Methods and compositions using RNA interference and antisense oligonucleotides for KRAS inhibition
RNA interference using targeted double-stranded RNA molecules addresses the challenge of specific KRAS mutation inhibition, effectively treating cancers by silencing mutant KRAS while preserving wild-type function.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-04-07
- Publication Date
- 2026-04-02
AI Technical Summary
Current therapeutic agents lack specificity in targeting mutant KRAS sequences while preserving wild-type KRAS, making KRAS a challenging target for cancer treatment.
Development of RNA interference-based compositions using double-stranded RNA molecules with antisense and sense strands targeting specific KRAS mutations (G12C, G12D, and G13D) to inhibit mutant KRAS expression while minimizing wild-type KRAS inhibition.
The approach effectively silences mutant KRAS genes, reducing cancer progression while maintaining wild-type KRAS function, demonstrating potential therapeutic benefits in treating cancers with KRAS mutations.
Smart Images

Figure 0007839554000014 
Figure 0007839554000015 
Figure 0007839554000016
Abstract
Description
Technical Field
[0001] [Description of Priority] This application claims the benefit of U.S. Application No. 16 / 842,404, filed Apr. 7, 2020, the entire contents of which are hereby incorporated by reference in their entirety.
[0002] The present invention relates to the inhibition of the expression of mutant KRAS sequences using RNA interference, antisense oligonucleotides and chemically modified oligonucleotides.
Background Art
[0003] Since their discovery in 1982, genes of the RAS family have been characterized as an important class of oncogenes (Cox et al., Nat. Rev. Drug Discov. 13:828 (2014)). Through extensive research over three decades, the mutational activation of certain RAS genes (KRAS, NRAS, and HRAS) has been implicated in approximately one-third of all cancers (Pecot et al., Mol. Cancer Ther. 13:2876 (2014)). In particular, KRAS mutations have been most frequently and exclusively observed, even in relation to other RAS isoforms (Cox et al., Nat. Rev. Drug Discov. 13:828 (2014)). Furthermore, despite efforts to develop inhibitors for this highly dominant mutation, no potent therapeutic candidates have emerged, and thus the KRAS gene has been evaluated as an elusive “undruggable” target.
[0004] The RAS gene encodes a family of small GTPases that act on downstream effector proteins to promote cell survival, growth, and proliferation (Khosravi-Far et al., Cancer Metastasis Rev. 13:67 (1994)). The proper function of the RAS protein depends on its activation to its active GTP-bound form via guanine nucleotide exchange factors (GEFs) and the membrane association of the RAS-GTP complex, both of which have been proposed as targets for KRAS inhibition. However, due to the low efficacy and target specificity of previously proposed therapeutic agents for direct KRAS inhibition, current means of targeting the KRAS pathway are mainly focused on inhibiting downstream effector proteins (Cox et al., Nat. Rev. Drug Discov. 13:828 (2014)). Nevertheless, even though it is difficult to develop small molecules that directly downregulate gene activity, KRAS remains a therapeutic-related target due to its ubiquity as a driving mutation in human cancers.
[0005] Advances in RNA interference (RNAi) suggest its potential as an effective means of knocking down KRAS expression. RNAi therapy selectively silences specific genes at the mRNA level using an interaction between exogenous small interfering RNA (siRNA) and an endogenous enzymatic mechanism called the RNA-induced silencing complex (RISC) (Pecot et al., Nat. Rev. Cancer 11:59 (2011)). Recent studies have revealed the efficacy of RNAi as a well-tolerated treatment for inducing metastatic regression in human cancer patients (Tabernero et al., Cancer Discov. 3:406 (2013)). In addition, we recently confirmed the efficacy of siRNA delivery for human KRAS knockdown in various lung and colon cancer models, both in vitro and in vivo, using nanoliposomes (Pecot et al., Mol. Cancer Ther. 13:2876 (2014)).
[0006] However, it still lacks target specificity for mutant KRAS compared to the wild-type (WT) allele. Despite the oncogenic properties of the mutant allele, WT KRAS is necessary for proper response to extracellular inputs that promote survival in non-cancer cells (Khosravi-Far et al., Cancer Metastasis Rev.13:67 (1994)). Therefore, there is a need for inhibitors that target mutant KRAS while preserving (spare) WT-KRAS (wild-type KRAS).
[0007] Therefore, the present invention overcomes the shortcomings in the art by providing compositions and methods that use RNA interference for the specific inhibition of mutant KRAS sequences. [Overview of the Initiative]
[0008] The present invention is based on the identification of an RNA molecule that inhibits the expression of mutant KRAS sequences while preserving the expression of WT-KRAS. Accordingly, one aspect of the present invention relates to a double-stranded RNA molecule comprising an antisense strand and a sense strand, wherein the nucleotide sequence of the antisense strand is complementary to a region of the nucleotide sequence of a synthetic human KRAS gene containing missense mutations G12C, G12D and G13D, or missense mutations G12C, G12V and G13D, which essentially consists of about 18 to about 25 consecutive nucleotides, and the double-stranded RNA molecule inhibits the expression of a mutant human KRAS gene containing one or more of the missense mutations G12C, G12D, G12V and G13D, and minimizes the inhibition of wild-type human KRAS expression.
[0009] Another aspect of the present invention relates to a composition comprising one or more RNA molecules of the present invention, such as a pharmaceutical composition.
[0010] A further aspect of the present invention relates to a method for inhibiting the expression of mutant human KRAS genes containing one or more missense mutations G12C, G12D, G12V, and G13D in cells, comprising contacting the cells with the RNA molecules of the present invention, thereby inhibiting the expression of mutant human KRAS genes in the cells.
[0011] An additional aspect of the present invention relates to a method for treating cancer in a subject requiring treatment, wherein the cancer comprises a mutant human KRAS gene containing one or more missense mutations G12C, G12D, G12V, and G13D, and the method comprises delivering the RNA molecule of the present invention to the subject, thereby treating the cancer in the subject.
[0012] Another aspect of the present invention relates to the use of the RNA molecule of the present invention for inhibiting the expression of a mutant human KRAS gene containing one or more missense mutations G12C, G12D, G12V, and G13D in cells, and for treating cancer in subjects requiring cancer treatment, wherein the cancer contains a mutant human KRAS gene containing one or more missense mutations G12C, G12D, G12V, and G13D.
[0013] A further aspect of the present invention relates to antisense oligonucleotides targeted to synthetic human KRAS-mRNA encoding missense mutations G12C, G12D, and G13D, having a length of 16 to 25 nucleotides and containing the sequence TCTTGCCTACGTCATA (SEQ ID NO: 114).
[0014] An additional aspect of the present invention is an antisense oligonucleotide targeted to native human KRAS-mRNA encoding a mutation selected from G12C, G12D, G12V, and G13D, having a length of 16 to 25 nucleotides. a) TCTTGCCTACGCCACA (SEQ ID NO: 117), which targets human KRAS-mRNA encoding the G12C mutation. b) TCTTGCCTACGCCATC (SEQ ID NO: 118), which targets human KRAS-mRNA encoding the G12D mutation. c) TCTTGCCTACGCCAAC (SEQ ID NO: 119), which targets human KRAS-mRNA encoding the G12V mutation. d) TCTTGCCTACGTCACC (SEQ ID NO: 120), which targets human KRAS-mRNA encoding the G13D mutation, or e)a)~d) is at least 90% identical to one of the given sequences. This relates to an antisense oligonucleotide comprising a sequence selected from and containing at least one non-natural chemical modification.
[0015] Another aspect of the present invention is an siRNA molecule targeted to native human KRAS-mRNA encoding a mutation selected from G12C, G12D, G12V, and G13D, comprising at least one chemical modification, The sense strand of sequence number 128 and the antisense strand of sequence number 129, The sense strand of sequence number 130 and the antisense strand of sequence number 131, The sense strand of sequence number 132 and the antisense strand of sequence number 133, The sense strand of sequence number 134 and the antisense strand of sequence number 135, The sense strand of sequence number 136 and the antisense strand of sequence number 137, The sense strand of sequence number 138 and the antisense strand of sequence number 139, The sense strand of sequence number 140 and the antisense strand of sequence number 141, The sense strand of sequence number 142 and the antisense strand of sequence number 143, The sense strand of sequence number 144 and the antisense strand of sequence number 145, The sense strand of sequence number 146 and the antisense strand of sequence number 147, The sense strand of sequence number 148 and the antisense strand of sequence number 149, The sense strand of sequence number 150 and the antisense strand of sequence number 151, The sense strand of SEQ ID NO: 152 and the antisense strand of SEQ ID NO: 153, The sense strand of SEQ ID NO: 154 and the antisense strand of SEQ ID NO: 155, The sense strand of SEQ ID NO: 156 and the antisense strand of SEQ ID NO: 157 or The sense strand of SEQ ID NO: 158 and the antisense strand of SEQ ID NO: 159 Relates to one of the sequence pairs, or an siRNA molecule comprising a sequence at least 90% identical thereto.
[0016] An additional aspect of the invention relates to an siRNA molecule targeted to human KRAS-mRNA, wherein the sense strand of the siRNA comprises the sequence of SEQ ID NO: 50 or SEQ ID NO: 51, and the siRNA comprises at least one non-natural chemical modification.
[0017] Another aspect of the invention relates to a composition comprising one or more of the antisense oligonucleotides or siRNA molecules of the invention, such as a pharmaceutical composition.
[0018] A further aspect of the invention is a method of inhibiting the expression of a mutant human KRAS gene comprising one or more of the missense mutations G12C, G12D, G12V and G13D in a cell, the method comprising contacting the cell with an antisense oligonucleotide or siRNA molecule of the invention, thereby inhibiting the expression of the mutant human KRAS gene in the cell.
[0019] An additional aspect of the invention is a method of treating cancer in a subject that requires treatment for cancer, wherein the cancer comprises a mutant human KRAS gene comprising one or more of the missense mutations G12C, G12D, G12V and G13D, the method comprising delivering an antisense oligonucleotide or siRNA molecule of the invention to the subject, thereby treating the cancer in the subject.
[0020] Another aspect of the invention relates to the use of an antisense oligonucleotide or siRNA molecule of the invention for inhibiting the expression of a mutant human KRAS gene comprising one or more of the missense mutations G12C, G12D, G12V, and G13D in a cell and for treating cancer in a subject needing treatment for cancer, wherein the cancer comprises a mutant human KRAS gene comprising one or more of the missense mutations G12C, G12D, G12V, and G13D.
[0021] These and other aspects of the invention are set forth in more detail in the following description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] [Figure 1] The KRAS-siRNA sequences (SEQ ID NOs: 40-51) are shown. The TMS-siRNA sequences were designed to bind to the G domain of the human KRAS gene at codons 12 and 13 and target three point mutations (each indicated by an asterisk). The underlines indicate the remaining base pairs targeted by the siRNA (sense). The sequences for G12C and G12D siRNA were obtained from Fleming et al., Mol. Cancer Res. 3:413 (2005). The positive control siRNAs (Seq2 and Seq3) were obtained from Pecot et al., Mol. Cancer Ther. 13:2876 (2014) and targeted the downstream coding region of KRAS-mRNA. [Figure 2A] Shows the KRAS expression levels of mutant-specific (MS) siRNAs. NIH3T3 cells infected with human WT, G12C, G12D, G12V, or G13D KRAS were reverse transfected with MS-siRNA sequences (12CD13D_1, 12CD13D_2, 12CD13D_3, 12CD13D_4, 12CV13D_1, and 12CV13D_2) or a non-specific sequence. [Figure 2B]This shows the KRAS expression levels of the control siRNA. NIH3T3 cells infected with human WT, G12C, G12D, G12V, or G13D KRAS were reverse-transfected with control mutant-specific siRNA or non-specific sequences. [Figure 3] This paper describes the testing of custom KRAS-siRNA sequences 12CD13D_1 and 12CD13D_4 in KRAS-G12D mutant lung cancer cell lines. [Figure 4] This shows the library of siRNA sequences (sequence numbers 45-51) used to test all possible siRNA sequence rearrangements between custom siRNA sequences. [Figure 5] This shows the relative expression of wild-type and mutant KRAS-mRNA in 3T3 cells. [Figure 6] A schematic diagram of antisense oligonucleotide screening for synthetic KRAS genes is shown (SEQ ID NOs. 52 and 53). [Figure 7] Sixteen antisense oligonucleotides demonstrate the ability to inhibit mutant KRAS expression in A431 cells. A431 cells were genetically engineered to remove the wild-type KRAS allele, and individual A431 clones express one of the following human KRAS mutant alleles: KRAS-G12C, KRAS-G12D, KRAS-G12V, or KRAS-G13D (as shown), thus being conditioned to control gymnosis delivery mechanisms, oligonucleotide transport, and RNase H silencing activity. [Figure 8] This study demonstrates the ability of six antisense oligonucleotides at different concentrations to inhibit mutant KRAS expression in genetically modified A431 cells. [Figure 9] Chemically modified ASO16 antisense oligonucleotides demonstrate the ability to inhibit mutant KRAS expression in genetically engineered A431 cells. [Figure 10] This shows the dose-response of KRAS-G12C-specific ASOs. [Figure 11]This demonstrates improvement in wild-type KRAS preservation with G12C-specific ASO. [Figure 12] This shows the activity of fully modified siRNA targeting the KRAS-G12C mutation in genetically engineered A431 cells expressing KRAS-G12C. [Figure 13] This shows the activity of fully modified siRNA targeting the KRAS-G12C mutation in genetically engineered A431 cells expressing KRAS-G12C. [Figure 14] This shows the activity of fully modified siRNA targeting the KRAS-G12D mutation in genetically engineered A431 cells expressing KRAS-G12D. [Figure 15] This shows the activity of fully modified siRNA targeting the KRAS-G12D mutation in genetically engineered A431 cells expressing KRAS-G12D. [Figure 16] This shows the activity of fully modified siRNA targeting the KRAS-G12V mutation in genetically engineered A431 cells expressing KRAS-G12V. [Figure 17] This shows the activity of fully modified siRNA targeting the KRAS-G12V mutation in genetically engineered A431 cells expressing KRAS-G12V. [Figure 18] This shows the activity of fully modified siRNA targeting the KRAS-G13D mutation in genetically engineered A431 cells expressing KRAS-G13D. [Figure 19] This shows the activity of fully modified siRNA targeting the KRAS-G13D mutation in genetically engineered A431 cells expressing KRAS-G13D. [Figure 20] The results of cell viability experiments using G12D-targeted siRNA are shown. [Figure 21] The results of cell viability experiments using G12D-targeted siRNA are shown. [Figure 22] The results of cell viability experiments using G13D-targeted siRNA are shown. [Figure 23]The results of cell viability experiments using G13D-targeted siRNA are shown. [Figure 24] This paper presents in vivo evidence of KRAS silencing in HCT116 tumors. [Figure 25] The results of cell viability experiments using G12V-targeted siRNA are shown. [Figure 26] The results of cell viability experiments using G12V-targeted siRNA are shown. [Figure 27] EFTX-D1 siRNA inhibits mutant KRAS expression and preserves the wild type. [Figure 28] This shows the activity of fully modified siRNA targeting KRAS in HCT116 (KRAS-G13D mutant) cells and LU65 (KRAS-G12C mutant) cells. [Modes for carrying out the invention]
[0023] The present invention will be described in more detail here with reference to the accompanying drawings illustrating preferred embodiments of the invention. However, the present invention can be embodied in various forms and should not be construed as being limited to the embodiments shown herein. Rather, these embodiments are provided so as to ensure that this disclosure is thorough and complete and to fully convey the scope of the invention to those skilled in the art.
[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the invention pertains. Terms used herein in describing the invention are for the sole purpose of describing specific embodiments and are not intended to be limitations of the invention. All publications, patent applications, patents, patent publications and other references cited herein are incorporated by reference as a whole with respect to the teachings relating to the sentences and / or sections in which the references are indicated.
[0025] Unless otherwise specified, nucleotide sequences are shown exclusively in single strands, from left to right in the 5' to 3' direction. Nucleotides and amino acids are represented herein in the format recommended by the IUPAC-IUB Biochemical Nomenclature Committee, or (for amino acids) in either single-letter or three-letter notation according to 37 CFR §1.822 and established usage.
