Mutant hydroxyphenylpyruvate dioxygenase polypeptide, its coding gene and its use

A mutant hydroxyphenylpyruvate dioxygenase polypeptide with specific amino acid mutations enhances plant resistance to HPPD-inhibiting herbicides, ensuring reduced damage and increased yield by maintaining enzyme activity and reducing sensitivity.

JP7836895B2Active Publication Date: 2026-03-27BEIJING DABEINONG BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-12-15
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing plants lack sufficient resistance to HPPD-inhibiting herbicides, which interfere with carotenoid biosynthesis and chlorophyll function, leading to plant death, and existing mutant HPPD polypeptides do not exhibit synergistic resistance when combined at specific amino acid positions.

Method used

A mutant hydroxyphenylpyruvate dioxygenase polypeptide with specific amino acid mutations at positions 372 and 383, optionally combined with additional mutations, confers enhanced resistance to HPPD-inhibiting herbicides by maintaining enzyme activity and reducing sensitivity.

Benefits of technology

The mutant polypeptide enables plants to withstand HPPD-inhibiting herbicides, allowing for reduced damage and increased yield, even when exposed to herbicides like topramezone, isoxaflutole, and mesotrione.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007836895000024
    Figure 0007836895000024
  • Figure 0007836895000025
    Figure 0007836895000025
  • Figure 0007836895000026
    Figure 0007836895000026
Patent Text Reader

Abstract

The present invention relates to a mutated hydroxyphenylpyruvate dioxygenase (HPPD) polypeptide, as well as its encoding gene and its use. The mutated HPPD polypeptide retains the activity of catalyzing the conversion of 4-hydroxyphenylpyruvate to homogentisate or homogentisate, and is less sensitive to HPPD-inhibiting herbicides than wild-type HPPD. The amino acid sequence corresponding to the amino acid sequence shown in SEQ ID NO:1 contains amino acid mutations at the following sites: F372 site is replaced by A, G or V, and F383 site is replaced by W. The present invention is the first to disclose that the combined mutations at 372 and 383 sites of HPPD polypeptide from various species sources can confer synergistic resistance to HPPD-inhibiting herbicides to plants, and the prospects for its application in plants are broad.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a mutant hydroxyphenylpyruvate dioxygenase polypeptide, its coding gene, and its use, and particularly to a mutant hydroxyphenylpyruvate dioxygenase polypeptide that is resistant to HPPD-inhibiting herbicides, its coding gene, and its use.

Background Art

[0002] Hydroxyphenylpyruvate dioxygenase (abbreviated as HPPD) is an enzyme that catalyzes the reaction in which 4-hydroxyphenylpyruvic acid (abbreviated as HPP), a tyrosine degradation product, is converted to homogentisate / homogentic acid (abbreviated as HG), a plant precursor of tocopherol and plastoquinone (abbreviated as PQ), in the presence of iron ions (Fe 2+ ) and oxygen. Tocopherol acts as a membrane-associated antioxidant. PQ not only acts as an electron carrier between PSII and the cytochrome b6 / f complex but also acts as an essential cofactor for phytoene desaturase involved in carotenoid biosynthesis.

[0003] The herbicides that act by inhibiting HPPD mainly include three chemical families: triketones, isoxazoles, and pyrazolinates. Inhibiting HPPD blocks the biosynthesis of PQ from tyrosine in plants, so PQ is depleted and carotenoids are lacking. HPPD-inhibiting herbicides are plant-shoot-mobile bleaching agents that cause new growth points and leaves exposed to light to appear white. Carotenoids are essential for light defense. In the absence of carotenoids, the synthesis and function of chlorophyll are interfered with by ultraviolet light and reactive oxygen intermediates, so plant growth is suppressed and eventually leads to death.

[0004] Methods for providing plants resistant to HPPD inhibitory herbicides include the following: 1) Overexpressing the HPPD enzyme so that a sufficient amount of HPPD enzyme is produced in the plant in relation to the HPPD inhibitory herbicide, making the functional enzyme available in sufficient quantities even in the presence of an HPPD enzyme inhibitor. 2) Mutating the target HPPD enzyme into a functional HPPD that is less sensitive to the herbicide or its active metabolite but retains the ability to convert to HG. Several mutant HPPD polypeptides have been reported in the prior art, and these mutant HPPD polypeptides have amino acid mutations at one or more positions relative to their original wild-type sequence and exhibit improved resistance to one or more HPPD inhibitory herbicides. Furthermore, the prior art has further reported that mutant HPPD polypeptides obtained by combining two amino acid mutations exhibit higher resistance to HPPD inhibitory herbicides than HPPD polypeptides having either of the two amino acid mutations alone. However, it has not yet been reported that HPPD polypeptides derived from various species, including combinations of mutations at positions 372 and 383 of the wild-type oat (Avena sativa) HPPD polypeptide, may allow plants to exhibit synergistically improved resistance to HPPD inhibitory herbicides. [Overview of the project]

[0005] The object of the present invention is to provide a novel mutant hydroxyphenylpyruvate dioxygenase polypeptide, its encoding gene, and its use. The mutant hydroxyphenylpyruvate dioxygenase polypeptide not only possesses HPPD enzyme activity, but also enables plants transformed with the gene encoding the mutant hydroxyphenylpyruvate dioxygenase polypeptide to exhibit synergistically improved resistance to HPPD inhibitory herbicides.

[0006] To achieve the above objective, the present invention provides a mutant hydroxyphenylpyruvate dioxygenase polypeptide that retains the activity to catalyze the reaction of converting 4-hydroxyphenylpyruvate to homogentisic acid or homogentisate, and has lower sensitivity to HPPD inhibitory herbicides than wild-type HPPD, comprising amino acid mutations at the following positions in the amino acid sequence described in SEQ ID NO: 1, namely, substitution of F at position 372 with A, G, or V, and substitution of F at position 383 with W.

[0007] Preferably, the mutant hydroxyphenylpyruvate dioxygenase polypeptide includes amino acid mutations at the following positions in the amino acid sequence described in SEQ ID NO: 1, namely, amino acid mutations in which F at position 372 is replaced with A and F at position 383 is replaced with W.

[0008] Based on the technical solution described above, the mutant hydroxyphenylpyruvate dioxygenase polypeptide may contain a second mutation.

[0009] Preferably, the second mutation includes at least one of the following amino acid mutations at a position corresponding to the amino acid sequence position described in Sequence ID No. 1: A106G, A107 deletion, A111T, or K351N.

[0010] In particular, the mutant hydroxyphenylpyruvate dioxygenase polypeptide includes polypeptides having the amino acid sequence described in SEQ ID NO: 173, SEQ ID NO: 182, SEQ ID NO: 185, SEQ ID NO: 188, SEQ ID NO: 191, SEQ ID NO: 194, SEQ ID NO: 197, SEQ ID NO: 200, or SEQ ID NO: 203.

[0011] Furthermore, the mutant hydroxyphenylpyruvate dioxygenase polypeptide is derived from wild-type HPPD in plants or microorganisms.

[0012] Preferably, the plants include monocots and dicots. More preferably, the plants are oats (Avena sativa), wheat (Triticum aestivum), barley (Hordeum vulgare), millet (Setaria italica), corn (Zea mays), sorghum (Sorghum bicolor), Brachypodium distachyo, rice (Oryza sativa), tobacco (Nicotiana tabacum), sunflower (Helianthus annuus), alfalfa (Medicago sativa), soybeans (Glycine max), chickpeas (cicer arietinum), peanuts (Arachis hypogaea), sugar beets (Beta vulgaris), cucumbers (Cucumis sativus), cotton (Gossypium hirsutum), rapeseed (Brassica napus), potatoes (Solanum tuberosum), tomatoes (Solanum It is also known as Arabidopsis thaliana (lycopersicum).

[0013] Preferably, the microorganism is Pseudomonas fluorescens.

[0014] To achieve the above objective, the present invention further provides a polynucleotide encoding a mutant hydroxyphenylpyruvate dioxygenase polypeptide.

[0015] To achieve the above objective, the present invention further provides an expression cassette or recombinant vector comprising the polynucleotide under the control of an effectively linked control sequence.

[0016] To achieve the above objective, the present invention further provides a method for expanding the range of herbicides to which a plant is resistant, comprising expressing a mutant hydroxyphenylpyruvate dioxygenase polypeptide together with at least one herbicide-resistant protein other than the mutant hydroxyphenylpyruvate dioxygenase polypeptide.

[0017] Furthermore, the herbicide-resistant proteins include 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, alpha-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, acetolactic acid synthase, cytochrome-like proteins, and / or protoporphyrinogen oxidase.

[0018] To achieve the above objective, the present invention further provides a method for selecting transformed plant cells, comprising transforming a plurality of plant cells with the polynucleotide and culturing the transformed cells expressing the polynucleotide under a certain concentration of an HPPD inhibitory herbicide that enables the proliferation of the transformed cells, while killing or inhibiting the proliferation of non-transformed cells.

[0019] Preferably, the plants include monocots and dicots. More preferably, the plants are oats, wheat, barley, millet, sorghum, sedge, rice, tobacco, sunflower, alfalfa, soybeans, chickpeas, peanuts, sugar beets, cucumbers, cotton, rapeseed, potatoes, tomatoes, or Arabidopsis thaliana.

[0020] Preferably, the HPPD inhibitory herbicide includes HPPD inhibitory herbicides of the pyrazolinate, triketone, and / or isoxazole classes. More preferably, the pyrazolinate HPPD inhibitory herbicide is topramezone, the isoxazole HPPD inhibitory herbicide is isoxaflutol, and the triketone HPPD inhibitory herbicide is mesotrione. Particularly preferably, a method for selecting transformed soybean plant cells comprises transforming a plurality of soybean plant cells with the polynucleotide and culturing the cells with a certain concentration of an HPPD inhibitory herbicide that enables the proliferation of the transformed cells expressing the polynucleotide and kills or inhibits the proliferation of non-transformed cells, wherein the HPPD inhibitory herbicide is topramezone, mesotrione, or isoxaflutol.

[0021] To achieve the above objective, the present invention further provides a method for controlling weeds, comprising applying an effective amount of an HPPD inhibitor herbicide to a field in which a target plant is planted, wherein the target plant contains the polynucleotide.

[0022] Preferably, the target plants include monocots and dicots. More preferably, the target plants are oats, wheat, barley, millet, sorghum, sedge, rice, tobacco, sunflower, alfalfa, soybeans, chickpeas, peanuts, sugar beets, cucumbers, cotton, rapeseed, potatoes, tomatoes, or Arabidopsis thaliana. Even more preferably, the target plants are glyphosate-resistant plants, and the weeds are glyphosate-resistant weeds.

[0023] Preferably, the HPPD inhibitor herbicide includes HPPD inhibitor herbicides of the pyrazolinate, triketone, and / or isoxazole classes. More preferably, the pyrazolinate HPPD inhibitor herbicide is topramezone, the isoxazole HPPD inhibitor herbicide is isoxaflutol, and the triketone HPPD inhibitor herbicide is mesotrione. Particularly preferably, the weed control method includes applying an effective amount of the HPPD inhibitor herbicide to a field where soybean plants are growing, the soybean plants contain the polynucleotide, and the HPPD inhibitor herbicide is topramezone, mesotrione, or isoxaflutol.

[0024] To achieve the above objectives, the present invention further provides a method for protecting plants from damage caused by HPPD inhibitory herbicides or conferring resistance to HPPD inhibitory herbicides to plants, comprising introducing the polynucleotide or expression cassette or recombinant vector into a plant and causing the plant to produce a sufficient amount of mutant hydroxyphenylpyruvate dioxygenase polypeptide after introduction, thereby protecting the plant from damage caused by HPPD inhibitory herbicides.

[0025] Preferably, the plants include monocots and dicots. More preferably, the plants are oats, wheat, barley, millet, sorghum, sedge, rice, tobacco, sunflower, alfalfa, soybeans, chickpeas, peanuts, sugar beets, cucumbers, cotton, rapeseed, potatoes, tomatoes, or Arabidopsis thaliana.

[0026] Preferably, the HPPD-inhibiting herbicide comprises HPPD-inhibiting herbicides of the classes of pyrazolinates, triketones and / or isoxazoles. More preferably, the HPPD-inhibiting herbicide of pyrazolinates is topramezone, the HPPD-inhibiting herbicide of isoxazoles is isoxaflutole, and the HPPD-inhibiting herbicide of triketones is mesotrione. Particularly preferably, the method for protecting plants from damage caused by HPPD-inhibiting herbicides or conferring resistance to HPPD-inhibiting herbicides to soybean plants comprises introducing a polynucleotide or an expression cassette or a recombinant vector into the soybean plants, and as a result, producing a mutant hydroxyphenylpyruvate dioxygenase polypeptide in an amount sufficient to protect the soybean plants introduced with the polynucleotide or the expression cassette or the recombinant vector from damage by the HPPD-inhibiting herbicide, and the HPPD-inhibiting herbicide is topramezone, mesotrione, or isoxaflutole. To achieve the above object, the present invention further provides a method for producing a plant resistant to an HPPD-inhibiting herbicide, the method comprising introducing the polynucleotide into the genome of the plant.

[0027] Preferably, the method of introduction comprises genetic transformation, genome editing, or a gene mutation method.

[0028] Preferably, the plants include monocotyledonous and dicotyledonous plants. More preferably, the plants are sorghum, wheat, barley, millet, corn, carpetweed, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rape, potato, tomato, or Arabidopsis thaliana.

[0029] Preferably, the HPPD inhibitor herbicide includes HPPD inhibitor herbicides of the pyrazolinate, triketone, and / or isoxazole classes. More preferably, the pyrazolinate HPPD inhibitor herbicide is topramezone, the isoxazole HPPD inhibitor herbicide is isoxaflutol, and the triketone HPPD inhibitor herbicide is mesotrione. Particularly preferably, a method for producing soybean plants resistant to HPPD inhibitor herbicides includes introducing the polynucleotide into the genome of a soybean plant, and the HPPD inhibitor herbicide is topramezone, mesotrione, or isoxaflutol.

[0030] To achieve the above objective, the present invention further provides a method for cultivating plants resistant to HPPD inhibitor herbicides, Planting at least one plant reproductive system containing the aforementioned polynucleotide genome, Growing the aforementioned plant reproductive organism on a plant, Applying an effective amount of HPPD inhibitor herbicide to the plant growing environment containing at least the aforementioned plants, and harvesting the plants with reduced plant damage and / or increased plant yield compared to other plants lacking the polynucleotides. The present invention provides a cultivation method that includes the following:

[0031] Preferably, the plants include monocots and dicots. More preferably, the plants are oats, wheat, barley, millet, sorghum, sedge, rice, tobacco, sunflower, alfalfa, soybeans, chickpeas, peanuts, sugar beets, cucumbers, cotton, rapeseed, potatoes, tomatoes, or Arabidopsis thaliana.

[0032] Preferably, the HPPD inhibitory herbicide includes HPPD inhibitory herbicides of the pyrazolinate, triketone, and / or isoxazole classes. More preferably, the pyrazolinate HPPD inhibitory herbicide is topramezone, the isoxazole HPPD inhibitory herbicide is isoxaflutol, and the triketone HPPD inhibitory herbicide is mesotrione. Particularly preferably, a method for cultivating soybean plants resistant to HPPD inhibitory herbicides comprises planting at least one soybean plant seed containing the polynucleotide in its genome, growing the soybean plant seed into a soybean plant, applying an effective amount of the HPPD inhibitory herbicide to a plant growing environment containing at least the soybean plant, and harvesting the soybean plant with reduced plant damage and / or increased plant yield compared to other soybean plants that do not contain the polynucleotide, wherein the HPPD inhibitory herbicide is topramezone, mesotrione, or isoxaflutol.

[0033] The present invention also provides a method for obtaining processed agricultural products, which includes processing the harvested products of HPPD inhibitor herbicide-resistant plants obtained by the above method to obtain processed agricultural products.

[0034] To achieve the above objective, the present invention further provides a planting system for controlling weed growth, comprising an HPPD inhibitor herbicide and a plant growth environment in which at least one target plant is present, wherein the target plant contains the polynucleotide.

[0035] Preferably, the target plants include monocots and dicots. More preferably, the target plants are oats, wheat, barley, millet, sorghum, sedge, rice, tobacco, sunflower, alfalfa, soybeans, chickpeas, peanuts, sugar beets, cucumbers, cotton, rapeseed, potatoes, tomatoes, or Arabidopsis thaliana. Even more preferably, the target plants are glyphosate-resistant plants, and the weeds are glyphosate-resistant weeds.

[0036] Preferably, the HPPD inhibitory herbicide comprises HPPD inhibitory herbicides of the pyrazolinate, triketone, and / or isoxazole classes. More preferably, the pyrazolinate HPPD inhibitory herbicide is topramezone, the isoxazole HPPD inhibitory herbicide is isoxaflutol, and the triketone HPPD inhibitory herbicide is mesotrione. Particularly preferably, the planting system for controlling weed growth comprises an HPPD inhibitory herbicide and a plant growing environment in which at least one soybean plant is present, the soybean plant containing the polynucleotide, and the HPPD inhibitory herbicide is topramezone, isoxaflutol, or mesotrione. To achieve the above objective, the present invention further provides the use of a mutant hydroxyphenylpyruvate dioxygenase polypeptide to confer resistance to HPPD inhibitory herbicides to plants.

[0037] Preferably, the plants include monocots and dicots. More preferably, the plants are oats, wheat, barley, millet, sorghum, sedge, rice, tobacco, sunflower, alfalfa, soybeans, chickpeas, peanuts, sugar beets, cucumbers, cotton, rapeseed, potatoes, tomatoes, or Arabidopsis thaliana.

[0038] Preferably, the HPPD inhibitory herbicide comprises HPPD inhibitory herbicides of the pyrazolinate, triketone, and / or isoxazole classes. More preferably, the pyrazolinate HPPD inhibitory herbicide is topramezone, the isoxazole HPPD inhibitory herbicide is isoxaflutol, and the triketone HPPD inhibitory herbicide is mesotrione. Particularly preferred is the use of a mutant hydroxyphenylpyruvate dioxygenase polypeptide to confer resistance to HPPD inhibitory herbicides to soybean plants, in which case the HPPD inhibitory herbicide is topramezone, isoxaflutol, or mesotrione.

[0039] As used herein, the articles “a” and “an” refer to one or more than one (i.e., at least one). For example, “an element” means one or more elements (components). Furthermore, the term “comprise,” or variations such as “comprises” or “comprising,” should be understood to include the element, integer, or process, or group of elements, integers, or processes, that is described, but not to exclude any other element, integer, or process, or group of elements, integers, or processes.

[0040] In the context of the present invention, the terms "hydroxyphenylpyruvate dioxygenase (HPPD)," "4-hydroxyphenylpyruvate dioxygenase (4-HPPD)," and "p-hydroxyphenylpyruvate dioxygenase (p-HPPD)" are synonymous.

[0041] The term "HPPD inhibitor herbicide" refers to a herbicide that inhibits HPPD by acting directly or indirectly, and in this case, the herbicide is a bleaching agent. Most commercially available HPPD inhibitor herbicides belong to one of the following three chemical families: (1) Triketones, e.g., sulcotrione (i.e., 2-[2-chloro-4-(methylsulfonyl)benzoyl]-1,3-cyclohexanedione), mesotrione (i.e., 2-[4-(methylsulfonyl)-2-nitrobenzoyl]-1,3-cyclohexanedione), tenbotrione (i.e., 2-[2-chloro-4-(methylsulfonyl)-3-[(2,2,2-trifluoroethoxy)methyl]benzoyl]-1,3-cyclohexanedione); (2) Isoxazoles, e.g., isoxaflutol (i.e., (5 (3) Pyrazolinates, e.g., topramezone (i.e., [3-(4,5-dihydro-3-isoxazolyl)-2-methyl-4-(methylsulfonyl)phenyl](5-hydroxy-1-methyl-pyrazole-4-yl)methane), pyrasulfol (i.e., (5-hydroxy-1,3-dimethylpyrazole-4-yl)(2-methyl--sulfonyl-4-(trifluoromethylphenyl)methane).

[0042] As used herein, topramezon (also known as BAS-670H) refers to the white crystalline solid [3-(4,5-dihydro-3-isoxazolyl)-2-methyl-4-(methylsulfonyl)phenyl](5-hydroxy-1-methylpyrazole-4-yl)methanone. It is a systemic, conductive HPPD inhibitory herbicide of the pyrazolinate type for post-emergence treatment of stems and leaves, in the usual dosage form of a 30% suspension concentrate. Commercial formulations of topramezon (such as topramezon SC) can be used at a dose of 5.6–6.7 g per acre to control grass weeds and broadleaf weeds. Weeds that can be effectively controlled include, but are not limited to, Digitaria sanguinalis (Calathodes oxycarpa), Barnyard grass, Eleusine indica Gaertn, Eriochloa villosa, Setaria viridis (Giant foxtail), Chenopodium album, Polygonaceae, Abutilon avicennae, Abutilon theophrasti, Pigweed, Portulaca oleracea, Xanthium strumarium, and Solanum nigrum. Combining topramezon SC with atrazine can significantly improve effectiveness. Apart from its excellent efficacy against the aforementioned weeds, topramezon can also provide good control against extremely harmful broadleaf weeds, such as Cephalanopoulos segetum Kitam (Cirsium segestum), Sonchus arvensis, Acalypha australis, and Commelina communis (Asiatic dayflower), and can effectively control Setaria viridis, Digitaria sanguinalis, Goosegrass, and Polygonum multiflorum, which are difficult to control with mesotrione.

[0043] As used herein, "effective amount" of toprameson means that it is used in an amount ranging from 25 to 200 g ai / ha, for example, 25 to 50 g ai / ha, 50 to 100 g ai / ha, 100 to 150 g ai / ha, or 150 to 200 g ai / ha.

[0044] As used herein, isoxaflutol refers to 5-cyclopropyl-4-isoxazolyl)[2-(methylsulfonyl)-4-(trifluoromethyl)phenyl]methanone, a white to pale yellow solid. It is a selective, systemic pre-emergence HPPD inhibitory herbicide of the organoheterocyclic isoxazole class, acting primarily by being absorbed and translocated through the roots of young weeds. Isoxaflutol is mainly found in a variety of annual broadleaf weeds, such as fig, goosefoot, kochia, Salsola arbuscula, black nightshade, Amaranthus retroflexus, Polygonum bungeanum, Bidens pilosa, purslane, chickweed, Elsholtzia, cocklebur, hackberry, Amethystea caerulea, Polygonum lapathifolium, and Veronica polifolia. It is useful for controlling polita in fields of arid-land crops, and also has good control efficacy against several annual grass weeds, such as crabgrass, barnyard grass, goosegrass, Leptochloa chinensis, Setaria faberi, and foxtail grass.

