 17, and / or the VL includes CDRL1, CDRL2 and CDRL3 of VL shown in Sequence ID No. 16, (h) The VH includes CDRH1, CDRH2 and CDRH3 of VH shown in Sequence ID No. 19, and / or the VL includes CDRL1, CDRL2 and CDRL3 of VL shown in Sequence ID No. 18, (i) The VH includes CDRH1, CDRH2 and CDRH3 of VH shown in Sequence ID No. 69, and / or the VL includes CDRL1, CDRL2 and CDRL3 of VL shown in Sequence ID No. 68, or (j) The VH includes CDRH1, CDRH2, and CDRH3 of VH shown in Sequence ID No. 71, and / or the VL includes CDRL1, CDRL2, and CDRL3 of VL shown in Sequence ID No. 70.

[0027] In some embodiments, among the isolated monoclonal antibodies or antigen-binding fragments of the present invention, (a) some antibodies can block the binding of themselves (1B2-8C) to tiragolumab, 4A042-H3, 4A042-H7 and 4B030a, and can partially block the binding to 4A063, but cannot block the binding to 4B037a, 4B056a, 4A063, 4D035a and 4E061a, and (b) some antibodies can block the binding of themselves (4A042-H3), (c) Some antibodies can block binding to 1B2-8C, 4A042-H7 and 4B030a, but do not block binding to 4B037a, 4B056a, 4A063, 4D035a and 4E061a, (d) Some antibodies can block binding to 4B042-H7 itself, 1B2-8C, 4A042-H3 and 4B030a, and partially block binding to 4B037a and 4A063, but cannot block binding to 4B056a, 4D035a and 4E061a, (d) Some antibodies can block binding to 1B2-8C, 4A042-H7 and 4B030a, and partially block binding to 4B037a and 4A063, but cannot block binding to 4B056a, 4D035a and 4E061a, (c) Some antibodies can block binding to 1B2-8C, 4A042-H7 and 4B030a, but do not block binding to 4B037a, 4B056a, 4D035a and 4E061a, (d) Some antibodies can block binding to 4B056a, 4D035a and 4E061a (e) Some antibodies can block binding to themselves (4B030a), partially block binding to 4B056a and 4A063, and do not block binding to 4B037a, 4D035a and 4E061a, (f) Some antibodies can block binding to themselves (4B037a, 4A063), 4B056a, 4D035a and 4E061a, and partially block binding to tiragolumab, 1B2-8C, 4A042-H3, 4A042-H7 and 4B030a, (f) Some antibodies can block binding to themselves (4B056a (g) Some antibodies can block binding to 4B037a, 4A063, 4D035a and 4E061a, and can partially block binding to tiragolumab, 1B2-8C, 4A042-H3 and 4B030a, but cannot block binding to 4A042-H7.

[0028] In some embodiments, the anti-huTIGIT antibody of the present invention or its antigen-binding fragment also binds to cynomolgus monkey TIGIT.

[0029] In some other embodiments of the present invention, the anti-TIGIT antibody or its antigen-binding fragment further comprises a heavy chain constant region selected from the heavy chain constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, and IgD.

[0030] In some embodiments of the present invention, the heavy chain constant region is the heavy chain constant region of human IgG or a variant thereof.

[0031] In some other embodiments of the present invention, the anti-TIGIT antibody or its antigen-binding fragment is in a form selected from the group consisting of F(ab')2, Fab', Fab, Fv, scFv, bispecific antibodies, and combinations thereof.

[0032] The present invention also provides an immune complex comprising an anti-TIGIT antibody as described herein, conjugated to a reagent (e.g., a detectable label or cytotoxic drug).

[0033] In other embodiments, the antibody of the present invention comprises an antigen-binding domain located on a bispecific molecule and further comprises an antigen-binding domain that specifically binds to a different immunoregulatory receptor, the immunoregulatory receptor comprising, but not limited to, PD-1, CTLA-4, or LAG3.

[0034] In a second aspect, the present invention provides a polynucleotide encoding an anti-TIGIT antibody or an antigen-binding fragment thereof.

[0035] In a third aspect, the present invention provides an expression vector for expressing the anti-TIGIT antibody or its antigen-binding fragment.

[0036] In a fourth aspect, the present invention provides engineered cells comprising a vector expressing the anti-TIGIT antibody or antigen-binding fragment.

[0037] In a fifth aspect, the present invention provides a pharmaceutical composition comprising an anti-TIGIT antibody or an antigen-binding fragment thereof according to a first aspect, a polynucleotide according to a second aspect, a vector according to a third aspect or a cell according to a fourth aspect, and a pharmaceutically acceptable carrier. The present invention further provides an antibody-drug conjugate comprising an anti-TIGIT antibody or an antigen-binding fragment according to a first aspect. This specification also provides a kit containing the anti-TIGIT antibody or an antigen-binding fragment thereof and instructions for use.

[0038] In a sixth aspect, the present invention provides uses of an anti-TIGIT antibody or its antigen-binding fragment according to a first aspect, a polynucleotide according to a second aspect, a vector according to a third aspect, cells according to a fourth aspect, or a pharmaceutical composition according to a fifth aspect in the manufacture of a drug for treating a TIGIT-related disease. Preferably, the TIGIT-related disease is a T-cell dysfunction disorder, more preferably, the TIGIT-related disease is a tumor, an immune disease, or an infection, and more preferably, the cancer is selected from the group consisting of melanoma, breast cancer, non-small cell lung cancer, colon adenocarcinoma, gastric cancer, acute myeloid leukemia, and multiple myeloma. More preferably, the cells of the tumor are CD155-positive or PVR-positive.

[0039] In some embodiments, the present invention provides a method for enhancing an antigen-specific T cell response, comprising contacting T cells with the anti-huTIGIT antibody of the present invention or its antigen-binding fragment, thereby enhancing the antigen-specific T cell response, for example, by reducing an inhibitory signal, otherwise the inhibitory signal weakens the antitumor response. In some embodiments, the antigen-specific T cells are tumor antigen-specific effector T cells, for example, CD8 +The present invention relates to T cells and enhances antitumor activity by, for example, enhancing the blockade of inhibitory effectors mediated by TIGIT. The anti-huTIGIT antibody or its antigen-binding fragment of the present invention can also increase the antitumor activity of NK cells by reducing inhibitory signals in them. Without being bound by a specific theory, the anti-huTIGIT antibody of the present invention enhances the function of effector T cells or NK cells by blocking the binding of TIGIT to PVR, thereby reducing or eliminating inhibitory signals, otherwise the inhibitory signals are delivered to the cells. Alternatively or additionally, the anti-TIGIT antibody or its antigen-binding fragment of the present invention can suppress the interaction between TIGIT and DNAM-1 / CD226, otherwise the interaction reduces the activation of DNAM-1-mediated immunity.

[0040] The present invention comprises administering an effective amount of the anti-huTIGIT antibody of the present invention to a subject in need of treatment for tumors. regs The present invention provides a method for reducing or depleting T in tumors, and the antibody has an effector function or an enhanced effector function, thus providing a method for reducing or depleting T in tumors. regs Reduce the number.

[0041] The present invention provides a method for enhancing the immune response of a subject, comprising administering an effective amount of the anti-huTIGIT antibody of the present invention or its antigen-binding fragment to the subject to enhance the subject's immune response. In some embodiments, the subject has a tumor and an enhanced immune response to the tumor is desired. In other embodiments, the subject has a viral infection and an enhanced antiviral immune response is desired.

[0042] The present invention also provides a method for suppressing tumor growth in a subject, comprising administering the anti-huTIGIT antibody or its antigen-binding fragment to the subject to suppress tumor growth.