[0026] Unless otherwise indicated, standard methods known to those skilled in the art can be used for cloning genes, amplifying and detecting nucleic acids, and so on. Such techniques are known to those skilled in the art. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor, NY, 1989); and Ausubel et al., Current Protocols in Molecular Biology (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).
[0027] Unless otherwise indicated by the context, the various features of the present invention described herein are expressly intended to be used in any combination.
[0028] Furthermore, the present invention intends that in some embodiments of the present invention, any feature or combination of features shown herein may be excluded or omitted.
[0029] For illustrative purposes, where the specification refers to a complex comprising components A, B, and C, it is particularly intended that any one of A, B, or C, or any combination thereof, may be omitted or discarded individually or in any combination.
[0030] [Definition] As used in the description of this invention and the accompanying claims, the singular forms "a," "an," and "the" are intended to include the plural forms unless the context clearly indicates otherwise.
[0031] Furthermore, as used herein, “and / or” means any and all possible combinations of one or more of the related enumerated items, and, when interpreted as alternative ("or"), the absence of any combination.
[0032] When used herein, the term "approximately" means that when referring to measurable values such as the amount, dose, time, temperature, enzyme activity, or other biological activity of a polypeptide, it encompasses a variation of ±20%, ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of a particular amount.
[0033] As used herein, the transitional phrase (and grammatical variation) "consisting essentially of" should be interpreted as encompassing the enumerated materials or steps and any materials or steps that do not substantially affect the basic and novel features of the claimed invention. Therefore, as used herein, the term "consisting essentially of" should not be interpreted as equivalent to "comprising."
[0034] The term "essentially consisting of" (and its grammatical variation), when applied to the polynucleotide sequences of the present invention, means a polynucleotide consisting of both the enumerated sequence (e.g., sequence number) and a total of 10 or fewer additional nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) at the 5' and / or 3' ends of the enumerated sequence such that the function of the polynucleotide is substantially altered. The total of 10 or fewer additional nucleotides includes the total number of additional nucleotides at both ends combined. The term "substantially altered," when applied to the polynucleotides of the present invention, means an increase or decrease in the ability to inhibit the expression of a target mRNA by at least about 50% or more compared to the expression level of the polynucleotide consisting of the enumerated sequence.
[0035] The terms "improve" or "increase" refer to an increase in a particular parameter of at least approximately 1.25 times, 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 8 times, 10 times, 12 times, or even 15 times.
[0036] The terms “inhibit” or “reduce,” or their grammatical variations, as used herein, refer to a reduction or attenuation of a particular level or activity of at least about 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95%, or more. In certain embodiments, inhibition or reduction results in little to no detectable activity (at most a small amount, e.g., about 10% or even less than 5%).
[0037] A “therapeutic” dose, as used herein, is an amount that provides some improvement or benefit to a subject. In other words, a “therapeutic” dose is an amount that provides some relief, mitigation, or reduction of at least one clinical symptom in a subject (for example, in the case of cancer, a reduction in tumor volume, prevention of further tumor growth, prevention of metastasis, or an increase in survival time). Those skilled in the art will understand that the therapeutic effect does not have to be complete or curative, as long as some benefit is provided to the subject.
[0038] The terms “to treat,” “to treat,” or “to treat” imply that the severity of the condition in question is reduced or at least partially improved or altered, and that some reduction, mitigation, or decrease of at least one clinical symptom is achieved.
[0039] "Preventing" or "preventing" means preventing or delaying the onset of a disorder in a subject, and / or reducing the severity of the disorder, compared to the severity that could progress in the absence of the method of the present invention. Prevention may be complete prevention, for example, the complete absence of cancer in the subject. Prevention may also be partial prevention, such that the occurrence or severity of cancer in the subject is less than what could occur without the present invention.
[0040] As used herein, “nucleic acid,” “nucleotide sequence,” and “polynucleotide” are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemosynthetic) DNA or RNA, and RNA and DNA chimeras. The terms polynucleotide, nucleotide sequence, or nucleic acid refer to a chain of nucleotides, regardless of chain length. A nucleic acid may be double-stranded or single-stranded. If single-stranded, the nucleic acid may be a sense strand or an antisense strand. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids with altered base-pairing ability or increased resistance to nucleases. The present invention further provides nucleic acids (which may be either complete or partial complements) that are complements to the nucleic acids, nucleotide sequences, or polynucleotides of the present invention. When dsRNA is synthesized, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, and others may also be used for antisense, dsRNA, and ribozyme pairing. For example, polynucleotides containing C-5 propine analogs of uridine and cytidine have been shown to bind to RNA with high affinity and to be potent antisense inhibitors of gene expression. Other modifications, such as phosphodiester backbones or modifications of the ribose sugar group of RNA to 2'-hydroxyl groups, may also be performed.
[0041] An "isolated polynucleotide" is a nucleotide sequence (e.g., DNA or RNA) that is not directly adjacent to any nucleotide sequences in the natural genome of the organism from which it originates (one at the 5' end and one at the 3' end). Therefore, in one embodiment, an isolated nucleic acid includes some or all of a 5' non-coding (e.g., promoter) sequence directly adjacent to a coding sequence. Thus, this term includes recombinant DNA (e.g., cDNA or genomic DNA fragments produced by PCR or restriction endonuclease treatment) that is incorporated independently of other sequences, for example, into a vector, an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryotic or eukaryotic organism, or that exists as another molecule. It also includes recombinant DNA that is a portion of a hybrid nucleic acid encoding an additional polypeptide or peptide sequence. An isolated polynucleotide containing a gene is not a chromosome fragment containing such a gene, but rather includes the coding and regulatory regions associated with the gene, but does not include any additional genes naturally found in the chromosome.
[0042] The term “isolated” may mean a nucleic acid, nucleotide sequence, or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (if produced by recombinant DNA techniques) or chemical precursors or other chemicals (if chemically synthesized). Furthermore, “isolated fragment” refers to a fragment of a nucleic acid, nucleotide sequence, or polypeptide that does not exist naturally as a fragment and is not found in its natural state. “Isolated” does not mean that the preparation is technically pure (homogeneous), but that the preparation is pure enough to provide a polypeptide or nucleic acid in a form that can be used for its intended purpose.
[0043] "Isolated cells" refers to cells that are separated from other components that are normally associated with them in their natural state. For example, isolated cells may be cells in a culture medium and / or cells in a pharmaceutically acceptable carrier of the present invention. Thus, isolated cells can be delivered to and / or introduced into a subject. In some embodiments, isolated cells may be cells that are removed from the subject, manipulated ex vivo as described herein, and then returned to the subject.
[0044] When applied to polynucleotides, the term “fragment” will be understood to mean a nucleotide sequence that is reduced in length compared to a reference nucleic acid or nucleotide sequence and contains a nucleotide sequence of consecutive nucleotides that is identical or nearly identical (e.g., 90%, 92%, 95%, 98%, 99% identical) to the reference nucleic acid or nucleotide sequence, essentially consisting of and / or comprising. Such nucleic acid fragments according to the present invention may, where appropriate, be contained within a larger polynucleotide of which it is a component. In some embodiments, such fragments may contain, essentially consisting of and / or comprising oligonucleotides having a nucleic acid or nucleotide sequence according to the present invention having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200 or more consecutive nucleotides.
[0045] When applied to polypeptides, the term “fragment” will be understood to mean an amino acid sequence that is reduced in length compared to a reference polypeptide or amino acid sequence and contains an amino acid sequence of consecutive amino acids that is identical or nearly identical (e.g., 90%, 92%, 95%, 98%, 99% identical) to the reference polypeptide or amino acid sequence, essentially consisting of and / or comprising an amino acid sequence of consecutive amino acids. Such polypeptide fragments according to the present invention may, where appropriate, be contained within a larger polypeptide of which it is a component. In some embodiments, such fragments may consist of and / or comprise a polypeptide or peptide having an amino acid sequence according to the present invention having a length of at least about 4, 6, 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200 or more consecutive amino acids.
[0046] A “vector” is any nucleic acid molecule for the cloning of nucleic acids and / or the transfer of nucleic acids into cells. A vector can be a replicon to which another nucleotide sequence can be bound, enabling the replication of the bound nucleotide sequence. A “replicon” can be any genetic element (e.g., plasmid, phage, cosmid, chromosome, viral genome) that functions as an autonomous unit of nucleic acid replication in vivo, i.e., can replicate under its own control. The term “vector” includes both viral and non-viral (e.g., plasmid) nucleic acid molecules for in vitro, ex vivo, and / or in vivo introduction of nucleic acids into cells. Numerous vectors known in the art can be used to manipulate nucleic acids, incorporate response elements and promoters into genes, and so on. For example, insertion of nucleic acid fragments corresponding to response elements and promoters into a suitable vector can be achieved by ligating the appropriate nucleic acid fragments into a selected vector having complementary attachment ends. Alternatively, the ends of a nucleic acid molecule may be enzymatically modified, or any site may be produced by ligating a nucleotide sequence (linker) to the nucleic acid end. Such vectors may be manipulated to include sequences that contain the vector and / or encode a selectable marker, which provides selection of cells that incorporate the vector's nucleic acid into the cellular genome. Such markers enable the identification and / or selection of host cells that incorporate and express the protein encoded by the marker. A “recombinant” vector refers to a viral or nonviral vector containing one or more heterogeneous nucleotide sequences (i.e., transgenes), e.g., two, three, four, five or more heterogeneous nucleotide sequences.
[0047] Viral vectors are used in a variety of gene delivery applications in cells and living animals. Viral vectors that can be used include, but are not limited to, retroviruses, lentiviruses, adeno-associated viruses, poxviruses, alphaviruses, baculoviruses, vaccinia viruses, herpesviruses, Epstein-Barr viruses, and / or adenovirus vectors. Non-viral vectors include, but are not limited to, plasmids, liposomes, charged lipids (cytofectin), nucleic acid-protein complexes, and biopolymers. In addition to the nucleic acid of interest, vectors may also contain one or more regulatory regions and / or selectable markers useful for selection, measurement, and monitoring of nucleic acid delivery outcomes (such as delivery to specific tissues and duration of expression).
[0048] The vector can be introduced into desired cells by methods known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or nucleic acid vector transporter (see, for example, Wu et al., J. Biol. Chem. 267:963 (1992); Wu et al., J. Biol. Chem. 263:14621 (1988); and Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990).
[0049] In some embodiments, the polynucleotides of the present invention can be delivered to cells in vivo by lipofection. Liposomes for in vivo transfection of the nucleotide sequences of the present invention can be prepared using synthetic cationic lipids designed to limit the difficulties and risks encountered in liposome-mediated transfection (Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413 (1987); Mackey, et al., Proc. Natl. Acad. Sci. USA 85:8027 (1988); and Ulmer et al., Science 259:1745 (1993)). The use of cationic lipids can promote encapsulation of negatively charged nucleic acids and also promote fusion with negatively charged cell membranes (Felgner et al., Science 337:387 (1989)). Lipid compounds and compositions particularly useful for nucleic acid transfer are described in International Patent Publications WO 95 / 18863 and WO 96 / 17823, and in U.S. Patent No. 5,459,127. The use of lipofection for introducing exogenous nucleotide sequences into specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells exhibits a range of advantages. It is clear that directing transfection to specific cell types may be particularly preferable in tissues with cellular heterogeneity, such as the pancreas, liver, kidney, and brain. Lipids can be chemically coupled to other molecules for targeting purposes (Mackey, et al., 1988, above). Targeted peptides, such as hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules, can be chemically coupled to liposomes.
[0050] In various embodiments, other molecules such as cationic oligopeptides (e.g., WO95 / 21931), peptides derived from nucleic acid-binding proteins (e.g., WO96 / 25508), and / or cationic polymers (e.g., WO95 / 21931) can be used to facilitate in vivo delivery of nucleic acids.
[0051] Furthermore, it is possible to introduce the vector as a naked nucleic acid in vivo (see U.S. Patents No. 5,693,622, 5,589,466, and 5,580,859). Alternatively, receptor-mediated nucleic acid delivery methods may be used (Curiel et al., Hum. Gene Ther. 3:147 (1992); Wu et al., J. Biol. Chem. 262:4429 (1987)).
[0052] As used herein, the terms “protein” and “polypeptide” are used interchangeably unless otherwise indicated and encompass both peptides and proteins.
[0053] A “fusion protein” is a polypeptide produced when two heterogeneous nucleotide sequences or fragments of two (or more) different polypeptides, which are not found to be fused together in nature, are fused together in a correct translational reading frame. Exemplary fusion polypeptides include the fusion of all or part of the polypeptide (or fragment thereof) of the present invention to glutathione-S-transferase, maltose-binding protein, or reporter protein (e.g., green fluorescent protein, β-glucuronidase, β-galactosidase, luciferase, etc.), hemagglutinin, c-myc, FLAG epitope, etc.
[0054] The terms "expressing" or "expressing" a polynucleotide coding sequence mean that the sequence is transcribed and, if applicable, translated. Typically, according to the present invention, the expression of the coding sequence of the present invention results in the production of the polypeptide of the present invention. Furthermore, the entire polypeptide or fragments expressed can function in intact cells without purification.
[0055] As used herein, the term “gene” refers to a nucleic acid molecule that can be used to produce mRNA, antisense RNA, miRNA, etc. A gene may or may not be used to produce a functional protein. A gene may include both coding and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, stop sequences, and 5' and 3' untranslated regions). A gene may be “isolated,” by which a nucleic acid substantially or essentially does not contain the components that are normally found in association with nucleic acids in their native state. Such components include other cellular material, culture media from recombinant production, and / or various chemicals used in the chemosynthesis of nucleic acids.
[0056] As used herein, “complementary” polynucleotides are polynucleotides that can form base pairs according to the standard Watson-Crick complementarity rules. In particular, purines base pair with pyrimidines to form combinations of guanine (G:C) paired with cytosine, adenine (A:T) paired with thymine in the case of DNA, or adenine (A:U) paired with uracil in the case of RNA. For example, the sequence “AGT” binds to the complementary sequence “TCA”. It is understood that even if two polynucleotides are not perfectly complementary to each other, they can hybridize as long as each has at least one region that is substantially complementary to the other.
[0057] The terms “complementary” or “complementarity,” as used herein, refer to the innate bonding of polynucleotides by base pairing under acceptable salt and temperature conditions. Complementarity between two single-stranded molecules may be “partial,” with only a portion of the nucleotides bonding, or it may be complete if complete complementarity exists between the single-stranded molecules. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
[0058] As used herein, the terms “substantially complementary” or “partially complementary” mean that two nucleic acid sequences are complementary to at least about 50%, 60%, 70%, 80%, or 90% of their nucleotides. In some embodiments, two nucleic acid sequences may be complementary to at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more of their nucleotides. The terms “substantially complementary” and “partially complementary” may also mean that two nucleic acid sequences can hybridize under high stringency conditions, such conditions being well known in the art.
[0059] As used herein, “heterogeneous” means a nucleic acid sequence that originates from a different species, or that originates from the same species or organism but has been modified from its original form or the form primarily expressed in its cells. Thus, a nucleotide sequence that originates from a different organism or species than the organism or species into which the nucleotide sequence is introduced is heterogeneous with respect to that cell and its offspring. In addition, heterogeneous nucleotide sequences include nucleotide sequences that originate from the same native original cell species and are inserted into it, but exist in a non-native state, for example, at a copy number different from that found in nature, and / or under the control of regulatory sequences different from those found in nature.
[0060] As used herein, the terms “contact,” “introduce,” and “administer” are interchangeable and refer to the process by which the dsRNA of the present invention or a nucleic acid molecule encoding the dsRNA of the present invention is delivered to a cell in order to inhibit, alter, or modify the expression of a target gene. The dsRNA can be administered in several ways, including, but not limited to, direct introduction into a cell (i.e., intracellularly) and / or extracellular introduction into the lumen, interstitial space, or circulation of an organism.
[0061] In the context of cells or organisms, “introduce” means presenting nucleic acid molecules to an organism and / or cell in a manner that allows the nucleic acid molecules to access the inside of the cell. If two or more nucleic acid molecules are to be introduced, these nucleic acid molecules may be assembled as parts of a single polynucleotide or nucleic acid construct, or as separate polynucleotides or nucleic acid constructs, and may be located in the same nucleic acid construct or in different nucleic acid constructs. Thus, these polynucleotides may be introduced into the cell in a single transformation event or in separate transformation events. Therefore, the term “transformation,” as used herein, refers to the introduction of heterologous nucleic acids into a cell. Cellular transformation can be stable or transient.