[0045] As used herein, "effective amount" of isoxaflutol means that it is used in an amount ranging from 35 to 280 g ai / ha, for example, 35 to 70 g ai / ha, 70 to 140 g ai / ha, 140 to 200 g ai / ha, or 200 to 280 g ai / ha.

[0046] As used herein, “mesotrione” refers to 2-[4-(methylsulfonyl)-2-nitrobenzoyl]-1,3-cyclohexanedione, a brown or pale yellow solid. It is a selective, systemic, conduction-type HPPD inhibitory herbicide of the triketone class that provides weed control both before and after emergence in plants. Mesotrione is absorbed by plants through the leaves and roots, and moves downward from top to bottom, resulting in chlorosis (yellowing) of the growing point followed by necrosis (dead tissue) 3 to 5 days after herbicide application, and ultimately leading to the death of the entire plant. Mesotrione is useful for controlling annual broadleaf weeds and grass weeds in plants before and after emergence. Annual broadleaf weeds that can be controlled mainly include cocklebur, fig, goosefoot, amaranth, Polygonaceae, black nightshade, and giant ragweed (Ambrosia trifida). Grass weeds that can be controlled mainly include young barnyard grass, crabgrass, foxtail grass, and Brachiaria decumbens.

[0047] As used herein, "effective amount" of mesotrione means an amount used in the range of 52.5 to 420 g ai / ha, for example, 52.5 to 105 g ai / ha, 105 to 210 g ai / ha, 210 to 300 g ai / ha, or 300 to 420 g ai / ha.

[0048] As used herein, the term “resistance” is hereditary and enables a plant to grow and reproduce even under conditions where it is subjected to effective treatment with conventional herbicides. As will be recognized by those skilled in the art, a plant can still be considered “resistant” if it suffers some degree of damage (such as minor necrosis, lysis, or chlorosis) after being treated with an herbicide, but at least its yield is not significantly impaired. In other words, a given plant has a heightened ability to resist varying degrees of damage induced by herbicides, and generally, the same dose of herbicide can cause damage to a wild-type plant of the same genotype. The terms “tolerant” or “tolerant” in this invention are broader than the term “resistance” and include “resistance.”

[0049] As used herein, the term “confer” means to provide a plant with a characteristic or trait, such as herbicide resistance and / or other desirable trait.

[0050] As used herein, the term “heterogeneous” means derived from a different source. In the context of DNA, “heterogeneous” refers to any foreign “non-self” DNA, including that derived from another plant of the same species. For example, in this invention, the soybean HPPD gene, which can be expressed in soybean plants by gene transfer, is also considered “heterogeneous” DNA.

[0051] As used herein, the term “nucleic acid” includes deoxyribonucleotide polymers or ribonucleotide polymers in either single-stranded or double-stranded form, and unless otherwise specified, includes known analogues (e.g., peptide nucleic acids) that possess the essential properties of wild-type nucleotides and hybridize to single-stranded nucleic acids in a manner similar to that of wild-type nucleotides.

[0052] As used herein, the terms “encode” or “encoded,” when used in the context of a particular nucleic acid, mean that the nucleic acid contains the information necessary to direct the translation of a nucleotide sequence into a particular protein. The information encoded by a protein is identified by the use of codons. Nucleic acids that encode proteins may or may not contain untranslated sequences (e.g., introns) within the coding region of the nucleic acid (e.g., as in cDNA).

[0053] The proteins of the present invention may be modified in a variety of ways, including amino acid substitution, deletion, cleavage, and insertion. For example, amino acid sequence variants and fragments of mutant HPPD proteins can be prepared by mutations in DNA. Methods for inducing polynucleotide mutations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492, Kunkel et al. (1987) Methods in Enzymol. 154:367-382, U.S. Patent No. 4,873,192, Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York), and the references cited therein. Guidelines for appropriate amino acid substitutions that often do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC). Conservative substitutions, such as replacing one amino acid with another amino acid having similar properties, may be optimal.

[0054] As described herein, mutant HPPD polypeptides or their variants and fragments possess HPPD enzyme activity and confer resistance to a particular class of HPPD inhibitory herbicides to plants. Mutant HPPD polypeptides have amino acid changes at one or more positions relative to their originating wild-type sequence and exhibit enhanced resistance to one or more HPPD inhibitory herbicides. HPPD enzymes exhibiting enhanced resistance to at least one HPPD inhibitory herbicide may exhibit this resistance by exhibiting specific characteristics relative to similar unmutated starting enzymes.

[0055] DNA sequences encoding such mutant HPPD polypeptides are used in providing the plants, plant cells, and seeds of the present invention that exhibit improved resistance to one or more HPPD inhibitory herbicides compared to similar plants that similarly express the unmutated starting enzyme.

[0056] Plant HPPD genes encoding such mutated HPPD polypeptides are useful for generating plants resistant to HPPD inhibitory herbicides. The modified plant HPPD genes described above are particularly suitable for intraplant expression to confer herbicide resistance to plants.

[0057] Many HPPD sequences are known in the art, and mutant HPPD sequences can be generated by using these to cause substitutions, deletions, and / or additions at the corresponding amino acids. The 372nd and 383rd positions of the present invention are calculated using the amino acid positions 372nd and 383rd of the wild-type oat HPPD amino acid sequence described in SEQ ID NO: 1, which serves as a reference. The mutant HPPD polypeptide according to the present invention includes combination mutations at the amino acid positions corresponding to the 372nd and 383rd positions of SEQ ID NO: 1, the combination mutations include a substitution of F by A, G, or V at the 372nd position and a substitution of F by W at the 383rd position. Preferably, the mutations include a substitution of F by A at the 372nd position and a substitution of F by W at the 383rd position. Therefore, known or suspected HPPD sequences can be aligned with the amino acid sequence described in SEQ ID NO: 1 using standard sequence alignment tools, and substitutions or deletions at the corresponding amino acids to the amino acid sequence described in SEQ ID NO: 1 described herein can be caused in known or suspected HPPD sequences.

[0058] The present invention relates to a mutant HPPD polypeptide derived from HPPD in plants or microorganisms, possessing HPPD enzyme activity, comprising a combination mutation at at least positions 372 and 383 of the amino acid sequence described in SEQ ID NO: 1, and optionally further comprising a combination of mutations at other positions (corresponding positions present in the HPPD polypeptide), for example, one or more mutations at the following corresponding positions, i.e., A106G, A107 deletion, A111T, or K351N in the amino acid sequence of oat-derived HPPD, to comprise a mutant HPPD polypeptide comprising the combination mutation. In the various embodiments described above, the combination mutation at positions 372 and 383 may be F372A+F383W, F372G+F383W, or F372V+F383W. Combinational mutations in combinations of mutations at positions 372 and 383 and mutations at other positions include F372A+F383W+A107 deletion, F372A+F383W+A111T, F372A+F383W+A106G, F372A+F383W+A106G+K351N, F372A+F383W+A107 deletion+K351N, or F372A+F383W+A111T+K351N. Furthermore, the present invention includes mutant HPPD polypeptides (by substitution, deletion, and / or addition) derived from HPPDs of various species or various ecotypes of plants or microorganisms within the same species. Exemplary HPPDs derived from various ecotypes within the same species include, but are not limited to, the following:HPPD derived from various ecotypes of alfalfa with acceptance numbers XP_003617391.2, AAX59006.1, XP_003617384.1, XP_013466115.1, AET00342.2, or A0A396HWH5; HPPD derived from various ecotypes of alfalfa with acceptance numbers A0A0D2PWQ6, A0A2P5SI66, A0A0D2LWN1, or A0A0D2 HPPD derived from various ecotypes of cotton, N7F6; acceptance numbers VDC64417.1, CDY10210.1, AFB74208.1, XP_013695640.1, XP_013695641.1, RID40406.1, RID48932.1, XP_009118533.1, XP_009119049.1, XP_013723237.1, AFB HPPDs from various ecotypes of rapeseed with acceptance numbers 74218.1 or AFB74207.1; HPPDs from various ecotypes of soybeans with acceptance numbers A5Z1N7, I1M6Z4, A0A088MGH9, or I1M6Z5; HPPDs from various ecotypes of tobacco with acceptance numbers XP_009770088.1 or XP_009587203.1; HPPDs from various ecotypes of rice with acceptance numbers A3A3J1, B8AIH6, or A0A0E0G1W2; and HPPDs from various ecotypes of barley with acceptance numbers BAJ86732.1, BAJ95714.1, or F2E412 (these acceptance numbers are available in the Genbank database or the UniProt Knowledgebase database).

[0059] The terms "position 372," "372nd," or "372nd single position" refer not only, in a narrow sense, to the amino acid (phenylalanine) at position 372 of the amino acid sequence described in SEQ ID NO: 1, but also, in a broader sense, to the position corresponding to the amino acid at position 372 of the amino acid sequence described in SEQ ID NO: 1, obtained in known or suspected HPPD amino acid sequences that can be aligned with the amino acid sequence described in SEQ ID NO: 1 using standard sequence alignment tools (such as CLUSTAL software), and which may not be the 372nd position of the amino acid sequence of that HPPD.

[0060] The terms "position 383," "383rd," or "383 single position" refer not only, in a narrow sense, to the amino acid (phenylalanine) at position 383 of the amino acid sequence described in SEQ ID NO: 1, but also, in a broader sense, to the position corresponding to the amino acid at position 383 of the amino acid sequence described in SEQ ID NO: 1, obtained in known or suspected HPPD amino acid sequences that can be aligned with the amino acid sequence described in SEQ ID NO: 1 using standard sequence alignment tools (such as CLUSTAL software), and which may not be the 383rd position of the amino acid sequence of that HPPD.

[0061] The terms "position 415," "position 415," or "single position 415" refer not only, in a narrow sense, to the amino acid (phenylalanine) at position 415 of the amino acid sequence described in SEQ ID NO: 1, but also, in a broader sense, to the position corresponding to the amino acid at position 415 of the amino acid sequence described in SEQ ID NO: 1, obtained in known or suspected HPPD amino acid sequences that can be aligned with the amino acid sequence described in SEQ ID NO: 1 using standard sequence alignment tools (such as CLUSTAL software), and which may not be the 415th position of the amino acid sequence of that HPPD.

[0062] Similarly, the above interpretation regarding "372nd place" or "372nd position" also applies to other positions.

[0063] "Corresponding" refers to the position corresponding to an amino acid at a specific position in the amino acid sequence described in Sequence ID No. 1, obtained by aligning the amino acid sequence described in Sequence ID No. 1 with HPPD amino acid sequences derived from various species or various ecotypes within the same species using a standard sequence alignment tool. For example, it refers to the position corresponding to the amino acid at position 372 or 383 in the amino acid sequence described in Sequence ID No. 1.

[0064] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein and refer to polymers of amino acid residues. This term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of their corresponding wild-type amino acids, as well as wild-type amino acid polymers. Polypeptides of the present invention can be prepared from nucleic acids disclosed herein or by standard molecular biological techniques. For example, cleaved proteins of the present invention can be prepared by expression of recombinant nucleic acids of the present invention in a suitable host cell, or by a combination of ex vivo procedures, such as protease digestion and purification.

[0065] Accordingly, the present invention also provides nucleic acid molecules comprising a polynucleotide sequence encoding a mutant HPPD polypeptide having the enzymatic activity of HPPD, which confers resistance in plants to a particular class of herbicides that inhibit HPPD, as well as variants and fragments thereof. Generally, the present invention comprises any polynucleotide sequence encoding any of the mutant HPPD polypeptides described herein, and any polynucleotide sequence encoding an HPPD polypeptide having one or more conserved amino acid substitutions for the mutant HPPD polypeptides described herein. Conserved substitutions that provide functionally similar amino acids are well known in the art. The following five groups each comprise amino acids that are conserved substitutions of each other. Aliphatic: Glycine (G), Alanine (A), Valine (V), Leucine (L), Isoleucine (I); Aromatic: Phenylalanine (F), Tyrosine (Y), Tryptophan (W); Sulfur-containing: Methionine (M), Cysteine ​​(C); Basic: Arginine (I), Lysine (K), Histidine (H); Acidic: Aspartic acid (D), Glutamic acid (E), Asparagine (N), Glutamine (Q).

[0066] In one embodiment, the present invention provides a polynucleotide sequence encoding an amino acid sequence derived from HPPD in a plant or microorganism, wherein the polypeptide has HPPD enzyme activity and includes combinational mutations at positions corresponding to at least the amino acids at positions 372 and 383 of SEQ ID NO: 1.

[0067] Therefore, sequences that hybridize to the gene encoding the mutant HPPD polypeptide of the present invention and have resistance activity to HPPD inhibitory herbicides are included in the present invention. Exemplary sequences are SEQ ID NOs: 11-12, 33-34, 45-46, 57-58, 69-70, 81-82, 93-94, 105-106, 117-118, 129-130, 141-142, 153-154, 159-160, 165-166, 174-1 75, containing at least approximately 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with sequence numbers 183-184, 186-187, 189-190, 192-193, 195-196, 198-199, 201-202, and 204-205.

[0068] The presence of the mutant HPPD gene of the present invention can be identified using any conventional nucleic acid hybridization or nucleic acid amplification method. A nucleic acid molecule or fragment thereof can specifically hybridize with another nucleic acid molecule under certain circumstances. In the present invention, if two nucleic acid molecules can form an antiparallel double-stranded nucleic acid structure, these two nucleic acid molecules can be considered to be able to specifically hybridize with each other. If two nucleic acid molecules exhibit complete complementarity, one of the nucleic acid molecules is said to be the "complement" of the other nucleic acid molecule. In the present invention, if each nucleotide of a nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, these two nucleic acid molecules are said to exhibit "complete complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability to anneal and bind to each other, at least under conventional "low stringency" conditions, these two nucleic acid molecules are said to be "minimally complementary". Similarly, two nucleic acid molecules are said to be "complementary" if they can hybridize with sufficient stability to anneal and bind to each other under conventional "high stringency" conditions. Deviations from perfect complementarity are acceptable as long as this deviation does not completely prevent the two molecules from forming a double-stranded structure. To enable nucleic acid molecules to function as primers or probes, it is simply necessary to ensure that the molecules have sufficient complementarity in their sequence so that a stable double-stranded structure is formed under specific solvent and salt concentration conditions.

[0069] In this invention, substantially homologous sequences are nucleic acid molecules that can specifically hybridize to the complementary strand of a compatible nucleic acid molecule under high stringency conditions. Suitable stringent conditions for promoting DNA hybridization are well known to those skilled in the art. For example, suitable stringent conditions can be achieved by treating with 6.0 × sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by washing with 2.0 × SSC at 50°C. For example, the salt concentration in the washing step can be selected from low stringency conditions of approximately 2.0 × SSC at 50°C to high stringency conditions of approximately 0.2 × SSC at 50°C. The temperature conditions in the washing step can also be increased from low stringency conditions of room temperature (approximately 22°C) to high stringency conditions of approximately 65°C. Both the temperature conditions and the salt concentration can be changed, and it is also possible to change one of them while keeping the other unchanged. Preferably, stringent conditions in the present invention can be achieved by specifically hybridizing the mutant HPPD gene of the present invention in a 6×SSC, 0.5% SDS solution at 65°C, and then washing the membrane once each with 2×SSC, 0.1% SDS, and then with 1×SSC, 0.1% SDS.

[0070] As used herein, the terms “hybridize” or “specifically hybridize” refer to the binding, doubling, or hybridization of a molecule to only a specific nucleotide sequence within the DNA or RNA of a complex mixture (e.g., a whole cell) under stringent conditions.

[0071] Due to the degeneracy of genetic codons, a diverse range of different DNA sequences may encode the same amino acid sequence. Constructing these alternative DNA sequences that encode the same or substantially the same protein is within the scope of the art. These different DNA sequences are included within the scope of the present invention. “Substantially the same” sequence means a sequence with amino acid substitutions, deletions, additions, or insertions that do not substantially affect herbicide resistance activity, and includes fragments that retain herbicide resistance activity.

[0072] In the present invention, the terms “functional activity” or “activity” mean that the protein / enzyme used in the present invention (either alone or in combination with other proteins) has the ability to degrade herbicides or reduce herbicidal activity. Plants producing the proteins of the present invention preferably produce an “effective amount” of the protein (in general amounts unless otherwise specified) such that, when the plant is treated with the herbicide, the expression level of the protein is sufficient to confer complete or partial resistance to the herbicide to the plant. The herbicide can be used in amounts that would normally kill the target plant, or in amounts and concentrations typical of a field. Preferably, the plant cells and plants of the present invention are protected from growth inhibition or damage resulting from treatment with the herbicide. Transformed plants and plant cells of the present invention are preferably resistant to HPPD inhibitory herbicides, i.e., transformed plants and plant cells can grow in the presence of an effective amount of HPPD inhibitory herbicide.

[0073] The genes and proteins in the present invention include not only specific exemplary sequences, but also moieties and / or fragments (including internal and / or terminal deletions compared to the full-length protein) that retain HPPD inhibitory herbicide resistance activity characteristic of the specific exemplary protein, variants, mutants, variant proteins, substitutions (proteins having substituted amino acids), chimerics, and fusion proteins.

[0074] In the present invention, the term “variant” is intended to mean a substantially identical sequence. In the case of polynucleotides, a variant includes the deletion and / or addition of one or more nucleotides at one or more internal sites in a reference polynucleotide, and / or the substitution of one or more nucleotides at one or more sites in a mutant HPPD polynucleotide. As used herein, the term “reference polynucleotide or polypeptide” includes, respectively, a mutant HPPD nucleotide sequence or an amino acid sequence. As used herein, the term “wild-type polynucleotide or polypeptide” includes, respectively, a wild-type nucleotide sequence or an amino acid sequence. In the case of polynucleotides, a conserved variant includes the above-mentioned sequences that, by degeneracy of the genetic code, encode one amino acid sequence of the mutant HPPD polypeptide of the present invention. Wild-type allele variants as described above can be identified using well-known molecular biological techniques, for example, by polymerase chain reaction (PCR) and hybridization techniques outlined below. Variant polynucleotides also include synthetically derived polynucleotides, such as those produced by site-directed mutagenesis but still encoding the mutant HPPD protein of the present invention. Generally, a particular polynucleotide variant of the present invention has at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with that particular polynucleotide as determined by the sequence alignment program and parameters.

[0075] In the present invention, “variant protein” is intended to mean a protein derived from a reference protein by the deletion or addition of one or more amino acids at one or more internal sites of the mutant HPPD protein, and / or the substitution of one or more amino acids at one or more sites of the mutant HPPD protein. The variant proteins incorporated in the present invention are biologically active, i.e., they continue to have the desired biological activity of the mutant HPPD protein, i.e., HPPD enzyme activity and / or herbicide resistance as described herein. Such variants may be generated, for example, by genetic polymorphism or artificial manipulation. The biologically active variants of the mutant HPPD protein of the present invention have at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the entire amino acid sequence of the mutant HPPD protein as determined by the sequence alignment program and parameters. A biologically active variant of the protein of the present invention may differ from the protein of the present invention by only 1 to 15 amino acid residues, only 1 to 10 amino acid residues, for example, 6 to 10, only 5, only 4, 3, 2, or just 1 amino acid residue.

[0076] Methods for aligning sequences are well-known in the art and can be achieved using mathematical algorithms such as the algorithm in Myers and Miller (1988) CABIOS 4:11-17, the local alignment algorithm in Smith et al. (1981) Adv.Appl.Math.2:482, the global alignment algorithm in Needleman and Wunsch (1970) J.Mol.Biol.48:443-453, and the algorithm in Karlin and Altschul (1990) Proc.Natl.Acad.Sci.USA 872264, which was modified in Karlin and Altschul (1993) Proc.Natl.Acad.Sci.USA 90:5873-5877. Computer implementations of these mathematical algorithms can be used to compare sequences and determine sequence identity. Examples of such implementations include, but are not limited to, the PC / Gene program CLUSTAL (Intelligentics, available from Mountain View, California); the GCG Wisconsin Genetics Software Package, version 10 of the ALIGN program (version 2.0); and GAP, BESTFIT, BLAST, FASTA, and TFASTA (Accelliss, available from 9685 Scranton Road, San Diego, California, USA).

[0077] In some examples, amino acids encoding a mutant HPPD polypeptide or a variant thereof that retains HPPD enzyme activity can be stacked with any combination of polynucleotide sequences of interest to produce plants with desired traits. The term "trait" refers to a phenotype derived from a particular sequence or set of sequences. For example, an amino acid / polynucleotide encoding a mutant HPPD polypeptide or a variant thereof that retains HPPD enzyme activity may be stacked with any other polynucleotide encoding a polypeptide that confers a desired trait, such as, but not limited to, resistance to diseases, insects, and herbicides; tolerance to heat and drought; reduced time to maturity; improved industrial processing, such as converting starch or biomass into fermentable sugars; and improved agricultural quality, such as higher oil and protein content.

[0078] Those skilled in the art know that the advantages of combining two or more mechanisms of action in improving the spectrum of controlled weeds and / or controlling wild-type, more resistant or resistant weed species can be extended beyond HPPD-resistant crops to chemicals in which crops have been made herbicide-resistant by artificial means (either genetically or non-genetically). In fact, traits encoding the following resistance factors can be combined, individually or in combination, to provide the ability to effectively control or prevent weed changes in response to herbicides. The resistance factors mentioned above include glyphosate resistance factors (such as EPSPS, GOX, and GAT derived from resistant plants or bacteria), glufosinate resistance factors (such as PAT and Bar), herbicide resistance factors to acetolactate synthase (ALS) inhibitors (such as resistance genes for chemicals like imidazolinone, sulfonylurea, triazolepyrimidine, sulfonated aniline, and pyrimidinylthiobenzoic acid, e.g., AHAS, Csrl, and SurA), phenoxyauxin herbicide resistance factors (such as aryloxyalkanoate dioxygenase-12 (AAD-12)), dicamba herbicide resistance factors (such as dicamba monooxygenase (DMO)), bromoxynil resistance factors (such as bxn), and phytoene desaturates. These include desaturase (PDS) inhibitor resistance factors, herbicide resistance factors to photosystem II inhibitors (such as psbA), herbicide resistance factors to photosystem I inhibitors, herbicide resistance factors to protoporphyrinogen oxidase (PPO) inhibitors (such as PPO-1), phenylurea herbicide resistance factors (such as CYP76B1), and dichloromethoxybenzoate degrading enzymes.