[0043] The present invention further provides a method for treating cancer by immunotherapy, which includes, for example, treating cancer by administering a therapeutically effective amount of the anti-huTIGIT antibody of the present invention or its antigen-binding fragment to a subject who requires it, for example, as a pharmaceutical composition. In some embodiments, cancer is bladder cancer, breast cancer, uterine or cervical cancer, ovarian cancer, prostate cancer, testicular cancer, esophageal cancer, gastrointestinal cancer, pancreatic cancer, colorectal cancer, colon cancer, kidney cancer, head and neck cancer, lung cancer, stomach cancer, germ cell tumor, bone tumor, liver cancer, thyroid cancer, skin cancer, central nervous system tumor, lymphoma, leukemia, myeloma, sarcoma, or viral cancer. In some embodiments, cancer is metastatic cancer, refractory cancer, or recurrent cancer.

[0044] In a seventh aspect, the present invention provides a method for treating a TIGIT-related disease, comprising administering an effective amount of an anti-TIGIT antibody or its antigen-binding fragment according to the first aspect, a polynucleotide according to the second aspect, a vector according to the third aspect, cells according to the fourth aspect, or a pharmaceutical composition according to the fifth aspect to a subject in need.

[0045] In an eighth aspect, the present invention provides a pharmaceutical composition for treating TIGIT-related diseases, comprising an anti-TIGIT antibody or its antigen-binding fragment according to the first aspect, a polynucleotide according to the second aspect, a vector according to the third aspect, or cells according to the fourth aspect. The composition is used in combination with one or more other therapeutic agents, or acts as a bispecific reagent together with one or more other therapeutic agents, the therapeutic agents being, for example, anti-PD-1 antibody, anti-PD-L1 antibody, anti-LAG3 antibody, anti-GITR antibody, anti-OX40 antibody, anti-CD73 antibody, anti-CD40 antibody, anti-CD137 mAb, anti-CD27 mAb, anti-CSF-1R antibody and / or anti-CTLA-4 antibody, a TLR agonist, or a small molecule antagonist of IDO or TGFβ. In certain embodiments, anti-huTIGIT therapy is combined with anti-PD-1 and / or anti-PD-L1 therapy (for example, treatment with an antibody that binds to human PD-1 or its antigen-binding fragment, or treatment with an antibody that binds to human PD-L1 or its antigen-binding fragment).

[0046] The present invention also provides a method for detecting the presence of TIGIT in a sample, on cells in a sample (e.g., FACS), or at a specific location within a cell or tissue (e.g., IHC), or a method for sorting cells based on the presence or absence of TIGIT on their surface (e.g., FACS), the method comprising contacting a sample with the anti-huTIGIT antibody of the present invention or its antigen-binding fragment under conditions that enable the formation of a complex between the antibody or its antigen-binding fragment and TIGIT, and detecting the formation of the complex. In some embodiments, the anti-TIGIT antibody for detection is conjugated with a detectable label.

[0047] In this invention, a chromosome transfected mouse (TC-mAb) into which the full-length human antibody gene sequence (including gene regulatory sequences) has been introduced is used. TM A mouse model is used. The target antigen is used to directly obtain fully humanized antibodies by immunizing transgenic mice. Since the obtained antibodies do not require subsequent humanization and affinity modification, costs are reduced and development time is shortened. Furthermore, because the antibodies are fully human antibodies derived from transgenic mice, their immunogenicity is significantly reduced, making them even more useful in drug development. [Brief explanation of the drawing]

[0048] [Figure 1] This graph shows the results of the binding affinity of recombinant huTIGIT protein and anti-TIGIT antibodies induced using the specified TC-mAb™ mice in the present invention to huTIGIT. See Example 3. [Figure 2A] The results of epitope competition between recombinant huTIGIT protein and anti-TIGIT antibodies induced using the specified TC-mAb™ mice of the present invention are shown. See Example 3. [Figure 2B] The results of epitope competition between recombinant huTIGIT protein and anti-TIGIT antibodies induced using the specified TC-mAb™ mice of the present invention are shown. See Example 3. [Figure 3A]This graph shows the results of measuring CHO-TIGIT binding at different concentrations of anti-TIGIT antibodies induced using human TIGIT-expressing CHO cells and the specified TC-mAb™ mice of the present invention. [Figure 3B] This graph shows the results of measuring CHO-TIGIT binding at different concentrations of anti-TIGIT antibodies induced using CHO cells expressing cynomolgus monkey TIGIT (mkTIGIT) and the specified TC-mAb™ mice of the present invention. See Example 4. [Figure 4] This graph shows the results of CHO-TIGIT CD155 blockade measurements at different concentrations of anti-TIGIT antibodies induced using human TIGIT-expressing CHO cells and the specified TC-mAb™ mice of the present invention. See Example 5. [Figure 5A] This graph shows the inhibitory effect of the anti-TIGIT antibody 4A063, induced by a specified TC-mAb™ mouse according to the present invention, on tumor growth in a human TIGIT genetically modified mouse model, when used in combination with an anti-PD1 antibody. [Figure 5B] The average body weight of mice in each group is shown as a function of time. See Example 6. [Figure 6A] This graph shows the adjustment of the proportion of tumor-infiltrating lymphocytes (CD8+ TILs) in the CD3+ T cell population in CT26 tumors treated with the anti-TIGIT antibody 4A063, induced by a specified TC mAb™, in combination with an anti-PD1 antibody. See Example 7. [Figure 6B] This graph shows the adjustment of the proportion of CD8+ T cells in the CD3+ T cell population within the splenocytes of CT26 tumor-bearing human TIGIT recombinant mice treated with the anti-TIGIT antibody 4A063, induced by a specified TC mAb™, in combination with an anti-PD1 antibody. See Example 7. [Modes for carrying out the invention]

[0049] (definition) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. While this specification describes methods and materials used in the present invention, other suitable conventional methods and materials of the art may also be used. Materials, methods, and examples are illustrative and not limiting. All publications, patent applications, patents, sequences, database entries, and other references referenced herein are incorporated herein by reference as a whole. In case of any inconsistency, this specification (including definitions) shall prevail.

[0050] In this disclosure, numerical ranges and parameter approximations are shown as large ranges, but the numerical values ​​shown in specific embodiments are described as accurately as possible. However, any numerical value contains inherent errors, which arise from the standard deviation in the measurement. Furthermore, all ranges disclosed herein are understood to cover any and all subranges thereof. For example, the range "1 to 10" is considered to include any and all subranges between the minimum value of 1 and the maximum value of 10 (including the endpoints), i.e., all subranges starting from the minimum value of 1 or greater (e.g., 1 to 6.1) and subranges ending from the maximum value of 10 or less (e.g., 5.5 to 10).

[0051] Unless explicitly and clearly stated otherwise, the singular form used herein includes the plural form of the subject. Unless otherwise indicated in the context, the terms "or" and "and / or" are interchangeable.

[0052] As used herein, the terms “contains” or “includes” mean that various components may be used together in the mixture or composition of the present invention. Accordingly, the terms “mainly consisting of…” or “consisting of…” are included in the terms “contains” or “includes.”

[0053] As used herein, the terms “identity,” “percentage identity,” “homology,” or “identical” refer to sequence identity between two amino acid sequences or between two nucleic acid sequences. Percentage identity may be determined by aligning the two sequences, or by comparing the number of identical residues (i.e., amino acids or nucleotides) at common positions in the sequences. Sequence sorting and comparison may be performed using standard algorithms in this field (e.g., Smith and Waterman, 1981, Adv.Appl.Math.2:482; Needleman and Wunsch, 10 1970, J.MoI.Biol.48:443; Pearson and Lipman, 1988, Proc.Natl.Acad.Sci.,USA, 85:2444) or computerized versions of these algorithms (Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive, Madison, WI), the computerized versions of which are disclosed and available as BLAST and FASTA. Additionally, ENTREZ, available from the National Institutes of Health (Bethesda, Maryland), can be used for sequence comparison. When using the BLAST or Gapped BLAST program, the default parameters for each program (e.g., BLASTN, available on the National Center for Biotechnology Information website) may be used. In one embodiment, GCG with a gap weight of 1 can be used to determine the percentage identity between two sequences. Any amino acid gap is weighted as if it were a one-amino acid mismatch between the two sequences. Alternatively, the ALIGN program (v2.0), part of the sequence comparison software package by GCG (Axellis, San Diego, California), may be used.