[0062] In the context of polynucleotides, "transient transformation" means that polynucleotides are introduced into cells but are not integrated into the cell's genome.
[0063] In the context of introducing polynucleotides into cells, "stable introduction" or "stable introduction" implies that the introduced polynucleotides are stably integrated into the cell's genome, and therefore the cell is stably transformed by the polynucleotides.
[0064] As used herein, “stable transformation” or “stable transformed” means that a nucleic acid molecule is introduced into a cell and integrated into the cell’s genome. The integrated nucleic acid molecule can then be inherited by subsequent generations, more particularly by a large number of successive generations. “Genome” as used herein includes the nuclear and mitochondrial genomes, and therefore includes the integration of nucleic acids into, for example, the mitochondrial genome. Furthermore, as used herein, stable transformation may refer to a transgene maintained outside of chromosomes, for example, as a minichromosome.
[0065] Transient transformation can be detected, for example, by enzyme-linked immunosorbent assay (ELISA) or Western blotting, which can detect the presence of peptides or polypeptides encoded by one or more transgenes introduced into an organism. Suitable cell transformation can be detected, for example, by Southern blotting hybridization assay of the cell's genomic DNA using a nucleic acid sequence that specifically hybridizes with the nucleotide sequence of the transgene introduced into the organism. Stable cell transformation can be detected, for example, by Northern blotting hybridization assay of the cell's RNA using a nucleic acid sequence that specifically hybridizes with the nucleotide sequence of the transgene introduced into the organism. Stable cell transformation can also be detected, for example, by polymerase chain reaction (PCR) or other amplification reactions well known in the art, which result in amplification of the transgene sequence using specific primer sequences that hybridize with target sequences (one or more) of the transgene, and which can be detected according to standard methods. Transformation can also be detected by direct sequencing and / or hybridization protocols well known in the art.
[0066] Embodiments of the present invention relate to expression cassettes designed to express the nucleic acids of the present invention. As used herein, “expression cassette” means a nucleic acid molecule having at least one regulatory sequence operably linked to a nucleotide sequence of interest. In this form, for example, a promoter operably interacting with a nucleotide sequence for the siRNA of the present invention is provided in the expression cassette for expression in an organism or cell.
[0067] As used herein, the term “promoter” refers to a region of nucleotide sequence that incorporates the signal necessary for the efficient expression of a coding sequence. This may include, but is not limited to, a sequence to which RNA polymerase binds, and may also include regions to which other regulatory proteins bind, regions involved in the regulation of protein translation, and may also include coding sequences.
[0068] Furthermore, the “promoter” of the present invention is a promoter capable of initiating transcription in the cells of an organism. Such promoters include promoters that constitutively drive the expression of a nucleotide sequence, promoters that drive expression when induced, and promoters that drive expression in a tissue-specific or development-specific manner, and various types of these promoters are known in the art.
[0069] For the purposes of the present invention, regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational stop regions) may be native / analogous to an organism or cell, and / or a regulatory region may be native / analogous to other regulatory regions. Alternatively, regulatory regions may be heterogeneous to an organism or cell, and / or to each other (i.e., to regulatory regions). Thus, for example, a promoter may be heterogeneous if it is operably ligated to a polynucleotide from a different species than the one from which the polynucleotide originates. Alternatively, a promoter may be heterogeneous to a selected nucleotide sequence if it is a promoter from the same / similar species as the one from which the polynucleotide originates, but one or both (i.e., the promoter and the polynucleotide) are substantially modified from their original form and / or genomic locus, or if the promoter is not a native promoter for the operably ligated polynucleotide.
[0070] The choice of promoter to use depends, non-limitingly, on several factors, including cell-specific or tissue-specific expression, desired expression level, efficiency, inducibility, and selectability. For example, if expression in a specific tissue or organ is desired, a tissue-specific promoter can be used. In contrast, if stimulus-responsive expression is desired, an inducible promoter can be used. If continuous expression throughout the cells of an organism is desired, a constitutive promoter can be used. Modulating the expression of a nucleotide sequence by appropriately selecting and positioning promoters and other regulatory regions relative to the nucleotide sequence is a routine matter for those skilled in the art.
[0071] In addition to the promoters described above, expression cassettes may also contain other regulatory sequences. As used herein, “regulatory sequence” means a nucleotide sequence located upstream (5' non-coding sequence), midway, or downstream (3' non-coding sequence) of a coding sequence that affects transcription, RNA processing, or stability, or translation of the associated coding sequence. Regulatory sequences include, but are not limited to, enhancers, introns, translational leader sequences, and polyadenylation signal sequences.
[0072] Furthermore, expression cassettes may optionally contain transcriptional and / or translational stop regions (i.e., stop regions) that are functional in the organism. Various transcriptional terminators are available for use in expression cassettes and are responsible for transcriptional stoppage beyond the transgene and precise mRNA polyadenylation. The stop region may be native to the transcription start region, native to the operatively linked nucleotide sequence of interest, native to the host, or derived from another source (i.e., exogenous or heterologous to the promoter, the nucleotide sequence of interest, the host, or any combination thereof).
[0073] A signal sequence can be operably ligated to the nucleic acid of the present invention to orient the nucleotide sequence to a cellular compartment. In this configuration, the expression cassette includes a nucleotide sequence encoding an siRNA, operably ligated to the nucleic acid sequence with respect to the signal sequence. The signal sequence can be operably ligated at the N or C terminus of the siRNA.
[0074] Regardless of the type of regulatory sequence(s) used, they can be operably ligated to the nucleotide sequence of an siRNA. As used herein, “operably ligated” means that elements of a nucleic acid construct, such as an expression cassette, are configured to perform their normal function. Thus, a regulatory or control sequence (e.g., a promoter) operably ligated to a nucleotide sequence of interest can influence the expression of that nucleotide sequence. The control sequence does not need to be adjacent to the nucleotide sequence of interest, as long as it functions to direct the expression of that nucleotide sequence of interest. For example, an intervening, untranslated but transcribed sequence may exist between the promoter and the coding sequence, and the promoter sequence can still be considered “operably ligated” to the coding sequence. The nucleotide sequences of the present invention (i.e., siRNAs) can be operably ligated to regulatory sequences, thereby enabling their expression in cells and / or subjects.
[0075] Furthermore, the expression cassette may include a nucleotide sequence for a selectable marker that can be used to select a transformed organism or cell. As used herein, “selectable marker” means a nucleic acid that, when expressed, gives a distinct phenotype to the organism or cell expressing the marker, and thus makes it possible to distinguish such a transformed organism or cell from an organism or cell that does not have the marker. Such nucleic acids may encode either a selectable marker or a screenable marker, depending on whether the marker gives a characteristic that can be selected by chemical means, for example by using a selector (e.g., an antibiotic or the like), or whether the marker is a characteristic that can be identified through tests such as simple observation or screening (of course, many examples of suitable selectable markers are known in the art and can be used in the expression cassettes described herein).
[0076] In some embodiments of the present invention, the expression cassette may include an expression control sequence operably ligated to a nucleotide sequence that is a template for one or both strands of the dsRNA. In further embodiments, the promoter may be adjacent to either end of the template nucleotide sequence, where the promoter drives the expression of each individual DNA strand, thereby generating two complementary (or substantially complementary) RNAs that hybridize to form the dsRNA. In alternative embodiments, the nucleotide sequence is transcribed to both strands of the dsRNA in a single transcription unit, where the sense strand is transcribed from the 5' end of the transcription unit and the antisense strand is transcribed from the 3' end, with the two strands separated by approximately 3 to 500 base pairs, and after transcription, the RNA transcript folds itself to form a small hairpin RNA (shRNA) molecule.
[0077] As used herein, “sequence identity” refers to the degree to which two optimally aligned polynucleotide or polypeptide sequences remain invariant throughout the entire alignment window of their constituent components, such as nucleotides or amino acids. “Identity” can be readily calculated, non-limitingly, by known methods, including those described in Computational Molecular Biology (Lesk, AM, ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, DW, ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, AM, and Griffin, HG, eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).
[0078] As used herein, the terms “substantially identical” or “corresponding” mean that two nucleic acid sequences have at least 60%, 70%, 80%, or 90% sequence identity. In some embodiments, two nucleic acid sequences may have at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.
[0079] The "identity fraction" for aligned segments of the test sequence and the reference sequence is the number of identical components shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined portion of the reference sequence.
[0080] As used herein, the terms “sequence identity percentage” or “identity percentage” refer to the percentage of identical nucleotides in the linear polynucleotide sequence of a reference (”query”) polynucleotide molecule (or its complementary chain) compared to a test (”subject”) polynucleotide molecule (or its complementary chain), provided that the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps totaling less than 20% of the reference sequence across the comparison window). In some embodiments, “identity percentage” may refer to the percentage of identical amino acids in an amino acid sequence.
[0081] The optimal alignment of sequences for aligning the comparison window is well known to those skilled in the art and can be performed by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the similarity search method of Pearson and Lipman, and, optionally, by computer execution of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA, which are available as part of the GCG® Wisconsin Package® (Accelrys Inc., Burlington, Mass.). The sequence identity percentage is expressed as the identity fraction multiplied by 100. Comparison of one or more polynucleotide sequences may be against the full-length polynucleotide sequence or a portion thereof, or against a longer polynucleotide sequence. Furthermore, for the purposes of the present invention, the "identity percentage" can be determined using the BLASTX 2.0 version for translated nucleotide sequences and the BLASTN 2.0 version for polynucleotide sequences.
[0082] The percentage of sequence identity can be determined using the “Best Fit” or “Gap” programs of the Sequence Analysis Software Package (trademark) (10th edition; Genetics Computer Group, Inc., Madison, Wis.). “Gap” utilizes the Needleman and Wunsch algorithm (Needleman and Wunsch, J Mol. Biol. 48:443-453, 1970) to find the alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. “Best Fit” uses the Smith and Waterman local homology algorithm (Smith and Waterman, Adv. Appl. Math., 2:482-489, 1981; Smith et al., Nucleic Acids Res. 11:2205-2220, 1983) to find the optimal alignment of the most similar segments between two sequences and insert gaps to maximize the number of matches.
[0083] Furthermore, useful methods for determining sequence identity are disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)) and Carillo, H., and Lipton, D. (Applied Math 48:1073 (1988)). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, which is publicly available from the National Center for Biotechnology Information (NCBI) of the National Library of Medicine, National Institutes of Health (Bethesda, Md. 20894); see BLAST Manual, Altschul et al., NCBI, NLM, NIH; (see Altschul et al., J.Mol.Biol.215:403-410(1990)); version 2.0 or later of the BLAST program allows for the introduction of gaps (deletions or insertions) into the alignment; for peptide sequences, sequence identity can be determined using BLASTX; and for polynucleotide sequences, sequence identity can be determined using BLASTN.
[0084] As used herein, “RNAi” or “RNA interference” refers to the process of sequence-specific post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA). As used herein, “dsRNA” refers to RNA that is partially or completely double-stranded. Double-stranded RNA is also referred to as small interfering RNA (siRNA), small interfering nucleic acid (siNA), microRNA (miRNA), etc. In the RNAi process, a dsRNA containing a first (antisense) strand complementary to a portion of the target gene and a second (sense) strand fully or partially complementary to the first antisense strand is introduced into the organism. After introduction into the organism, the target gene-specific dsRNA is processed into relatively small fragments (siRNA), which then become distributed throughout the organism, potentially resulting in a loss-of-function mutation with a phenotype that closely resembles the phenotype resulting from a complete or partial deletion of the target gene over the course of one generation.
[0085] MicroRNAs (miRNAs) are non-protein-coding RNAs, typically about 18 to 25 nucleotides in length. These miRNAs direct cleavage in the trans region of target transcripts, negatively regulating the expression of genes involved in various regulatory and developmental pathways (Bartel, Cell, 116:281-297 (2004); Zhang et al. Dev. Biol. 289:3-16 (2006)). Therefore, miRNAs have been shown to be involved in various aspects of growth and development, as well as signal transduction and proteolysis. Since the first miRNAs were discovered in plants (Reinhart et al. Genes Dev. 16:1616-1626 (2002), Park et al. Curr. Biol. 12:1484-1495 (2002)), hundreds have been identified. Many microRNA genes (MIR genes) have been identified and are publicly available in databases (miRBase; microrna.sanger.ac.uk / sequences). Furthermore, miRNAs are described in U.S. Patent Publication No. 2005 / 0120415 and No. 2005 / 144669A1, the entire contents of which are incorporated herein by reference.
[0086] Genes encoding miRNAs produce primary miRNAs (referred to as "pri-miRNAs") that are 70 to 300 bp in length and can form an imperfect stem-loop structure. A single pri-miRNA can contain one to several miRNA precursors. In animals, pri-miRNAs are processed in the nucleus by the RNase III enzyme Drosha and its cofactor DGCR8 / Pasha into shorter hairpin-shaped RNAs (pre-miRNAs) of approximately 65 nt. Subsequently, the pre-miRNAs are exported to the cytoplasm where they are further processed by another RNase III enzyme, Dicer, to release miRNA / miRNA* duplexes of approximately 22 nt in size. Many reviews on microRNA biogenesis and function are available, see, for example, Bartel Cell 116:281-297 (2004), Murchison et al. Curr. Opin. Cell Biol. 16:223-229 (2004), Dugas et al. Curr. Opin. Plant Biol. 7:512-520 (2004) and Kim Nature Rev. Mol. Cell Biol. 6:376-385 (2005).
[0087] <RNA molecule> The present invention is based on the identification of an RNA molecule that inhibits the expression of mutant KRAS sequences while preserving the expression of WT-KRAS. Accordingly, one aspect of the present invention relates to a double-stranded RNA molecule comprising an antisense strand and a sense strand, wherein the nucleotide sequence of the antisense strand is complementary to a region of the nucleotide sequence of a synthetic human KRAS gene containing missense mutations G12C, G12D and G13D, or missense mutations G12C, G12V and G13D, where the antisense strand is a region essentially consisting of about 18 to about 25 consecutive nucleotides, and the double-stranded RNA molecule inhibits the expression of a mutant human KRAS gene containing one or more of the missense mutations G12C, G12D, G12V and G13D, and minimizes the inhibition of wild-type human KRAS expression. The region of the KRAS gene targeted by the RNA molecule contains nucleotides encoding residues 12 and 13. The RNA molecule provides a reduction in the expression of mutant KRAS in cells compared to wild-type cells (e.g., control cells or non-transformed cells). In some embodiments, the expression of mutant KRAS is inhibited by at least about 50%, for example, at least about 50%, 60%, 70%, 80%, 90%, 95%, or more.
[0088] Human KRAS genes containing missense mutations G12C, G12D, and G13D, or missense mutations G12C, G12V, and G13D, do not exist in nature. Examples of such artificial gene sequence regions include SEQ ID NOs. 37 and 38, with the mutations underlined compared to the corresponding WT-KRAS sequence (SEQ ID NO. 39). Sequence ID 37 ACTGAATATAAACTTGTGGTAGTTGGAGCT TA TG A CGTAGGCAAGAGTGCCTTGACGATACAG Sequence ID 38 ACTGAATATAAACTTGTGGTAGTTGGAGCT TT TG A CGTAGGCAAGAGTGCCTTGACGATACAG Sequence ID 39 ACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAG
[0089] A double-stranded RNA molecule contains, essentially consists of, or may consist of approximately 18 to approximately 25 nucleotides (e.g., 18, 19, 20, 21, 22, 23, 24, or 25, or any range thereof). Additional nucleotides can be added to the 3' end, 5' end, or both the 3' and 5' ends to facilitate the manipulation of the RNA molecule, but this does not substantially affect the fundamental characteristics or function of the double-stranded RNA molecule in RNA interference (RNAi). In addition, one or two nucleotides may be deleted from one or both ends of any of the sequences disclosed herein, and this does not substantially affect the fundamental characteristics or function of the double-stranded RNA molecule in RNAi. The term "substantially affecting," as used herein, refers to a change in the ability to inhibit the expression of a mRNA-encoded protein (e.g., WT-KRAS) by approximately 50% or less, for example, approximately 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or less. Such additional nucleotides may be nucleotides that extend the complementarity of the antisense strand along the target sequence, as may be known to those skilled in the art, and / or such nucleotides may be nucleotides that facilitate the manipulation of the RNA molecule or the nucleic acid molecule encoding the RNA molecule. For example, a 3' terminal TT overhang may be present, which is used to stabilize the siRNA double-stranded nucleotide and does not affect the specificity of the siRNA.