[0079] Glyphosate is widely used because it controls a very broad spectrum of broadleaf and grass weed species. However, repeated use of glyphosate in glyphosate-resistant crops and non-crop crops has led (and continues to lead) weeds to select for more resistant species in their wild form or for glyphosate-resistant biotypes. Most herbicide resistance management programs propose the effective use of multiple herbicide analogues mixed in tanks as a means of delaying the emergence of resistant weeds; herbicide analogues are those that control the same species but have different mechanisms of action. By superimposing the gene encoding the mutant HPPD polypeptide of the present invention with a glyphosate resistance trait (and / or other herbicide resistance trait), it is possible to control glyphosate-resistant weed species (broadleaf weed species controlled by one or more HPPD inhibitors) in glyphosate-resistant crops by enabling the selective use of glyphosate herbicides and HPPD inhibitors (such as topramezone, mesotrione, or isoxaflutol) in the same crop. These herbicides can be applied simultaneously in a tank mixture containing two or more herbicides with different mechanisms of action, or in a single herbicide composition in sequential applications (e.g., before planting, or before or after emergence) (with application intervals ranging from 2 hours to 3 months). Alternatively, these herbicides can be applied by combining any number of herbicides representing each applicable compound category at any time (from 7 months after planting the crop to the time of harvest (or, for a single herbicide, at the shortest interval before harvest)).

[0080] In controlling broadleaf weeds, flexibility is crucial in terms of application timing, single herbicide application rates, and the ability to control stubborn or resistant weeds. The application range for glyphosate in crops superimposed with glyphosate resistance genes / mutant HPPD genes may be 250–2500 g ae / ha. The application range for one or more HPPD inhibitor herbicides may be 25–500 g ai / ha. The optimal combination of application timings depends on specific conditions, species, and environment.

[0081] Herbicide formulations (e.g., ester, acid, or salt formulations, or soluble concentrates, emulsifying concentrates, or soluble liquids) and tank mixing additives (e.g., adjuvants or compatibilizers) can significantly affect weed control by a given herbicide, or by a combination of one or more herbicides. Any chemical combination of any of the aforementioned herbicides falls within the scope of this invention.

[0082] Furthermore, the gene encoding the mutant HPPD polypeptide of the present invention, either alone or in combination with other characteristics of herbicide-resistant crops, can be combined with one or more other input traits (e.g., insect resistance, fungal resistance, or stress tolerance) or output traits (e.g., increased yield, improved oil content, improved fiber quality). Thus, the present invention can provide a complete agricultural solution that improves crop quality with the ability to flexibly and economically control any number of agricultural pests.

[0083] The stacked combinations described above can be created by any method, including, but not limited to, hybrid plants using any conventional or top-cross method, or genetic transformation. When stacking sequences by genetically transforming plants, the target polynucleotide sequences can be combined in any order at any time. For example, a genetically modified plant containing one or more desired traits can be used as a target to introduce further traits through subsequent transformation. These traits can be introduced simultaneously in a co-transformation protocol along with the target polynucleotides provided by any combination of transformation cassettes. For example, when two sequences are introduced, they can be included in separate transformation cassettes (trans) or in the same transformation cassette (cis). The expression of these sequences can be promoted by the same or different promoters. In some cases, it may be desirable to introduce a transformation cassette that suppresses the expression of the target polynucleotide. This may be combined with any combination of other suppression cassettes or overexpression cassettes to produce the desired combination of traits in the plant. Furthermore, it is recognized that site-directed recombination systems can be used to stack polynucleotide sequences at desired genomic locations.

[0084] The gene encoding the mutant HPPD polypeptide according to the present invention exhibits higher resistance to HPPD inhibitory herbicides, which is an important basis for the potential of herbicide-resistant crops and selective marker traits.

[0085] As used herein, the term “expression cassette” means a nucleic acid molecule capable of directing the expression of a specific nucleotide sequence in a suitable host cell, comprising a promoter effectively ligated to the nucleotide sequence of interest (i.e., a polynucleotide encoding a mutant HPPD polypeptide or a variant thereof that retains HPPD enzyme activity, either alone or in combination with one or more additional nucleic acid molecules encoding a polypeptide that confers a desired trait), the nucleotide sequence of interest being effectively ligated to a termination signal. The coding region typically encodes for the protein of interest, but may also encode for the functional RNA of interest, such as antisense RNA or uncoding RNA, in sense or antisense directions. An expression cassette containing the nucleotide sequence of interest may be a chimeric, meaning that at least one of its components is heterologous to at least one of the other components. An expression cassette may also be wild-type, but is obtained in a recombinant form useful for heterologous expression. However, typically, an expression cassette is heterologous to the host, meaning that the specific DNA sequence of the expression cassette must not arise in the wild type in the host cell, but must be introduced into a new host cell by a transformation event. The expression of nucleotide sequences in an expression cassette may be under the control of a constitutive promoter or an inductive promoter that initiates transcription only when the host cell is exposed to certain specific external stimuli. Furthermore, promoters may also be specific to particular tissues or organs or developmental stages.

[0086] The present invention encompasses plant transformation using an expression cassette capable of expressing a polynucleotide of interest (i.e., a polynucleotide encoding a mutant HPPD polypeptide or a variant thereof that retains HPPD enzyme activity, either alone or in combination with one or more additional nucleic acid molecules encoding a polypeptide that confers a desired trait). The expression cassette includes a transcription and translation initiation region (i.e., promoter) and a polynucleotide open reading frame in the 5′-3′ direction of transcription. The expression cassette may optionally include a transcription and translation termination region (i.e., termination region) that functions in the plant. In some embodiments, the expression cassette includes a selectivity marker gene that enables the selection of stable transformants. The expression construct of the present invention may also include a leader sequence and / or a sequence that enables the inducible expression of the polynucleotide of interest.

[0087] The regulatory sequences of the expression construct are effectively ligated to the polynucleotide of interest. The regulatory sequences in this invention include, but are not limited to, promoters, transport peptides, terminators, enhancers, leader sequences, and introns that are ligated to the herbicide resistance gene encoding the mutant HPPD polypeptide.

[0088] The promoter is a plant-expression promoter. A "plant-expression promoter" refers to a promoter that ensures the expression of the coding sequence linked to it in plant cells. A plant-expression promoter can be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, the 35S promoter derived from cauliflower mosaic virus, the maize Ubi promoter, and the rice GOS2 gene promoter. Alternatively, a plant-expression promoter can be a tissue-specific promoter, which is a promoter that directs the expression of a coding sequence at a higher level (measurable by conventional RNA testing) in certain tissues, such as green tissue, than in other plant tissues, for example, the PEP carboxylase promoter. Alternatively, a plant-expression promoter can be a wound-inducible promoter. A wound-inducible promoter, or a promoter that directs a wound-inducible expression pattern, means that when a plant suffers a wound caused by mechanical factors or insect nibbling, the expression of the coding sequence regulated by the promoter is significantly improved compared to normal growing conditions. Examples of wound-inducing promoters include, but are not limited to, the promoters of potato and tomato protease inhibitor genes (pin I and pin II), and the maize protease inhibitor gene (MPI).

[0089] Transport peptides (also known as secretory signaling sequences or targeting sequences) guide gene transproducts to specific organelles or cellular compartments. In the case of receptor proteins, the transport peptides may be heterologous; for example, some target chloroplasts using sequences encoding chloroplast transport peptides, others target the endoplasmic reticulum using "KDEL" retention sequences, and still others target vacuoles using CTPP from the barley plant agglutinin gene.

[0090] Examples of leader sequences include, but are not limited to, small RNA virus leader sequences such as the EMCV leader sequence (the 5′ non-coding region of encephalomyocarditis virus), potato virus group Y leader sequences such as the MDMV (Maize Dwarf Mosaic Virus) leader sequence, human immunoglobulin heavy chain binding protein (BiP), the untranslated leader sequence of the coat protein mRNA of alfalfa mosaic virus (AMV RNA4), and the tobacco mosaic virus (TMV) leader sequence.

[0091] Enhancers include those for Cauliflower Mosaic Virus (CaMV), Figwort Mosaic Virus (FMV), Carnation Etched Ring Virus (CERV), Cassava Vein Mosaic Virus (CsVMV), Mirabilis Mosaic Virus (MMV), Cestrum Yellow Leaf Curling Virus (CmYLCV), Cotton Leaf Curl Multan Virus (CLCuMV), Commelina Yellow Mottle Virus (CoYMV), and Peanut Chlorotic Karimovirus. Streak Caulimovirus (PCLSV) enhancers exist, but are not limited to these.

[0092] When used in monocots, introns include, but are not limited to, the maize hsp70 intron, maize ubiquitin intron, Adh intron 1, sucrose synthase intron, or rice Act1 intron. When used in dicots, introns include, but are not limited to, the CAT-1 intron, pKANNIBAL intron, PIV2 intron, and "superubiquitin" intron.

[0093] A terminator can be any appropriate polyadenylation signal sequence that functions in plants, and is not limited to, but includes, the polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthetase (NOS) gene, the polyadenylation signal sequence derived from the protease inhibitor II (pinII) gene, the polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and the polyadenylation signal sequence derived from the α-tubulin gene.

[0094] In this invention, “effectively ligating” refers to the binding of nucleic acid sequences in such a way that one nucleic acid sequence provides the necessary function to the sequence it is ligated to. In this invention, “effectively ligating” allows a promoter to be ligated to a sequence of interest, and as a result, the transcription of the sequence of interest is controlled and regulated by the promoter. If the sequence of interest codes for a protein and the expression of that protein is desired, “effectively ligating” means that the promoter is ligated to the sequence in such a manner that the resulting transcript is effectively translated. If the ligation of the promoter to the coding sequence is a transcript fusion and the expression of the encoded protein is achieved, such ligation is made such that the first translation start codon of the resulting transcript is the start codon of the coding sequence. Alternatively, if the ligation of the promoter to the coding sequence is a translation fusion and the expression of the encoded protein is achieved, such ligation is made such that the first translation start codon contained in the 5′ untranslated sequence is ligated to the promoter in such a manner that the relationship between the resulting translation product and the translation open reading frame encoding the desired protein is in-frame. Nucleic acid sequences that can be "effectively linked" include, but are not limited to, sequences that provide gene expression function (i.e., gene expression elements such as promoters, 5′ untranslated regions, introns, protein-coding regions, 3′ untranslated regions, polyadenylation sites and / or transcription terminators), sequences that provide DNA transfer and / or integration function (i.e., T-DNA boundary sequences, site-specific recombinase recognition sites and integrase recognition sites), sequences that provide selective function (i.e., antibiotic resistance markers and biosynthetic genes), sequences that provide marker scoring function, sequences that assist in sequence manipulation in vitro or in vivo (i.e., polylinker sequences and site-specific recombination sequences), and sequences that provide replication function (i.e., bacterial origins of replication, self-replicating sequences and centromere sequences).

[0095] In this invention, the genome of a plant, plant tissue, or plant cell refers to any genetic material within a plant, plant tissue, or plant cell, and includes the genomes of the cell nucleus, plastids, and mitochondria.

[0096] As used herein, the terms “plant part” or “plant tissue” include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, plant aggregates, and intact plant cells in a plant or plant part, where plant parts include embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, grains, spikes, galls, exoskeletons, stems, roots, root tips, anthers, etc.

[0097] The mutant HPPD polypeptide of the present invention can be applied to various types of plants. Dicotyledonous plants include, but are not limited to, alfalfa, beans, cauliflower, cabbage, carrots, celery, cotton, cucumbers, eggplants, lettuce, melons, peas, pepper, zucchini, radishes, rapeseed, spinach, soybeans, pumpkins, tomatoes, Arabidopsis thaliana, peanuts, or watermelons. Preferably, dicotyledonous plants refer to cucumbers, soybeans, Arabidopsis thaliana, tobacco, cotton, peanuts, and rapeseed. Monocotyledonous plants include, but are not limited to, rice, sorghum, wheat, barley, rye, millet, sugarcane, oats, or sedge. Preferably, monocotyledonous plants refer to rice, sorghum, wheat, barley, millet, sugarcane, or oats.

[0098] As used herein, the term “plant transformation” means transforming plant cells after cloning a herbicide-resistant or herbicide-tolerant mutant HPPD polynucleotide, either alone or in combination with one or more additional nucleic acid molecules encoding polypeptides that confer a desired trait, into an expression system. The receptors and target expression cassettes of the present invention can be introduced into plant cells by several methods recognized in the art. For example, the term “introduction” in the context of a polynucleotide, which is a nucleotide construct of interest, is intended to mean the presentation of the polynucleotide to the plant in a manner such that the polynucleotide reaches the interior of the plant cell. When introducing two or more polynucleotides, these polynucleotides can be assembled as part of a single nucleotide construct or as separate nucleotide constructs and can be placed in the same or different transformation vectors. Thus, these polynucleotides can be introduced into the host cell of interest in a single transformation event, in separate transformation events, or, for example in plants, as part of a breeding protocol. The methods of the present invention do not rely on a specific method for introducing one or more polynucleotides into a plant, but rather rely only on the fact that the (one or more) polynucleotides reach the interior of at least one cell of the plant. Methods for introducing one or more polynucleotides into plants are known in the art and include, but are not limited to, transient transformation, stable transformation, and virus-mediated or genome editing techniques.

[0099] The term "stable transformation" refers to the process where a foreign gene is introduced into a plant's genome and stably integrated into the genome of that plant or any subsequent successor, resulting in the stable inheritance of that foreign gene.

[0100] The term "transient transformation" refers to a process where a nucleic acid molecule or protein is introduced into a plant cell and performs a function, but it is not integrated into the plant's genome, resulting in the foreign gene not being stably inherited.

[0101] Genome editing technology refers to techniques used to modify the genome, specifically those that precisely manipulate the genome sequence to achieve site-specific gene mutations, insertions, and deletions. Currently, genome editing technologies mainly include homing endonucleases (HE), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and CRISPR (Clustered Regulatory Interspaced Short Palindromic Repeat).

[0102] Numerous transformation vectors available for plant transformation are known to those skilled in the art, and the genes relating to the present invention can be used in combination with any such vector. The selection of vectors depends on the preferred transformation technique and the target species for transformation. Depending on the target species, different antibiotic or herbicide selection markers may be preferred. Commonly used selection markers in transformation include the nptII gene, which confers resistance to kanamycin and related antibiotics or herbicides (published in Bevan et al., Nature 304:184-187 (1983)); the pat and bar genes, which confer resistance to the herbicide glufosinate (also known as phosphinotricin) (see White et al., Nucl. Acids Res 18:1062 (1990), Spencer et al. Theon. Appl. Genet. 79:625-631 (1990), and U.S. Patents 5,561,236 and 5,276,268); the hph gene, which confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann, Mol. Cell. Biol. 4:2929-2931); and the dhfr gene, which confers resistance to methotrexate (Bourouis et al., EMBO J. 2(7):1099-1104(1983)); the EPSPS gene that confers resistance to glyphosate (U.S. Patent Nos. 4,940,935 and 5,188,642); the glyphosate N-acetyltransferase (GAT) gene that also confers resistance to glyphosate (Castle et al. (2004) Science, 304:1151-1154, U.S. Patent Publication Nos. 20070004912, 20050246798 and 20050060767); and the mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose (U.S. Patent Nos. 5,767,378 and 5,994,629).

[0103] Methods for plant regeneration are also well known in this field. For example, Ti plasmid vectors are used for the delivery of foreign DNA, as are direct DNA uptake, liposomes, electroporation, microinjection, and microparticle guns.

[0104] The planting system in the present invention comprises genetically modified plants resistant to one or more herbicides and / or combinations of herbicide treatments applicable at various developmental stages of the plants. When herbicides are applied, the planting system can effectively control weed growth and produce plants with higher yields and / or less damage.

[0105] In this invention, "weed" refers to a plant that competes with the target plant cultivated in the plant growth environment.

[0106] In this invention, the terms “control” and / or “prevention” refer to the application of an effective amount of HPPD inhibitory herbicide to the plant growing environment, at least directly (e.g., by spraying), to minimize weed emergence and / or halt weed growth. At the same time, the target plants to be cultivated should be morphologically normal and can be cultivated in conventional ways for product consumption and / or production. Preferably, the cultivated plants suffer less plant damage and / or have a higher plant yield compared to non-genetically modified wild-type plants. Reduction of plant damage includes, but is not limited to, improved stem resistance and / or increased grain weight. The “control” and / or “prevention” effect of mutant HPPD polypeptides on weeds can exist independently and will not be diminished and / or eliminated by the presence of other substances that can “control” and / or “prevent” weeds. Specifically, if any tissue of a genetically modified plant (containing the gene encoding the mutant HPPD polypeptide) simultaneously and / or separately possesses and / or produces the mutant HPPD polypeptide and / or another substance capable of controlling weeds, the presence of the other substance does not affect the “control” and / or “preventive” effect of the mutant HPPD polypeptide on weeds, nor is the “control” and / or “preventive” effect, regardless of the mutant HPPD polypeptide, consequently not fully and / or partially brought about by the other substance.

[0107] In this invention, "plant reproductive organisms" include, but are not limited to, plant sexual reproductive organisms and plant vegetative reproductive organisms. Plant sexual reproductive organisms include, but are not limited to, plant seeds. Plant vegetative reproductive organisms refer to the vegetative organs or specific tissues of a plant that can produce new plants under ex vivo conditions. Vegetative organs or specific tissues are not limited to, but include roots, stems, and leaves. For example, plants that use roots as vegetative reproductive organisms include strawberries and sweet potatoes, plants that use stems as vegetative reproductive organisms include sugarcane and potatoes (tubers), and plants that use leaves as vegetative reproductive organisms include aloe and begonias.

[0108] The present invention can confer novel herbicide resistance traits to plants without adverse effects on phenotypic traits (such as yield). Plants in the present invention may exhibit resistance to typical application levels of at least one tested herbicide, for example, 0.5×, 1×, 2×, 3×, 4×, or 8×. Improvements in these resistance levels are within the scope of the present invention. For example, various techniques known in the art can be foreseen and further developed to increase the expression of a given gene.

[0109] The present invention provides a mutant HPPD polypeptide, its coding gene, and its use, which have the following advantages.

[0110] 1. This invention discloses for the first time that combination mutations at the 372nd and 383rd positions of hydroxyphenylpyruvate dioxygenase polypeptides derived from various species can confer synergistically improved resistance to HPPD inhibitory herbicides such as pyrazolinates, triketones, and isoxazoles to plants, and in particular, can confer resistance to topramesone, isoxaflutol, and mesotrione at four times the field concentration to genetically modified soybean plants. Therefore, this invention has potential for wide-area application in plants.

[0111] 2. In the hydroxyphenylpyruvate dioxygenase polypeptide of the present invention, the combination of the combination mutation at position 372 + 383 and the mutation at other positions does not affect the synergistically improved resistance to HPPD inhibitory herbicides produced by the combination mutation at position 372 + 383 alone. This demonstrates the importance and stability of the plant resistance to HPPD inhibitory herbicides conferred by the combination mutation at position 372 + 383 of the HPPD polypeptide.

[0112] 3. Optimizing the C-terminus of the HPPD amino acid sequence based on the combination mutation at positions 372 and 383 of the hydroxyphenylpyruvate dioxygenase polypeptide of the present invention is beneficial for improving plant tolerance to isoxaflutol.

[0113] The technical solution of the present invention will be described in more detail with reference to the following drawings and embodiments. [Brief explanation of the drawing]

[0114] [Figure 1] This is a schematic structural diagram of DBN11726, a recombinant expression vector for Arabidopsis thaliana containing the AsHPPDm-F372A-F383W-02 nucleotide sequence according to the present invention. [Figure 2] This is a schematic diagram of the control recombinant expression vector DBN11726N according to the present invention. [Figure 3] This is a phylogenetic tree of HPPDs from various species according to the present invention. [Modes for carrying out the invention]

[0115] Embodiments relating to the mutant hydroxyphenylpyruvate dioxygenase polypeptide, its coding gene, and its use according to the present invention will be further described with specific examples.

[0116] Example 1: Selection of positions 372 and 383 of AsHPPD for a combination mutation (F372A+F383W) and verification of the mutation effect. 1. Acquisition of AsHPPD and AsHPPDm-F372A-F383W genes The amino acid sequence of wild-type oat (Avena sativa) HPPD (AsHPPD) is listed as Sequence ID 1 in the sequence listing, the AsHPPD-01 nucleotide sequence encoding AsHPPD is listed as Sequence ID 2, and the AsHPPD-02 nucleotide sequence encoding AsHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana / soybean, is listed as Sequence ID 3.

[0117] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the AsHPPDm-F372A amino acid sequence described as SEQ ID NO: 4 in the sequence listing. The AsHPPDm-F372A-01 nucleotide sequence encoding the AsHPPDm-F372A amino acid sequence is described as SEQ ID NO: 5 in the sequence listing. The AsHPPDm-F372A-02 nucleotide sequence encoding the AsHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 6 in the sequence listing.

[0118] The amino acid at position 383 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F383W amino acid sequence described as SEQ ID NO: 7 in the sequence listing. The AsHPPDm-F383W-01 nucleotide sequence encoding the AsHPPDm-F383W amino acid sequence is described as SEQ ID NO: 8 in the sequence listing. The AsHPPDm-F383W-02 nucleotide sequence encoding the AsHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 9 in the sequence listing.

[0119] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372A-F383W amino acid sequence described as Sequence ID No. 10 in the sequence listing. The AsHPPDm-F372A-F383W-01 nucleotide sequence encoding the AsHPPDm-F372A-F383W amino acid sequence is described as Sequence ID No. 11 in the sequence listing. The AsHPPDm-F372A-F383W-02 nucleotide sequence encoding the AsHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 12 in the sequence listing.

[0120] 2. Synthesis of the aforementioned nucleotide sequence The 5′ and 3′ ends of the synthesized AsHPPD-02 nucleotide sequence (SEQ ID NO: 3), AsHPPDm-F372A-02 nucleotide sequence (SEQ ID NO: 6), AsHPPDm-F383W-02 nucleotide sequence (SEQ ID NO: 9), and AsHPPDm-F372A-F383W-02 nucleotide sequence (SEQ ID NO: 12) were respectively ligated to the following universal adapter primer 1. Universal adapter primer 1 for the 5′ end: 5′-agtttttctgattaacagactagt-3′ as described in Sequence ID No. 230 of the sequence listing. Universal adapter primer 1 for 3′ end: 5′-caaatgtttgaacgatcggcgcgcc-3′ as described in Sequence ID No. 231 of the sequence listing.