[0054] As used herein, the term “antibody” refers to any antigen-binding molecule that contains at least one (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) (e.g., any of the three CDRs derived from the light chain of an immunoglobulin or any of the three CDRs derived from the heavy chain of an immunoglobulin) and is capable of specifically binding to an epitope. Non-limiting examples of antibodies include monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies, chimeric antibodies, human antibodies, and humanized antibodies. In some embodiments, the antibody may contain the Fc region of a human antibody. The term “antibody” includes, for example, bispecific antibodies, single-chain antibodies, diabodies, linear antibodies, and derivatives such as multispecific antibodies formed from antibody fragments.

[0055] Conventional antibody structural units generally consist of tetramers. Each tetramer is generally composed of two pairs of identical polypeptide chains, each having one "light" chain and one "heavy" chain. Human light chains are classified into κ light chains and λ light chains. Heavy chains are classified into μ, δ, γ, α, and ε, and the antibody isotypes are defined as IgM, IgD, IgG, and IgE, respectively. IgG includes, but is not limited to, IgG1, IgG2, IgG3, and IgG4, and has several subclasses. IgM includes, but is not limited to, IgM1 and IgM2, and has several subclasses. Therefore, as used herein, "isotype" means any subclass of immunoglobulin defined by the chemical and antigenic characteristics of its constant region. Conventional human immunoglobulin isotypes are IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgM1, IgM2, IgD, and IgE. Furthermore, therapeutic antibodies may include isotype and / or subclass hybrids.

[0056] As used herein, “CDR region” or “CDR” refers to the hypervariable regions of the heavy and light chains of immunoglobulins as defined by Kabat et al. (Kabat et al., Sequences of proteins of immunological interest, 5th Ed., USD Department of Health and Human Services, NIH, 1991, and later). There are three heavy chain CDRs and three light chain CDRs. As used herein, the term “CDR or more CDRs” refers to one, more or all of those regions, containing the majority of amino acid residues that are bound by affinity between the antibody and the antigen or its epitope.

[0057] As used herein, the terms “antibody fragment” or “antigen-binding fragment” refer to a full-length antibody and a portion of an antibody analog of an antibody that retains the ability to specifically bind to an antigen (e.g., tigit) and generally includes at least a portion of the antigen-binding region or variable region of a parent antibody. In some embodiments, the antigen-binding fragment contains at least one variable domain (e.g., a variable domain in the heavy chain or a variable domain in the light chain). The antibody fragment retains the binding specificity of at least a portion of the parent antibody. Generally, when activity is observed in moles, the antibody fragment retains at least 10% of the binding activity to the parent. Preferably, the antibody fragment retains at least 20%, 50%, 70%, 80%, 90%, 95%, or 100% of the binding affinity of the parent antibody to the target. Antibody fragments include, but are not limited to, Fab fragments, Fab' fragments, F(ab')2 fragments, Fv fragments, scFv fragments, FD fragments, complementarity-determining region (CDR) fragments, disulfide-stabilized proteins (dsFv), linear antibodies, single-chain antibodies (e.g., scFv single-chain antibodies) (produced using Genmab technology), bivalent single-chain antibodies, phage-presenting single-chain antibodies, single-domain antibodies (e.g., VH domain antibodies), domain antibodies (produced using Ablynx technology), multispecific antibodies formed from antibody fragments (e.g., triple-chain antibodies, quadruple-chain antibodies), genetically modified antibodies (e.g., chimeric antibodies such as humanized mouse antibodies), and heterocomplex antibodies. These antibody fragments can be obtained by the usual techniques of those skilled in the art, and their practicality is screened in the same way as complete antibodies.

[0058] As used herein, the term “single-chain antibody” refers to a single polypeptide containing at least two immunoglobulin variable domains (e.g., variable domains of the heavy or light chains of mammalian immunoglobulins) and capable of specifically binding to an antigen. Non-exclusive examples of single-chain antibodies are described herein.

[0059] In one embodiment, the antibody of the present invention may be a multispecific antibody, particularly a bispecific antibody, sometimes referred to as a "diabody." These are antibodies that bind to two (or more) different antigens or different epitopes of the same antigen. Diabodies may be produced by various conventional methods in the art, for example, by chemical methods or from hybridomas.

[0060] As used herein, the term "chromosome transducer mouse (TC-mAb)" refers to a mouse with transchromosomes. TM "Mouse)" refers to a mouse containing a mouse artificial chromosome, the mouse artificial chromosome containing the gene or locus of the heavy chain of a human antibody and / or the gene or locus of the κ light chain of a human antibody and / or the gene or locus of the λ light chain of a human antibody, and at least two genes or loci of endogenous mice antibodies corresponding to the genes or loci of the human antibody are knocked out. TC-mAb TM Mice and their offspring can stably retain human antibody genes and produce human antibodies.

[0061] The antibodies of the present invention are generally isolated or recombinant. When “isolated” refers to the various polypeptides disclosed herein, it means polypeptides that have been identified, isolated and / or recovered from cells or cell cultures expressing the polypeptide. Generally, isolated polypeptides are obtained via at least one purification step. “Isolated antibody” means an antibody that is substantially free from other antibodies having different antigen specificities.

[0062] The present invention further provides mutant antibodies. That is, various modifications may be made to the antibodies of the present invention, and these modifications include, but are not limited to, amino acid modifications in the CDR (affinity maturation), amino acid modifications in the Fc region, glycosylation mutants, and other types of covalent modifications. For example, as used herein, “mutant” means a polypeptide sequence that differs from the polypeptide sequence of the parent polypeptide by modification of at least one amino acid. Amino acid modifications may include substitutions, insertions, and deletions. Generally, a mutant may have any number of modifications, as long as the function of the protein as described herein is preserved.

[0063] As used herein, the term “epitope” refers to a determinant that interacts with a specific antigen-binding site (called a paratope) in the variable region of an antibody molecule. An epitope is generally a collection of molecules (e.g., amino acids or sugar side chains) that have specific structural features and specific charge properties. An antigen may have one or more epitopes.

[0064] An epitope may include an amino acid residue directly involved in binding (also called the immunodominant component of the epitope) and other amino acid residues not directly involved in binding, such as those effectively blocked by a specific antigen-binding peptide; in other words, the amino acid residues are within the footprint of the specific antigen-binding peptide. An epitope generally consists of at least three, more commonly at least five or eight to ten, amino acids that exhibit a specific conformation. Antibodies that recognize the same epitope can be validated in a simple immunoassay, which demonstrates the antibody's ability to block the binding of another antibody to the target antigen.

[0065] As used herein, the terms “polypeptide,” “peptide,” and “protein” are used interchangeably to refer to amino acid polymers of any length consisting of at least two amino acids.

[0066] As used herein, the terms “polynucleotide,” “nucleic acid molecule,” and “nucleic acid sequence” are interchangeable to refer to nucleotide polymers of any length consisting of at least two nucleotides, and include, but are not limited to, DNA, RNA, DNA / RNA hybrids, and their variants.

[0067] As used herein, the terms “pharmaceutical composition,” “combination drug,” and “drug combination” are interchangeable and mean a combination of at least one drug and optionally a pharmaceutically acceptable carrier or excipient to achieve a particular purpose. In some embodiments, the pharmaceutical composition may include combinations separated in time and / or space, as long as they act together to achieve the purposes of this disclosure.