[0090] The dsRNA of the present invention may optionally contain single-stranded overhangs at either or both ends. The double-stranded structure may be formed by a single self-complementary RNA strand (i.e., forming a hairpin loop) or by two complementary RNA strands. RNA double-stranding may be initiated either inside or outside the cell. If the dsRNA of the present invention forms a hairpin loop, it may optionally contain introns and / or nucleotide spacers, which are ranges of nucleotides between complementary RNA strands, to stabilize the hairpin sequence in the cell. The RNA may be introduced in an amount that allows for the delivery of at least one copy per cell. Higher doses of double-stranded material may produce more effective inhibition.
[0091] In certain embodiments, the present invention provides double-stranded RNA containing a nucleotide sequence that is perfectly complementary to the region of the target gene for inhibition. However, it should be understood that 100% complementarity between the antisense strand of the double-stranded RNA molecule and the target sequence is not required to carry out the present invention. Therefore, sequence variations that can be expected due to gene mutations, strain polymorphisms, or evolutionary divergence may be acceptable. RNA sequences having insertions, deletions, and single point mutations compared to the target sequence may also be effective for inhibition.
[0092] In certain embodiments, the nucleotide sequence of the antisense strand contains at least three mismatches with the nucleotide sequence of wild-type human KRAS so that the RNA molecule does not target WT-KRAS and inhibits WT-KRAS expression to a minimal degree. As used herein, “inhibits expression to a minimal degree” means that the expression of the mRNA-encoded protein (e.g., WT-KRAS) is inhibited by about 50% or less, for example, about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or less.
[0093] In certain embodiments, the nucleotide sequence of the antisense strand contains two or fewer mismatches with the nucleotide sequence of a mutant human KRAS gene containing one or more of the missense mutations G12C, G12D, G12V, and G13D. In some embodiments, the nucleotide sequence of the antisense strand contains at least three mismatches with the nucleotide sequence of wild-type human KRAS and also contains two or fewer mismatches with the nucleotide sequence of a mutant human KRAS gene containing one or more of the missense mutations G12C, G12D, G12V, and G13D.
[0094] In some embodiments, the sense strand nucleotide sequence includes a nucleotide sequence that is at least about 80% identical to any of the nucleotide sequences of SEQ ID NOs: 1-9, for example, a nucleotide sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to any of the nucleotide sequences of SEQ ID NOs: 1-9. In some embodiments, the sense strand nucleotide sequence includes, essentially consists of, or comprises any of the nucleotide sequences of SEQ ID NOs: 1-9. Sequence ID 1: GAGCUUAUGACGUAGGCAA Sequence ID 2 AGUUGGAGCUUAUGACGUA Sequence ID 3: GGUAGUUGGAGCUUAUGAC Sequence ID 4 GUAGUUGGAGCUUAUGACG Sequence ID 5 UAGUUGGAGCUUAUGACGU Sequence ID 6 GUUGGAGCUUAUGACGUAG Sequence ID 7 UUGGAGCUUAUGACGUAGG Sequence ID 8 UGGAGCUUAUGACGUAGGC Sequence ID 9 GGAGCUUAUGACGUAGGCA
[0095] In some embodiments, the nucleotide sequence of the antisense strand includes a nucleotide sequence that is at least about 80% identical to any of the nucleotide sequences of SEQ ID NOs. 19-27, for example, a nucleotide sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to any of the nucleotide sequences of SEQ ID NOs. 19-27. In some embodiments, the nucleotide sequence of the antisense strand includes, essentially consists of, or comprises any of the nucleotide sequences of SEQ ID NOs. 19-27. Sequence ID 19 UUGCCUACGUCAUAAGCUC Sequence ID 20 UACGUCAUAAGCUCCAACU Sequence ID 21 GUCAUAAGCUCCAACUACC Sequence ID 22 CGUCAUAAGCUCCAACUAC Sequence ID 23 ACGUCAUAAGCUCCAACUA Sequence ID 24 CUACGUCAUAAGCUCCAAC Sequence ID 25 CCUACGUCAUAAGCUCCAA Sequence ID 26 GCCUACGUCAUAAGCUCCA Sequence ID 27 UGCCUACGUCAUAAGCUCC
[0096] In some embodiments, one or both of the sense and antisense strands include a TT overhang at the 3' end. Thus, in some embodiments, the sense strand includes a nucleotide sequence that is at least about 80% identical to any of the nucleotide sequences of SEQ ID NOs. 10-18, for example, a nucleotide sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to any of the nucleotide sequences of SEQ ID NOs. 10-18. In some embodiments, the nucleotide sequence of the sense strand includes, essentially consists of, or comprises any of the nucleotide sequences of SEQ ID NOs. 10-18. Sequence ID 10 GAGCUUAUGACGUAGGCAAdTdT Sequence ID 11 AGUUGGAGCUUAUGACGUAdTdT Sequence ID 12 GGUAGUUGGAGCUUAUGACdTdT Sequence ID 13 GUAGUUGGAGCUUAUGACGdTdT Sequence ID 14 UAGUUGGAGCUUAUGACGUdTdT Sequence ID 15 GUUGGAGCUUAUGACGUAGdTdT Sequence ID 16 UUGGAGCUUAUGACGUAGGdTdT Sequence ID 17 UGGAGCUUAUGACGUAGGCdTdT Sequence ID 18 GGAGCUUAUGACGUAGGCAdTdT
[0097] In some embodiments, the nucleotide sequence of the antisense strand includes a nucleotide sequence that is at least about 80% identical to any of the nucleotide sequences of SEQ ID NOs. 28-36, for example, a nucleotide sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to any of the nucleotide sequences of SEQ ID NOs. In some embodiments, the nucleotide sequence of the antisense strand includes, essentially consists of, or comprises any of the nucleotide sequences of SEQ ID NOs. 28-36. Sequence ID 28 UUGCCUACGUCAUAAGCUCdTdT Sequence ID 29 UACGUCAUAAGCUCCAACUdTdT Sequence ID 30 GUCAUAAGCUCCAACUACCdTdT Sequence ID 31 CGUCAUAAGCUCCAACUACdTdT Sequence ID 32 ACGUCAUAAGCUCCAACUAdTdT Sequence ID 33 CUACGUCAUAAGCUCCAACdTdT Sequence ID 34 CCUACGUCAUAAGCUCCAAdTdT Sequence ID 35 GCCUACGUCAUAAGCUCCAdTdT Sequence ID 36 UGCCUACGUCAUAAGCUCCdTdT
[0098] In some embodiments of the present invention, the sense strand of a double-stranded RNA molecule may be fully complementary to the antisense strand, or the sense strand may be substantially complementary or partially complementary to the antisense strand. Substantially or partially complementary means that the sense strand and antisense strand may have mismatches in the formation of about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide pairs. Such mismatches may be introduced into the sense strand sequence, for example near the 3' end, as may be known to those skilled in the art, to improve the processing of the double-stranded RNA molecule by Dicer, or to replicate the mismatch pattern in an siRNA molecule inserted into the chimeric nucleic acid molecule or artificial microRNA precursor molecule of the present invention. Such modifications weaken base pairing at one end of the double helix, generating strand asymmetry, and thus increasing the chances that the antisense strand is processed instead of the sense strand, thereby silencing the intended gene (Geng and Ding “Double-mismatched siRNAs enhance selective gene silencing of a mutant ALS-causing Allele1” Acta Pharmacol.Sin.29:211-216(2008); Schwarz et al. “Asymmetry in the assembly of the RNAi enzyme complex” Cell 115:199-208(2003)).
[0099] The double-stranded RNA molecule of the present invention may be in any form of RNA interference molecule known in the art. In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA) molecule. In other embodiments, the double-stranded RNA molecule is a small hairpin RNA (shRNA) molecule. In other embodiments, the double-stranded RNA molecule is a portion of a microRNA precursor molecule.
[0100] <Antisense oligonucleotide> One aspect of the present invention relates to antisense oligonucleotides (ASOs) targeted at synthetic human KRAS-mRNA encoding missense mutations G12C, G12D, and G13D, having a length of 16 to 25 nucleotides and comprising or essentially comprising the sequence TCTTGCCTACGTCATA (SEQ ID NO: 114). In some embodiments, the ASO is 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides or any range therein. In some embodiments, the ASO is 20, 21, or 22 nucleotides in length. In some embodiments, the ASO is 20 nucleotides in length. In certain embodiments, at least 80% of the unspecified nucleotides in the ASO are complementary to the wild-type human KRAS gene, for example, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In certain embodiments, at least 80% of the unspecified nucleotides in the ASO are complementary to the mutant human KRAS gene by, for example, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In certain embodiments, the ASO comprises or essentially consists of sequences CTCTTGCCTACGTCATA (SEQ ID NO: 121), ACTCTTGCCTACGTCATA (SEQ ID NO: 122), or CACTCTTGCCTACGTCATA (SEQ ID NO: 123), having a length of 17–25 nucleotides.
[0101] In some embodiments, the ASO essentially consists of or comprises the sequence CACTCTTGCCTACGTCATAA (SEQ ID NO: 115) or a sequence that is at least 90% identical thereto, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical. In some embodiments, the ASO essentially consists of or comprises the sequence GCACTCTTGCCTACGTCATA (SEQ ID NO: 116) or a sequence that is at least 90% identical thereto, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0102] ASOs can consist of deoxyribonucleotides, ribonucleotides, or combinations thereof.
[0103] In some embodiments, ASO contains at least one non-natural chemical modification. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the nucleotide bonds are chemically modified. In some embodiments, ASO contains at least one phosphorothioate bond. In some embodiments, ASO contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 phosphorothioate bonds. In some embodiments, ASO contains only phosphorothioate bonds (all are phosphorothioate bonds).
[0104] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the nucleotides are chemically modified. In some embodiments, the ASO contains at least one modified nucleotide, for example, at least 1, 2, 3, 4, or 5 modified nucleotides, at or near the 5' and / or 3' ends, for example, within the 5 nucleotides of the 5' and / or 3' ends. In some embodiments, the ASO contains at least 3, for example, at least 4, or at least 5, modified nucleotides at each of the 5' and 3' ends. In some embodiments, at least one of the modified nucleotides is a 2'-O-methoxyethyl (2'-MOE) modified nucleotide. In some embodiments, all of the modified nucleotides are 2'-MOE modified nucleotides. In some embodiments, the ASO contains at least 3, for example, at least 4, or at least 5, 2'-MOE modified nucleotides at each of the 5' and / or 3' ends.
[0105] In some embodiments, ASO is [ka] ASO contains, essentially consists of, or comprises a sequence selected from, where * indicates a phosphorothioate bond and bold indicates a 2'-MOE modified nucleotide. In some embodiments, ASO contains, essentially consists of, or comprises a sequence that is at least 90% identical to, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs. 68 and SEQ ID NOs.
[0106] Another aspect of the present invention is an ASO targeted to native human KRAS-mRNA encoding a mutation selected from G12C, G12D, G12V, and G13D, having a length of 16 to 25 nucleotides. a) TCTTGCCTACGCCACA (SEQ ID NO: 117), which targets human KRAS-mRNA encoding the G12C mutation. b) TCTTGCCTACGCCATC (SEQ ID NO: 118), which targets human KRAS-mRNA encoding the G12D mutation. c) TCTTGCCTACGCCAAC (SEQ ID NO: 119), which targets human KRAS-mRNA encoding the G12V mutation. d) TCTTGCCTACGTCACC (SEQ ID NO: 120), which targets human KRAS-mRNA encoding the G13D mutation, or e)a)~d) is at least 90% identical to one of the given sequences. The ASO relates to an antisense oligonucleotide containing or essentially derived from a sequence selected from, which contains at least one non-natural chemical modification.
[0107] In some embodiments, ASO is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of sequence numbers 117-120.
[0108] In some embodiments, the ASO is 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, or any range therein. In some embodiments, the ASO is 20, 21, or 22 nucleotides in length. In some embodiments, the ASO is 20 nucleotides in length. In certain embodiments, at least 80% of the unspecified nucleotides in the ASO are complementary to the wild-type human KRAS gene by, for example, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In certain embodiments, at least 80% of the unspecified nucleotides in the ASO are complementary to the mutant human KRAS gene by, for example, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In certain embodiments, ASO has a length of 17 to 25 nucleotides and includes an additional nucleotide C at the 5' end of one of the sequences from SEQ ID NOs. 117 to 120. In certain embodiments, ASO has a length of 18 to 25 nucleotides and includes an additional nucleotide AC at the 5' end of one of the sequences from SEQ ID NOs. 117 to 120. In certain embodiments, ASO has a length of 19 to 25 nucleotides and includes an additional nucleotide CAC at the 5' end of one of the sequences from SEQ ID NOs. 117 to 120. In certain embodiments, ASO has a length of 20 to 25 nucleotides and includes an additional nucleotide GCAC at the 5' end of one of the sequences from SEQ ID NOs. 117 to 120.
[0109] In some embodiments, the antisense oligonucleotide is a) GCACTCTTGCCTACGCCACA (SEQ ID NO: 124), which targets human KRAS-mRNA encoding the G12C mutation. b) GCACTCTTGCCTACGCCATC (SEQ ID NO: 125), which targets human KRAS-mRNA encoding the G12D mutation. c) GCACTCTTGCCTACGCCAAC (SEQ ID NO: 126) targeted at human KRAS-mRNA encoding the G12V mutation, or d) GCACTCTTGCCTACGTCACC (SEQ ID NO: 127), which targets human KRAS-mRNA encoding the G13D mutation. It consists of an array selected from the following.
[0110] ASOs can consist of deoxyribonucleotides, ribonucleotides, or combinations thereof.
[0111] In some embodiments, ASO contains at least one non-natural chemical modification. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the nucleotide bonds are chemically modified. In some embodiments, ASO contains at least one phosphorothioate bond. In some embodiments, ASO contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 phosphorothioate bonds. In some embodiments, ASO contains only phosphorothioate bonds.
[0112] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the nucleotides are chemically modified. In some embodiments, the ASO contains at least one modified nucleotide, for example, at least 1, 2, 3, 4, or 5 modified nucleotides, at or near the 5' and / or 3' ends, for example, within the 5 nucleotides of the 5' and / or 3' ends. In some embodiments, the ASO contains at least 5 modified nucleotides at each of the 5' and 3' ends. In some embodiments, at least one of the modified nucleotides is a 2'-MOE modified nucleotide. In some embodiments, all of the modified nucleotides are 2'-MOE modified nucleotides. In some embodiments, the ASO contains at least 3, for example, at least 4, or at least 5 2'-MOE modified nucleotides at each of the 5' and / or 3' ends.
[0113] In a particular embodiment, ASO is [ka] The ASO consists of sequences selected from, where * indicates a phosphorothioate bond and bold indicates a 2'-MOE modified nucleotide. In some embodiments, the ASO contains, essentially consists of, or comprises sequences that are at least 90% identical to, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, one of sequence numbers 70-73.
[0114] In some embodiments, at least one modified nucleotide is a locked nucleic acid nucleotide, for example, at least 1, 2, 3, 4, or 5 modified nucleotides. The locked nucleic acid can be, non-limitingly, a methylene bridge that links the 2' oxygen and 4' carbon of ribose, locking ribose into a 3'-end (North) conformation.
[0115] In a particular embodiment, ASO is [ka] ASO consists of a sequence selected from, where * indicates a phosphorothioate bond, bold indicates a 2'-methoxymethyl modified nucleotide, and + indicates that the subsequent nucleotide is a locked nucleic acid. In some embodiments, ASO contains, essentially consists of, or comprises a sequence that is at least 90% identical to one of sequence numbers 74-77, 160, or 161, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0116] <Chemically modified siRNA> One aspect of the present invention relates to an siRNA molecule targeted to native human KRAS-mRNA encoding a mutation selected from G12C, G12D, G12V, and G13D, wherein the siRNA comprises at least one chemical modification. In some embodiments, the siRNA molecule is fully chemically modified. The term "fully chemically modified" means that every nucleotide in the siRNA contains a chemical modification. In some embodiments, each nucleotide in the siRNA molecule is modified by a 2'-O-methyl group or a 2'-fluoro group.