[0121] 3. Construction of a recombinant expression vector for Arabidopsis thaliana containing the oat HPPD gene (F372A-F383W) The plant expression vector DBNBC-01 was double digested using restriction enzymes Spe I and Asc I to linearize the plant expression vector. The digested product was purified to obtain the linearized DBNBC-01 expression vector backbone (vector backbone: pCAMBIA2301 (available from CAMBIA)). Then, following the instructions for the Takara In-Fusion Products Seamless Connection Kit (Clontech, California, USA, CAT: 121416), a recombination reaction was performed with the AsHPPDm-F372A-F383W-02 nucleotide sequence linked to Universal Adapter Primer 1 to construct the recombinant expression vector DBN11726 having the schematic structure shown in Figure 1 (Spec: spectinomycin gene, RB: right boundary, eFMV: 34S enhancer of Scrophularia mosaic virus (SEQ ID NO: 13), prBrCBP: promoter of Brassica napus eukaryotes elongation factor gene 1α (Tsf1) (SEQ ID NO: 14), spAt CTP2: Arabidopsis thaliana chloroplast transport peptide (SEQ ID NO: 15), EPSPS: 5-enolpyruvirshikimic acid-3-phosphate synthase gene (SEQ ID NO: 16), tPsE9: Terminator of the pea RbcS gene (SEQ ID NO: 17), prAtUbi10: Promoter of the Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 18), AsHPPDm-F372A-F383W-02: AsHPPDm-F372A-F383W-02 nucleotide sequence (SEQ ID NO: 12), tNos: Terminator of the nopalin synthase gene (SEQ ID NO: 19), pr35S-01: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 20), PAT: Phosphinotricin acetyltransferase gene (SEQ ID NO: 21), t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 22), LB: Left boundary).

[0122] E. coli T1 competent cells were transformed with the recombinant expression vector DBN11726 using the heat shock method under the following heat shock conditions: 50 μL of E. coli T1 competent cells and 10 μL of plasmid DNA (recombinant expression vector DBN11726) were bathed in water at 42°C for 30 seconds, then cultured with shaking at 37°C for 1 hour (using a shaker at 100 rpm). Subsequently, the cells were cultured for 12 hours at 37°C on an LB solid plate containing 50 mg / L of spectinomycin. White bacterial colonies were removed and cultured overnight at 37°C in LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, and 50 mg / L of spectinomycin; pH adjusted to 7.5 with NaOH). Intracellular plasmids were extracted by the alkaline method. The mycelium was centrifuged at a rotation speed of 12,000 rpm for 1 minute, the supernatant was removed, and the precipitated mycelium was suspended in 100 μL of solution I (25 mM Tris-HCl, 10 mM ethylenediaminetetraacetic acid (EDTA), and 50 mM glucose, pH 8.0) pre-cooled with ice. A freshly prepared solution II (0.2 M NaOH, 1% sodium dodecyl sulfate) was then added. Add 200 μL of sulfate (SDS), mix by inverting the tube four times, and leave on ice for 3-5 minutes. Add 150 μL of ice-cooled solution III (3M potassium acetate, 5M acetic acid), mix immediately and homogeneously, and leave on ice for 5-10 minutes. Centrifuge the mixture for 5 minutes at 4°C and 12,000 rpm, add twice the volume of anhydrous ethanol to the supernatant, mix homogeneously, and leave at room temperature for 5 minutes. The mixture was centrifuged for 5 minutes under these conditions, the supernatant was discarded, the precipitate was washed with 70% (V / V) ethanol, and then air-dried. 30 μL of TE (10 mM Tris-HCl and 1 mM EDTA, pH 8.0) containing RNase (20 μg / mL) was added to dissolve the precipitate. The resulting product was digested in a water bath at 37°C for 30 minutes to remove the RNA, and then stored at -20°C for use. The extracted plasmids were identified by sequencing.As a result, the nucleotide sequence between the Spe I and Asc I sites of the recombinant expression vector DBN11726 was shown to be the one described in Sequence ID No. 12 of the sequence listing, namely the AsHPPDm-F372A-F383W-02 nucleotide sequence.

[0123] Following the method described above for constructing the recombinant expression vector DBN11726, the AsHPPD-02 nucleotide sequence, the AsHPPDm-F372A-02 nucleotide sequence, and the AsHPPDm-F383W-02 nucleotide sequence, linked to Universal Adapter Primer 1, were recombined with the linearized DBNBC-01 expression vector backbone to sequentially construct recombinant expression vectors DBN11727, DBN11728, and DBN11729. Sequencing confirmed that the nucleotide sequences in recombinant expression vectors DBN11727, DBN11728, and DBN11729 contained the nucleotide sequences described in Sequence ID No. 3, Sequence ID No. 6, and Sequence ID No. 9, respectively, in the sequence listing, thus confirming that the AsHPPD-02 nucleotide sequence, the AsHPPDm-F372A-02 nucleotide sequence, and the AsHPPDm-F383W-02 nucleotide sequence were correctly inserted.

[0124] A control recombinant expression vector DBN11726N was constructed, and its structure is shown in Figure 2 (Spec: spectinomycin gene, RB: right boundary, eFMV: 34S enhancer of Scrophularia mosaic virus (SEQ ID NO: 13), prBrCBP: promoter of Brassica napus eukaryote elongation factor gene 1α (Tsf1) (SEQ ID NO: 14), spAtCTP2: Arabidopsis thaliana chloroplast transport peptide (SEQ ID NO: 15), EPSPS: 5-enolpyruvir shikimic acid-3-phosphate synthase gene (SEQ ID NO: 16), tPsE9: terminator of pea RbcS gene (SEQ ID NO: 17), pr35S-01: cauliflower mosaic virus 35S promoter (SEQ ID NO: 20), PAT: phosphinotricin acetyltransferase gene (SEQ ID NO: 21), t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 22), LB: left boundary).

[0125] 4. Transformation of Agrobacterium using recombinant expression vectors for Arabidopsis thaliana Correctly constructed recombinant expression vectors DBN11726, DBN11727, DBN11728, DBN11729, and DBN11726N were used to transform Agrobacterium GV3101 under the following transformation conditions using the liquid nitrogen method. 100 μL of Agrobacterium GV3101 and 3 μL of plasmid DNA (recombinant expression vector) were placed in liquid nitrogen for 10 minutes, and then immersed in 37°C warm water for 10 minutes. Transformed Agrobacterium GV3101 was inoculated into LB tubes and cultured for 2 hours at 28°C and 200 rpm. Positive single clones were grown by spreading them onto LB solid plates containing 50 mg / L rifampicin and 50 mg / L spectinomycin. The single clones were isolated and cultured, and their plasmids were extracted. The extracted plasmids were identified by sequencing. As a result, the structures of the recombinant expression vectors DBN11726~DBN11729 and DBN11726N were shown to be completely correct.

[0126] 5. Acquisition of genetically modified Arabidopsis thaliana plants Seeds of wild-type Arabidopsis thaliana were suspended in a 0.1% (w / v) agarose solution. To ensure synchronized seed germination, the suspended seeds were stored at 4°C for 2 days to satisfy the dormancy requirement. Vermiculite was mixed with horse manure compost, and the mixture was kept moist by bottom watering, with the water draining from the soil mixture over 24 hours. The pre-treated seeds were sown in this soil mixture and covered with a moisture-retaining cover for 7 days. After germination, the seeds were kept at a constant temperature (22°C), constant humidity (40-50%), and light intensity of 120-150 μmol / m². 2 s -1 Plants were cultivated in a greenhouse under long-day conditions (16 hours of light / 8 hours of darkness). Initially, the plants were watered with Hoagland nutrient solution, and then with deionized water to maintain the soil in a moist but impermeable state.

[0127] Arabidopsis thaliana was transformed using the flower immersion method. One or more pre-cultures of Agrobacterium colonies were inoculated into 15-30 mL of LB culture medium containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) (10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl; pH adjusted to 7.5 with NaOH). These pre-cultures were incubated overnight at 28°C and 220 rpm with constant shaking. Two 500 mL cultures of LB culture medium containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) were inoculated into each pre-culture, and these cultures were incubated overnight at 28°C with continuous shaking. Cells were precipitated by centrifugation at approximately 4,000 rpm for 20 minutes at room temperature, and the resulting supernatant was discarded. The cell precipitate was gently resuspended in 500 mL of osmotic culture medium containing 1 / 2 × MS salt / vitamin B5, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μL / L (1 mg / mL preserved DMSO solution)), and 300 μL / L Silvet L-77. Arabidopsis thaliana plants, approximately one month old, were immersed in the osmotic culture medium containing the resuspended cells for 15 seconds to ensure the freshest inflorescences were fully submerged. The Arabidopsis plants were then placed on their sides, covered, and kept moist in the dark for 24 hours. The Arabidopsis plants were then cultivated as usual at 22°C with a photoperiod of 16 hours of light and 8 hours of darkness. Seeds were harvested after approximately 4 weeks.

[0128] The newly harvested (AsHPPD-02 nucleotide sequence, AsHPPDm-F372A-02 nucleotide sequence, AsHPPDm-F383W-02 nucleotide sequence, AsHPPDm-F372A-F383W-02 nucleotide sequence, and control recombinant expression vector DBN11726N) T1 seeds were dried at room temperature for 7 days. These seeds were sown on 26.5 cm × 51 cm germination discs, with 200 mg of T1 seeds (approximately 10,000 seeds) placed per disc. To ensure synchronized seed germination, the seeds were pre-suspended in distilled water and stored at 4°C for 2 days to satisfy their dormancy requirements.

[0129] Vermiculite was mixed with horse manure compost, and the mixture was moistened by bottom watering, with the water draining by gravity. Using a pipette, the pre-treated seeds were sown evenly into the mixed soil and covered with a moist cover for 4-5 days. To select early transgenic plants, the cover was removed one day before the application of glufosinate (used for selection of the cotransformed PAT gene) after germination.

[0130] A 0.2% solution of Liberty herbicide (glufosinate 200 g ai / L) was sprayed onto T1 plants at a spray volume of 10 mL / disk (703 L / ha) using a DeVilbiss compressed air nozzle 7 days after planting (DAP) and 11 DAP (at the cotyledon stage and 2-4 leaf stage, respectively), providing an effective dose of glufosinate of 280 g ai / ha per application. Four to seven days after the final application, surviving plants (actively growing plants) were identified and transplanted into 7 cm x 7 cm square pots prepared with horse manure compost and vermiculite (3-5 plants / disk). The transplanted plants were covered with a moisture-retaining cover for 3-4 days and placed in a 22°C culture chamber or directly transferred to the greenhouse mentioned above. Next, remove the cover and place the plants in a greenhouse (22±5℃, 50±30%RH, 14 hours light: 10 hours dark, minimum 500μE / m²) at least one day before testing the ability of the mutated HPPD gene to provide HPPD inhibitor herbicide resistance. 2 s -1 Planted using the wild type (with supplemental lighting).

[0131] 6. Detection of herbicide resistance in genetically modified Arabidopsis thaliana plants containing the AsHPPDm-F372A-F383W-02 nucleotide sequence. Using a glufosinate selection scheme, T1 transformants were initially selected from non-transformed seeds. Arabidopsis thaliana T1 plants with the AsHPPD-02 nucleotide sequence introduced (AsHPPD-02), Arabidopsis thaliana T1 plants with the AsHPPDm-F372A-02 nucleotide sequence introduced (AsHPPDm-F372A-02), Arabidopsis thaliana T1 plants with the AsHPPDm-F383W-02 nucleotide sequence introduced (AsHPPDm-F383W-02), Arabidopsis thaliana T1 plants with the AsHPPDm-F372A-F383W-02 nucleotide sequence introduced (AsHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants with the control recombinant expression vector DBN11726N introduced (DBN11726N), and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with toprameson at three concentrations (100g) The resistance of Arabidopsis thaliana to herbicides was determined by spraying isoxaflutol at three concentrations (140g ai / ha (2x field concentration, 2x), 280g ai / ha (4x field concentration, 4x), and 0g ai / ha (water, 0x)), mesotrione at three concentrations (210g ai / ha (2x field concentration, 2x), 420g ai / ha (4x field concentration, 4x), and 0g ai / ha (water, 0x)), and Arabidopsis thaliana at three concentrations. Seven days after application (7DAT), the degree of damage caused by the herbicide was measured for each plant according to the percentage of bleached leaf area (percentage of bleached leaf area = area of ​​bleached leaves / total leaf area × 100%). Grade 0 was defined as the absence of a bleached phenotype, Grade 1 as the percentage of bleached leaf area being less than 50%, Grade 2 as the percentage of bleached leaf area being more than 50%, and Grade 3 as the percentage of bleached leaf area being 100%.

[0132] According to the formula X = [Σ(N×S) / (T×M)]×100, the resistance performance of each recombinant expression vector to transformation events was scored (X - pesticide damage score, N - number of plants with the same damage grade, S - pesticide damage grade, T - total number of plants, M - maximum pesticide damage grade). Based on these scores, resistance was evaluated as highly resistant plants (score 0-15), moderately resistant plants (score 16-33), lowly resistant plants (score 34-67), and non-resistant plants (score 68-100). The results are shown in Table 1.

[0133] [Table 1]

[0134] The results in Table 1 show that, compared to CK, all Arabidopsis thaliana genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02, and AsHPPDm-F372A-F383W-02 showed high resistance to toprameson at 4-fold or 8-fold field concentrations, while neither AsHPPD-02 nor DBN11726N showed resistance to toprameson.

[0135] [Table 2]

[0136] The results in Table 2 show the following: (1) Compared to CK, Arabidopsis thaliana genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02, and AsHPPDm-F372A-F383W-02 showed varying degrees of tolerance to different concentrations of isoxaflutol, but neither AsHPPD-02 nor DBN11726N showed any tolerance to isoxaflutol. (2) Arabidopsis thaliana genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02, and AsHPPDm-F372A-F383W-02 showed moderate resistance, moderate resistance, and high resistance, respectively, to twice the field concentration of isoxaflutol, demonstrating that the combination mutation at positions 372 and 383 of the wild-type HPPD amino acid sequence (F372A+F383W) had a better effect than the single-position mutation F372A or F383W. (3) Arabidopsis thaliana genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02, and AsHPPDm-F372A-F383W-02 showed low resistance, low resistance, and high resistance, respectively, to isoxaflutol at four times the field concentration. This demonstrated that the combination mutation at positions 372 and 383 of the wild-type HPPD amino acid sequence (F372A+F383W) produced a better effect than the single-position mutation F372A or F383W, and furthermore, it synergistically improved the effect of herbicide resistance.

[0137] [Table 3]

[0138] The results in Table 3 show the following: (1) Compared to CK, Arabidopsis thaliana genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02, and AsHPPDm-F372A-F383W-02 showed varying degrees of resistance to different concentrations of mesotrione, but neither AsHPPD-02 nor DBN11726N showed resistance to mesotrione. (2) Arabidopsis thaliana genotypes AsHPPDm-F372A-02, AsHPPDm-F383W-02, and AsHPPDm-F372A-F383W-02 showed moderate resistance, moderate resistance, and high resistance, respectively, to twice the field concentration of mesotrione, demonstrating that the combination mutation at positions 372 and 383 of the wild-type HPPD amino acid sequence (F372A+F383W) produced a better effect than the single-position mutation F372A or F383W. (3) Arabidopsis thaliana gene The genetic types AsHPPDm-F372A-02, AsHPPDm-F383W-02, and AsHPPDm-F372A-F383W-02 exhibited low resistance, low resistance, and high resistance, respectively, to mesotrione at four times the field concentration. This demonstrated that the combination mutation at positions 372 and 383 of the wild-type HPPD amino acid sequence (F372A+F383W) yielded better results than the single-position mutation F372A or F383W, and furthermore, synergistically improved herbicide resistance.

[0139] Tables 2 and 3 above clearly demonstrate that the combination mutation (F372A+F383W) at positions 372 and 383 of the wild-type HPPD amino acid sequence resulted in a synergistic improvement in HPPD inhibitory herbicide resistance.

[0140] Example 2: Combination mutations at positions 372 and 383 (F372A + F383W) of HPPD amino acid sequences from various species, and verification of their mutational effects. To further investigate the synergistic effects of combinational mutations at positions 372 and 383 of the HPPD amino acid sequence, we analyzed phylogenetic trees of HPPD from various species (shown in Figure 3). To examine the mutation effect, we selected representative HPPD from various branches and mutated the amino acids at positions 372 and 383 of the amino acid sequence (F372A + F383W).

[0141] 1. Acquisition of HPPD and mutant HPPD (F372A+F383W) from various species. (1) Acquisition of the mutant HPPD (F372A+F383W) derived from Arabidopsis thaliana. The amino acid sequence of wild-type Arabidopsis thaliana HPPD (AtHPPD) is listed as Sequence ID No. 23 in the sequence listing, the AtHPPD-01 nucleotide sequence encoding AtHPPD is listed as Sequence ID No. 24, and the AtHPPD-02 nucleotide sequence encoding AtHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana and soybeans, is listed as Sequence ID No. 25.

[0142] The amino acid at position 372 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the AtHPPDm-F372A amino acid sequence described as SEQ ID NO. 26 in the sequence listing. The AtHPPDm-F372A-01 nucleotide sequence encoding the AtHPPDm-F372A amino acid sequence is described as SEQ ID NO. 27 in the sequence listing. The AtHPPDm-F372A-02 nucleotide sequence encoding the AtHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO. 28 in the sequence listing.

[0143] The amino acid at position 383 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F383W amino acid sequence described as SEQ ID NO. 29 in the sequence listing. The AtHPPDm-F383W-01 nucleotide sequence encoding the AtHPPDm-F383W amino acid sequence is described as SEQ ID NO. 30 in the sequence listing. The AtHPPDm-F383W-02 nucleotide sequence encoding the AtHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO. 31 in the sequence listing.

[0144] The amino acid at position 372 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F372A-F383W amino acid sequence described as Sequence ID No. 32 in the sequence listing. The AtHPPDm-F372A-F383W-01 nucleotide sequence encoding the AtHPPDm-F372A-F383W amino acid sequence is described as Sequence ID No. 33 in the sequence listing. The AtHPPDm-F372A-F383W-02 nucleotide sequence encoding the AtHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 34 in the sequence listing.

[0145] (2) Acquisition of alfalfa-derived variant HPPD (F372A and F383W) The amino acid sequence of wild-type alfalfa (Medicago sativa) HPPD (MsHPPD) is listed as Sequence ID No. 35 in the sequence listing, the MsHPPD-01 nucleotide sequence encoding MsHPPD is listed as Sequence ID No. 36, and the MsHPPD-02 nucleotide sequence encoding MsHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is listed as Sequence ID No. 37.

[0146] The amino acid at position 372 of the MsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the MsHPPDm-F372A amino acid sequence described as SEQ ID NO: 38 in the sequence listing. The MsHPPDm-F372A-01 nucleotide sequence encoding the MsHPPDm-F372A amino acid sequence is described as SEQ ID NO: 39 in the sequence listing. The MsHPPDm-F372A-02 nucleotide sequence encoding the MsHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 40 in the sequence listing.

[0147] The amino acid at position 383 of the MsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the MsHPPDm-F383W amino acid sequence described as SEQ ID NO: 41 in the sequence listing. The MsHPPDm-F383W-01 nucleotide sequence encoding the MsHPPDm-F383W amino acid sequence is described as SEQ ID NO: 42 in the sequence listing. The MsHPPDm-F383W-02 nucleotide sequence encoding the MsHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 43 in the sequence listing.

[0148] The amino acid at position 372 of the MsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the MsHPPDm-F372A-F383W amino acid sequence described as SEQ ID NO: 44 in the sequence listing. The MsHPPDm-F372A-F383W-01 nucleotide sequence encoding the MsHPPDm-F372A-F383W amino acid sequence is described as SEQ ID NO: 45 in the sequence listing. The MsHPPDm-F372A-F383W-02 nucleotide sequence encoding the MsHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 46 in the sequence listing.

[0149] (3) Acquisition of cotton-derived mutant HPPD (F372A and F383W) The amino acid sequence of wild-type cotton (Gossypium hirsutum) HPPD (GsHPPD) is listed as sequence number 47 in the sequence listing, the GsHPPD-01 nucleotide sequence encoding GsHPPD is listed as sequence number 48, and the GsHPPD-02 nucleotide sequence encoding GsHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana / soybean, is listed as sequence number 49.

[0150] The amino acid at position 372 of the GsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the GsHPPDm-F372A amino acid sequence described as SEQ ID NO: 50 in the sequence listing. The GsHPPDm-F372A-01 nucleotide sequence encoding the GsHPPDm-F372A amino acid sequence is described as SEQ ID NO: 51 in the sequence listing. The GsHPPDm-F372A-02 nucleotide sequence encoding the GsHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 52 in the sequence listing.

[0151] The amino acid at position 383 of the GsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GsHPPDm-F383W amino acid sequence described as SEQ ID NO: 53 in the sequence listing. The GsHPPDm-F383W-01 nucleotide sequence encoding the GsHPPDm-F383W amino acid sequence is described as SEQ ID NO: 54 in the sequence listing. The GsHPPDm-F383W-02 nucleotide sequence encoding the GsHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 55 in the sequence listing.

[0152] The amino acid at position 372 of the GsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GsHPPDm-F372A-F383W amino acid sequence described as SEQ ID NO: 56 in the sequence listing. The GsHPPDm-F372A-F383W-01 nucleotide sequence encoding the GsHPPDm-F372A-F383W amino acid sequence is described as SEQ ID NO: 57 in the sequence listing. The GsHPPDm-F372A-F383W-02 nucleotide sequence encoding the GsHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 58 in the sequence listing.

[0153] (4) Acquisition of rapeseed-derived mutant HPPD (F372A and F383W) The amino acid sequence of wild-type Brassica napus HPD (BnHPPD) is listed as sequence number 59 in the sequence listing, the BnHPPD-01 nucleotide sequence encoding BnHPPD is listed as sequence number 60, and the BnHPPD-02 nucleotide sequence encoding BnHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is listed as sequence number 61.

[0154] The amino acid at position 372 of the BnHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the BnHPPDm-F372A amino acid sequence described as SEQ ID NO. 62 in the sequence listing. The BnHPPDm-F372A-01 nucleotide sequence encoding the BnHPPDm-F372A amino acid sequence is described as SEQ ID NO. 63 in the sequence listing. The BnHPPDm-F372A-02 nucleotide sequence encoding the BnHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO. 64 in the sequence listing.

[0155] The amino acid at position 383 of the BnHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the BnHPPDm-F383W amino acid sequence described as SEQ ID NO. 65 in the sequence listing. The BnHPPDm-F383W-01 nucleotide sequence encoding the BnHPPDm-F383W amino acid sequence is described as SEQ ID NO. 67 in the sequence listing is described as the BnHPPDm-F383W-02 nucleotide sequence encoding the BnHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans.