[0068] As used herein, “therapeutic dose” or “effective dose” refers to a dose sufficient to produce a benefit to the subject being administered. The actual dose, rate, and duration of administration will depend on the condition and severity of the person being treated. The prescription of treatment (e.g., dose determination) is ultimately the responsibility and judgment of the general practitioner and other physicians, and generally takes into account the disease being treated, the individual patient’s condition, the site of delivery, the method of administration, and other factors known to the physician.

[0069] Where used herein, the terms “subject” and “patient” are interchangeable throughout this specification and refer to animals, humans, or non-humans receiving treatment by the methods of the present invention. Veterinary and non-veterinary applications are envisioned in this invention. Human patients may be adults or adolescents (e.g., persons under 18 years of age). In addition to humans, patients include, but are not limited to, mice, rats, hamsters, guinea pigs, rabbits, ferrets, cats, dogs, and primates. For example, non-human primates (e.g., monkeys, chimpanzees, gorillas, etc.), rodents (e.g., rats, mice, gerbils, hamsters, ferrets, rabbits), lagomorphs, pigs (e.g., domesticated wild boars, miniature pigs), horses, dogs, cats, cattle, and other livestock, farm animals, and zoo animals.

[0070] The antibody and chemotherapy preparation of the present invention are administered to subjects by conventional methods, for example, intravenously in the form of a single dose or in continuous infusions over a certain period, or administered via routes such as intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, synovial, intramedullary, oral, topical, or inhalation.

[0071] In this specification, the term "pharmaceutically acceptable" means that a compound is physiologically acceptable when administered to humans and does not cause adverse events, such as gastrointestinal disorders, dizziness, or other adverse events, or systemic adverse events similar to these.

[0072] In this disclosure, “pharmaceutically acceptable carriers” include, but are not limited to, binders (e.g., microcrystalline cellulose, alginates, gelatin, polyvinylpyrrolidone), fillers (e.g., starch, sucrose, glucose, lactic acid anhydride), disintegrants (e.g., cross-linked PVP, sodium starch croglycolate, sodium crocarboxymethylcellulose, low-substituted hydroxypropylcellulose), lubricants (magnesium stearate, aluminum stearate, talc, polyethylene glycol, sodium benzoate), wetting agents (e.g., glycerin), surfactants (e.g., cetyl alcohol), and absorption enhancers, flavoring agents, sweeteners, diluents, coating agents, etc.

[0073] Unless otherwise specified, the terms “TIGIT” or “T-cell immune receptor having Ig and ITIM domains” as used herein refer to any natural TIGIT derived from any vertebrate, which includes mammals (e.g., primates (e.g., humans)) and rodents (e.g., mice, rats). TIGIT is also known in the art as DKFZp667A205, FLJ39873, V-set, protein 9 containing immunoglobulin domain, V-set, protein 3 containing transmembrane domain, VSIGU, VSTM3, and WUCAM. The terms cover “full-length,” raw TIGIT (e.g., full-length human TIGIT having the amino acid sequence of a given sequence number), and any form of TIGIT. The terms also cover naturally occurring TIGIT variants, such as splice variants or allele variants. The term "TIGIT-related disease" refers to the abnormal expression of the TIGIT protein or its ligand CD155 in tumors (e.g., melanoma, breast cancer, non-small cell lung cancer (NSCLC), colorectal adenocarcinoma (COAD), gastric cancer, acute myeloid leukemia (AML), multiple myeloma (MM) (Clin Exp Immunol. 2020 May;200(2):108-119)) or immune-related diseases (e.g., T-cell dysfunction) in subjects (e.g., humans). When an anti-TIGIT antibody blocks the binding of the TIGIT protein to its ligand, the anti-TIGIT antibody can achieve a therapeutic effect on the disease by suppressing the proliferation of tumor cells, alleviating the symptoms of other diseases, or curing the related disease. Such diseases are defined as TIGIT-related diseases.

[0074] "T-cell dysfunction" is a T-cell disorder or condition characterized by reduced responsiveness to antigen stimulation. In some embodiments, a feature of T-cell dysfunction is T-cell depletion. In certain embodiments, T-cell dysfunction is a disorder clearly related to an inadequate reduction in signaling via OX40 and / or OX40L. In other embodiments, T-cell dysfunction is a disorder in which T cells are unresponsive or have reduced ability to perform cytokine secretion, proliferation, or cytolytic functions. In certain embodiments, the reduced responsiveness leads to impaired control against immunogen-expressing pathogens or tumors. Examples of T-cell dysfunction characterized by T-cell dysfunction include unresolved acute infections, chronic infections, and tumor immunity. In some embodiments, the subject is human.

[0075] The terms "cancer" and "tumor" are used interchangeably. They refer to a range of diseases characterized by the uncontrolled proliferation of abnormal cells in the body. Uncontrolled cell division can lead to the formation of malignant tumors or cell infiltration into adjacent tissues, and may metastasize to the distal ends of the body via the lymphatic system or bloodstream. Cancer includes benign and malignant cancers, as well as dormant tumors or micrometastases. Cancer also includes hematological malignancies.

[0076] "Hematological malignancies" include lymphoma, leukemia, myeloma or lymphoid malignancies, and cancers of the spleen and lymph nodes. Exemplary lymphomas include B-cell lymphoma and T-cell lymphoma. B-cell lymphomas include Hodgkin lymphoma and the majority of non-Hodgkin lymphomas. Non-exclusive examples of B-cell lymphomas include diffuse follicular lymphoma, large B-cell lymphoma, mucosa-associated lymphoid tissue lymphoma, small lymphocytic lymphoma (included in chronic lymphocytic leukemia), Burkitt lymphoma, mantle cell lymphoma (MCL), mediastinal large B-cell lymphoma, Waldenström macroglobulinemia, nodal marginal zone B-cell lymphoma, splenic marginal zone lymphoma, primary exudative lymphoma, intravascular large B-cell lymphoma, and lymphomatoid granulomatosis. Non-exclusive examples of T-cell lymphomas include extranodal T-cell lymphoma, cutaneous T-cell lymphoma, anaplastic large cell lymphoma, and angioimmunoblastic T-cell lymphoma. Hematological malignancies also include leukemia, but are not limited to secondary leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and acute lymphocytic leukemia. Hematological malignancies further include myeloma, but are not limited to multiple myeloma and smoldering multiple myeloma. Other hematological cancers and / or B-cell or T-cell related cancers are covered by the term hematological malignancies.

[0077] The term "PVR-positive tumor" refers to a tumor in which the expression of PVR is increased in cancer tissue. PVR-positive tumors include, but are not limited to, adrenocortical carcinoma, chromophobe renal cell carcinoma, papillary renal cell carcinoma, hepatocellular carcinoma, pancreatic ductal adenocarcinoma, pheochromocytoma and paraganglioma, lung adenocarcinoma, head and neck squamous cell carcinoma, prostate cancer, endometrial cancer, cervical cancer, melanoma (skin), mesothelioma, urothelial carcinoma (bladder cancer), colorectal adenocarcinoma, clear cell renal cell carcinoma, lung squamous cell carcinoma, uterine carcinosarcoma, sarcoma, ovarian serous cystadenocarcinoma, papillary thyroid carcinoma, glioblastoma multiforme, breast cancer, low-grade glioma, and diffuse B-cell lymphoma.

[0078] In this specification, the term “immune-related disease” refers to a mammalian immune-related disease caused, mediated, or otherwise arising from components of the mammalian immune system, including diseases whose progression can be improved by stimulating or interfering with the immune response. “Immune-related diseases” include immune-mediated inflammatory diseases, non-immune-mediated inflammatory diseases, infections, immunodeficiency diseases, tumors, and others.