[0117] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotide bonds in the siRNA are chemically modified. In some embodiments, the siRNA contains at least one phosphorothioate bond. In some embodiments, the siRNA contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 phosphorothioate bonds. In some embodiments, the siRNA contains only phosphorothioate bonds.
[0118] In a particular embodiment, an siRNA molecule comprising at least one chemical modification comprises a sense strand and an antisense strand, wherein the siRNA molecule is The sense strand of sequence number 128 and the antisense strand of sequence number 129, The sense strand of sequence number 130 and the antisense strand of sequence number 131, The sense strand of sequence number 132 and the antisense strand of sequence number 133, The sense strand of sequence number 134 and the antisense strand of sequence number 135, The sense strand of sequence number 136 and the antisense strand of sequence number 137, The sense strand of sequence number 138 and the antisense strand of sequence number 139, The sense strand of sequence number 140 and the antisense strand of sequence number 141, The sense strand of sequence number 142 and the antisense strand of sequence number 143, The sense strand of sequence number 144 and the antisense strand of sequence number 145, The sense strand of sequence number 146 and the antisense strand of sequence number 147, The sense strand of sequence number 148 and the antisense strand of sequence number 149, The sense strand of sequence number 150 and the antisense strand of sequence number 151, The sense strand of sequence number 152 and the antisense strand of sequence number 153, The sense strand of sequence number 154 and the antisense strand of sequence number 155, The sense strand of sequence number 156 and the antisense strand of sequence number 157, or Sense strand of SEQ ID NO: 158 and antisense strand of SEQ ID NO: 159 It contains one of the sequence pairs.
[0119] In some embodiments, the siRNA contains, essentially consists of, a sequence that is at least 90% identical to one of sequence numbers 128-159, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0120] [Table 1] S - Sense Chain AS - Antisense Chain
[0121] In a particular embodiment, the siRNA molecule is fully chemically modified and comprises a sense chain and an antisense chain, where the siRNA molecule is The sense strand of sequence number 78 and the antisense strand of sequence number 79, The sense strand of sequence number 80 and the antisense strand of sequence number 81, The sense strand of sequence number 82 and the antisense strand of sequence number 83, The sense strand of sequence number 84 and the antisense strand of sequence number 85, The sense strand of sequence number 86 and the antisense strand of sequence number 87, The sense strand of sequence number 88 and the antisense strand of sequence number 89, The sense strand of sequence number 90 and the antisense strand of sequence number 91, The sense strand of sequence number 92 and the antisense strand of sequence number 93, The sense strand of sequence number 94 and the antisense strand of sequence number 95, The sense strand of sequence number 96 and the antisense strand of sequence number 97, The sense strand of sequence number 98 and the antisense strand of sequence number 99, The sense strand of sequence number 100 and the antisense strand of sequence number 101, The sense strand of sequence number 102 and the antisense strand of sequence number 103, The sense strand of sequence number 104 and the antisense strand of sequence number 105, The sense strand of sequence number 106 and the antisense strand of sequence number 107, The sense strand of sequence number 108 and the antisense strand of sequence number 109, The sense strand of sequence number 162 and the antisense strand of sequence number 163, The sense strand of sequence number 164 and the antisense strand of sequence number 165, The sense strand of sequence number 166 and the antisense strand of sequence number 167, The sense strand of sequence number 168 and the antisense strand of sequence number 169, The sense strand of sequence number 170 and the antisense strand of sequence number 171, The sense strand of sequence number 172 and the antisense strand of sequence number 173, The sense strand of sequence number 174 and the antisense strand of sequence number 175, The sense strand of sequence number 176 and the antisense strand of sequence number 177, The sense strand of sequence number 178 and the antisense strand of sequence number 179, The sense strand of sequence number 180 and the antisense strand of sequence number 181, The sense strand of sequence number 182 and the antisense strand of sequence number 183, or Sense strand of SEQ ID NO: 184 and antisense strand of SEQ ID NO: 185 It contains one of the sequence pairs.
[0122] In some embodiments, the siRNA contains, essentially consists of, or comprises a sequence that is at least 90% identical to one of sequence numbers 78-109 or 162-185, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0123] Another aspect of the present invention relates to an siRNA molecule targeted to human KRAS-mRNA, wherein the sense strand of the siRNA comprises, essentially comprises, or consists of the sequence of SEQ ID NO: 50 or SEQ ID NO: 51, and the siRNA comprises at least one non-natural chemical modification. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in the siRNA are chemically modified. In some embodiments, the siRNA is fully chemically modified. In some embodiments, each nucleotide in the siRNA molecule is modified with a 2'-O-methyl group or a 2'-fluoro group.
[0124] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotide bonds in the siRNA are chemically modified. In some embodiments, the siRNA contains at least one phosphorothioate bond. In some embodiments, the siRNA contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 phosphorothioate bonds. In some embodiments, the siRNA contains only phosphorothioate bonds.
[0125] In a particular embodiment, the fully chemically modified siRNA molecule comprises a sense strand and an antisense strand, where the siRNA molecule is The sense strand of sequence number 110 and the antisense strand of sequence number 111, or Sense strand of SEQ ID NO: 112 and antisense strand of SEQ ID NO: 113 It contains one of the sequence pairs.
[0126] In some embodiments, the siRNA contains, essentially consists of, a sequence that is at least 90% identical to, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, one of sequence numbers 110-113.
[0127] Double-stranded RNA molecules, ASOs, or chemically modified siRNA molecules can be constructed using chemical synthesis and enzymatic ligation reactions by techniques known in the art. For example, double-stranded RNA molecules, ASOs, or chemically modified siRNA molecules may be chemically synthesized using native nucleotides or various modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the double helix formed between the double-stranded RNA, ASO, or chemically modified siRNA molecule and the target nucleotide sequence. For example, phosphorothioate derivatives and acridine-substituted nucleotides can be used. Examples of modified nucleotides that can be used to generate double-stranded RNA, ASO, or chemically modified siRNA molecules include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosyl cuosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, and 5-methyl This includes, but is not limited to, aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueucine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid(v), wybutoxosine, pseudouracil, queucine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine.Alternatively, double-stranded RNA or ASO can be produced using an expression vector in which the nucleic acid encoding the double-stranded RNA or ASO has been cloned.
[0128] A double-stranded RNA, ASO, or chemically modified siRNA molecule may further comprise a nucleotide sequence in which at least one or all of the internucleotide crosslinking phosphate residues are modified phosphates, such as methylphosphonate, methylphosphonothioate, phosphoromolholide, phosphoropiperadate, and phosphoramidate. For example, any or every other of the internucleotide crosslinking phosphate residues may be modified as described. In another non-limiting example, a double-stranded RNA, ASO, or chemically modified siRNA molecule is a nucleotide sequence in which at least one or all of the nucleotides contain a 2' lower alkyl moiety (e.g., C1-C4 linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl). In another example, one or more of the nucleotides may be 2'-fluoronucleotides, 2-O-methylnucleotides, or locked nucleic acid nucleotides. For example, any or every other of the nucleotides may be modified as described. Furthermore, please refer to Furdon et al., Nucleic Acids Res. 17:9193 (1989); Agrawal et al., Proc. Natl. Acad. Sci. USA 87:1401 (1990); Baker et al., Nucleic Acids Res. 18:3537 (1990); Sproat et al., Nucleic Acids Res. 17:3373 (1989); and Walder and Walder, Proc. Natl. Acad. Sci. USA 85:5011 (1988). These documents, with their teachings on methods for producing polynucleotide molecules containing modified nucleotide bases, are incorporated herein by reference as a whole.
[0129] The present invention further relates to nucleic acid constructs comprising the RNA molecule or ASO of the present invention. The present invention further relates to nucleic acid constructs encoding the RNA molecule or ASO of the present invention, and nucleic acid constructs comprising the RNA molecule or ASO encoding the nucleic acid molecule. In each of these embodiments, the nucleic acid construct may be a vector or plasmid, for example, an expression vector.
[0130] Another aspect of the present invention relates to a composition comprising an RNA molecule, ASO, chemically modified siRNA molecule, or nucleic acid construct of the present invention and another component, such as a suitable carrier. In some embodiments, the composition comprises two or more of the RNA molecules, ASO, chemically modified siRNA molecules, or nucleic acid constructs of the present invention, where each of the two or more RNA molecules, ASO, or chemically modified siRNA molecules comprises a different antisense strand. In certain embodiments, the two or more RNA molecules are present in the same nucleic acid construct, in different nucleic acid constructs, or in any combination thereof. In some embodiments, the composition is a pharmaceutical composition comprising an RNA molecule, ASO, chemically modified siRNA molecule, or nucleic acid construct of the present invention and a pharmaceutically acceptable carrier.
[0131] The compositions of the present invention contain, essentially consist of, or may consist of, any combination and any ratio of RNA molecules, ASOs, chemically modified siRNA molecules, and nucleic acid constructs. Furthermore, "two or more" means up to a total number of RNA molecules, ASOs, chemically modified siRNA molecules, and nucleic acid constructs of the present invention, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, etc. In some embodiments, the compositions contain, essentially consist of, or comprise the RNA molecules of SEQ ID NO: 1 and SEQ ID NO: 3.
[0132] In some embodiments of the present invention, the composition or pharmaceutical composition further comprises additional components that improve the delivery of the RNA molecule, ASO, chemically modified siRNA molecule, or nucleic acid construct to a target by improving the stability of the RNA molecule, ASO, chemically modified siRNA molecule, or nucleic acid construct of the present invention. In some embodiments, the additional components may be particles, such as microparticles or nanoparticles. In some embodiments, the particles are lipid particles, such as liposomes, such as microliposomes or nanoliposomes. The liposomes, microliposomes, or nanoliposomes may contain any components known in the art to be suitable for preparing liposomes. In some embodiments, the liposomes contain 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC). The liposomes may be prepared by methods known in the art, for example, as described in Pecot et al., Mol. Cancer Ther. 13:2876 (2014), which in whole is part of this specification by reference. In some embodiments, RNA molecules are formed into stable nucleic acid lipid particles (SNALPs) using particles such as those provided by Arbutus Biopharma (Doylestown, PA). In certain embodiments, the lipid particles contain, essentially consist of, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), PEG-cDMA or PEG-cDSA, and 1,2-dilinoleyloxy-3-(N,N-dimethyl)aminopropane (DLinDMA) (see Judge et al., J. Clin. Invest. 119:661 (2009)). In some embodiments, the lipid particles contain two or more of the RNA molecules, ASOs, or chemically modified siRNA molecules of the present invention, for example, the RNA molecules of SEQ ID NOs: 1 and SEQ ID NOs: 3. In some embodiments, the additional components are targeted delivery portions, such as ligands, aptamers, or monoclonal antibodies, to which RNA molecules, ASOs, chemically modified siRNA molecules, or nucleic acid constructs are covalently or noncovalently conjugated.
[0133] The present invention encompasses cells comprising the RNA molecule and / or nucleic acid construct of the present invention. Accordingly, in some embodiments, the present invention provides transformed cells comprising the RNA molecule and / or nucleic acid construct and / or composition of the present invention, wherein the expression of mutant KRAS is reduced compared to control cells.
[0134] <Method> Various methods using the nucleic acid molecules, nucleic acid constructs and / or compositions of the present invention are provided herein. Accordingly, in one embodiment, the present invention provides a method for inhibiting the expression of mutant human KRAS genes containing one or more missense mutations G12C, G12D, G12V and G13D in cells, comprising contacting cells with the RNA molecules, ASOs, chemically modified siRNA molecules, nucleic acid constructs, compositions and / or pharmaceutical compositions of the present invention, thereby inhibiting the expression of mutant human KRAS genes in cells.
[0135] Furthermore, the Specified Information Provides a method for treating cancer in a subject requiring treatment for cancer, wherein the cancer comprises a mutant human KRAS gene containing one or more missense mutations G12C, G12D, G12V, and G13D, and the method comprises delivering the RNA molecule, ASO, chemically modified siRNA molecule, nucleic acid construct, composition, and / or pharmaceutical composition of the present invention to the subject, thereby treating the cancer in the subject. A cancer comprising a mutant human KRAS gene containing one or more missense mutations G12C, G12D, G12V, and G13D is a cancer in which one or more cells express the mutant KRAS gene, for example, a tumor.
[0136] In one embodiment of each of these embodiments, the subject may be a subject diagnosed with cancer. In another embodiment, the subject may be a subject at risk of developing cancer (e.g., susceptible due to genetic factors, smoking, viral infection, exposure to chemicals, etc.). In a further embodiment, the subject may be a subject identified as having a mutant KRAS gene and diagnosed or undiagnosed with cancer.
[0137] The double-stranded RNA, ASO, or chemically modified siRNA molecules of the present invention can be delivered directly to cells by any method known in the art, for example, by transfection or microinjection, for example, as part of a composition containing lipid particles. In other embodiments, the double-stranded RNA or ASO can be delivered to a target in the form of a polynucleotide encoding the RNA or ASO, which produces expression of the double-stranded RNA or ASO within the target cell. Those skilled in the art will understand that the isolated polynucleotide encoding the RNA or ASO of the present invention is typically accompanied by appropriate expression regulatory sequences, such as transcription / translation regulatory signals and polyadenylation signals.
[0138] It will be further understood that various promoter / enhancer elements can be used for desired levels and tissue-specific expression. Promoters can be constitutive or inducible depending on the desired expression pattern. Promoters can be native or exogenous, and can be native or synthetic sequences. Exogenous promoters are intended to prevent the transcription start region from being found in the wild-type host into which it is introduced. Promoters are selected so that they function in the target cell(s) of interest.
[0139] For example, RNA or ASO coding sequences may be associated with the activation of the cytomegalovirus (CMV) major early promoter, albumin promoter, elongation factor 1-α (EF1-α) promoter, PγK promoter, MFG promoter, or Roussarcoma virus promoter.
[0140] Inducible promoter / enhancer elements include, but are not limited to, zinc-inducible metallothionein (MT) promoters, dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoters, T7 polymerase promoter systems (see WO 98 / 10088); ecdysone insect promoters (No et al., Proc. Natl. Acad. Sci. USA 93:3346 (1996)); tetracycline inhibitory systems (Gossen et al., Proc. Natl. Acad. Sci. USA 89:5547 (1992)); tetracycline induction systems (Gossen et al., Science 268:1766 (1995); also see Harvey et al., Curr. Opin. Chem. Biol. 2:512 (1998)); and RU486 induction systems (Wang et al. This includes hormone-inducible and metal-inducible elements, as well as other promoters regulated by exogenously supplied compounds, including al., Nat. Biotech. 15:239 (1997); Wang et al., Gene Ther., 4:432 (1997); and the rapamycin-inducible system (Magari et al., J. Clin. Invest. 100:2865 (1997)).
[0141] Other tissue-specific or regulatory promoters typically include, but are not limited to, promoters that confer tissue specificity in neurons. These include, but are not limited to, promoters for synapsin 1, tubulin α1, platelet-derived growth factor B chain, tyrosine hydroxylase, neuron-specific enolase, and neurofilament. Skeletal muscle cell promoters include, but are not limited to, promoters for β-actin, Pitx3, creatine kinase, and myosin light chain. Cardiomyocyte promoters include, but are not limited to, promoters for cardiac actin, cardiac troponin T, troponin C, myosin light chain-2, and α-myosin heavy chain. Pancreatic islet (beta) cell promoters include, but are not limited to, glucokinase, gastrin, insulin, and pancreatic islet amyloid polypeptide.
[0142] Furthermore, specific start signals are generally required for the efficient translation of inserted RNA or ASO coding sequences. These translational regulatory sequences, which may include ATG start codons and adjacent sequences, may be translational regulatory sequences of various origins, both natural and synthetic.