[0156] The amino acid at position 372 of the BnHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the BnHPPDm-F372A-F383W amino acid sequence described as SEQ ID NO. 68 in the sequence listing. The BnHPPDm-F372A-F383W-01 nucleotide sequence encoding the BnHPPDm-F372A-F383W amino acid sequence is described as SEQ ID NO. 69 in the sequence listing. The BnHPPDm-F372A-F383W-02 nucleotide sequence encoding the BnHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO. 70 in the sequence listing.

[0157] (5) Acquisition of soybean-derived mutant HPPD (F372A and F383W) The amino acid sequence of wild-type soybean (Glycine max) HPPD (GmHPPD) is listed as Sequence ID 71 in the sequence listing, the GmHPPD-01 nucleotide sequence encoding GmHPPD is listed as Sequence ID 72, and the GmHPPD-02 nucleotide sequence encoding GmHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana / soybean, is listed as Sequence ID 73 in the sequence listing.

[0158] The amino acid at position 372 of the GmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the GmHPPDm-F372A amino acid sequence described as Sequence ID No. 74 in the sequence listing. The GmHPPDm-F372A-01 nucleotide sequence encoding the GmHPPDm-F372A amino acid sequence is described as Sequence ID No. 75 in the sequence listing. The GmHPPDm-F372A-02 nucleotide sequence encoding the GmHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 76 in the sequence listing.

[0159] The amino acid at position 383 of the GmHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GmHPPDm-F383W amino acid sequence described in Sequence ID No. 77 of the sequence listing. The GmHPPDm-F383W-01 nucleotide sequence encoding the GmHPPDm-F383W amino acid sequence is described as Sequence ID No. 78 of the sequence listing. The GmHPPDm-F383W-02 nucleotide sequence encoding the GmHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 79 of the sequence listing.

[0160] The amino acid at position 372 of the GmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GmHPPDm-F372A-F383W amino acid sequence described as Sequence ID No. 80 in the sequence listing. The GmHPPDm-F372A-F383W-01 nucleotide sequence encoding the GmHPPDm-F372A-F383W amino acid sequence is described as Sequence ID No. 81 in the sequence listing. The GmHPPDm-F372A-F383W-02 nucleotide sequence encoding the GmHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 82 in the sequence listing.

[0161] (6) Acquisition of tobacco-derived variant HPPD (F372A+F383W) The amino acid sequence of wild tobacco (Nicotiana tabacum) HPPD (NtHPPD) is listed as sequence number 83 in the sequence listing, the NtHPPD-01 nucleotide sequence encoding NtHPPD is listed as sequence number 84, and the NtHPPD-02 nucleotide sequence encoding NtHPPD, obtained based on a codon use bias common to Arabidopsis thaliana / soybeans, is listed as sequence number 85.

[0162] The amino acid at position 372 of the NtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the NtHPPDm-F372A amino acid sequence described as SEQ ID NO: 86 in the sequence listing. The NtHPPDm-F372A-01 nucleotide sequence encoding the NtHPPDm-F372A amino acid sequence is described as SEQ ID NO: 87 in the sequence listing. The NtHPPDm-F372A-02 nucleotide sequence encoding the NtHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 88 in the sequence listing.

[0163] The amino acid at position 383 of the NtHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the NtHPPDm-F383W amino acid sequence described as SEQ ID NO: 89 in the sequence listing. The NtHPPDm-F383W-01 nucleotide sequence encoding the NtHPPDm-F383W amino acid sequence is described as SEQ ID NO: 90 in the sequence listing. The NtHPPDm-F383W-02 nucleotide sequence encoding the NtHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 91 in the sequence listing.

[0164] The amino acid at position 372 of the NtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the NtHPPDm-F372A-F383W amino acid sequence described as SEQ ID NO: 92 in the sequence listing. The NtHPPDm-F372A-F383W-01 nucleotide sequence encoding the NtHPPDm-F372A-F383W amino acid sequence is described as SEQ ID NO: 93 in the sequence listing. The NtHPPDm-F372A-F383W-02 nucleotide sequence encoding the NtHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 94 in the sequence listing.

[0165] (7) Acquisition of rice-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type rice (Oryza sativa) HPPD (OsHPPD) is listed as sequence number 95 in the sequence listing, the OsHPPD-01 nucleotide sequence encoding OsHPPD is listed as sequence number 96, and the OsHPPD-02 nucleotide sequence encoding OsHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is listed as sequence number 97.

[0166] The amino acid at position 372 of the OsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the OsHPPDm-F372A amino acid sequence described as SEQ ID NO: 98 in the sequence listing. The OsHPPDm-F372A-01 nucleotide sequence encoding the OsHPPDm-F372A amino acid sequence is described as SEQ ID NO: 99 in the sequence listing. The OsHPPDm-F372A-02 nucleotide sequence encoding the OsHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 100 in the sequence listing.

[0167] The amino acid at position 383 of the OsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the OsHPPDm-F383W amino acid sequence described as SEQ ID NO: 101 in the sequence listing. The OsHPPDm-F383W-01 nucleotide sequence encoding the OsHPPDm-F383W amino acid sequence is described as SEQ ID NO: 102 in the sequence listing. The OsHPPDm-F383W-02 nucleotide sequence encoding the OsHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 103 in the sequence listing.

[0168] The amino acid at position 372 of the OsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the OsHPPDm-F372A-F383W amino acid sequence described as SEQ ID NO: 104 in the sequence listing. The OsHPPDm-F372A-F383W-01 nucleotide sequence encoding the OsHPPDm-F372A-F383W amino acid sequence is described as SEQ ID NO: 105 in the sequence listing. The OsHPPDm-F372A-F383W-02 nucleotide sequence encoding the OsHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 106 in the sequence listing.

[0169] (8) Acquisition of sorghum-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type sorghum bicolor HPD (SbHPPD) is listed as sequence number 107 in the sequence listing, the SbHPPD-01 nucleotide sequence encoding SbHPPD is listed as sequence number 108, and the SbHPPD-02 nucleotide sequence encoding SbHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is listed as sequence number 109.

[0170] The amino acid at position 372 of the SbHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the SbHPPDm-F372A amino acid sequence described as SEQ ID NO: 110 in the sequence listing. The SbHPPDm-F372A-01 nucleotide sequence encoding the SbHPPDm-F372A amino acid sequence is described as SEQ ID NO: 111 in the sequence listing. The SbHPPDm-F372A-02 nucleotide sequence encoding the SbHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 112 in the sequence listing.

[0171] The amino acid at position 383 of the SbHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the SbHPPDm-F383W amino acid sequence described as SEQ ID NO: 113 in the sequence listing. The SbHPPDm-F383W-01 nucleotide sequence encoding the SbHPPDm-F383W amino acid sequence is described as SEQ ID NO: 114 in the sequence listing. The SbHPPDm-F383W-02 nucleotide sequence encoding the SbHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybean, is described as SEQ ID NO: 115 in the sequence listing.

[0172] The amino acid at position 372 of the SbHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the SbHPPDm-F372A-F383W amino acid sequence described as SEQ ID NO: 116 in the sequence listing. The SbHPPDm-F372A-F383W-01 nucleotide sequence encoding the SbHPPDm-F372A-F383W amino acid sequence is described as SEQ ID NO: 117 in the sequence listing. The SbHPPDm-F372A-F383W-02 nucleotide sequence encoding the SbHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 118 in the sequence listing.

[0173] (9) Acquisition of the barley-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type barley (Hordeum vulgare) HPPD (HvHPPD) is listed as sequence number 119 in the sequence listing, the HvHPPD-01 nucleotide sequence encoding HvHPPD is listed as sequence number 120, and the HvHPPD-02 nucleotide sequence encoding HvHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana / soybean, is listed as sequence number 121 in the sequence listing.

[0174] The amino acid at position 372 of the HvHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the HvHPPDm-F372A amino acid sequence described as SEQ ID NO: 122 in the sequence listing. The HvHPPDm-F372A-01 nucleotide sequence encoding the HvHPPDm-F372A amino acid sequence is described as SEQ ID NO: 123 in the sequence listing. The HvHPPDm-F372A-02 nucleotide sequence encoding the HvHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 124 in the sequence listing.

[0175] The amino acid at position 383 of the HvHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HvHPPDm-F383W amino acid sequence described as SEQ ID NO: 125 in the sequence listing. The HvHPPDm-F383W-01 nucleotide sequence encoding the HvHPPDm-F383W amino acid sequence is described as SEQ ID NO: 126 in the sequence listing. The HvHPPDm-F383W-02 nucleotide sequence encoding the HvHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 127 in the sequence listing.

[0176] The amino acid at position 372 of the HvHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HvHPPDm-F372A-F383W amino acid sequence described as Sequence ID No. 128 in the sequence listing. The HvHPPDm-F372A-F383W-01 nucleotide sequence encoding the HvHPPDm-F372A-F383W amino acid sequence is described as Sequence ID No. 129 in the sequence listing. The HvHPPDm-F372A-F383W-02 nucleotide sequence encoding the HvHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 130 in the sequence listing.

[0177] (10) Acquisition of maize-derived mutant HPPD (F372A+F383W) The amino acid sequence of wild-type maize (Zea mays) HPPD (ZmHPPD) is listed as sequence number 131 in the sequence listing, the ZmHPPD-01 nucleotide sequence encoding ZmHPPD is listed as sequence number 132, and the ZmHPPD-02 nucleotide sequence encoding ZmHPPD, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is listed as sequence number 133.

[0178] The amino acid at position 372 of the ZmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the ZmHPPDm-F372A amino acid sequence described as SEQ ID NO: 134 in the sequence listing. The ZmHPPDm-F372A-01 nucleotide sequence encoding the ZmHPPDm-F372A amino acid sequence is described as SEQ ID NO: 135 in the sequence listing. The ZmHPPDm-F372A-02 nucleotide sequence encoding the ZmHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 136 in the sequence listing.

[0179] The amino acid at position 383 of the ZmHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the ZmHPPDm-F383W amino acid sequence described in Sequence ID No. 137 of the sequence listing. The ZmHPPDm-F383W-01 nucleotide sequence encoding the ZmHPPDm-F383W amino acid sequence is described as Sequence ID No. 138 of the sequence listing. The ZmHPPDm-F383W-02 nucleotide sequence encoding the ZmHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 139 of the sequence listing.

[0180] The amino acid at position 372 of the ZmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the ZmHPPDm-F372A-F383W amino acid sequence described as Sequence ID No. 140 in the sequence listing. The ZmHPPDm-F372A-F383W-01 nucleotide sequence encoding the ZmHPPDm-F372A-F383W amino acid sequence is described as Sequence ID No. 141 in the sequence listing. The ZmHPPDm-F372A-F383W-02 nucleotide sequence encoding the ZmHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 142 in the sequence listing.

[0181] (11) Acquisition of the HPPD mutation (F372A+F383W) derived from Pseudomonas fluorescens The amino acid sequence of wild-type Pseudomonas fluorescens HPD (PfHPPD) is listed as sequence number 143 in the sequence listing, the PfHPPD-01 nucleotide sequence encoding PfHPPD is listed as sequence number 144, and the PfHPPD-02 nucleotide sequence encoding PfHPPD, obtained based on a common codon usage bias for Arabidopsis thaliana / soybeans, is listed as sequence number 145.

[0182] The amino acid at position 372 of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the PfHPPDm-F372A amino acid sequence described as SEQ ID NO: 146 in the sequence listing. The PfHPPDm-F372A-01 nucleotide sequence encoding the PfHPPDm-F372A amino acid sequence is described as SEQ ID NO: 147 in the sequence listing. The PfHPPDm-F372A-02 nucleotide sequence encoding the PfHPPDm-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as SEQ ID NO: 148 in the sequence listing.

[0183] The amino acid at position 383 of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the PfHPPDm-F383W amino acid sequence described as SEQ ID NO: 149 in the sequence listing. The PfHPPDm-F383W-01 nucleotide sequence encoding the PfHPPDm-F383W amino acid sequence is described as SEQ ID NO: 150 in the sequence listing. The PfHPPDm-F383W-02 nucleotide sequence encoding the PfHPPDm-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybean, is described as SEQ ID NO: 151 in the sequence listing.

[0184] The amino acid at position 372 of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the PfHPPDm-F372A-F383W amino acid sequence described in Sequence ID No. 152 of the sequence listing. The PfHPPDm-F372A-F383W-01 nucleotide sequence encoding the PfHPPDm-F372A-F383W amino acid sequence is described as Sequence ID No. 153 of the sequence listing. The PfHPPDm-F372A-F383W-02 nucleotide sequence encoding the PfHPPDm-F372A-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 154 of the sequence listing.

[0185] 2. Construction of recombinant expression vectors for Arabidopsis thaliana containing mutant HPPDs from various species (combination mutations of F372A + F383W, or single-position mutations F372A or F383W). According to the method for constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence described in item 3 of Example 1 above, the following sequences were linked to the universal adapter primer 1: AtHPPD-02 nucleotide sequence, AtHPPDm-F372A-02 nucleotide sequence, AtHPPDm-F383W-02 nucleotide sequence, AtHPPDm-F372A-F383W-02 nucleotide sequence, MsHPPD-02 nucleotide sequence, MsHPPDm-F372A-02 nucleotide sequence, MsHPP Dm-F383W-02 nucleotide sequence, MsHPPDm-F372A-F383W-02 nucleotide sequence, GsHPPD-02 nucleotide sequence, GsHPPDm-F372A-02 nucleotide sequence, GsHPPDm-F383W-02 nucleotide sequence, GsHPPDm-F372A-F383W-02 nucleotide sequence, BnHPPD-02 nucleotide sequence, BnHPPDm-F372A-02 nucleotide sequence, BnHPPDm-F383W-02 nucleotide sequence, BnHPPDm-F372A-F383W-02 nucleotide sequence , GmHPPD-02 nucleotide sequence, GmHPPDm-F372A-02 nucleotide sequence, GmHPPDm-F383W-02 nucleotide sequence, GmHPPDm-F372A-F383W-02 nucleotide sequence, NtHPPD-02 nucleotide sequence, NtHPPDm-F372A-02 nucleotide sequence, NtHPPDm-F383W-02 nucleotide sequence, NtHPPDm-F372A-F383W-02 nucleotide sequence, OsHPPD-02 nucleotide sequence, OsHPPDm-F372A-02 nucleotide sequence, OsHPPD m-F383W-02 nucleotide sequence, OsHPPDm-F372A-F383W-02 nucleotide sequence, SbHPPD-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F383W-02 nucleotide sequence, SbHPPDm-F372A-F383W-02 nucleotide sequence, HvHPPD-02 nucleotide sequence, HvHPPDm-F372A-02 nucleotide sequence, HvHPPDm-F383W-02 nucleotide sequence, HvHPPDm-F372A-F383W-02 nucleotide sequence,The ZmHPPD-02 nucleotide sequence, ZmHPPDm-F372A-02 nucleotide sequence, ZmHPPDm-F383W-02 nucleotide sequence, ZmHPPDm-F372A-F383W-02 nucleotide sequence, PfHPPD-02 nucleotide sequence, PfHPPDm-F372A-02 nucleotide sequence, PfHPPDm-F383W-02 nucleotide sequence, and PfHPPDm-F372A-F383W-02 nucleotide sequence were each recombined with a linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN11730 to DBN11773 in sequence. Sequence determination confirmed that each of the aforementioned nucleotide sequences was correctly inserted into recombinant expression vectors DBN11730 to DBN11773.

[0186] 3. Transformation of Agrobacterium using recombinant expression vectors for Arabidopsis thaliana Following the Agrobacterium transformation method using recombinant expression vectors for Arabidopsis thaliana described in item 4 of Example 1 above, correctly constructed recombinant expression vectors DBN11730-DBN11773 and the control recombinant expression vector DBN11726N constructed in item 3 of Example 1 were each transformed into Agrobacterium GV3101 using the liquid nitrogen method. The results were confirmed by sequencing, which showed that the structures of the recombinant expression vectors DBN11730-DBN11773 and DBN11726N were completely correct.

[0187] 4. Detection of herbicide resistance in Arabidopsis thaliana plants introduced with various species-derived HPPD mutations (combination mutations of F372A + F383W, or single-position mutations F372A or F383W). In order to introduce the T-DNA from the recombinant expression vectors DBN11730~DBN11773 constructed in Example 2 and the control recombinant expression vector DBN11726N constructed in item 3 of Example 1 into the Arabidopsis thaliana chromosome, the Arabidopsis thaliana inflorescences were immersed in the Agrobacterium solution described in item 3 of this Example, following the method described in item 5 of Example 1 above, thereby obtaining the corresponding gene-transformed Arabidopsis thaliana plants. Specifically, Arabidopsis thaliana T1 plants with the AtHPPD-02 nucleotide sequence introduced (AtHPPD-02), Arabidopsis thaliana T1 plants with the AtHPPDm-F372A-02 nucleotide sequence introduced (AtHPPDm-F372A-02), Arabidopsis thaliana T1 plants with the AtHPPDm-F383W-02 nucleotide sequence introduced (AtHPPDm-F383W-02), and AtHPPDm-F372A-F383W- Arabidopsis thaliana T1 plants with the 02 nucleotide sequence introduced (AtHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants with the MsHPPD-02 nucleotide sequence introduced (MsHPPD-02), Arabidopsis thaliana T1 plants with the MsHPPDm-F372A-02 nucleotide sequence introduced (MsHPPDm-F372A-02), Arabidopsis thaliana T1 plants with the MsHPPDm-F383W-02 nucleotide sequence introduced Shepherd's purse T1 plant (MsHPPDm-F383W-02), Arabidopsis thaliana T1 plant with the MsHPPDm-F372A-F383W-02 nucleotide sequence introduced (MsHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plant with the GsHPPD-02 nucleotide sequence introduced (GsHPPD-02), Arabidopsis thaliana T1 plant with the GsHPPDm-F372A-02 nucleotide sequence introduced (GsHPP Arabidopsis thaliana T1 plants with the Dm-F372A-02, GsHPPDm-F383W-02 nucleotide sequences introduced (GsHPPDm-F383W-02), Arabidopsis thaliana T1 plants with the GsHPPDm-F372A-F383W-02 nucleotide sequences introduced (GsHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants with the BnHPPD-02 nucleotide sequence introduced (BnHPPD-02),Arabidopsis thaliana T1 plants with the BnHPPDm-F372A-02 nucleotide sequence introduced (BnHPPDm-F372A-02), Arabidopsis thaliana T1 plants with the BnHPPDm-F383W-02 nucleotide sequence introduced (BnHPPDm-F383W-02), Arabidopsis thaliana T1 plants with the BnHPPDm-F372A-F383W-02 nucleotide sequence introduced (BnHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants with the GmHPPD-02 nucleotide sequence introduced (GmHPPD-02), GmHPPDm-F372A- Arabidopsis thaliana T1 plants with the 02 nucleotide sequence introduced (GmHPPDm-F372A-02), Arabidopsis thaliana T1 plants with the GmHPPDm-F383W-02 nucleotide sequence introduced (GmHPPDm-F383W-02), Arabidopsis thaliana T1 plants with the GmHPPDm-F372A-F383W-02 nucleotide sequence introduced (GmHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants with the NtHPPD-02 nucleotide sequence introduced (NtHPPD-02), and Arabidopsis thaliana T1 plants with the NtHPPDm-F372A-02 nucleotide sequence introduced Arabidopsis thaliana T1 plant (NtHPPDm-F372A-02), Arabidopsis thaliana T1 plant with the NtHPPDm-F383W-02 nucleotide sequence introduced (NtHPPDm-F383W-02), Arabidopsis thaliana T1 plant with the NtHPPDm-F372A-F383W-02 nucleotide sequence introduced (NtHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plant with the OsHPPD-02 nucleotide sequence introduced (OsHPPD-02), Arabidopsis thaliana T1 plant with the OsHPPDm-F372A-02 nucleotide sequence introduced (OsH Arabidopsis thaliana T1 plants with the PPDm-F372A-02, OsHPPDm-F383W-02 nucleotide sequences introduced (OsHPPDm-F383W-02), Arabidopsis thaliana T1 plants with the OsHPPDm-F372A-F383W-02 nucleotide sequences introduced (OsHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants with the SbHPPD-02 nucleotide sequence introduced (SbHPPD-02), Arabidopsis thaliana T1 plants with the SbHPPDm-F372A-02 nucleotide sequence introduced (SbHPPDm-F372A-02),Arabidopsis thaliana T1 plants with the SbHPPDm-F383W-02 nucleotide sequence introduced (SbHPPDm-F383W-02), Arabidopsis thaliana T1 plants with the SbHPPDm-F372A-F383W-02 nucleotide sequence introduced (SbHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants with the HvHPPD-02 nucleotide sequence introduced (HvHPPD-02), Arabidopsis thaliana T1 plants with the HvHPPDm-F372A-02 nucleotide sequence introduced (HvHPP Arabidopsis thaliana T1 plants with the Dm-F372A-02, HvHPPDm-F383W-02 nucleotide sequences introduced (HvHPPDm-F383W-02), Arabidopsis thaliana T1 plants with the HvHPPDm-F372A-F383W-02 nucleotide sequences introduced (HvHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants with the ZmHPPD-02 nucleotide sequence introduced (ZmHPPD-02), Arabidopsis thaliana with the ZmHPPDm-F372A-02 nucleotide sequence introduced Arabidopsis thaliana T1 plant (ZmHPPDm-F372A-02), Arabidopsis thaliana T1 plant with the ZmHPPDm-F383W-02 nucleotide sequence introduced (ZmHPPDm-F383W-02), Arabidopsis thaliana T1 plant with the ZmHPPDm-F372A-F383W-02 nucleotide sequence introduced (ZmHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plant with the PfHPPD-02 nucleotide sequence introduced (PfHPPD-02), PfHPPDm-F372A-02 nucleotide We obtained Arabidopsis thaliana T1 plants with the following sequences introduced: PfHPPDm-F372A-02, PfHPPDm-F383W-02, PfHPPDm-F372A-F383W-02, and the control recombinant expression vector DBN11726N.

[0188] Following the method described in item 6 of Example 1 above, the aforementioned Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with toprameson at three concentrations (25 g ai / ha (1x field concentration, 1×), 100 g ai / ha (4x field concentration, 4×), and 0 g ai / ha (water, 0×)), isoxaflutol at three concentrations (35 g ai / ha (half-field concentration, 0.5×), 70 g ai / ha (1x field concentration, 1×), and 0 g ai / ha (water, 0×)), and mesotrione at three concentrations (52.5 g ai / ha (half-field concentration, 0.5×), 105 g ai / ha (1x field concentration, 1×), and 0 g The herbicide was applied at ai / ha (water, 0x) and the resistance of Arabidopsis thaliana to the herbicide was detected. The experimental results are shown in Tables 4 to 6.