[0079] The anti-TIGIT antibody or its antigen-binding fragment of the present invention may be used to treat an infection or disease in a subject (e.g., a human). In some preferred embodiments, the infection or disease is selected from viral infections, bacterial infections, fungal infections, and parasitic infections, and includes, but is not limited to, HIV, hepatitis viruses, herpesviruses, CMV, EBV, and influenza viruses.

[0080] The following describes several preferred embodiments and aspects of the present invention in connection with specific examples, but these examples should not be considered as limitations on the scope of the invention.

[0081] (Examples) Example 1: Production of anti-TIGIT monoclonal antibody 1. TIGIT recombinant protein for antigen immunization and binding measurement. Based on the cDNA encoding full-length human TIGIT (huTIGIT, SEQ ID NO: 1) from the GenBank sequence (locus: NM_173799), the cDNA was synthesized and purchased from Eurofins. The coding region of the extracellular domain ECD corresponding to amino acids (AA) 1-141 (SEQ ID NO: 2) of full-length human TIGIT was amplified by PCR, and this was cloned into an expression vector to produce expression plasmids for two recombinant fusion proteins, Trx-huTIGIT-HIS and Gst-huTIGIT-HIS. To produce the recombinant fusion proteins, the expression plasmids for the recombinant fusion proteins (Trx-TIGIT-HIS and Gst-TIGIT-HIS) were transferred to competent E. coli cells (E. coli gamiB(DE3)pLysS, Novagen) and cultured. After IPTG induction, the E. coli cells were centrifuged and the precipitate was collected. After crushing the E. coli under sonication, the precipitate was obtained by centrifugation. The precipitate was dissolved by adding a solubilizing reagent, then purified using a Ni-NTA column (Qiagen, Ni-NTA Superflow, #30410), and dialyzed. The effect of the recombinant protein purification was detected by PAGE, and then the recombinant protein was divided into small equal portions and stored at -30°C. ATGCGCTGGTGTCTCCTCCTGATCTGGGCCCAGGGGCTGAGGCAGGCTCCCCTCGCCTCAGGAATGATGACAGGCACAATAGAAACAACGGGGAACATTTCTGCAGAGAAAGGTGGCTCTATCATCTTACAATGTCACCTCTCCTCCACCACGGCACAAGTGACCCAGGTCAACTGGGAGCAGCAGGACCAGCTTCTGGCCATTTGTAATGCTGACTTGGGGTGGCACATCTCCCCATCCTTCAAGGATCGAGTGGCCCCAGGTCCCGGCCTGGGCCTCACCCTCCAGTCGCTGACCGTGAACGATACAGGGGAGTACTTCTGCATCTATCACACCTACCCTGATGGGACGTACACTGGGAGAATCTTCCTGGAGGTCCTAGAAAGCTCAGTGGCTGAGCACGGTGCCAGGTTCCAGATTCCATTGCTTGGAGCCATGGCCGCGACGCTGGTGGTCATCTGCACAGCAGTCATCGTGGTGGTCGCGTTGACTAGAAAGAAGAAAGCCCTCAGAATCCATTCTGTGGAAGGTGACCTCAGGAGAAAATCAGCTGGACAGGAGGAATGGAGCCCCAGTGCTCCCTCACCCCCAGGAAGCTGTGTCCAGGCAGAAGCTGCACCTGCTGGGCTCTGTGGAGAGCAGCGGGGAGAGGACTGTGCCGAGCTGCATGACTACTTCAATGTCCTGAGTTACAGAAGCCTGGGTAACTGCAGCTTCTTCACAGAGACTGGTTAG(SEQ ID NO: 1) MMTGTIETTGNISAEKGGSIILQCHLSSTTAQVTQVNWEQQDQLLAICNADLGWHISPSFKDRVAPGPGLGLTLQSLTVNDTGEYFCIYHTYPDGTYTGRIFLEVLESSVAEHGAR FQIP(SEQ ID NO: 2)

[0082] 2. Construction of stable expression cell line The cDNAs were synthesized based on the GenBank sequences (NM_73799) and (XM_005548101.2) encoding full-length human TIGIT (huTIGIT, SEQ ID NO: 1) and cynomolgus monkey TIGIT (mkTIGIT, SEQ ID NO: 3), respectively. The cDNAs were purchased from Genscript. After PCR amplification, the DNA products were cloned into a pcDNA3.1 expression vector (Invitrogen) and transduced into the CHO-K1 cell line (JCRB, #JCRB9018) to produce CHO-huTIGIT and CHO-mkTIGIT cell lines. Stable cell lines with high HuTIGIT or mkTIGIT expression were selected by culturing in a medium containing G418, eGFP expression, and binding measurement by FACS. ATGCGGTGGTGTCTCTTCCTGATCTGGGCCCAGGGGCTGAGGCAGGCTCCCCTCGCCTCAGGAATGATGACAGGCACAATAGAAACAACGGGGAACATTTCTGCAAAGAAAGGTGGCTCTGTTATCTTACAATGTCACCTCTCCTCCACCATGGCACAAGTGACCCAGGTCAACTGGGAGCAGCATGACCATTCGCTTCTGGCCATTCGTAATGCTGAGTTGGGGTGGCACATCTACCCAGCCTTCAAGGATCGAGTGGCCCCGGGTCCTGGCCTGGGCCTCACCCTCCAGTCGCTGACCATGAATGATACAGGGGAGTACTTCTGCACCTATCACACCTACCCTGATGGGACTTACAGAGGGAGAATCTTCCTGGAGGTCCTAGAAAGCTCAGTGGCTGAGCACAGTGCCAGGTTCCAGATTCCATTGCTTGGAGCCATGGCCATGATGCTGGTGGTCATCTGCATAGCAGTCATCGTGGTGGTCGTGTTGGCTAGAAAGAAGAAATCCCTCAGAATCCATTCTGTGGAAAGTGGCCTCCAGAGAAAATCAACTGGACAGGAAGAACAGATTCCCAGTGCTCCCTCACCCCCAGGAAGCTGTGTCCAGGCAGAAGCTGCACCTGCTGGGCTCTGTGGAGAGCAGCAGGGAGATGACTGTGCCGAGCTGCATGACTACTTCAATGTCCTGAGTTACAGAAGCCTGGGGAGCTGCAGCTTCTTCACAGAGACTGGGTAG (SEQ ID NO: 3)

[0083] 3. Immunization, Hybridoma Fusion and Cloning 6-8 week-old transgenic mice (TC-mAb TMIn preparation for the initial immunization of mice, human TIGIT recombinant protein (Trx-huTIGIT-HIS fusion protein, 100 μg per mouse for the initial immunization, 50 μg per mouse for the boost immunization) was mixed with complete Freund's adjuvant (FCA, purchased from BD, catalog number 263810, 100 μL per mouse for the initial immunization). A boost immunization was also performed using Sigma Adjust System® (SAS, purchased from sigma, catalog number s6322-1vl, 50 μL per mouse for the boost immunization), with intervals of 2-3 weeks. The final immunization did not require an adjuvant, and only Trx-huTIGIT-HIS fusion protein (50 μg per mouse for the final immunization) was needed. All immunizations were performed by intraperitoneal injection.

[0084] Three days after final immunization, mice were euthanized, and the spleen and lymph nodes were removed under sterile conditions. Mouse lymphocytes were also isolated and extracted under sterile conditions. The resulting lymphocyte population was fused with mouse myeloma cells (1:1, P3X63-Ag8.653, ATCC, #CRL-1580) by electrofusion. The fused cells were placed in HAT medium in a 96-well plate and incubated at 37°C with 5% CO2 for 7 days, then replaced with HT medium and incubated for another 5 days.