[0143] Isolated nucleic acids encoding double-stranded RNA or ASOs can be incorporated into expression vectors. Expression vectors compatible with various host cells are well known in the art and contain suitable elements for the transcription and translation of nucleic acids. Typically, an expression vector contains an "expression cassette" in the 5' to 3' direction, comprising a promoter, a coding sequence encoding double-stranded RNA activating the promoter, and optionally a stop sequence containing a stop signal for RNA polymerase and a polyadenylation signal for polyadenylase.
[0144] Non-limiting examples of animal and mammalian promoters known in the art include the SV40 early (SV40e) promoter region, the promoter contained in the 3' terminal repeat (LTR) of Rous sarcoma virus (RSV), the promoter of the E1A or major late promoter (MLP) gene of adenovirus (Ad), the cytomegalovirus (CMV) early promoter, the herpes simplex virus (HSV) thymidine kinase (TK) promoter, the baculovirus IE1 promoter, the elongation factor 1 alpha (EF1) promoter, and phosphoglycerides. This includes, but is not limited to, regulatory sequences and transcriptional regulatory regions of tokinase (PGK) promoters, ubiquitin (Ubc) promoters, albumin promoters, mouse metallothionein-L promoters, ubiquitous promoters (such as HPRT, vimentin, α-actin, and tubulin), intermediate filament promoters (such as desmin, neurofilament, keratin, and GFAP), therapeutic gene promoters (such as MDR, CFTR, or factor VIII type promoters), and pathogenic and / or disease-related promoters. In addition, any of these expression sequences of the present invention may be modified by the addition of enhancers and / or regulatory sequences.
[0145] Enhancers that may be used in embodiments of the present invention include, but are not limited to, SV40 enhancers, cytomegalovirus (CMV) enhancers, elongation factor I (EF1) enhancers, yeast enhancers, and viral gene enhancers.
[0146] The stop control region, i.e., the terminator or polyadenylation sequence, may be derived from a variety of genes native to a preferred host. In some embodiments of the present invention, the stop control region may include, or be derived from, a synthetic sequence, a synthetic polyadenylation signal, an SV40 late polyadenylation signal, an SV40 polyadenylation signal, a bovine growth hormone (BGH) polyadenylation signal, a viral terminator sequence, or the like.
[0147] It will be apparent to those skilled in the art that any suitable vector can be used to deliver polynucleotides to cells or subjects. The vector may be delivered to cells in vivo. In other embodiments, the vector may be delivered to cells ex vivo, and the cells containing the vector are then delivered to the subject. The selection of a delivery vector may be based on several factors known in the art, including the age and species of the target host, in vitro versus in vivo delivery, desired level and persistence of expression, intended purpose (e.g., therapeutic or screening), target cells or organs, delivery route, size of isolated polynucleotides, and safety considerations.
[0148] Suitable vectors include, but are not limited to, plasmid vectors, viral vectors (e.g., retroviruses, alphaviruses; vaccinia viruses; adenoviruses, adeno-associated viruses, and other parvoviruses, lentiviruses, poxviruses, or herpes simplex viruses), lipid vectors, polylysine vectors, and synthetic polyaminopolymer vectors.
[0149] Any viral vector known in the art can be used in the present invention. Protocols for producing recombinant viral vectors and protocols for using viral vectors for nucleic acid delivery can be found in Ausubel et al., Current Protocols in Molecular Biology (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York) and other standard laboratory manuals (e.g., Vectors for Gene Therapy. In: Current Protocols in Human Genetics. John Wiley and Sons, Inc.: 1997).
[0150] Nonviral delivery methods can also be used. Many nonviral methods for nucleic acid delivery rely on the usual mechanisms used by mammalian cells for macromolecule uptake and intracellular transport. In certain embodiments, nonviral nucleic acid delivery systems rely on endocytosis pathways for uptake of nucleic acid molecules by targeted cells. Exemplary nucleic acid delivery systems of this type include liposome-derived systems, polylysine conjugates, and artificial viral envelopes.
[0151] In certain embodiments, plasmid vectors are used in the implementation of the present invention. For example, naked plasmids can be introduced into muscle cells by injection into tissue. Although the number of positive cells is typically low, expression can be prolonged for several months (Wolff et al., Science 247:247 (1989)). Cationic lipids have been demonstrated to be helpful in introducing nucleic acids into certain cells in culture (Felgner and Ringold, Nature 337:387 (1989)). Injection of cationic lipid plasmid-DNA complexes into the circulation of mice has been shown to result in DNA expression in the lungs (Brigham et al., Am.J.Med.Sci. 298:278 (1989)). One advantage of plasmid DNA is that it can be introduced into non-replicating cells.
[0152] In typical embodiments, nucleic acid molecules (e.g., plasmids) are captured by positively charged lipid particles on their surface and, optionally, tagged with antibodies against cell surface antigens of the target tissue (Mizuno et al., No Shinkei Geka 20:547 (1992); PCT Publication WO 91 / 06309; Japanese Patent Application No. 1047381; and European Patent Publication EP-A-43075).
[0153] Liposomes, composed of amphiphilic cationic molecules, are useful as non-viral vectors for nucleic acid delivery in vitro and in vivo (summarized in Crystal, Science 270:404 (1995); Blaese et al., Cancer Gene Ther. 2:291 (1995); Behr et al., Bioconjugate Chem. 5:382 (1994); Remy et al., Bioconjugate Chem. 5:647 (1994); and Gao et al., Gene Therapy 2:710 (1995)). Positively charged liposomes are thought to form lipid:nucleic acid complexes by complexing with negatively charged nucleic acids via electrostatic interactions. Lipid:nucleic acid complexes have several advantages as nucleic acid delivery vectors. Unlike viral vectors, lipid:nucleic acid complexes can be used to deliver expression cassettes that are essentially size-unlimited. Because the complexes lack proteins, they may induce fewer immunogenic and inflammatory responses. Furthermore, they are unable to replicate or recombine to form infectious pathogens and have a low integration frequency. Several published reports have demonstrated that amphiphilic cationic lipids can mediate nucleic acid delivery in vivo and in vitro (Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413 (1987); Loeffler et al., Meth. Enzymol. 217:599 (1993); Felgner et al., J. Biol. Chem. 269:2550 (1994)).
[0154] Several groups have reported the use of amphiphilic cationic lipid:nucleic acid complexes for in vivo transfection in both animals and humans (summarized in Gao et al., Gene Therapy 2:710 (1995); Zhu et al., Science 261:209 (1993); and Thierry et al., Proc. Natl. Acad. Sci. USA 92:9742 (1995)). U.S. Patent No. 6,410,049 describes a method for preparing cationic lipid:nucleic acid complexes with extended shelf life.
[0155] Furthermore, nuclear localization signals can be used to enhance the targeting of double-stranded RNA or expression vectors to the proximal part of the nucleus and / or their entry into the nucleus. Such nuclear localization signals may be proteins or peptides, such as SV40 large-tag NLS or nucleoplasmin NLS. These nuclear localization signals interact with various nuclear transport factors, such as the NLS receptor (carioferrin alpha), which then interacts with carioferrin beta.
[0156] Expression vectors can be designed for the expression of chain RNA or ASO in prokaryotic or eukaryotic cells. For example, chain RNA or ASO can be expressed in bacterial cells such as Escherichia coli (E. coli), insect cells (e.g., baculovirus expression systems), yeast cells, plant cells, or mammalian cells. Some suitable host cells are Goeddel, Gene Expression TechnologyThis is further explained in Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Examples of bacterial vectors include, but are not limited to, pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia). Examples of vectors for expression in the yeast Saccharomyces cerevisiae (S. cerevisiae) include pYepSecl (Baldari et al., EMBO J.6:229 (1987)), pMFa (Kurjan and Herskowitz, Cell 30:933 (1982)), pJRY88 (Schultz et al., Gene 54:113 (1987)), and pYES2 (Invitrogen Corporation, San Diego, Calif.). Non-limiting examples of baculovirus vectors that can be used for nucleic acid expression to produce proteins in cultured insect cells (e.g., Sf9 cells) include the pAc series (Smith et al., Mol.Cell.Biol.3:2156 (1983)) and the pVL series (Lucklow and Summers Virology 170:31 (1989)).
[0157] Examples of mammalian expression vectors include pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, PBPV, pMSG, PSVL (Pharmacia), pCDM8 (Seed, Nature 329:840 (1987)), and pMT2PC (Kaufman et al., EMBO J.6:187 (1987)). When used in mammalian cells, the regulatory function of expression vectors is often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, and simian virus 40.
[0158] Viral vectors are used in a wide range of gene delivery applications in cells and living animals. Viral vectors that can be used include, but are not limited to, retroviruses, lentiviruses, adeno-associated viruses, poxviruses, alphaviruses, baculoviruses, vaccinia viruses, herpesviruses, Epstein-Barr viruses, adenoviruses, geminiviruses, and karimovirus vectors. Non-viral vectors, non-limiting examples, include plasmids, liposomes, charged lipids (cytofectins), nucleic acid-protein complexes, and biopolymers. In addition to the nucleic acid of interest, vectors may also contain one or more regulatory regions and / or selectable markers useful for selection, measurement, and monitoring of nucleic acid delivery outcomes (such as delivery to specific tissues or duration of expression).
[0159] In addition to the regulatory sequences described above, recombinant expression vectors may contain additional nucleotide sequences. For example, a recombinant expression vector may encode a selectable marker gene for identifying the host cell into which the vector has been incorporated.
[0160] Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” refer to a variety of techniques recognized in the art for introducing exogenous nucleic acids (e.g., DNA and RNA) into host cells, including, but not limited to, calcium phosphate or calcium chloride coprecipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection, DNA-loaded liposomes, lipofectamine-DNA complexes, cell sonication, gene bombardment using high-speed microparticle guns, and virus-mediated transfection. Preferred methods for transforming or transfecting host cells can be found in Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor, NY, 1989) and other laboratory manuals.
[0161] When stable integration is desired, in many cases only a small fraction of cells (particularly mammalian cells) integrate exogenous DNA into their genomes. To identify and select the integrators, nucleic acids encoding selectable markers (e.g., antibiotic resistance) may be introduced into host cells along with the nucleic acid of interest. Preferred selectable markers include those constituting drug resistance, such as G418, hygromycin, and methotrexate. The nucleic acids encoding the selectable markers may be introduced into host cells using the same vector as the nucleic acid of interest, or they may be introduced using separate vectors. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells incorporating the selectable marker gene survive, while other cells die).
[0162] In one embodiment, the double-stranded RNA, ASO, or chemically modified siRNA molecule of the present invention is administered directly to the subject. Generally, the compounds of the present invention are suspended in a pharmaceutically acceptable carrier (e.g., saline) and administered orally, topically, or by intravenous infusion, or by subcutaneous, intramuscular, intracranial, subarachnoid, intraperitoneal, intrarectal, vaginal, nasal, intragastric, intratracheal, or intrapulmonary injection. They are preferably delivered directly to the site of disease or impairment, such as the lungs, intestines, or pancreas. The required dose depends on the choice of route of administration; the nature of the formulation; the nature of the patient's illness; the patient's size, weight, surface area, age, and sex; other drugs being administered; and the judgment of the attending physician. A suitable dose is in the range of 0.01 to 100.0 μg / kg. A wide variation in the required dose should be anticipated in terms of different efficiencies of various routes of administration. For example, oral administration may be expected to require higher doses than IV injection (e.g., 2, 3, 4, 6, 8, 10, 20, 50, 100, 150 times or more). Variations in these dose levels can be adjusted using standard empirical routines for optimization, as is well understood in the art. Administration may be a single dose or multiple doses. Encapsulation of the inhibitor into a suitable delivery medium (e.g., polymer microparticles or an implantable device) can increase the efficiency of delivery, particularly oral delivery.
[0163] According to certain embodiments, double-stranded RNA, ASO, or chemically modified siRNA molecules can be targeted in vivo to specific cells or tissues. Targeting delivery media, including liposomes and viral vector systems, are known in the art. For example, liposomes can be directed to specific target cells or tissues by using targeting agents, such as antibodies, soluble receptors, or ligands, incorporated into the liposomes, to target specific cells or tissues to which the targeting molecule can bind. Targeting liposomes are described, for example, in Ho et al., Biochemistry 25:5500 (1986); Ho et al., J. Biol. Chem. 262:13979 (1987); Ho et al., J. Biol. Chem. 262:13973 (1987); and U.S. Patent No. 4,957,735 by Huang et al., each of which, in whole, constitutes part of this specification by reference. Enveloped viral vectors can be modified to deliver nucleic acid molecules to target cells by altering or substituting envelope proteins so that the virus infects specific cell types. In adenovirus vectors, the gene encoding the adhesion fiber may be modified to encode a protein domain that binds to a cell-specific receptor. Herpesvirus vectors naturally target cells of the central and peripheral nervous systems. Alternatively, the route of administration can be used to target specific cells or tissues. For example, intracoronal administration of adenovirus vectors has been shown to be effective in delivering genes to cardiomyocytes (Maurice et al., J. Clin. Invest. 104:21 (1999)). Intravenous delivery of cholesterol-containing cationic liposomes preferentially targets lung tissue (Liu et al., Nature Biotechnol. 15:167 (1997)) and has been shown to effectively mediate gene transfer and expression in vivo. Other successful examples of targeted in vivo delivery of nucleic acid molecules are known in the art.Finally, by selecting transcriptional regulatory sequences and, preferably, promoters that are selectively induced in target cells and remain substantially inactive in non-target cells, recombinant nucleic acid molecules can be selectively (i.e., preferentially, substantially exclusively) expressed in target cells.
[0164] The double-stranded RNA, ASO, or chemically modified siRNA molecules of the present invention may be delivered together with other therapeutic agents. Additional therapeutic agents may be delivered concurrently with the double-stranded RNA, ASO, or chemically modified siRNA molecules of the present invention. As used herein, the term “concurrently” means that the time intervals are close enough to produce a combined effect (i.e., concurrently may also mean simultaneously, or it may be two or more events occurring within a short period before or after each other). In one embodiment, the double-stranded RNA, ASO, or chemically modified siRNA molecule of the present invention is a useful agent for treating cancer, for example: 1) vinca alkaloids (e.g., vinblastine, vincristine), 2) epipodophyllotoxins (e.g., etoposide and teniposide), 3) antibiotics (e.g., dactinomycin (actinomycin D), daunorubicin (daunomycin, rubidomycin), doxorubicin, bleomycin, plicamycin (mitramycin), and mitomycin (mitomycin C)), 4) enzymes (e.g., L-asparaginase), 5) biological response modifiers (e.g., interferon-alpha), 6) platinum coordination complexes (e.g., cisplatin and carboplatin), 7) anthracendiones (e.g., mitoxantrone), 8) substituted ureas (e.g., They are administered together with hydroxyureas, 9) methylhydrazine derivatives (e.g., procarbazine (N-methylhydrazine, MIH)), 10) corticosteroids (e.g., mitotane (o,p'-DDD) and aminoglutethimide), 11) corticosteroids (e.g., prednisone), 12) progestins (e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate and megestrol acetate), 13) estrogens (e.g., diethylstilbestrol and ethinylestradiol), 14) antiestrogens (e.g., tamoxifen), 15) androgens (e.g., testosterone propionate and fluoxymesterone), 16) antiandrogens (e.g., flutamide), and 17) gonadotropin-releasing hormone analogs (e.g., leuprolide).In another embodiment, the compounds of the present invention include anti-angiogenic agents, such as antibodies against VEGF (e.g., bevacizumab (AVASTIN), ranibizumab (LUCENTIS)) and antibodies against other promoters of angiogenesis (e.g., bFGF, angiopoietin-1), antibodies against alpha-v / beta-3 vascular integrins (e.g., VITAXIN), angiostatin, endostatin, dalteparin, ABT-510, CNGRC peptide TNF alpha conjugate, cyclophosphamide, combretastatin A4 phosphate, dimethylxanthenon acetate, docetaxel, and lena. It is administered with lidomide, enzastaurin, paclitaxel, paclitaxel albumin-stabilized nanoparticle formulation (Abraxane), soy isoflavones (Genistein), tamoxifen citrate, thalidomide, ADH-1 (EXHERIN), AG-013736, AMG-706, AZD2171, sorafenib tosylate, BMS-582664, CHIR-265, pazopanib, PI-88, batalanib, everolimus, suramin, sunitinib malate, XL184, ZD6474, ATN-161, cilentide, and celecoxib, or any combination thereof.