[0189] [Table 4] [Table 5]

[0190] The results in Table 4 show the following: (1) Compared to Arabidopsis thaliana plants into which an unmutated HPPD gene was introduced, Arabidopsis thaliana plants into which HPPD genes from various species with combined mutations at positions 372 and 383 (F372A+F383W) and HPPD genes from various species with a single mutation at position 372 (F372A) were introduced showed different degrees of resistance to topramesone. Only HPPD genes from several species (sorghum, barley, and maize) with a single mutation at position 383 (F383W) were able to confer resistance to topramesone to Arabidopsis thaliana plants, while CK plants and control vector DBN11726N plants lacked resistance to topramesone.

[0191] (2) From the perspective of resistance evaluation, with respect to toprameson, Arabidopsis thaliana plants into which HPPD genes from various species (other than alfalfa) with combined mutations at positions 372 and 383 (F372A+F383W) were introduced showed better herbicide resistance than Arabidopsis thaliana plants into which HPPD genes with single-position mutations F372A or F383W were introduced, and furthermore, the effect of herbicide resistance was synergistically improved.

[0192] (3) In terms of scores, Arabidopsis thaliana plants introduced with alfalfa-derived HPPD genes having combined mutations at positions 372 and 383 (F372A+F383W) had lower tolerance scores than Arabidopsis thaliana plants introduced with HPPD genes having single-position mutations F372A or F383W. Furthermore, when treated with 4x field concentration of toprameson, approximately 50% of Arabidopsis thaliana plants introduced with alfalfa-derived HPPD genes having combined mutations at positions 372 and 383 had a damage level of grade 0 or grade 1, 25% of Arabidopsis thaliana plants introduced with alfalfa-derived HPPD genes having a single mutation at position 372 had a damage level of grade 0 or grade 1, and among Arabidopsis thaliana plants introduced with alfalfa-derived HPPD genes having a single mutation at position 383, there were 0 plants with a damage level of grade 0 or grade 1. This indicates that the HPPD gene derived from alfalfa, possessing a combination mutation at positions 372 and 383 (F372A+F383W), was able to confer synergistically improved herbicide resistance to Arabidopsis thaliana plants.

[0193] [Table 6] [Table 7] [Table 8]

[0194] The results in Table 5 show the following: (1) Compared to Arabidopsis thaliana plants into which an unmutated HPPD gene was introduced, Arabidopsis thaliana plants into which HPPD genes from various species with combined mutations at positions 372 and 383 (F372A+F383W) and HPPD genes from various species with a single mutation at position 372 (F372A) were introduced showed different degrees of resistance to isoxaflutol. Only HPPD genes from several species (sorghum, barley, and maize) with a single mutation at position 383 (F383W) could confer resistance to isoxaflutol to Arabidopsis thaliana plants, while CK plants and control vector DBN11726N plants lacked resistance to isoxaflutol.

[0195] (2) From the perspective of resistance evaluation, with respect to isoxaflutol, Arabidopsis thaliana plants into which HPPD genes from various species (other than maize) with combined mutations at positions 372 and 383 (F372A+F383W) were introduced showed better herbicide resistance than Arabidopsis thaliana plants into which HPPD genes with single-position mutations F372A or F383W were introduced, and furthermore, the effect of herbicide resistance was synergistically improved.

[0196] (3) In terms of scores, Arabidopsis thaliana plants introduced with maize-derived HPPD genes having combined mutations at positions 372 and 383 (F372A+F383W) had lower tolerance scores than Arabidopsis thaliana plants introduced with HPPD genes having single-position mutations F372A or F383W. Furthermore, when treated with a 1x field concentration of isoxaflutol, approximately 69% of Arabidopsis thaliana plants introduced with maize-derived HPPD genes having combined mutations at positions 372 and 383 had a damage level of grade 0 or grade 1, 6% of Arabidopsis thaliana plants introduced with maize-derived HPPD genes having a single mutation at position 372 had a damage level of grade 0 or grade 1, and among Arabidopsis thaliana plants introduced with maize-derived HPPD genes having a single mutation at position 383, there were 0 plants with a damage level of grade 0 or grade 1. This indicates that maize-derived HPPD genes with a combination mutation at positions 372 and 383 (F372A+F383W) can confer synergistically improved herbicide resistance to Arabidopsis thaliana plants.

[0197] [Table 9] [Table 10] [Table 11]

[0198] The results in Table 6 show the following: (1) Compared to Arabidopsis thaliana plants into which an unmutated HPPD gene was introduced, Arabidopsis thaliana plants into which HPPD genes from various species with combined mutations at positions 372 and 383 (F372A+F383W) and HPPD genes from various species with a single mutation at position 372 (F372A) were introduced showed different degrees of resistance to mesotrione. Only HPPD genes from several species (barley and maize) with a single mutation at position 383 (F383W) could confer resistance to mesotrione to Arabidopsis thaliana plants, while CK plants and control vector DBN11726N plants lacked resistance to mesotrione.

[0199] (2) From the perspective of resistance evaluation, with respect to mesotrione, Arabidopsis thaliana plants into which HPPD genes from various species (excluding tobacco) with combined mutations at positions 372 and 383 (F372A+F383W) were introduced showed better herbicide resistance than Arabidopsis thaliana plants into which HPPD genes with single-position mutations F372A or F383W were introduced, and furthermore, the effect of herbicide resistance was synergistically improved.

[0200] (3) In terms of scores, when treated with half or one-times field concentrations of mesotrione, Arabidopsis thaliana plants introduced with the tobacco-derived HPPD gene containing the combined mutation at positions 372 and 383 (F372A+F383W) had lower resistance scores than Arabidopsis thaliana plants with the single-position mutation F372A or F383W, and further showed a synergistically improved herbicide resistance effect.

[0201] Based on the results in Tables 4 to 6, it is shown that all HPPD genes from various species possessing the combined mutation (F372A+F383W) at positions 372 and 383 can confer synergistically improved herbicide resistance to plants.

[0202] Example 3: Different mutations at positions 372 and 383 of the HPPD amino acid sequence (combination mutations F372G+F383W or F372V+F383W), and verification of their mutational effects. 1. Acquisition of the genes AsHPPDm-F372G-F383W and AsHPPDm-F372V-F383W (1) The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to glycine (G) to obtain the AsHPPDm-F372G amino acid sequence described in Sequence ID No. 155 of the sequence listing. The AsHPPDm-F372G-01 nucleotide sequence encoding the AsHPPDm-F372G amino acid sequence is described as Sequence ID No. 156 of the sequence listing. The AsHPPDm-F372G-02 nucleotide sequence encoding the AsHPPDm-F372G amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 157 of the sequence listing.

[0203] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to glycine (G), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372G-F383W amino acid sequence described as Sequence ID No. 158 in the sequence listing. The AsHPPDm-F372G-F383W-01 nucleotide sequence encoding the AsHPPDm-F372G-F383W amino acid sequence is described as Sequence ID No. 159 in the sequence listing. The AsHPPDm-F372G-F383W-02 nucleotide sequence encoding the AsHPPDm-F372G-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 160 in the sequence listing.

[0204] (2) The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to valine (V) to obtain the AsHPPDm-F372V amino acid sequence described in Sequence ID No. 161 of the sequence listing. The AsHPPDm-F372V-01 nucleotide sequence encoding the AsHPPDm-F372V amino acid sequence is described as Sequence ID No. 162 of the sequence listing. The AsHPPDm-F372V-02 nucleotide sequence encoding the AsHPPDm-F372V amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 163 of the sequence listing.

[0205] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to valine (V), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372V-F383W amino acid sequence described as Sequence ID No. 164 in the sequence listing. The AsHPPDm-F372V-F383W-01 nucleotide sequence encoding the AsHPPDm-F372V-F383W amino acid sequence is described as Sequence ID No. 165 in the sequence listing. The AsHPPDm-F372V-F383W-02 nucleotide sequence encoding the AsHPPDm-F372V-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described as Sequence ID No. 166 in the sequence listing.

[0206] 2. Construction of a recombinant expression vector for Arabidopsis thaliana containing the oat HPPD gene (F372G+F383W or F372V+F383W) Following the construction method for recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence described in item 3 of Example 1 above, the AsHPPDm-F372G-02 nucleotide sequence, the AsHPPDm-F372G-F383W-02 nucleotide sequence, the AsHPPDm-F372V-02 nucleotide sequence, and the AsHPPDm-F372V-F383W-02 nucleotide sequence, linked to universal adapter primer 1, were recombined with a linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN11774 to DBN11777 in order. Sequence determination confirmed that each of the aforementioned nucleotide sequences was correctly inserted into recombinant expression vectors DBN11774 to DBN11777.

[0207] 3. Transformation of Agrobacterium using recombinant expression vectors for Arabidopsis thaliana According to the method for transforming Agrobacterium using recombinant expression vectors for Arabidopsis thaliana, as described in item 4 of Example 1 above, correctly constructed recombinant expression vectors DBN11774-DBN11777, as well as recombinant expression vector DBN11727 from item 3 of Example 1 containing the AsHPPD-02 nucleotide sequence, recombinant expression vector DBN11729 from item 3 of Example 1 containing the AsHPPDm-F383W-02 nucleotide sequence, and the control recombinant expression vector DBN11726N constructed in item 3 of Example 1, were each transformed into Agrobacterium GV3101 using the liquid nitrogen method. The results were confirmed by sequencing, which showed that the structures of recombinant expression vectors DBN11774-DBN11777 and DBN11727, DBN11729, and DBN11726N were completely correct.

[0208] 4. Detection of herbicide resistance in genetically modified Arabidopsis thaliana plants into which the nucleotide sequences AsHPPDm-F372G-F383W-02 or AsHPPDm-F372V-F383W-02 have been introduced. To introduce the T-DNA from the recombinant expression vectors DBN11774-DBN11777 constructed in item 2 of this example, the recombinant expression vector DBN11727 from item 3 of Example 1 containing the AsHPPD-02 nucleotide sequence, the recombinant expression vector DBN11729 from item 3 of Example 1 containing the AsHPPDm-F383W-02 nucleotide sequence, and the control recombinant expression vector DBN11726N constructed in item 3 of Example 1 into the Arabidopsis thaliana chromosome, the Arabidopsis thaliana inflorescences were immersed in the Agrobacterium solution described in item 3 of this example, according to the method described in item 5 of Example 1 above, thereby obtaining the corresponding gene-transformed Arabidopsis thaliana plants. Specifically, Arabidopsis thaliana T1 plants with the AsHPPDm-F372G-02 nucleotide sequence introduced (AsHPPDm-F372G-02), Arabidopsis thaliana T1 plants with the AsHPPDm-F372G-F383W-02 nucleotide sequence introduced (AsHPPDm-F372G-F383W-02), and Arabidopsis thaliana T1 plants with the AsHPPDm-F372V-02 nucleotide sequence introduced (AsHPPDm-F372V-0 2) We obtained Arabidopsis thaliana T1 plants into which the AsHPPDm-F372V-F383W-02 nucleotide sequence was introduced (AsHPPDm-F372V-F383W-02), Arabidopsis thaliana T1 plants into which the AsHPPD-02 nucleotide sequence was introduced, Arabidopsis thaliana T1 plants into which the AsHPPDm-F383W-02 nucleotide sequence was introduced, and Arabidopsis thaliana T1 plants into which the control recombinant expression vector DBN11726N was introduced.

[0209] 5. Verification of the synergistic effect of F372G + F383W or F372V + F383W Following the method described in item 6 of Example 1 above, the aforementioned Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with toprameson at three different concentrations (i.e., 100 g ai / ha (4x field concentration, 4×), 200 g ai / ha (8x field concentration, 8×), and 0 g ai / ha (water, 0×)), isoxaflutol at three different concentrations (i.e., 140 g ai / ha (2x field concentration, 2×), 280 g ai / ha (4x field concentration, 4×), and 0 g ai / ha (water, 0×)), and mesotrione at three different concentrations (i.e., 210 g ai / ha (2x field concentration, 2×), 420 g ai / ha (4x field concentration, 4×), and 0 g Herbicide resistance in Arabidopsis thaliana was detected by spraying with ai / ha (water, 0x). The experimental results are shown in Tables 7 to 9.

[0210] [Table 12]

[0211] The results in Table 7 show that when treated with toprameson at 4 or 8 times the field concentration compared to CK, all Arabidopsis thaliana genotypes AsHPPDm-F372G-02, AsHPPDm-F383W-02, AsHPPDm-F372G-F383W-02, AsHPPDm-F372V-02, and AsHPPDm-F372V-F383W-02 showed high resistance, but plants of AsHPPD-02 and the control vector DBN11726N did not show resistance to toprameson.

[0212] [Table 13]

[0213] [Table 14]

[0214] The results in Tables 8 and 9 show the following: (1) Compared to CK, Arabidopsis thaliana plants introduced with oat-derived HPPD genes having combinational mutations at positions 372 and 383 (F372G+F383W or F372V+F383W), oat-derived HPPD genes having a single mutation at position 372 (F372G or F372V), and oat-derived HPPD genes having a single mutation at position 383 (F383W) showed different degrees of resistance to both isoxaflutol and mesotrione. However, Arabidopsis thaliana plants introduced with an unmutated HPPD gene and the control vector DBN11726N showed no resistance to either isoxaflutol or mesotrione.

[0215] (2) From the perspective of resistance evaluation, when treated with isoxaflutol or mesotrione at twice the field concentration, Arabidopsis thaliana plants into which oat-derived HPPD genes with combined mutations at positions 372 and 383 (F372G+F383W or F372V+F383W) were introduced showed better herbicide tolerance (high resistance) than Arabidopsis thaliana plants into which HPPD genes with a single mutation at position 372 (medium resistance) or a single mutation at position 383 (medium resistance) were introduced. When treated with isoxaflutol or mesotrione at four times the field concentration, Arabidopsis thaliana plants introduced with oat-derived HPPD genes containing combined mutations at positions 372 and 383 (F372G+F383W or F372V+F383W) showed better herbicide tolerance (higher resistance) than Arabidopsis thaliana plants introduced with HPPD genes containing a single mutation at position 372 (low resistance) or a single mutation at position 383 (low resistance), and the effect of herbicide tolerance was further synergistically improved.

[0216] Tables 8 and 9 above demonstrate that different combination mutations at positions 372 and 383 of the wild-type HPPD amino acid sequence (combination mutations F372G+F383W or F372V+F383W) also synergistically improved resistance to HPPD inhibitory herbicides.

[0217] Example 4: Combinations of combinational mutations at positions 372 and 383 of the HPPD amino acid sequence with mutations at other positions, and their mutagenic effects. 1. Acquisition of sequences with combinational mutations at multiple locations. (1) Acquisition of the HPPDm-1 amino acid sequence (AsHPPDm-A107-F372A-F383W amino acid sequence) The original alanine (A) at position 107 of the AsHPPD amino acid sequence was deleted, and the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A) to obtain the AsHPPDm-A107-F372A amino acid sequence described in Sequence ID No. 167 of the sequence listing. The AsHPPDm-A107-F372A-01 nucleotide sequence encoding the AsHPPDm-A107-F372A amino acid sequence is described in Sequence ID No. 168 of the sequence listing. The AsHPPDm-A107-F372A-02 nucleotide sequence encoding the AsHPPDm-A107-F372A amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in Sequence ID No. 169 of the sequence listing.

[0218] The original alanine (A) at position 107 of the AsHPPD amino acid sequence was deleted, and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-A107-F383W amino acid sequence described in Sequence ID No. 170 of the sequence listing. The AsHPPDm-A107-F383W-01 nucleotide sequence encoding the AsHPPDm-A107-F383W amino acid sequence is described in Sequence ID No. 171 of the sequence listing. The AsHPPDm-A107-F383W-02 nucleotide sequence encoding the AsHPPDm-A107-F383W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in Sequence ID No. 172 of the sequence listing.

[0219] The original alanine (A) at position 107 of the AsHPPD amino acid sequence was deleted, the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-1 amino acid sequence (AsHPPDm-A107-F372A-F383W amino acid sequence) described in sequence number 173 of the sequence listing. The HPPDm-1-01 nucleotide sequence encoding the HPPDm-1 amino acid sequence is described in sequence number 174 of the sequence listing. The HPPDm-1-02 nucleotide sequence encoding the HPPDm-1 amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in sequence number 175 of the sequence listing.

[0220] (2) Acquisition of the HPPDm-2 amino acid sequence (AsHPPDm-A111T-F372A-F383W amino acid sequence) The amino acid at position 111 of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), and the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A) to obtain the AsHPPDm-A111T-F372A amino acid sequence described in Sequence ID No. 176 of the sequence listing. The AsHPPDm-A111T-F372A-01 nucleotide sequence encoding the AsHPPDm-A111T-F372A amino acid sequence is described in Sequence ID No. 177 of the sequence listing. The AsHPPDm-A111T-F372A-02 nucleotide sequence encoding the AsHPPDm-A111T-F372A amino acid sequence, obtained based on a common codon usage bias for Arabidopsis thaliana / soybeans, is described in Sequence ID No. 178 of the sequence listing.

[0221] The amino acid at position 111 of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-A111T-F383W amino acid sequence described in Sequence ID No. 179 of the sequence listing. The AsHPPDm-A111T-F383W-01 nucleotide sequence encoding the AsHPPDm-A111T-F383W amino acid sequence is described in Sequence ID No. 180 of the sequence listing. The AsHPPDm-A111T-F383W-02 nucleotide sequence encoding the AsHPPDm-A111T-F383W amino acid sequence, obtained based on a common codon usage bias for Arabidopsis thaliana / soybeans, is described in Sequence ID No. 181 of the sequence listing.

[0222] The HPPDm-2 amino acid sequence (AsHPPDm-A111T-F372A-F383W amino acid sequence) was obtained by mutating the amino acid at position 111 of the AsHPPD amino acid sequence from the original alanine (A) to threonine (T), the amino acid at position 372 from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 from the original phenylalanine (F) to tryptophan (W). The HPPDm-2 amino acid sequence (AsHPPDm-A111T-F372A-F383W amino acid sequence) is described in sequence number 182 of the sequence listing. The HPPDm-2-01 nucleotide sequence encoding the HPPDm-2 amino acid sequence is described in sequence number 183 of the sequence listing. The HPPDm-2-02 nucleotide sequence encoding the HPPDm-2 amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in sequence number 184 of the sequence listing.

[0223] (3) Acquisition of the HPPDm-3 amino acid sequence (AsHPPDm-A106G-F372A-F383W amino acid sequence) The HPPDm-3 amino acid sequence (AsHPPDm-A106G-F372A-F383W amino acid sequence) was obtained by mutating the amino acid at position 106 of the AsHPPD amino acid sequence from the original alanine (A) to glycine (G), the amino acid at position 372 from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 from the original phenylalanine (F) to tryptophan (W). The HPPDm-3 amino acid sequence (AsHPPDm-A106G-F372A-F383W amino acid sequence) is described in sequence number 185 of the sequence listing. The HPPDm-3-01 nucleotide sequence encoding the HPPDm-3 amino acid sequence is described in sequence number 186 of the sequence listing. The HPPDm-3-02 nucleotide sequence encoding the HPPDm-3 amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in sequence number 187 of the sequence listing.

[0224] (4) Acquisition of the HPPDm-4 amino acid sequence (AsHPPDm-A107-K351N-F372A-F383W amino acid sequence) The original alanine (A) at position 107 of the AsHPPD amino acid sequence was deleted, the amino acid at position 351 was mutated from the original lysine (K) to asparagine (N), the amino acid at position 372 was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-4 amino acid sequence (AsHPPDm-A107-K351N-F372A-F383W amino acid sequence) described in sequence number 188 of the sequence listing. The HPPDm-4-01 nucleotide sequence encoding the HPPDm-4 amino acid sequence is described in sequence number 189 of the sequence listing. The HPPDm-4-02 nucleotide sequence encoding the HPPDm-4 amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in sequence number 190 of the sequence listing.

[0225] (5) Acquisition of the HPPDm-5 amino acid sequence (AsHPPDm-A111T-K351N-F372A-F383W amino acid sequence) The HPPDm-5 amino acid sequence (AsHPPDm-A111T-K351N-F372A-F383W amino acid sequence) was obtained by mutating the amino acid at position 111 of the AsHPPD amino acid sequence from the original alanine (A) to threonine (T), the amino acid at position 351 from the original lysine (K) to asparagine (N), the amino acid at position 372 from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 from the original phenylalanine (F) to tryptophan (W) as described in sequence number 191 of the sequence listing. The HPPDm-5-01 nucleotide sequence encoding the HPPDm-5 amino acid sequence is described in sequence number 192 of the sequence listing. The HPPDm-5-02 nucleotide sequence encoding the HPPDm-5 amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in sequence number 193 of the sequence listing.

[0226] (6) Acquisition of the HPPDm-6 amino acid sequence (AsHPPDm-A106G-K351N-F372A-F383W amino acid sequence) The HPPDm-6 amino acid sequence (AsHPPDm-A106G-K351N-F372A-F383W amino acid sequence) was obtained by mutating the amino acid at position 106 of the AsHPPD amino acid sequence from the original alanine (A) to glycine (G), the amino acid at position 351 from the original lysine (K) to asparagine (N), the amino acid at position 372 from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 from the original phenylalanine (F) to tryptophan (W) as described in sequence number 194 of the sequence listing. The HPPDm-6-01 nucleotide sequence encoding the HPPDm-6 amino acid sequence is described in sequence number 195 of the sequence listing. The HPPDm-6-02 nucleotide sequence encoding the HPPDm-6 amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in sequence number 196 of the sequence listing.

[0227] (7) Acquisition of the HPPDm-7 amino acid sequence The HPPDm-7 amino acid sequence is obtained by mutating the C-terminal amino acid of the oat-derived HPPD amino acid sequence based on the AsHPPDm-A107-K351N-F372A-F383W amino acid sequence, and this HPPDm-7 amino acid sequence is listed as Sequence ID No. 197 in the sequence listing. The HPPDm-7-01 nucleotide sequence encoding the HPPDm-7 amino acid sequence is listed as Sequence ID No. 198 in the sequence listing. The HPPDm-7-02 nucleotide sequence encoding the HPPDm-7 amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is listed as Sequence ID No. 199 in the sequence listing.

[0228] (8) Acquisition of the HPPDm-8 amino acid sequence The HPPDm-8 amino acid sequence is obtained by mutating the C-terminal amino acid of the oat-derived HPPD amino acid sequence based on the AsHPPDm-A111T-K351N-F372A-F383W amino acid sequence, and this HPPDm-8 amino acid sequence is listed as Sequence ID No. 200 in the sequence listing. The HPPDm-8-01 nucleotide sequence encoding the HPPDm-8 amino acid sequence is listed as Sequence ID No. 201 in the sequence listing. The PPDm-8-02 nucleotide sequence encoding the HPPDm-8 amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybean, is listed as Sequence ID No. 202 in the sequence listing.