[0085] 4. Evaluation of anti-TIGIT antibody binding activity by ELISA, immunocytochemistry (ICC), and flow cytometry. Using human TIGIT protein, supernatants containing specific anti-TIGIT antibodies were screened by ELISA. 96-well plates (Nunc, catalog no. 44-2404) were coated with Gst-huTIGIT-HIS fusion protein and Trx-huTIGIT-HIS (50 ng / well), respectively, diluted in PBS buffer, and incubated overnight at 4°C. Next, the wells were blocked at room temperature for 30 minutes using 300 μL of TBS containing skim milk and Tween20. After washing, 100 μL of supernatant and / or serum were added and incubated at room temperature. To detect antibody specificity, anti-human IgG antibody conjugated to horseradish peroxidase (goat anti-human IgG-Fc fragment cross-adsorbed antibody conjugated to HRP, BETHYL, #A80-304P) was diluted to optimal concentration in PBS containing 0.05% Tween20, washed, added at 100 μL / well, and incubated at room temperature for 30 minutes. The plates were washed three times with 300 μL of TBS containing 0.05% Tween20. 100 μL of matrix solution containing 0.5 mg / mL OPD and 0.03% H2O2 was added, and the plates were incubated at room temperature for 30 minutes. Then, 25 μL of 1 M H2SO4 (Nacalai Tesque, #95626-06) was added, and the readings were taken at 492 nm. Positive clones were selected and inoculated into new 96-well plates. After 3 days, the supernatant of the new 96-well plates was screened by ELISA using human TIGIT protein. Hybridoma cell lines conjugated to human TIGIT were grown and cultured for 2–4 days. ELISA-positive clones were detected and selected using ICC and flow cytometry with CHO-huTIGIT and CHO-mkTIGIT cells. After several days of culture, secondary detection was performed according to the method described above. The secondary positive clones were diluted to their limit, and after two weeks, they were tested again by ICC and flow cytometry, and then diluted to their limit again.

[0086] Example 2: Sequence analysis of anti-TIGIT antibody After preliminary screening using ELISA, ICC, and FACS, positive hybridoma clones were subcloned using the limiting dilution method. After further validation, the cloned hybridoma cells were cultured in a 10 cm petri dish. When the cell density reached 80%–90%, the cells were collected and suspended in solution. RNA was extracted from the suspension cells using a microKit (QIAGEN, #74104). The extracted RNA was rapidly amplified at the 5' cDNA end using a kit (Takara, #Z4858N). The sequence analysis (Eurofins) results of the products are shown in Table 1. Based on the above sequences, a TIGIT antibody expression plasmid was constructed and expressed in HEK293 cells. Eight antibodies were purified using Protein A and analyzed by SDS-PAGE, and the purity of the antibodies exceeded 95%. Amino acid sequencing was performed on the obtained 10 antibodies, and the sequences of the heavy chain variable region (VH) and light chain variable region (VL) are shown in Table 1.

[0087] [Table 1] TIFF0007836594000002.tif255170TIFF0007836594000003.tif233170

[0088] The IMGT program was used to predict the CDR of VL and VH. The results are shown in Table 2. [Table 2]

[0089] Furthermore, depending on the CDR prediction program used, there may be slight differences even among CDRs with the same VH or VL, such as changes in amino acid positions. These different CDRs with the same VH or VL are also included within the scope of the present invention.

[0090] Example 3: A predetermined TC-mAb against recombinant human TIGIT protein TM Measurement of affinity of anti-TIGIT antibodies induced by mice The equilibrium dissociation constant (K) of the eight antibodies of the present invention conjugated to human TIGIT was determined by FortebioOctet RED96. D The following was measured: The measurement method was the conventional method (Estep, P et al., High throughput solution Based measurement of antibody-antigen affinity and epitope binning, MAbs, 2013.5(2):p.270-8). A predetermined TC-mAb for TIGIT-HIS (Biointron, BI120) was measured. TM The affinity of the anti-TIGIT antibody of the present invention, induced by mice, was measured. An NTA (HIS-tag) sensor was used. After equilibrating the sensor in analytical buffer, human TIGIT-HIS was loaded onto the NTA sensor (fortebio) and the affinity was measured. The antigen-loaded sensor was placed in an antibody-containing solution (antibody concentrations were 5, 2.5, 0.83, 0.278, 0.09, 0.03, and 0.01 μg / mL, respectively) and allowed to stand until the resting phase. Then, the sensor was transferred to analytical buffer and dissociated for at least 2 minutes in preparation for measuring the dissociation rate. Dynamic analysis was performed using a 1:1 combinatorial model.

[0091] In the tests described above, the predetermined TC-mAb in the present invention TM K of anti-TIGIT antibodies induced by mice D The values ​​are shown in Table 3. [Table 3]

[0092] The epitopes that bind to human TIGIT were studied using the Octet binding test, comparing all human TIGIT antibodies (1B2-8C, 4A042-H3, 4A042-H7, 4B030a, 4B037a, 4B056a, 4A063, 4D035a, 4E061a) with a reference anti-TIGIT antibody tilagolumab (synthesized based on the tilagolumab sequence disclosed in the KEGG-DRUG database). The test procedure was as follows: A sensor loaded with TIGIT-HIS (Biointron, BI120) was allowed to stand in a solution containing the TIGIT antibody until it reached the quiescent phase. The sensor was then transferred to analytical buffer to saturate it, and then transferred to another analyte or buffer containing the reference antibody (tilagolumab). Once the binding reached the quiescent phase, it was eluted. As shown in the epitope group, competition was observed among the three candidate clonal epitopes compared to tiragolumab, meaning they all bound to the same antigenic epitope as TIGIT. The results are shown in Figure 2A.

[0093] Epitope competition is observed among the various antibodies of the present invention. 1B2-8C can block its own binding to tilagolumab, 4A042-H3, 4A042-H7 and 4B030a, and can partially block its binding to 4A063, but does not block its binding to 4B037a, 4B056a, 4A063, 4D035a and 4E061a. Tiragolumab and 4A042-H3 can block their binding to tilagolumab, 1B2-8C, 4A042-H7 and 4B030a, but not to 4B037a and 4B0 4A042-H7 does not block binding to 56a, 4A063, 4D035a, and 4E061a, and can block binding to itself with tiragolumab, 1B2-8C, 4A042-H3, and 4B030a, and can partially block binding to 4B037a and 4A063, but does not block binding to 4B056a, 4D035a, and 4E061a, and can block binding to itself with 4B030a, and can partially block binding to 4B056a and 4A063. It can be partially blocked and does not block binding to 4B037a, 4D035a and 4E061a, 4B037a and 4A063 can block binding to 4B037a, 4B056a, 4A063, 4D035a and 4E061a, and can partially block binding to tiragolumab, 1B2-8C, 4A042-H3, 4A042-H7 and 4B030a, 4B056a can block binding to itself and to 4B037a, 4A063, 4D035a and 4E0 4D035a and 4E061a could block binding to 61a and partially block binding to tiragolumab, 1B2-8C, 4A042-H3, and 4B030a, but did not block binding to 4A042-H7. 4D035a and 4E061a could block binding to 4B037a, 4B056a, 4A063, 4D035a, and 4E061a, but did not block binding to tiragolumab, 1B2-8C, 4A042-H3, 4A042-H7, and 4B030a. The results are shown in Figures 2B and 2C.

[0094] Example 4: A predetermined TC-mAb against TIGIT on the cell surface TM Binding activity of anti-TIGIT monoclonal antibodies induced by mice CHO-huTIGIT cells or CHO-mkTIGIT cells were seeded in a 96-well plate. The antibodies from Example 2 were diluted to different concentrations and added to the 96-well plates covered with cells (100 μL / well), and incubated at 4°C (on ice) for 1 hour.