[0165] The term "cancer," as used herein, refers to any benign or malignant abnormal proliferation of cells. Examples include breast cancer, prostate cancer, lymphoma, skin cancer, pancreatic cancer, colon cancer, melanoma, malignant melanoma, ovarian cancer, brain cancer, primary brain cancer, head and neck cancer, glioma, glioblastoma, liver cancer, bladder cancer, non-small cell lung cancer, head and neck cancer, breast cancer, ovarian cancer, lung cancer, small cell lung cancer, Wilms' tumor, cervical cancer, testicular cancer, bladder cancer, pancreatic cancer, gastric cancer, colon cancer, prostate cancer, genitourinary cancer, thyroid cancer, esophageal cancer, myeloma, multiple myeloma, adrenal cancer, renal cell carcinoma, endometrial cancer, adrenocortical carcinoma, and malignant pancreatic cancer. This includes, but is not limited to, insulinoma, malignant carcinoid carcinoma, choriocarcinoma, mycosis fungoides, malignant hypercalcemia, cervical hyperplasia, leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, chronic granulocytic leukemia, acute granulocytic leukemia, hairy cell leukemia, neuroblastoma, rhabdomyosarcoma, Kaposi's sarcoma, polycythemia vera, essential thrombocytosis, Hodgkin's disease, non-Hodgkin lymphoma, soft tissue sarcoma, osteosarcoma, primary macroglobulinemia, and retinoblastoma. In some embodiments, the cancer is selected from the group of neoplastic carcinomas.
[0166] <Pharmaceutical composition> In a further embodiment, the present invention provides a pharmaceutical formulation and a method of administering it to achieve any of the therapeutic effects described above (e.g., treatment of cancer). The pharmaceutical formulation may contain any of the reagents described above in a pharmaceutically acceptable carrier.
[0167] "Pharmacologically acceptable" means that a material is not biologically or otherwise undesirable; that is, the material can be administered to a subject without causing any undesirable biological effects, such as toxicity.
[0168] The formulations of the present invention may optionally include medicinal agents, pharmaceutical agents, carriers, auxiliaries, dispersants, diluents, and the like.
[0169] The double-stranded RNA, ASO, chemically modified siRNA molecule, or nucleic acid construct of the present invention can be formulated for administration in a pharmaceutical carrier according to known techniques. For example, Remington, The Science and Practice of Pharmacy (9 th See Ed. 1995). In the manufacture of the pharmaceutical formulation according to the present invention, double-stranded RNA, ASO, or chemically modified siRNA molecules (including physiologically acceptable salts thereof) are typically, and in particular, mixed with an acceptable carrier. The carrier may be solid, liquid, or both, and is preferably formulated with the double-stranded RNA, ASO, or chemically modified siRNA molecules in a unit dose formulation, such as a tablet, which may contain 0.01 or 0.5% to 95% or 99% by weight of the double-stranded RNA, ASO, or chemically modified siRNA molecules. One or more double-stranded RNA, ASO, or chemically modified siRNA molecules may be incorporated into the formulation of the present invention, which can be prepared by any of the well-known pharmaceutical techniques.
[0170] A further aspect of the present invention is a method for treating a subject in vivo, comprising administering to the subject a pharmaceutical composition comprising the double-stranded RNA, ASO, or chemically modified siRNA molecule of the present invention in a pharmaceutically acceptable carrier, wherein the pharmaceutical composition is administered in a therapeutically effective dose. Administration of the double-stranded RNA, ASO, or chemically modified siRNA molecule of the present invention to a human subject or animal requiring administration may be carried out by any means known in the art for administering compounds.
[0171] Non-limiting examples of formulations of the present invention include formulations suitable for oral, rectal, oral (e.g., sublingual), vaginal, parenteral (e.g., subcutaneous; intramuscular (including skeletal muscle, cardiac muscle, diaphragmatic muscle and smooth muscle); intradermal; intravenous; intraperitoneal), topical (i.e., both skin and mucosal surfaces including the airway surface), intranasal, transdermal, intra-articular, intracranial, subarachnoid, and inhalation administration, administration to the liver by portal vein delivery, and direct organ injection (e.g., to the liver, to the limbs, to the brain or spinal cord for delivery to the central nervous system, to the pancreas, or to a tumor or surrounding tissue of a tumor). In any given case, the most preferred route depends on the nature and severity of the condition being treated, and the nature of the specific compound used. In some embodiments, it may be desirable to deliver the formulation locally to avoid any adverse effects associated with systemic administration. For example, local administration can be achieved by direct injection at the desired treatment site, or by intravenous delivery at a site near the desired treatment site (e.g., into a blood vessel supplying the treatment site). In some embodiments, the formulation may be delivered locally to ischemic tissue. In certain embodiments, the formulation may be in the form of a slow-release formulation, such as a slow-release depot formulation.
[0172] For injection, the carrier is typically a liquid, such as sterile pyrogen-free water, pyrogen-free phosphate-buffered saline, bacteriostatic water, or Cremophor EL[R] (BASF, Parsippany, NJ). For other administration methods, the carrier may be either solid or liquid.
[0173] For oral administration, the compound may be administered in solid dosage forms such as capsules, tablets, and powders, or in liquid dosage forms such as elixirs, syrups, and suspensions. The compound may be encapsulated in gelatin capsules with inert components and powder carriers such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, tarkan, and magnesium carbonate. Examples of additional inert components that may be added to provide desirable color, taste, stability, buffering capacity, dispersion, or other known desirable characteristics include red iron oxide, silica gel, sodium lauryl sulfate, titanium dioxide, and edible white ink. Similar diluents may be used to manufacture compressed tablets. Both tablets and capsules may be manufactured as sustained-release products that provide continuous release of the drug over a period of several hours. Compressed tablets may be sugar-coated or film-coated to mask any unpleasant taste and protect the tablets from the air, or they may be enterically coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration may contain colorants and flavorings to increase patient tolerance.
[0174] Preparations suitable for oral (sublingual) administration include lozenges containing a flavored base, usually sucrose and compounds in acacia or tragacanth; and pastel preparations containing gelatin and compounds in an inert base such as glycerin or sucrose and acacia.
[0175] The formulations of the present invention, suitable for parenteral administration, comprise sterile aqueous and non-aqueous injectable solutions of the compound, the preparations preferably isotonic with the blood of the intended recipient. These preparations may contain antioxidants, buffers, bacteriostatic agents, and solutes to make the formulation isotonic with the blood of the intended recipient. The aqueous and non-aqueous sterile suspensions may contain suspending agents and thickeners. The formulations may be presented in unit / dose or multi-dose containers, such as sealed ampoules and vials, and may be stored in a lyophilized state requiring only the addition of a sterile liquid carrier, such as saline or sterile water for injection, immediately before use.
[0176] Immediate injection solutions and suspensions can be prepared from the types of sterile powders, granules, and tablets previously described. For example, in one embodiment of the present invention, a stable sterile composition for injection is provided, comprising a unit dosage form of the compound of the present invention in a sealed container. The compound or salt is provided in the form of a lyophilized product that can be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection into a subject. The unit dosage form typically contains about 10 mg to about 10 g of the compound or salt. If the compound or salt is substantially water-insoluble, the compound or salt may be emulsified in an aqueous carrier using a sufficient amount of a pharmaceutically acceptable emulsifier. One such useful emulsifier is phosphatidylcholine.
[0177] Formulations suitable for rectal administration are preferably presented as unit-dose suppositories. These can be prepared by mixing the compound with one or more conventional solid carriers, such as cocoa butter, and then molding the resulting mixture.
[0178] Formulations suitable for topical application to the skin are preferably in the form of ointments, creams, lotions, pastes, gels, sprays, aerosols, or oils. Carriers that can be used include yellow petrolatum, lanolin, polyethylene glycol, alcohol, transdermal enhancers, and combinations of two or more of these.
[0179] Formulations suitable for transdermal administration may be presented as separate patches adapted to remain in close contact with the recipient's epidermis for extended periods. Alternatively, formulations suitable for transdermal administration can be delivered by iontophoresis (see, e.g., Tyle, Pharm. Res. 3:318 (1986)), typically in the form of an aqueous solution of the compound, sometimes buffered. Suitable formulations contain citrate or bis / Tris buffer (pH 6) or ethanol / water, and contain 0.1–0.2 M of the compound.
[0180] The compound may be formulated for nasal administration or otherwise administered to the lungs of the subject by any suitable means, for example, by an aerosol suspension inhaled by the subject, of respiratory particles containing the compound. The respiratory particles may be liquid or solid. The term "aerosol" includes any gaseous suspension phase that can be inhaled into the bronchioles or nasal passages. In particular, an aerosol includes droplets of a gaseous suspension, such as those produced in a metered-dose inhaler or nebulizer, or in a mist atomizer. An aerosol also includes a dry powder composition suspended in air or another carrier gas, which may be delivered, for example, by blowing from an inhalation device. See Ganderton & Jones, Drug Delivery to the Respiratory Tract, Ellis Horwood (1987); Gonda (1990) Critical Reviews in Therapeutic Drug Carrier Systems 6:273-313; and Raeburn et al., J. Pharmacol. Toxicol. Meth. 27:143 (1992). Aerosols of liquid particles containing compounds can be produced by any suitable means, such as by a pressure-driven aerosol sprayer or an ultrasonic sprayer, as is well known to those skilled in the art. See, for example, U.S. Patent No. 4,501,729. Aerosols of solid particles containing compounds can similarly be produced by any solid particulate pharmaceutical aerosol generator by techniques known in the pharmaceutical field.
[0181] Alternatively, the compound may be administered topically rather than systemically, for example, in the form of a depot or sustained-release formulation.
[0182] Furthermore, the present invention provides liposome formulations of the compounds and salts disclosed herein. Techniques for forming liposome suspensions are well known in the art. If the compound or salt is a water-soluble salt, the compound or salt can be incorporated into lipid vesicles using conventional liposome techniques. In such cases, due to the water solubility of the compound or salt, the compound or salt is substantially incorporated into the hydrophilic center or core of the liposome. The lipid layer used may be a layer of any conventional composition and may or may not contain cholesterol. If the compound or salt of interest is water-insoluble, the salt can again be substantially incorporated into the hydrophobic lipid bilayer that forms the structure of the liposome using conventional liposome formation techniques. In either case, the size of the resulting liposomes can be reduced through the use of standard sonication and homogenization techniques.
[0183] Liposome formulations containing the compounds disclosed herein or salts thereof may be freeze-dried to produce a lyophilized product which can be reconstituted with a pharmaceutically acceptable carrier such as water to regenerate a liposome suspension.
[0184] In the case of water-insoluble compounds, pharmaceutical compositions containing the water-insoluble compound can be prepared, for example, in an aqueous emulsion. In such cases, the composition contains a sufficient amount of pharmaceutically acceptable emulsifier to emulsify the desired amount of the compound. Particularly useful emulsifiers include phosphatidylcholine and lecithin.
[0185] In certain embodiments, the compound is administered to the subject in a therapeutically effective dose, the term therapeutically effective dose as defined above. The dosage of a pharmaceutically active compound can be determined by methods known in the art; see, for example, Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa). The therapeutically effective dose of any particular compound varies somewhat from compound to compound and from patient to patient, depending on the patient's condition and route of delivery. As a general suggestion, dosages of approximately 0.001 to approximately 50 mg / kg have therapeutic efficacy, and all weights, including when salts are used, are calculated based on the weight of the compound. Due to concerns about toxicity at higher levels, intravenous dosages may be limited to lower levels, such as up to approximately 10 mg / kg, and all weights, including when salts are used, are calculated based on the weight of the compound. Doses of approximately 10 mg / kg to approximately 50 mg / kg may be used for oral administration. Typically, dosages of approximately 0.5 mg / kg to 5 mg / kg can be used for intramuscular injection. Specific dosages for intravenous or oral administration are approximately 1 μmol / kg to 50 μmol / kg, and particularly approximately 22 μmol / kg to 33 μmol / kg of the compound.
[0186] In certain embodiments of the present invention, two or more doses (e.g., two, three, four or more doses) may be administered at various time intervals (e.g., hourly, daily, weekly, monthly, etc.) to achieve a therapeutic effect.
[0187] The present invention finds use in veterinary and medical applications. Preferred subjects include both birds and mammals, with mammals being preferred. The term "birds," as used herein, includes, but is not limited to, chickens, ducks, geese, quail, turkeys, and pheasants. The term "mammals," as used herein, includes, but is not limited to, humans, cattle, sheep, goats, horses, cats, dogs, rabbits, and the like. Human subjects include neonates, infants, children, and adults. In other embodiments, the subject is an animal model of cancer. In certain embodiments, the subject has cancer or is at risk of developing cancer.
[0188] The following embodiments are not intended to limit the scope of the claims of the present invention, but rather to illustrate certain particular embodiments. Any variations in the illustrated methods that can be conceived by those skilled in the art are intended to fall within the scope of the invention. As will be understood by those skilled in the art, several embodiments and elements exist for each aspect of the claimed invention, and all combinations of different elements are thus expected; therefore, any particular combination illustrated herein should not be construed as limiting the scope of the claimed invention. Where a particular element is removed from or added to the group of elements that can be used in a combination, the group of elements should be construed as incorporating such variations. [Examples]
[0189] [Example 1] Mutant KRAS-specific siRNA <Method> Novel mutant-specific siRNAs (MS-siRNAs) were designed based on previous literature suggesting a 3-mismatch resistance threshold for 19-nucleotide siRNA efficacy (Naito et al., Nucleic Acids Res. 32:W124 (2004)). Two or fewer mismatches between the sequence and the target gene allow the siRNA to bind to the gene of interest and successfully knock down its expression. However, at and above the 3-mismatch threshold, the siRNA cannot recognize the target and therefore allows the expression of the encoded protein. Using open-source software provided by Sigma Aldrich, Life Technologies, and Dharmacon, custom MS-siRNAs were generated to act as antisense for an artificial hypermutant version of the WT-KRAS gene that does not actually occur in nature, each with exactly three point mutations corresponding to each of the most commonly present KRAS mutants (G12C, G12D, or G12V and G13D). Thirty contiguous nucleotides were included upstream and downstream of these sites in the artificial hypermutant mRNA input (Figure 1). It should be noted that the siRNA sequences were designed to target two different artificial mRNA sequences, one containing specific missense mutations simultaneously at codons 12 (G12C and G12D) and 13 (G13D), and the other containing specific missense mutations simultaneously at codons 12 (G12C and G12V) and 13 (G13D) (Figure 1). The resulting sequences are thus antisense, having three mismatch errors for WT-KRAS but only two mismatch errors for each of the three mutant KRAS alleles. As a result, these sequences were hypothesized to be below the 3-mismatch threshold for mutant KRAS and above the threshold for the WT-KRAS alleles, thus optimizing the task of targeting mutant KRAS while preserving the WT-KRAS alleles.In addition, by introducing one mutation from each of three different dominant KRAS mutants in the custom sequence design, the resulting siRNA has the added potential advantage of simultaneously targeting several KRAS mutants, rather than just one.
[0190] Constructs containing WT, G12C, G12D, G12V, or G13D-KRAS genes inserted into a pBABE-puro retrovirus expression vector were prepared. To expand the vector constructs, plasmids were added to highly efficient competent E. coli cells and incubated in SOC medium on a shaker at 37°C. Subsequently, the cells were seeded onto ampicillin agarose plates and incubated overnight at 37°C. Bacterial colonies were taken from the overnight culture plates and placed in LB medium containing 1 μl / ml carbocyclin, and incubated overnight on a shaker at 37°C to prepare liquid cultures. Three sets of liquid cultures were prepared. Plasmid DNA from the resulting turbid cultures was purified using the QIAprep Spin Miniprep Kit (Qiagen). Successful plasmid expansion was confirmed by restriction enzyme digestion using BamHI and HindIII, and gel electrophoresis. Undigested plasmids from Miniprep were further expanded in LB medium containing 0.1 μl / ml of carbocycline, and then purified using the QIAprep Spin Maxiprep Kit (Qiagen).