[0229] (9) Acquisition of the HPPDm-9 amino acid sequence The HPPDm-9 amino acid sequence is obtained by mutating the C-terminal amino acid of the oat-derived HPPD amino acid sequence based on the AsHPPDm-A106G-K351N-F372A-F383W amino acid sequence, and this HPPDm-9 amino acid sequence is listed as Sequence ID No. 203 in the sequence listing. The HPPDm-9-01 nucleotide sequence encoding the HPPDm-9 amino acid sequence is listed as Sequence ID No. 204 in the sequence listing. The HPPDm-9-02 nucleotide sequence encoding the HPPDm-9 amino acid sequence, obtained based on a codon use bias common to Arabidopsis thaliana / soybeans, is listed as Sequence ID No. 205 in the sequence listing.

[0230] 2. Construction of a recombinant expression vector for Arabidopsis thaliana containing HPPD with combinational mutations at multiple positions. According to the method for constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence described in item 3 of Example 1 above, the following sequences were linked to the universal adapter primer 1: AsHPPDm-A107-F372A-02 nucleotide sequence, AsHPPDm-A107-F383W-02 nucleotide sequence, HPPDm-1-02 nucleotide sequence, AsHPPDm-A111T-F372A-02 nucleotide sequence, and AsHPPDm-A111T-F383W-02 nucleotide sequence. The creotide sequence, HPPDm-2-02 nucleotide sequence, HPPDm-3-02 nucleotide sequence, HPPDm-4-02 nucleotide sequence, HPPDm-5-02 nucleotide sequence, HPPDm-6-02 nucleotide sequence, HPPDm-7-02 nucleotide sequence, HPPDm-8-02 nucleotide sequence, and HPPDm-9-02 nucleotide sequence were each recombined with a linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN11778 to DBN11790 in sequence. Sequence determination confirmed that each of the aforementioned nucleotide sequences was correctly inserted into recombinant expression vectors DBN11778 to DBN11790.

[0231] 3. Transformation of Agrobacterium using recombinant expression vectors for Arabidopsis thaliana According to the method for transforming Agrobacterium using recombinant expression vectors for Arabidopsis thaliana, as described in item 4 of Example 1 above, correctly constructed recombinant expression vectors DBN11778-DBN11790, recombinant expression vector DBN11727 from item 3 of Example 1 containing the AsHPPD-02 nucleotide sequence, and control recombinant expression vector DBN11726N from item 3 of Example 1 were each transformed into Agrobacterium GV3101 using the liquid nitrogen method. The results were confirmed by sequencing, which showed that the structures of recombinant expression vectors DBN11778-DBN11790, DBN11727, and DBN11726N were completely correct.

[0232] 4. Detection of herbicide resistance in Arabidopsis thaliana plants into which HPPD with combinational mutations at multiple locations has been introduced. To introduce the T-DNA from the recombinant expression vectors DBN11778-DBN11790 constructed in item 2 of this example, the recombinant expression vector DBN11727 from item 3 of Example 1 containing the AsHPPD-02 nucleotide sequence, and the control recombinant expression vector DBN11726N from item 3 of Example 1 into the Arabidopsis thaliana chromosome, the Arabidopsis thaliana inflorescences were immersed in the Agrobacterium solution described in item 3 of this example, according to the method described in item 5 of Example 1 above, thereby obtaining the corresponding gene-transformed Arabidopsis thaliana plants.Specifically, Arabidopsis thaliana T1 plants with the AsHPPDm-A107-F372A-02 nucleotide sequence introduced (AsHPPDm-A107-F372A-02), Arabidopsis thaliana T1 plants with the AsHPPDm-A107-F383W-02 nucleotide sequence introduced (AsHPPDm-A107-F383W-02), Arabidopsis thaliana T1 plants with the HPPDm-1-02 nucleotide sequence introduced (HPPDm-1-02), and AsHPPDm-A1 Arabidopsis thaliana T1 plants with the 11T-F372A-02 nucleotide sequence introduced (AsHPPDm-A111T-F372A-02), Arabidopsis thaliana T1 plants with the AsHPPDm-A111T-F383W-02 nucleotide sequence introduced (AsHPPDm-A111T-F383W-02), Arabidopsis thaliana T1 plants with the HPPDm-2-02 nucleotide sequence introduced (HPPDm-2-02), and Arabidopsis thaliana T1 plants with the HPPDm-3-02 nucleotide sequence introduced Arabidopsis thaliana T1 plant (HPPDm-3-02), Arabidopsis thaliana T1 plant with the HPPDm-4-02 nucleotide sequence introduced (HPPDm-4-02), Arabidopsis thaliana T1 plant with the HPPDm-5-02 nucleotide sequence introduced (HPPDm-5-02), Arabidopsis thaliana T1 plant with the HPPDm-6-02 nucleotide sequence introduced (HPPDm-6-02), Arabidopsis thaliana T1 plant with the HPPDm-7-02 nucleotide sequence introduced We obtained Arabidopsis thaliana T1 plants into which the (HPPDm-7-02) and HPPDm-8-02 nucleotide sequences were introduced (HPPDm-8-02), Arabidopsis thaliana T1 plants into which the HPPDm-9-02 nucleotide sequence was introduced (HPPDm-9-02), Arabidopsis thaliana T1 plants into which the AsHPPD-02 nucleotide sequence was introduced (AsHPPD-02), and Arabidopsis thaliana T1 plants into which a control recombinant expression vector was introduced (DBN11726N).

[0233] Following the method described in item 6 of Example 1 above, the aforementioned Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with toprameson at three different concentrations (i.e., 100 g ai / ha (4x field concentration, 4×), 200 g ai / ha (8x field concentration, 8×), and 0 g ai / ha (water, 0×)), isoxaflutol at three different concentrations (i.e., 140 g ai / ha (2x field concentration, 2×), 280 g ai / ha (4x field concentration, 4×), and 0 g ai / ha (water, 0×)), and mesotrione at three different concentrations (i.e., 210 g ai / ha (2x field concentration, 2×), 420 g ai / ha (4x field concentration, 4×), and 0 g Herbicide resistance in Arabidopsis thaliana was detected by spraying with ai / ha (water, 0x). The experimental results are shown in Tables 10 to 12.

[0234] [Table 15]

[0235] The results in Table 10 show the following: (1) Compared to Arabidopsis thaliana plants into which CK and unmutated HPPD genes have been introduced, all HPPD genes having combinations of mutations at positions 372 and 383 and mutations at other positions (such as A107 deletion, A111T, A106G, A107+K351N, A111T+K351N, A106G+K351N, A107+K351N+C-terminal mutation, A111T+K351N+C-terminal mutation, or A106G+K351N+C-terminal mutation) can confer high resistance to toprameson to plants. This indicates that the combination of the 372+383 amino acid sequence mutation and mutations at other positions did not affect the toprameson resistance of the 372+383 combination mutation alone, and also demonstrates the importance and stability of the plant resistance to HPPD inhibitory herbicides conferred by the 372 and 383 amino acid sequence mutations. In contrast, Arabidopsis thaliana T1 plants introduced with the control recombinant expression vector DBN11726N lacked resistance to toprameson.

[0236] [Table 16]

[0237] [Table 17]

[0238] The results in Tables 11 and 12 show the following: (1) Compared to Arabidopsis thaliana plants into which CK and unmutated HPPD genes were introduced, when treated with isoxaflutol and mesotrione at 2x or 4x field concentrations, all HPPD genes having combination mutations at positions 372 and 383 and mutations at other positions (such as A107 deletion, A111T, A106G, A107+K351N, A111T+K351N, A106G+K351N, A107+K351N+C-terminal mutation, A111T+K351N+C-terminal mutation, or A106G+K351N+C-terminal mutation) could confer high resistance to isoxaflutol and mesotrione to plants. However, Arabidopsis thaliana T1 plants into which the control recombinant expression vector DBN11726N was introduced lacked resistance to isoxaflutol and mesotrione.

[0239] (2) From the perspective of resistance evaluation, when treated with isoxaflutol or mesotrione at four times the field concentration, Arabidopsis thaliana plants into which the HPPDm-1-02 (AsHPPDm-A107-F372A-F383W-02) gene was introduced showed better herbicide tolerance (high resistance) than Arabidopsis thaliana plants into which the AsHPPDm-A107-F372A-02 gene (low resistance) or the AsHPPDm-A107-F383W-02 gene (low resistance) was introduced, and furthermore, the effect of herbicide tolerance was synergistically improved. Similarly, Arabidopsis plants introduced with the HPPDm-2-02 (AsHPPDm-A111T-F372A-F383W) gene showed better herbicide resistance (high resistance) than Arabidopsis plants introduced with the AsHPPDm-A111T-F372A-02 gene (low resistance) or the AsHPPDm-A111T-F383W-02 gene (low resistance), and the effect of herbicide resistance was synergistically improved. Therefore, the combination of the combined mutation at positions 372 and 383 of the HPPD amino acid sequence and mutations at other positions did not affect the synergistically improved herbicide resistance to HPPD inhibitory herbicides achieved by the combined mutation at positions 372 and 383 alone. Furthermore, the importance and stability of plant resistance to HPPD inhibitory herbicides conferred by the combined mutation at positions 372 and 383 of the HPPD amino acid sequence are demonstrated.

[0240] (3) In terms of resistance score, when treated with isoxaflutol at a 4x field concentration, Arabidopsis T1 plants with the HPDm-7-02~HPPDm-9-02 nucleotide sequence introduced had a higher resistance score (0) than Arabidopsis T1 plants with the HPDm-1-02~HPPDm-6-02 nucleotide sequence introduced, indicating that optimizing the C-terminus of the HPD amino acid sequence is advantageous in improving plant tolerance to isoxaflutol.

[0241] Example 5: Verification of combinational mutations in the HPPD amino acid sequence (not combinational mutation F372A (F372G / F372V) + F383W) and their mutational effects. 1. Acquisition of mutant genes of the HPPD amino acid sequence derived from oats and Arabidopsis thaliana (not the combined mutant F372A (F372G / F372V) + F383W). (1) Combination mutation gene of HPPD derived from oats (F372A+F415W) The amino acid at position 415 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F415W amino acid sequence described in Sequence ID No. 206 of the sequence listing. The AsHPPDm-F415W-01 nucleotide sequence encoding the AsHPPDm-F415W amino acid sequence is described in Sequence ID No. 207 of the sequence listing. The AsHPPDm-F415W-02 nucleotide sequence encoding the AsHPPDm-F415W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in Sequence ID No. 208 of the sequence listing.

[0242] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 415 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372A-F415W amino acid sequence described in Sequence ID No. 209 of the sequence listing. The AsHPPDm-F372A-F415W-01 nucleotide sequence encoding the AsHPPDm-F372A-F415W amino acid sequence is described in Sequence ID No. 210 of the sequence listing. The AsHPPDm-F372A-F415W-02 nucleotide sequence encoding the AsHPPDm-F372A-F415W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in Sequence ID No. 211 of the sequence listing.

[0243] (2) Combination mutant gene of HPPD derived from Arabidopsis thaliana (F372A+F415W) The amino acid at position 424 of the AtHPPD amino acid sequence (corresponding to position 415 of the amino acid sequence described in SEQ ID NO: 1, i.e., position 415) was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F415W amino acid sequence described in SEQ ID NO: 212 of the sequence listing. The AtHPPDm-F415W-01 nucleotide sequence encoding the AtHPPDm-F415W amino acid sequence is described in SEQ ID NO: 213 of the sequence listing. The AtHPPDm-F415W-02 nucleotide sequence encoding the AtHPPDm-F415W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in SEQ ID NO: 214 of the sequence listing.

[0244] The amino acid at position 372 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 415 was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F372A-F415W amino acid sequence described in Sequence ID No. 215 of the sequence listing. The AtHPPDm-F372A-F415W-01 nucleotide sequence encoding the AtHPPDm-F372A-F415W amino acid sequence is described in Sequence ID No. 216 of the sequence listing. The AtHPPDm-F372A-F415W-02 nucleotide sequence encoding the AtHPPDm-F372A-F415W amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in Sequence ID No. 217 of the sequence listing.

[0245] (3) Combination mutation gene of HPPD derived from oats (F372A+F383Y) The amino acid at position 383 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AsHPPDm-F383Y amino acid sequence described in Sequence ID No. 218 of the sequence listing. The AsHPPDm-F383Y-01 nucleotide sequence encoding the AsHPPDm-F383Y amino acid sequence is described in Sequence ID No. 219 of the sequence listing. The AsHPPDm-F383Y-02 nucleotide sequence encoding the AsHPPDm-F383Y amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in Sequence ID No. 220 of the sequence listing.

[0246] The amino acid at position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AsHPPDm-F372A-F383Y amino acid sequence described in Sequence ID No. 221 of the sequence listing. The AsHPPDm-F372A-F383Y-01 nucleotide sequence encoding the AsHPPDm-F372A-F383Y amino acid sequence is described in Sequence ID No. 222 of the sequence listing. The AsHPPDm-F372A-F383Y-02 nucleotide sequence encoding the AsHPPDm-F372A-F383Y amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in Sequence ID No. 223 of the sequence listing.

[0247] (4) Combination mutant gene of HPPD derived from Arabidopsis thaliana (F372A+F383Y) The amino acid at position 392 of the AtHPPD amino acid sequence (corresponding to position 383 of the amino acid sequence described in SEQ ID NO: 1, i.e., position 383) was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AtHPPDm-F383Y amino acid sequence described in SEQ ID NO: 224 of the sequence listing. The AtHPPDm-F383Y-01 nucleotide sequence encoding the AtHPPDm-F383Y amino acid sequence is described in SEQ ID NO: 225 of the sequence listing. The AtHPPDm-F383Y-02 nucleotide sequence encoding the AtHPPDm-F383Y amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in SEQ ID NO: 226 of the sequence listing.

[0248] The amino acid at position 372 of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the amino acid at position 383 was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AtHPPDm-F372A-F383Y amino acid sequence described in Sequence ID No. 227 of the sequence listing. The AtHPPDm-F372A-F383Y-01 nucleotide sequence encoding the AtHPPDm-F372A-F383Y amino acid sequence is described in Sequence ID No. 228 of the sequence listing. The AtHPPDm-F372A-F383Y-02 nucleotide sequence encoding the AtHPPDm-F372A-F383Y amino acid sequence, obtained based on a codon usage bias common to Arabidopsis thaliana / soybeans, is described in Sequence ID No. 229 of the sequence listing.

[0249] 2. Construction of a recombinant expression vector for Arabidopsis thaliana containing the mutant HPPD gene (not the combination mutation F372A (F372G / F372V) + F383W). According to the method for constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence described in item 3 of Example 1 above, the AsHPPDm-F415W-02 nucleotide sequence, the AsHPPDm-F372A-F415W-02 nucleotide sequence, the AtHPPDm-F415W-02 nucleotide sequence, and the AtHPPDm-F372A-F415 The W-02 nucleotide sequence, the AsHPPDm-F383Y-02 nucleotide sequence, the AsHPPDm-F372A-F383Y-02 nucleotide sequence, the AtHPPDm-F383Y-02 nucleotide sequence, and the AtHPPDm-F372A-F383Y-02 nucleotide sequence were each recombined with a linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN11791 to DBN11798 in order. Sequence determination confirmed that each of the aforementioned nucleotide sequences was correctly inserted into recombinant expression vectors DBN11791 to DBN11798.

[0250] 3. Transformation of Agrobacterium using recombinant expression vectors for Arabidopsis thaliana According to the method of transforming Agrobacterium using the recombinant expression vectors for Arabidopsis thaliana described in item 4 of Example 1 above, the correctly constructed recombinant expression vectors DBN11791 to DBN11798, the recombinant expression vector DBN11727 of item 3 of Example 1 containing the AsHPPD-02 nucleotide sequence, the recombinant expression vector DBN11728 of item 3 of Example 1 containing the AsHPPDm-F372A-02 nucleotide sequence, the recombinant expression vector DBN11730 of item 2 of Example 2 containing the AtHPPDm-02 nucleotide sequence, and the recombinant expression vector DBN11731 of item 2 of Example 2 containing the AtHPPDm-F372A-02 nucleotide sequence were each transformed into Agrobacterium GV3101 using the liquid nitrogen method. When the results were confirmed by the sequencing method, it was shown that the structures of the recombinant expression vectors DBN11791 to DBN11798, DBN11727, DBN11728, DBN11730 and DBN11731 were completely correct.

[0251] 4. Detection of herbicide tolerance of Arabidopsis plants into which a mutant HPPD gene (not the combined mutation F372A (F372G / F372V)+F383W) has been introduced To introduce the T-DNA from the recombinant expression vectors DBN11791-DBN11798, DBN11727, DBN11728, DBN11730, and DBN11731 constructed in Example 2 into Arabidopsis thaliana chromosomes, corresponding gene-transformed Arabidopsis thaliana plants were obtained by immersing Arabidopsis thaliana inflorescences in the solution of Agrobacterium described in item 3 of this example, following the method described in item 5 of Example 1 above. Specifically, Arabidopsis thaliana T1 plants with the AsHPPDm-F415W-02 nucleotide sequence introduced (AsHPPDm-F415W-02), Arabidopsis thaliana T1 plants with the AsHPPDm-F372A-F415W-02 nucleotide sequence introduced (AsHPPDm-F372A-F415W-02), and Arabidopsis thaliana T1 plants with the AtHPPDm-F415W-02 nucleotide sequence introduced (AtHPPDm-F Arabidopsis thaliana T1 plants with the nucleotide sequences 415W-02, AtHPPDm-F372A-F415W-02 introduced (AtHPPDm-F372A-F415W-02), Arabidopsis thaliana T1 plants with the nucleotide sequence AsHPPDm-F383Y-02 introduced (AsHPPDm-F383Y-02), Arabidopsis thaliana T1 plants with the nucleotide sequence AsHPPDm-F372A-F383Y-02 introduced Arabidopsis thaliana T1 plants with the (AsHPPDm-F372A-F383Y-02) and AtHPPDm-F383Y-02 nucleotide sequences introduced (AtHPPDm-F383Y-02), Arabidopsis thaliana T1 plants with the AtHPPDm-F372A-F383Y-02 nucleotide sequences introduced (AtHPPDm-F372A-F383Y-02), Arabidopsis thaliana T1 plants with the AsHPPD-02 nucleotide sequence introduced We obtained one plant (AsHPPD-02), an Arabidopsis thaliana T1 plant (AsHPPDm-F372A-02) into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, an Arabidopsis thaliana T1 plant (AtHPPDm-02) into which the AtHPPDm-02 nucleotide sequence was introduced, and an Arabidopsis thaliana T1 plant (AtHPPDm-F372A-02) into which the AtHPPDm-F372A-02 nucleotide sequence was introduced.According to the method described in item 6 of the above Example 1, to the aforementioned Arabidopsis T1 plants and wild-type Arabidopsis plants (CK) (18 days after sowing), topramezone was applied at three different concentrations (i.e., 25 g ai / ha (1-fold field concentration, 1×), 100 g ai / ha (4-fold field concentration, 4×), and 0 g ai / ha (water, 0×)), isoxaflutole was applied at five different concentrations (i.e., 35 g ai / ha (half-fold field concentration, 0.5×), 70 g ai / ha (1-fold field concentration, 1×), 140 g ai / ha (2-fold field concentration, 2×), 280 g ai / ha (4-fold field concentration, 4×), and 0 g ai / ha (water, 0×)) (among them, for spraying on Arabidopsis T1 plants into which mutant HPPD derived from Arabidopsis was introduced, isoxaflutole at concentrations of 0×, 0.5×, and 1× was used, and for spraying on Arabidopsis T1 plants into which mutant HPPD derived from barnyard grass was introduced, isoxaflutole at concentrations of 0×, 2×, and 4× was used), and mesotrione was applied at five different concentrations (i.e., 52.5 g ai / ha (half-fold field concentration, 0.5×), 105 g ai / ha (1-fold field concentration, 1×), 210 g ai / ha (2-fold field concentration, 2×), 420 g ai / ha (4-fold field concentration, 4×), and 0 g ai / ha (water, 0×)) (among them, for spraying on Arabidopsis T1 plants into which mutant HPPD derived from Arabidopsis was introduced, mesotrione at concentrations of 0×, 0.5×, and 1× was used, and for spraying on Arabidopsis T1 plants into which mutant HPPD derived from barnyard grass was introduced, mesotrione at concentrations of 0×, 2×, and 4× was used) respectively for spraying to detect the herbicide tolerance of Arabidopsis. The experimental results are shown in Tables 13 to 15.

[0252]

Table 18

[0253]

Table 19

[0254]

Table 20

[0255] The results in Tables 13 to 15 show that Arabidopsis T1 plants introduced with the HPPD gene containing the combined mutations F372A+F415W or F372A+F383Y, and Arabidopsis T1 plants introduced with the HPPD gene containing the single-position mutation F372A, did not show substantially different resistance to HPPD inhibitory herbicides. Therefore, it is clear that not all combined mutations at any two positions in the HPPD amino acid sequence can confer synergistically improved resistance to HPPD inhibitory herbicides to plants, and the synergistically improved technical effect resulting from the mutation at positions 372 and 383 of the HPPD amino acid sequence in the present invention is unexpected.

[0256] Example 6: Acquisition and verification of genetically modified soybean plants 1. Transformation of Agrobacterium using recombinant expression vectors The recombinant expression vectors DBN11758 containing the SbHPPD-02 nucleotide sequence, DBN11759 containing the SbHPPDm-F372A-02 nucleotide sequence, DBN11760 containing the SbHPPDm-F383W-02 nucleotide sequence, and DBN11761 containing the SbHPPDm-F372A-F383W-02 nucleotide sequence, as well as the control recombinant expression vector DBN11726N from item 3 of Example 1, were each transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT:18313-015) using the liquid nitrogen method. This transformation was carried out under the following transformation conditions: 100 μL of Agrobacterium LBA4404 and 3 μL of plasmid DNA (recombinant expression vector) were placed in liquid nitrogen for 10 minutes and then immersed in 37°C warm water for 10 minutes. Transformed Agrobacterium LBA4404 was inoculated into LB tubes and cultured for 2 hours at 28°C and 200 rpm. The resulting cells were then spread onto LB plates containing 50 mg / L rifampicin and 50 mg / L spectinomycin to grow positive single clones. The single clones were isolated and cultured, and their plasmids were extracted. The extracted plasmids were identified by sequencing. The results showed that the structures of the recombinant expression vectors DBN11758, DBN11759, DBN11760, DBN11761, and DBN11726N were completely correct.