[0095] Cells were washed with 200 μL / well of washing buffer, then centrifuged at 1600 rpm (approx. 260 × g) at 4°C for 3 minutes, discarded the supernatant, and this process was repeated twice. 30 μL of washing buffer containing anti-human IgG secondary antibody (Jackson ImmunoResearch, #109-585-190, Alexa Fluor® 594 AffiniPure goat anti-human IgG, Fcγ fragment specificity) was added to each well, and the cells were cultured at 4°C (on ice) for 1 hour. After two washes, the cells were transferred to a flat-bottom 96-well plate and analyzed using CytoFLEX S. A base-10 logarithmic scale was used as the x-coordinate, and the median fluorescence intensity of the two channels was used as the y-coordinate for antibody concentration. EC 50 The peak values ​​of the curves for (CHO-huTIGIT and CHO-mkTIGIT) were compared. (μg / mL) The results are shown in Table 4, Figure 3A, and Figure 3B. [Table 4]

[0096] Example 5: TC-mAb of the present invention TM Blocking of TIGIT and CD155 binding by mouse-induced anti-TIGIT monoclonal antibodies. CHO-huTIGIT-eGFP cells were seeded in a V-bottom 96-well plate. The antibody from Example 2 and the reference antibody were diluted to different concentrations, and 100 μL was added per well to a 96-well plate covered with cells (100%). The plates were incubated at 4°C for 1 hour.

[0097] The cells were washed with 200 μL / well of wash buffer, then centrifuged at 1600 rpm (approx. 260 × g) at 4°C for 3 minutes, discarded the supernatant, and this process was repeated twice. 30 μL of wash buffer containing biotinylated human CD155 (human CD155 / PVR / NECL5 protein (Fc tag), biotinylated, Sin Biological, 10109-H02H-B) was added, and the cells were then cultured at 4°C (on ice) for 1 hour. 30 μL of wash buffer containing streptavidin-594 (fc=10 μg / mL) was added to the wells, and the cells were incubated at 4°C for 30 minutes. After one wash, the cells were transferred to a flat-bottom 96-well plate, and the cells were analyzed using CytoFLEX S. The base-10 logarithm of the antibody concentration (μg / mL) was used as the x-coordinate, and the median fluorescence intensity corresponding to each antibody concentration was used as the y-coordinate. IC of the curve 50 We analyzed the data to distinguish the blocking ability of different antibodies against the binding of CD155 to TIGIT.

[0098] Using IgG1 as a negative control antibody, the blocking ability of eight antibodies against CD155 was tested. 50 The results (μg / mL) are shown in Table 5 and Figure 4. [Table 5]

[0099] Example 6: In vivo efficacy of combination therapy with anti-TIGIT antibody and anti-PD-1 antibody To evaluate the in vivo synergistic effect of anti-TIGIT antibody and anti-PD-1 antibody, we used the mouse colorectal cancer cell line CT26.WT (5×10⁶). 5 Cells (individual cells / mouse) were subcutaneously transplanted into TIGIT humanized BALB / c mice. The average tumor volume was 120 ± 50 mm². 3Upon reaching a certain tumor volume, mice were randomly divided into groups based on tumor volume (n=3). They were then administered an IgG-negative control antibody (anti-HEL human IgG1 isotype, biointron, 200 μg per mouse each time), an anti-mPD-1 antibody (in vivo MAb anti-mouse PD-1, approval number: 795720D1, 20 μg per mouse each time), a combination of a positive reference antibody (tiragolumab-hIgG1, 200 μg per mouse each time) and an anti-mPD-1 antibody (20 μg per mouse each time), and a combination of a 4A063 antibody (4A063-hIgG1, 200 μg per mouse each time) and an anti-mPD-1 antibody (20 μg per mouse each time). These were administered once every three days for a total of six times. Tumor volume and body weight were measured twice a week.

[0100] The results are shown in Figure 5. Figure 5 provides the mean tumor volume and mean body weight of mice in each group as a function of time. Compared to the positive reference antibody, 4A063 showed significant suppression of tumor growth (TGI: 44% vs. 92.33%), and there were no significant differences in mean body weight between the groups.

[0101] Example 7: Study on the mechanism of action of in vivo antitumor activity of combination therapy with anti-TIGIT antibody and anti-PD-1 antibody. To study the in vivo mechanism of action of anti-TIGIT antibodies, immunocellular infiltration of tumors was analyzed by flow cytometry after combination therapy with anti-TIGIT antibody 4A063 (hIgG1) and anti-PD-1 antibody. Inoculation and treatment were performed on mice as described in Example 6. Three days after six treatments, the mice were killed and the tumors and spleens were removed. The tumors were lysed with tumor digestion buffer (1 mg / mL type I collagenase and 20 μg / mL DNAase I, sigma), and the spleens were polished to obtain a spleen single-cell suspension. After staining with Fc-block, cells were stained with anti-CD3 (FITC anti-mouse CD3, Biolegend, 100204) and anti-CD8 (PE anti-mouse CD8a, Biolegend, 100708). Furthermore, commercially available buffer (BD Cytofix / Cytoperm) was used. TMAfter fixation and clearing using a fixation / clearing kit (554714), the cells were stained with an anti-IFNγ antibody (PerCP / Cyanine 5.5 anti-mouse IFN-γ, Biolegend, 505822). Following standard washing and filtration, the cells were analyzed by flow cytometry.

[0102] The results are shown in Figure 6. As shown in Figure 6A, compared to the control group, in vivo combination therapy of tumors with the anti-TIGIT antibody 4A063 hIgG1 resulted in CD8 in the tumor microenvironment. + The proportion of TILs increased (P=0.0335), but this was not observed in the PD-1 antibody monotherapy group. Furthermore, the flow cytometry results of T cells in splenic cells (shown in Figure 6B) were consistent with the results in the tumor microenvironment, and CD8 was observed in the combination therapy group. + The proportion of TILs was significantly higher in the TIL population than in the subtype control group (P=0.0025), and also higher in the PD-1 antibody monotherapy group (P=0.0171). This indicates that cytotoxic effector T cells are activated after combination therapy, which explains the difference between the combination therapy group and the PD-1 monotherapy group discussed in Example 5. In the comparison between the combination therapy groups, the CD8 of the 4A063-hIgG1 combination group was higher than that of the anti-TIGIT antibody reference (tiragolumab-hIgG1) combination group. + The increase in TILs was more pronounced. Combination therapy with anti-TIGIT antibody 4A063 hIgG1 and PD-1 antibody also improved T cell function within the tumor, and CD3 + CD8 + T cell production of IFNγ was increased.

[0103] All publications and patents referenced herein are incorporated herein by reference. Various modifications and variations of the methods and compositions described herein will be obvious to those skilled in the art, without departing from the scope and spirit of the invention. While the invention is described in conjunction with certain preferred embodiments, the claimed invention should not be limited to these specific embodiments. In practice, various variations of the forms for carrying out the invention described herein are also intended to be included in the claims, and these variations will be obvious to those skilled in the art.