[0257] 2. Acquisition of genetically modified soybean plants T-DNA of recombinant expression vectors DBN11758, DBN11759, DBN11760, DBN11761 and DBN11726N (Scrophularia japonica mosaic virus 34S enhancer sequence, Brassica napus eukaryote elongation factor gene 1α(Tsf1) promoter sequence, Arabidopsis thaliana chloroplast transport peptide sequence, 5-enolpyruvirshikimic acid-3-phosphate synthase gene, pea RbcS gene terminator sequence, Arabidopsis thaliana ubiquitin 10 gene promoter sequence, SbHPPD-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F383W-02 nucleotide sequence, SbHPPDm-F372A-F383W-02 nucleotide sequence, nopalin synthase gene terminator sequence, cauliflower mosaic virus To introduce the Iku virus 35S promoter sequence, the phosphinotricin-N-acetyltransferase gene, and the cauliflower mosaic virus 35S terminator sequence into soybean chromosomes, cotyledonous node tissue of the soybean variety Zhonghuang13, cultured aseptically according to the conventional Agrobacterium infection method, was co-cultured with Agrobacterium as described in item 1 of this example. This yielded soybean plants with the SbHPPD-02 nucleotide sequence, soybean plants with the SbHPPDm-F372A-02 nucleotide sequence, soybean plants with the SbHPPDm-F383W-02 nucleotide sequence, soybean plants with the SbHPPDm-F372A-F383W-02 nucleotide sequence, and soybean plants with the control vector DBN11726N.

[0258] In Agrobacterium-mediated soybean transformation, mature soybean seeds were germinated in soybean germination medium (3.1 g / L B5 salt, 20 g / L B5 vitamin, sucrose, and 8 g / L agar, pH 5.6), and then cultured under conditions of 25 ± 1°C and a photoperiod (light / dark) of 16 hours / 8 hours. Four to six days after germination, sterile soybean seedlings with swollen, bright green cotyledon nodes were collected, the hypocotyl was cut 3 to 4 millimeters below the cotyledon node, the hypocotyl was cut longitudinally, and the apical bud, lateral buds, and seed root were removed. A wound was made in the cotyledon node using the back of a scalpel, and the Agrobacterium suspension was applied to the wounded cotyledon node tissue. Here, Agrobacterium can transfer the SbHPPD-02 nucleotide sequence, the SbHPPDm-F372A-02 nucleotide sequence, the SbHPPDm-F383W-02 nucleotide sequence, or the SbHPPDm-F372A-F383W-02 nucleotide sequence to the wound cotyledonous node tissue (Step 1: Infection Step). In this step, Agrobacterium suspension (OD) is used. 660Inoculation was initiated by immersing the cotyledonous node tissue in an infection medium (MS salt 2.15 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholine ethanesulfonic acid (MES) 4 g / L, and zeatin (ZT) 2 mg / L, pH 5.3) at a concentration of 0.5 to 0.8. The cotyledonous node tissue was then co-cultured with Agrobacterium for a certain period (3 days) (Step 2: Co-culture step). Preferably, after the infection step, the cotyledonous node tissue was cultured in a solid medium (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, and agar 8 g / L, pH 5.6). After this co-culture stage, an optional "recovery" step may be added, in which at least one antibiotic (cephalosporin 150-250 mg / L) is added to inhibit the growth of Agrobacterium, and a recovery medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, and aspartic acid 100 mg / L, pH 5.6) without any selective agents for plant transformants is used (Step 3: Recovery step). Preferably, tissue masses regenerated from cotyledonous nodes are cultured in a solid medium containing antibiotics but without selective agents to eliminate Agrobacterium and provide a recovery step for infected cells. Subsequently, tissue masses regenerated from cotyledonous nodes are cultured in a medium containing a selective agent (glyphosate) to select transformant calluses in the process of growth (Step 4: Selection step). Preferably, transformed cells were selectively proliferated by culturing tissue masses regenerated from cotyledonous nodes in a screening solid medium containing a selective agent (3.1 g / L of B5 salt, 1 g / L of vitamin B5 and MES, 30 g / L of sucrose, 1 mg / L of 6-benzyladenine (6-BAP), 8 g / L of agar, 150 mg / L of cephalosporin, 100 mg / L of glutamic acid, 100 mg / L of aspartic acid, and 0.25 mol / L of N-(phosphonomethyl)glycine, pH 5.6).Next, plants were regenerated from the transformed cells (Step 5: Regeneration Step). Preferably, tissue masses regenerated from cotyledonous nodes grown in a medium containing a selective agent were cultured in solid media (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0259] Screened resistant tissues were transferred to B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, and N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6) and cultured at 25°C for differentiation. Differentiated seedlings were transferred to B5 rooting medium (3.1 g / L B5 salt, 1 g / L B5 vitamin, 1 g / L MES, 30 g / L sucrose, 8 g / L agar, 150 mg / L cephalosporin, 1 mg / L indole-3-butyric acid (IBA)), cultured at 25°C until they reached a height of approximately 10 cm, and then moved to a glass greenhouse to allow fruiting. In the greenhouse, the plants were cultured at 26°C for 16 hours, followed by 8 hours of culture at 20°C for one day.

[0260] Soybean T0 plants introduced with the SbHPPD-02 nucleotide sequence, soybean T0 plants introduced with the SbHPPDm-F372A-02 nucleotide sequence, soybean T0 plants introduced with the SbHPPDm-F383W-02 nucleotide sequence, soybean T0 plants introduced with the SbHPPDm-F372A-F383W-02 nucleotide sequence, and soybean T0 plants introduced with the control vector DBN11726N were transplanted into a greenhouse for cultivation and propagation to obtain the corresponding gene-modified T1 plants.

[0261] 3. Verification of genetically modified soybean plants using TaqMan 100 mg of leaves were collected as samples from soybean T1 plants into which the SbHPPD-02 nucleotide sequence was introduced, soybean T1 plants into which the SbHPPDm-F372A-02 nucleotide sequence was introduced, soybean T1 plants into which the SbHPPDm-F383W-02 nucleotide sequence was introduced, soybean T1 plants into which the SbHPPDm-F372A-F383W-02 nucleotide sequence was introduced, and soybean T1 plants into which the control vector DBN11726N was introduced. Genomic DNA was extracted using Qiagen's DNeasy Plant Maxi Kit, and the copy number of the EPSPS gene was detected by TaqMan probe fluorescence quantitative PCR to determine the copy number of the mutant HPPD gene. Simultaneously, wild-type soybean plants were used as a control and detection and analysis were performed according to the method described above. Three repeats were set up for the experiment and averaged.

[0262] The specific method for detecting the copy number of the EPSPS gene was as follows:

[0263] Step 11: 100 mg of leaves were taken from soybean T1 plants into which the SbHPPD-02 nucleotide sequence had been introduced, soybean T1 plants into which the SbHPPDm-F372A-02 nucleotide sequence had been introduced, soybean T1 plants into which the SbHPPDm-F383W-02 nucleotide sequence had been introduced, soybean T1 plants into which the SbHPPDm-F372A-F383W-02 nucleotide sequence had been introduced, soybean T1 plants into which the control vector DBN11726N nucleotide sequence had been introduced, and wild-type soybean plants. These were homogenized in a mortar using liquid nitrogen, and this process was repeated three times for each sample.

[0264] Step 12: Using Qiagen's DNeasy Plant Mini Kit, genomic DNA was extracted from the aforementioned samples using the specific method described in the product manual.

[0265] Step 13: The concentration of genomic DNA in the above-mentioned samples was detected using NanoDrop 2000 (Thermo Scientific).

[0266] Step 14: The genomic DNA concentrations of each of the above samples were adjusted to the same value within the range of 80 - 100 ng / μL.

[0267] Step 15: The copy number of the samples was determined using the Taqman probe fluorescence quantitative PCR method. Here, a sample with a known and determined copy number was used as a standard, and a sample of wild - type soybean plants was used as a control. Each sample was repeated 3 times and averaged. The sequences of the fluorescence quantitative PCR primers and probes were as follows.

[0268] For the detection of the EPSPS gene sequence, the following primers and probes were used. Primer 1: ctggaaggcgaggacgtcatcaata as described in SEQ ID NO: 232 of the Sequence Listing Primer 2: tggcggcattgccgaaatcgag as described in SEQ ID NO: 233 of the Sequence Listing Probe 1: atgcaggcgatgggcgcccgcatccgta as described in SEQ ID NO: 234 of the Sequence Listing PCR reaction system: JumpStart(™) Taq ReadyMix(™) (Sigma) 10 μL 50× primer / probe mixture 1 μL Genomic DNA 3 μL Water (ddH2O) 6 μL The 50× primer / probe mixture contained 45 μL of each primer with a concentration of 1 mM, 50 μL of the probe with a concentration of 100 μM, and 860 μL of 1×TE buffer, and was placed in an amber tube and stored at 4°C. PCR reaction conditions: Step Temperature Time 21 95°C 5 minutes 22 95°C 30 seconds 23 60°C 1 minute 24 Return to Step 22 and repeat 40 times The data was analyzed using the SDS2.3 software (Applied Biosystems).

[0269] By analyzing experimental results regarding the copy number of the EPSPS gene, it was further demonstrated that the SbHPPD-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F383W-02 nucleotide sequence, SbHPPDm-F372A-F383W-02 nucleotide sequence, and the control vector DBN11726N were all incorporated into the chromosomes of the detected soybean plants. This demonstrated that all soybean T1 plants, including those with the SbHPPD-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F383W-02 nucleotide sequence, SbHPPDm-F372A-F383W-02 nucleotide sequence, and the control vector DBN11726N nucleotide sequence, were single-copy gene-transformed soybean plants.

[0270] 4. Detection of herbicide resistance to HPPD inhibitor herbicides in genetically modified soybean plants Soybean T1 plants with the SbHPPD-02 nucleotide sequence introduced, soybean T1 plants with the SbHPPDm-F372A-02 nucleotide sequence introduced, soybean T1 plants with the SbHPPDm-F383W-02 nucleotide sequence introduced, soybean T1 plants with the SbHPPDm-F372A-F383W-02 nucleotide sequence introduced, soybean T1 plants with the control vector DBN11726N nucleotide sequence introduced, and wild-type soybean plants (seedling stage V3-V4) were treated with toprameson at three different concentrations (i.e., 25g ai / ha (1x field concentration, 1×), 100g ai / ha (4x field concentration, 4×), and 0g ai / ha (water, 0×)) and isoxaflutol at three different concentrations (i.e., 70g ai / ha (1x field concentration, 1×), 280g Herbicide resistance in soybean plants was detected by spraying with ai / ha (4x field concentration, 4×) and 0g ai / ha (water, 0×)), as well as mesotrione at three different concentrations (i.e., 105g ai / ha (1x field concentration, 1×), 420g ai / ha (4x field concentration, 4×), and 0g ai / ha (water, 0×)). Following the method of item 6 in Example 1, the degree of damage to each plant by the herbicide was statistically analyzed 7 days after spraying (7DAT), and scoring and resistance evaluation were performed accordingly. Soybean plants into which the SbHPPD-02 nucleotide sequence was introduced consisted of a total of two lines (S1 and S2), soybean plants into which the SbHPPDm-F372A-02 nucleotide sequence was introduced consisted of a total of two lines (S3 and S4), soybean plants into which the SbHPPDm-F383W-02 nucleotide sequence was introduced consisted of a total of two lines (S5 and S6), soybean plants into which the SbHPPDm-F372A-F383W-02 nucleotide sequence was introduced consisted of a total of two lines (S7 and S8), soybean plants into which the control vector DBN11726N nucleotide sequence was introduced consisted of a total of one line (S9), and soybean plants into which the wild-type plant consisted of a total of one line (CK1). Eight plants were selected from each line and detected. The results are shown in Tables 16 to 18.

[0271] [Table 21]

[0272] [Table 22]

[0273] [Table 23]

[0274] The results in Tables 16-18 show the following: (1) Compared to soybean plants into which the unmutated HPPD gene was introduced and wild-type soybean plants, soybean plants SbHPPDm-F372A-02, SbHPPDm-F383W-02, and SbHPPDm-F372A-F383W-02 were able to produce varying degrees of resistance to HPPD inhibitory herbicides at different concentrations, but DBN11726N did not have resistance to HPPD inhibitory herbicides. (2) Soybean plants into which the HPPD gene (F372A+F383W) with combinational mutations at positions 372 and 383 was introduced showed better herbicide resistance than soybean plants into which the HPPD gene with single-position mutations F372A or F383W was introduced, and furthermore, the effect of herbicide resistance was synergistically improved. This indicates that the mutated HPPD (F372A+F383W) can confer synergistically improved resistance to HPPD inhibitory herbicides to genetically modified soybean plants. Furthermore, it demonstrates the importance and stability of herbicide resistance to HPPD inhibitory herbicides conferred by the combination mutation at positions 372 and 383 of the HPPD amino acid sequence.

[0275] In conclusion, the present invention discloses for the first time that combination mutations at positions 372 and 383 of hydroxyphenylpyruvate dioxygenase polypeptides derived from various species can confer synergistically improved resistance to HPPD inhibitor herbicides such as pyrazolinates, isoxazoles, and triketones to plants, and in particular, can confer resistance to four times the field concentration of topramezone, isoxaflutol, or mesotrione to genetically modified soybean plants. Therefore, the present invention has potential for wide-area application in plants.

[0276] Finally, it should be noted that all the above embodiments are used solely to illustrate embodiments of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art will understand that embodiments of the present invention can be equivalently modified or replaced without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A mutant hydroxyphenylpyruvate dioxygenase polypeptide that retains the activity to catalyze the conversion of 4-hydroxyphenylpyruvate to homogentisic acid or homogentisate, and has lower sensitivity to HPPD inhibitory herbicides than wild-type HPPD, wherein the mutant hydroxyphenylpyruvate dioxygenase polypeptide includes the following amino acid mutations at positions corresponding to the amino acid sequence positions described in SEQ ID NO: 1, namely, substitution of F at position 372 with A, G, or V, and substitution of F at position 383 with W, and the amino acid sequence of the mutant hydroxyphenylpyruvate dioxygenase polypeptide has at least 90% sequence identity with the corresponding wild-type HPPD. Mutant hydroxyphenylpyruvate dioxygenase polypeptide.

2. The aforementioned mutant hydroxyphenylpyruvate dioxygenase polypeptide includes amino acid mutations at the following positions corresponding to the amino acid sequence positions described in SEQ ID NO: 1, namely, amino acid mutations in which F at position 372 is replaced with A and F at position 383 is replaced with W. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to claim 1.

3. The aforementioned mutant hydroxyphenylpyruvate dioxygenase polypeptide further comprises a second mutation, The second mutation includes at least one of the following amino acid mutations at a position corresponding to the amino acid sequence position described in Sequence ID No. 1: A106G, A107 deletion, A111T, or K351N. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to claim 1 or 2.

4. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1 to 3, wherein the mutant hydroxyphenylpyruvate dioxygenase polypeptide comprises a polypeptide having the amino acid sequence described in SEQ ID NO: 173, SEQ ID NO: 182, SEQ ID NO: 185, SEQ ID NO: 188, SEQ ID NO: 191, SEQ ID NO: 194, SEQ ID NO: 197, SEQ ID NO: 200, or SEQ ID NO:

203.

5. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1 to 4, wherein the mutant hydroxyphenylpyruvate dioxygenase polypeptide is derived from wild-type HPPD of a plant or microorganism.

6. A polynucleotide encoding a mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1 to 5.

7. An expression cassette or recombinant vector comprising the polynucleotide described in claim 6, wherein the expression cassette or recombinant vector is under the control of an effectively linked regulatory sequence.

8. A method for expanding the range of herbicides to which a plant is resistant, comprising expressing a mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1 to 5 together with at least one herbicide resistance protein other than the mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1 to 5.

9. A method for expanding the range of herbicides to which a plant is resistant, according to claim 8, wherein the herbicide resistance protein is 5-enolpyruvirshikimate-3-phosphate synthase (EPSPS), glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, alpha-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, acetolactate synthase, cytochrome-like protein, and / or protoporphyrinogen oxidase.

10. A method for selecting transformed plant cells, comprising transforming a plurality of plant cells with the polynucleotide described in claim 6, and culturing the transformed plant cells under a certain concentration of an HPPD inhibitor herbicide that enables the proliferation of the transformed plant cells expressing the polynucleotide, while killing or inhibiting the proliferation of non-transformed plant cells.

11. The method for selecting transformed plant cells according to claim 10, wherein the HPPD inhibitor herbicide comprises an HPPD inhibitor herbicide of the pyrazolinate, triketone, and / or isoxazole class.

12. The method for selecting transformed plant cells according to claim 11, wherein the pyrazolinate-based HPPD inhibitory herbicide is topramezone, the isoxazole-based HPPD inhibitory herbicide is isoxaflutol, and the triketone-based HPPD inhibitory herbicide is mesotrione.

13. A method for controlling weeds, comprising applying an effective amount of an HPPD inhibitor herbicide to a field where a target plant is planted, wherein the target plant contains the polynucleotide described in claim 6.

14. The method for controlling weeds according to claim 13, wherein the target plant is a glyphosate-resistant plant and the weed is a glyphosate-resistant weed.

15. The method for controlling weeds according to claim 13 or 14, wherein the HPPD inhibitor herbicide comprises an HPPD inhibitor herbicide of the pyrazolinate, triketone, and / or isoxazole class.

16. The method for controlling weeds according to claim 15, wherein the pyrazolinate-based HPPD inhibitor herbicide is topramezone, the isoxazole-based HPPD inhibitor herbicide is isoxaflutol, and the triketone-based HPPD inhibitor herbicide is mesotrione.

17. A method for protecting plants from damage caused by HPPD inhibitory herbicides or conferring resistance to HPPD inhibitory herbicides to plants, comprising introducing a polynucleotide according to claim 6 or an expression cassette or recombinant vector according to claim 7 into a plant, thereby causing the introduced plant to produce a sufficient amount of mutant hydroxyphenylpyruvate dioxygenase polypeptide to protect the plant from damage caused by the HPPD inhibitory herbicide.

18. A method for protecting plants from damage caused by an HPPD inhibitor herbicide or conferring resistance to an HPPD inhibitor herbicide to plants, according to claim 17, wherein the HPPD inhibitor herbicide comprises an HPPD inhibitor herbicide of the pyrazolinate, triketone, and / or isoxazole class.

19. A method for protecting plants from damage caused by an HPPD inhibitor herbicide or conferring resistance to an HPPD inhibitor herbicide to plants, according to claim 18, wherein the pyrazolinate-based HPPD inhibitor herbicide is topramezone, the isoxazole-based HPPD inhibitor herbicide is isoxaflutol, and the triketone-based HPPD inhibitor herbicide is mesotrione.

20. A method for producing a plant resistant to an HPPD inhibitor herbicide, comprising introducing the polynucleotide described in claim 6 into the genome of the plant.

21. The method for producing plants resistant to HPPD inhibitor herbicides according to claim 20, wherein the introduction method includes gene transformation, genome editing, or gene mutation.

22. The method for producing plants resistant to an HPPD inhibitor herbicide according to claim 19 or 20, wherein the HPPD inhibitor herbicide comprises an HPPD inhibitor herbicide of the pyrazolinate, triketone, and / or isoxazole class.

23. The method for producing plants resistant to HPPD inhibitors according to claim 22, wherein the pyrazolinate-based HPPD inhibitor herbicide is topramezone, the isoxazole-based HPPD inhibitor herbicide is isoxaflutol, and the triketone-based HPPD inhibitor herbicide is mesotrione.

24. A method for cultivating plants resistant to HPD inhibitor herbicides, Planting at least one plant reproduction containing the polynucleotide genome described in claim 6, Growing the aforementioned plant reproductive organism on a plant, Applying an effective amount of the HPPD inhibitor herbicide to a plant growing environment containing at least the aforementioned plants, and harvesting the plants with reduced plant damage and / or increased plant yield compared to other plants lacking the polynucleotide described in claim 6. Cultivation methods, including those mentioned above.

25. The method for cultivating plants resistant to HPPD inhibitors according to claim 24, wherein the HPPD inhibitor herbicide comprises an HPPD inhibitor herbicide of the pyrazolinate, triketone, and / or isoxazole class.

26. The method for cultivating plants resistant to HPPD inhibitors according to claim 25, wherein the pyrazolinate-based HPPD inhibitor herbicide is topramezone, the isoxazole-based HPPD inhibitor herbicide is isoxaflutol, and the triketone-based HPPD inhibitor herbicide is mesotrione.

27. A method for obtaining processed agricultural products, comprising processing the harvested product of an HPPD inhibitor herbicide-resistant plant obtained by the method described in any one of claims 24 to 26 to obtain processed agricultural products.

28. A planting system for controlling weed growth, comprising an HPPD inhibitor herbicide and a plant growth environment containing at least one target plant, wherein the target plant contains the polynucleotide described in claim 6.

29. The planting system for controlling weed growth according to claim 28, wherein the target plant is a glyphosate-resistant plant and the weed is a glyphosate-resistant weed.

30. The planting system for controlling weed growth according to claim 28 or 29, wherein the HPPD inhibitor herbicide comprises an HPPD inhibitor herbicide of the pyrazolinate, triketone, and / or isoxazole class.

31. The planting system for controlling weed growth according to claim 30, wherein the pyrazolinate-based HPPD inhibitory herbicide is topramezone, the isoxazole-based HPPD inhibitory herbicide is isoxaflutol, and the triketone-based HPPD inhibitory herbicide is mesotrione.

32. Use of a mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1 to 5 for conferring resistance to HPPD inhibitor herbicides to plants.

33. The use according to claim 32, wherein the HPPD inhibitor herbicide includes HPPD inhibitor herbicides of the pyrazolinate, triketone, and / or isoxazole classes.

34. The use according to claim 33, wherein the pyrazolinate-based HPPD inhibitory herbicide is topramezone, the isoxazole-based HPPD inhibitory herbicide is isoxaflutol, and the triketone-based HPPD inhibitory herbicide is mesotrione.

Citation Information

Patent Citations

  • HPPD variants and methods of use

    JP2015528310A

  • Soybean event syht0h2 and compositions and methods for detection thereof

    JP2020054343A

  • Mutant p-hydroxyphenylpyruvate dioxygenases, nucleic acids encoding same and uses thereof

    JP2021526849A

  • Cytochrome p450 genes conferring herbicide resistance

    WO2008150473A2

  • Mutant hydroxyphenylpyruvate dioxygenase polypeptide, encoding gene thereof and use thereof

    WO2021051265A1