Claims

1. An anti-TIGIT antibody or its antigen-binding fragment comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises CDRH1, CDRH2, and CDRH3, and the light chain variable region comprises CDRL1, CDRL2, and CDRL3, and further, (a) CDRH1 includes the sequence of sequence number 23, CDRH2 includes the sequence of sequence number 24, and CDRH3 includes the sequence of sequence number 25, and CDRL1 includes the sequence of sequence number 20, CDRL2 includes the sequence of sequence number 21, and CDRL3 includes the sequence of sequence number 22, (b) CDRH1 includes the sequence of sequence number 29, CDRH2 includes the sequence of sequence number 30, and CDRH3 includes the sequence of sequence number 31, and CDRL1 includes the sequence of sequence number 26, CDRL2 includes the sequence of sequence number 27, and CDRL3 includes the sequence of sequence number 28, (c) CDRH1 includes the sequence of sequence number 35, CDRH2 includes the sequence of sequence number 36, and CDRH3 includes the sequence of sequence number 37, and CDRL1 includes the sequence of sequence number 32, CDRL2 includes the sequence of sequence number 33, and CDRL3 includes the sequence of sequence number 34, (d) CDRH1 includes the sequence of sequence number 41, CDRH2 includes the sequence of sequence number 42, and CDRH3 includes the sequence of sequence number 43, and CDRL1 includes the sequence of sequence number 38, CDRL2 includes the sequence of sequence number 39, and CDRL3 includes the sequence of sequence number 40, (e) CDRH1 includes the sequence of sequence number 47, CDRH2 includes the sequence of sequence number 48, and CDRH3 includes the sequence of sequence number 49, and CDRL1 includes the sequence of sequence number 44, CDRL2 includes the sequence of sequence number 45, and CDRL3 includes the sequence of sequence number 46, (f) CDRH1 includes the sequence of sequence number 53, CDRH2 includes the sequence of sequence number 54, and CDRH3 includes the sequence of sequence number 55, and CDRL1 includes the sequence of sequence number 50, CDRL2 includes the sequence of sequence number 51, and CDRL3 includes the sequence of sequence number 52, (g) CDRH1 includes the sequence of sequence number 59, CDRH2 includes the sequence of sequence number 60, and CDRH3 includes the sequence of sequence number 61, and CDRL1 includes the sequence of sequence number 56, CDRL2 includes the sequence of sequence number 57, and CDRL3 includes the sequence of sequence number 58, (h) CDRH1 includes the sequence of sequence number 65, CDRH2 includes the sequence of sequence number 66, and CDRH3 includes the sequence of sequence number 67, and CDRL1 includes the sequence of sequence number 62, CDRL2 includes the sequence of sequence number 63, and CDRL3 includes the sequence of sequence number 64, (i) CDRH1 includes the sequence of sequence number 75, CDRH2 includes the sequence of sequence number 76, and CDRH3 includes the sequence of sequence number 77, and CDRL1 includes the sequence of sequence number 72, CDRL2 includes the sequence of sequence number 73, and CDRL3 includes the sequence of sequence number 74, or (j) An anti-TIGIT antibody or its antigen-binding fragment, wherein CDRH1 comprises the sequence of SEQ ID NO: 81, CDRH2 comprises the sequence of SEQ ID NO: 82, CDRH3 comprises the sequence of SEQ ID NO: 83, CDRL1 comprises the sequence of SEQ ID NO: 78, CDRL2 comprises the sequence of SEQ ID NO: 79, and CDRL3 comprises the sequence of SEQ ID NO:

80.

2. The anti-TIGIT antibody or antigen-binding fragment thereof according to claim 1, wherein the heavy chain variable region includes a sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 69, and SEQ ID NO:

71.

3. The anti-TIGIT antibody or antigen-binding fragment thereof according to claim 1, wherein the light chain variable region includes a sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 68, and SEQ ID NO:

70.

4. (a) The heavy chain variable region includes the sequence of sequence number 5, and the light chain variable region includes the sequence of sequence number 4, (b) The heavy chain variable region includes the sequence of sequence number 7, and the light chain variable region includes the sequence of sequence number 6, (c) The heavy chain variable region includes the sequence of sequence number 9, and the light chain variable region includes the sequence of sequence number 8, (d) The heavy chain variable region includes the sequence of sequence number 11, and the light chain variable region includes the sequence of sequence number 10, (e) The heavy chain variable region includes the sequence of sequence number 13, and the light chain variable region includes the sequence of sequence number 12, (f) The heavy chain variable region includes the sequence of sequence number 15, and the light chain variable region includes the sequence of sequence number 14, (g) The heavy chain variable region includes the sequence of sequence number 17, and the light chain variable region includes the sequence of sequence number 16, (h) The heavy chain variable region includes the sequence of sequence number 19, and the light chain variable region includes the sequence of sequence number 18, (i) The heavy chain variable region includes the sequence of sequence number 69, and the light chain variable region includes the sequence of sequence number 68, or (j) The anti-TIGIT antibody or antigen-binding fragment thereof according to claim 1, wherein the heavy chain variable region includes the sequence of SEQ ID NO: 71 and the light chain variable region includes the sequence of SEQ ID NO:

70.

5. The anti-TIGIT antibody or antigen-binding fragment thereof according to claim 1, further comprising a heavy chain constant region selected from the heavy chain constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, and IgD, and / or further comprising a heavy chain constant region of human IgG.

6. F(ab') ２ The anti-TIGIT antibody or antigen-binding fragment thereof according to claim 1, which is in a form selected from the group consisting of Fab', Fab, Fv, scFv, bispecific antibodies and combinations thereof.

7. An anti-TIGIT antibody or antigen-binding fragment thereof conjugated with a reagent, wherein the reagent is a detectable label or a cytotoxic drug, according to claim 1.

8. A polynucleotide encoding an anti-TIGIT antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7.

9. An expression vector comprising a polynucleotide encoding an anti-TIGIT antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7.

10. A polynucleotide encoding an anti-TIGIT antibody or an antigen-binding fragment thereof, according to any one of claims 1 to 7, or An expression vector comprising a polynucleotide encoding an anti-TIGIT antibody or its antigen-binding fragment according to any one of claims 1 to 7. Manipulated cells, including those containing artificial cells.

11. The anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, A polynucleotide encoding an anti-TIGIT antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7, An expression vector comprising a polynucleotide encoding an anti-TIGIT antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7, Manipulated cells comprising an anti-TIGIT antibody according to any one of claims 1 to 7 or a polynucleotide encoding the antigen-binding fragment thereof, or A manipulated cell comprising an expression vector containing an anti-TIGIT antibody according to any one of claims 1 to 7 or a polynucleotide encoding the antigen-binding fragment thereof, Pharmacologically acceptable carriers and A pharmaceutical composition containing the following:

12. The pharmaceutical composition according to claim 11, further comprising another immune checkpoint inhibitor.

13. The pharmaceutical composition according to claim 12, wherein the other immune checkpoint inhibitor is a PD-1 / PD-L1 inhibitor and / or a CTLA-4 inhibitor.

14. The pharmaceutical composition according to claim 12, wherein the other immune checkpoint inhibitor is an antibody against another immune checkpoint or an antigen-binding fragment thereof.

15. A medicine for treating TIGIT-related diseases, (a) The anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, (b) A polynucleotide encoding an anti-TIGIT antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7, (c) An expression vector comprising a polynucleotide encoding an anti-TIGIT antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7, (d) Modified cells comprising an anti-TIGIT antibody according to any one of claims 1 to 7 or a polynucleotide encoding an antigen-binding fragment thereof, (e) Manipulated cells comprising an expression vector comprising an anti-TIGIT antibody according to any one of claims 1 to 7 or a polynucleotide encoding an antigen-binding fragment thereof, or (f) A pharmaceutical composition comprising an anti-TIGIT antibody or its antigen-binding fragment, polynucleotide, expression vector, or engineered cell as described in any one of (a) to (e), and a pharmaceutically acceptable carrier. Pharmaceuticals, including

16. The pharmaceutical product according to claim 15, wherein the TIGIT-related disease is a T-cell dysfunction disorder.

17. The pharmaceutical product according to claim 15, wherein the TIGIT-related disease is a tumor, an immune disease, or an infectious disease.

18. The pharmaceutical product according to claim 17, wherein the tumor cells are CD155-positive or PVR-positive.

19. The pharmaceutical product according to claim 17, wherein the tumor is selected from the group consisting of melanoma, breast cancer, non-small cell lung cancer, colon adenocarcinoma, gastric cancer, acute myeloid leukemia, and multiple myeloma.

Images