[0191] To produce a retrovirus containing the pBABE-puro-KRAS plasmid, HEK293T cells 9×10 6The cells were seeded on 6 cm cell culture plates in 293T medium (DMEM containing 10% FBS and 1% penicillin-streptomycin) and incubated at 37°C and 5% CO2. After 24 hours, plasmid DNA mixtures were prepared for each pBABE-puro-KRAS plasmid by creating a mixture of 0.01 μg / μl plasmid construct and 0.01 μg / μl PCL10A packed vector plasmid in OptiMEM medium. In addition, L2K mixtures were prepared by adding 0.05 μg / μl of lipofectamine 2000 (Thermo Fisher Scientific) to OptiMEM medium and incubating at room temperature for 5 minutes. Subsequently, the L2K mixtures were mixed 1:1 with each plasmid DNA mixture and incubated at room temperature for 20 minutes. The culture medium was removed from the incubated cells, and then 2 ml of 293T medium was added to each well along with 250 μl of plasmid DNA / L2K mixture. After a further 24 hours, the plasmid DNA / L2K medium was replaced with 293T medium. After another 24 hours, the resulting virus medium was collected from the wells and replaced with fresh 293T medium. The virus medium was stored overnight on ice at 4°C. After another 24 hours, the medium was again collected from the wells and added to the previously stored virus. The mixture was centrifuged at room temperature, and the supernatant was collected. This process was repeated using mCherry and 293T medium instead of the plasmid construct to produce mCherry and empty vector viruses, respectively.
[0192] To infect cells with the KRAS plasmid, NIH3T3 cells were harvested and seeded at a rate of 100,000 cells per well in a 6-well plate in complete medium (DMEM containing 10% Colorado bovine serum and 1% penicillin / streptomycin). After 4–6 hours and once cells had adhered, the medium was aspirated and 2 ml of complete medium containing 10 μl / ml polyblen was added to each well along with 250 μl of viral medium (WT, G12C, G12D, G12V, G13D, mCherry, and empty vector) or complete medium (negative control). Cells were centrifuged at 1500 g at 30°C for 60 minutes and then incubated overnight at 37°C. After 24 hours, the wells were aspirated and complete medium was added to each well. After another 24 hours, the wells were aspirated and complete medium containing 2 μg / ml puromycin was added. The culture medium in the negative control wells was replaced with puromycin every 24 hours until no viable cells remained. Successful infection was further confirmed using mCherry expression.
[0193] RNAi knockdown was induced in KRAS-infected NIH3T3 cells seeded at a density of 60,000 cells per 500 μl of complete medium per well in a 24-well plate. Scrambled control siRNA sequences, as well as positive controls (Seq2 and 3, G12C and G12D siRNAs) previously found to potently silence wild-type and mutant KRAS, were used as shown in Figure 1 (Fleming et al., Mol. Cancer Res. 3:413 (2005); Pecot et al., Mol. Cancer Ther. 13:2876 (2014)). Cells were incubated with 20 nM siRNA (Sigma Aldrich) and lipofectamine(R) RNAiMAX transfection reagent (Thermo Fisher Scientific, transfection reagent to siRNA in a 2:1 volume ratio) in a 5:1 mixture of complete medium and serum-free medium at 37°C under 5% CO2 for 5 hours. The medium was removed, and the cells were incubated in complete medium alone for a further 19 hours. RNA was then collected and purified using the QIAprep Spin Miniprep Kit.
[0194] Purified RNA from siRNA treatment was quantified using a spectrophotometer and then reverse transcribed into cDNA using the iScript® cDNA Synthesis Kit (Bio-Rad). To quantify the relative expression level of KRAS, RT-PCR reactions were performed using the StepOnePlus® Real-Time PCR System (Thermo Fisher Scientific) by monitoring the real-time change in SYBR green fluorescence intensity. Each sample was performed in three replicates. Additionally, the ΔCt value was calculated using StepOnePlus® by comparing the period threshold (Ct value) of KRAS with the Ct value of the target reference gene 18s. The RQ value was then obtained using ΔΔCT analysis, comparing the ΔCt value for each siRNA with the ΔCt value of NC siRNA. Error bars represent one standard deviation. The data represent the results of one trial of two sets of biological replicates for WT and G12D, and two trials of two sets of biological replicates for G12C, G12V, and G13D. Reverse transfection experiments were performed twice for each siRNA in each cell line.
[0195] <Result> To test the effectiveness of mutant-specific KRAS silencing in vitro, siRNA sequences of candidate MS KRAS from a single panel were tested for their ability to knock down KRAS expression in both WT and target mutant KRAS-expressing cells. The 12CD13D_1 sequence was observed to knock down G12C (50%), G12D (82%), and G13D mutant KRAS (66%), while preserving WT-KRAS expression (only 4% knockdown compared to the negative control siRNA) (Figure 2A). Unexpectedly, this sequence was also recorded to knock down G12V expression (58%). In addition, 12CD13D_2 and 12CD13D_4 were found to exhibit both WT preservation and mutant knockdown. However, the former appeared to exhibit lower WT preservation than 12CD13D_1, while the latter appeared to exhibit less KRAS knockdown in all cell lines (Figure 2A). The remaining sequences exhibited low potency against mutant KRAS, high KRAS knockdown in WT-KRAS cell lines, or both (Figure 2A).
[0196] In addition, to compare the effectiveness of MS-siRNA sequences with sequences previously demonstrated to exhibit target specificity, G12C-specific and G12D-specific siRNA sequences (Fleming et al., Mol. Cancer Res. 3:413 (2005)) were tested. However, mutant specificity was not confirmed for these sequences, and they did not exhibit the expected preferential knockdown of G12C and G12D mutant KRAS, respectively, over WT or other mutant alleles (Figure 2B).
[0197] KRAS-siRNA sequences 12CD13D_1 and 12CD13D_4 were tested in a KRAS-G12D mutant lung cancer cell line. Using a control siRNA (Scr) and two previously validated KRAS-siRNAs (Seq2 and 3), the customized mutant-specific KRAS-siRNA sequences 12CD13D_1 and 12CD13D_4 were demonstrated to be highly effective in silencing KRAS protein expression (Figure 3).
[0198] We tested all possible siRNA sequence reorders between our custom siRNA sequences. To confirm the best possible custom KRAS-siRNA sequence (read sequences 12CD13D_1 and 12CD13D_4), we tested a sequence library (12CD13D_A~12CD13D_F) moving progressively downstream between 12CD13D_1 and 12CD13D_4 (Figure 4).
[0199] After stable transduction into 3T3 cells with either wild-type (WT) or mutant G12C, G12D, G12V, and G13D human KRAS sequences, the cells were transfected with the KRAS-siRNA sequences listed in Figure 5. 24 hours after transfection, the cells were lysed, RNA was collected, and cDNA was constructed. Quantitative qPCR was performed for KRAS using 18s as the housekeeping gene. The custom sequences 12CD13D_1 and 12CD13D_4 were found to be the most superior overall in silencing mutant KRAS, while other possible KRAS-siRNA sequences ("A" to "F") were found to be less potent overall in silencing various KRAS-mRNA sequences. In this experiment, the custom KRAS-siRNA 12CD13D_4 sequence was the most superior in preserving the WT sequence.
[0200] <Consideration> Despite considerable effort to target mutant KRAS, no direct inhibitors currently exist for clinical use. Furthermore, recent small molecule cancer therapies exhibit low target specificity and result in adverse toxicity in non-cancer cells (Pecot et al., Nat. Rev. Cancer 11:59 (2011)). Despite current advances in inhibiting downstream effectors in the KRAS signaling pathway, KRAS remains an elusive target for drug development (Cox et al., Nat. Rev. Drug Discov. 13:828 (2014)). Therefore, this study investigated the effectiveness of a novel MS-siRNA as a means of selectively inhibiting the expression of mutant KRAS.
[0201] Based on these preliminary findings, the 12CD13D_1 and 12CD13D_2 siRNA sequences were selected as lead candidates for further investigation as therapeutic agents due to their high mutant specificity and potency. 12CD13D_4 is also a promising candidate, albeit to a lower degree. However, its low efficiency in knocking down KRAS expression in mutant targets suggests it may not be effective as a clinically relevant therapeutic agent. In contrast, G12C-specific and G12D-specific siRNAs appear to exhibit no preservation of the WT-KRAS allele at all.
[0202] In addition, the lower specificity of both sequences, which were designed to target G12V rather than G12D point mutations, suggests greater resistance to WT-KRAS in G12V-targeting sequences.
[0203] These preliminary findings collectively suggest the viability of novel MS-siRNA as a mutant-specific medium for silencing oncogenic KRAS. Due to its potential as an effective payload with mutant KRAS specificity, novel mutant-specific siRNAs represent a promising tool for exploring drug development for previously "undevelopable" conditions.
[0204] [Example 2] Antisense oligonucleotides targeting synthetic mutant KRAS A series of antisense oligonucleotide (ASO) sequences were created targeting the mutant KRAS of the present invention (SEQ ID NO: 53), including mutants G12C, G12D, and G13D, relative to the wild-type KRAS sequence (SEQ ID NO: 52) (Figure 6 and Table 2). In Figure 6, black bars represent nucleotides with 2'-methoxy-ethyl (MOE) modifications, while gray areas represent "gapmers" consisting of DNA. The schematic diagram is not to scale, and the black bars consist of five adjacent MOE-modified nucleotides on each side, while there are 10 nucleotide gapmers. The ASO incorporates phosphorothioate bonds (PS, indicated by "*") between all nucleotides, a 10nt gapmer (underlined), and five adjacent 2'-MOE (methoxy-ethyl) modifications (bold). The ASOs were tested to identify single-stranded RNA and / or DNA sequences that retain the ability to silence several KRAS mutations.
[0205] [Table 2]
[0206] Four separate A431 cell lines were manipulated to remove wild-type KRAS expression and express one of the following mutations: G12C, G12D, G13D, or G12V. Each cell line was treated with 1.1 μM free ASO for 48 hours and then subjected to qPCR. The results are shown in Figure 7. While some ASOs demonstrated the ability to silence one or more of the mutations, ASO15 and ASO16 were found to be very potent in silencing all four of the most common KRAS mutations.
[0207] We re-evaluated some of the top hits and found that ASO15 and ASO16 again potently silenced all four KRAS mutations in a dose-response manner (Figure 8). Cells were treated with 1.1 μM and 10 μM free ASO for 48 hours, and then qPCR was performed for mutant KRAS.
[0208] [Example 3] Modified ASO16 sequence To identify ASOs with increased mutation specificity by targeting naturally occurring mutations, such as single mutations (G12C, G12D, G12V, or G13D), modified versions were prepared, starting with potent ASO16. Modifications included base substitutions and the use of locked nucleic acids. The modified sequences are shown in Table 3. The ASOs incorporate phosphorothioate bonds (PS, indicated by "*") between all nucleotides, a 10nt gapmer (underlined), and five adjacent 2'-MOE (methoxy-ethyl) modifications (bold). The last four sequences use a single locked nucleic acid (LNA, indicated by "+" before the base) instead of MOE to increase the melting temperature at specific sites. The LNA consists of a methylene bridge connecting the 2' and 4' carbons.
[0209] [Table 3]
[0210] ASO was tested in the A431 cell line as described above. The results are shown in Figure 9. Improvements in potency for each KRAS mutation were found for 1) G12C using ASO16-G12C and ASO-G12C-LNA, 2) G12D using ASO16-G12D and ASO16-G12D-LNA, 3) G12V using ASO16-G12V and ASO16-G12V-LNA, and 4) G13D using ASO16-G13D and ASO16-G13D-LNA. These results indicate that the increased mutation specificity of these ASO sequences resulted in increased potency.
[0211] The effect of LNA on ASO16 activity was investigated. MIAPaCa-2 pancreatic cancer cell lines expressing the KRAS-G12C mutation were tested by free ASO uptake. Cell lines were treated for 72 hours with 1 μM or 5 μM of ASO16, ASO16 C12C, or ASO16 G12C containing 1, 2, or 3 LNA molecules around the mismatch site, and qPCR was performed. The results are shown in Figure 10. The results show a significant improvement in KRAS silencing due to increased LNA at the mismatch site.
[0212] The ability to preserve wild-type KRAS expression was tested using the same ASO. A luciferase reporter system was used in A431 cells, in which the endogenous wild-type KRAS allele was deleted to avoid competition for ASO. Subsequently, these A431-KRAS null strains were manipulated to express either wild-type KRAS or KRAS-G12C tagged with the firefly luciferase reporter. Upon 72 hours of exposure to 5 μM ASO via free uptake, ASO showed significant wild-type preservation compared to G12C silencing, most pronounced in ASO16-G12C ASO with LNA modification (Figure 11).
[0213] [Example 4] Fully modified siRNA sequence To identify sequences that preserve the wild-type KRAS sequence while maximizing the reduction of mutated sequence expression, some of the ASOs targeting a single KRAS mutation, as described in Example 3, were converted to siRNA molecules. These siRNAs were then fully modified (FM) to minimize nuclease degradation and immunostimulation. While these types of modifications often reduce the silencing activity of siRNAs, we developed several fully modified siRNA sequences that retain all or almost all of the silencing activity of the siRNA compared to unmodified siRNAs.
[0214] Table 4 lists the prepared fully modified siRNA sequences.
[0215] Each siRNA was tested in A431 cells engineered to express either wild-type (WT) or the targeted KRAS mutation. For mutant-expressing A431 cells, the WT allele was deleted via CRISPR, so the expression shown reflects only mutant mRNA. Cells were transfected with low-dose (20 nM) negative control (NC) or FM KRAS-siRNA, and qPCR for KRAS expression was performed on RNA isolated 24 hours later.
[0216] [Table 4] JPEG0007839554000008.jpg255163 JPEG0007839554000009.jpg255163
[0217] For siRNAs targeting the G12C mutation, both D1-G12C-FM and D2-G12C-FM were found to be able to reduce mutant KRAS-G12C while preserving wild-type expression (Figure 12). Notably, not all siRNAs were equivalent in suppressing G12C KRAS or preserving wild-type KRAS. As shown in Figure 13, some of the mutant-specific (MS) repeats (barred in gray) of the "parent" D1 (12CD13D_1), D2 (12CD13D_2), and D4 (12CD13D_4) sequences were found to be more potent (panel 1). Some of the MS sequences, unlike pan-KRAS Seq2, were found to reduce the mutant more potently than the WT sequence (see D1-G12C, D2-G12C, D4-G12C) (panel 2). Finally, the FM repeats of these MS sequences were found to exhibit retention of silencing activity against mutant KRAS over WT-KRAS expression (e.g., D2-G12C-FM-F) (panel 3).
[0218] Regarding siRNAs targeting the G12D mutation, D1-G12D-FM, D2-G12D-FM, and D2-G12D-FM-F were all found to reduce mutant KRAS-G12D (Figure 14). Furthermore, D1-G12D-FM and D2-G12D-FM were able to preserve WT expression (Figure 14). Notably, not all siRNAs were equivalent in suppressing G12D KRAS or preserving wild-type KRAS. As shown in Figure 15, some mutant-specific (MS) repeats (shaded bars) of the “parent” D1, D2, and D4 sequences were found to be more potent (Panel 1). Some of the MS sequences, unlike pan-KRAS Seq2, were found to reduce mutants more potently than WT sequences (see D1-G12D) (Panel 2). Finally, these MS sequence FM repeats were found to retain silencing activity against mutant KRAS more effectively than WT-KRAS expression (e.g., D1-G12D-FM and D2-G12D-FM) (Panel 3).
[0219] Regarding siRNAs targeting the G12V mutation, V1-G12V-FM and V2-G12D-FM were found to reduce mutant KRAS-G12V while preserving wild-type expression (Figure 16). Notably, not all siRNAs were equivalent in suppressing G12D KRAS or preserving wild-type KRAS. As shown in Figure 17, some mutant-specific (MS) repeats (shaded bars) of the “parent” D1, D2, and D4 sequences were found to be more potent (Panel 1). Some of the MS sequences, unlike pan-KRAS Seq2, were found to reduce the mutant more potently than the WT sequence (see D2-G12V) (Panel 2). Finally, these MS sequence FM repeats were found to retain silencing activity against mutant KRAS more effectively than WT-KRAS expression (e.g., D1-G12V-FM and D2-G12V-FM) (Panel 3).
[0220] Regarding siRNAs targeting the G13D mutation, D2-G13D-FM and D2-G13D-FM-F were found to reduce mutant KRAS-G12D (Figure 18). Furthermore, D2-G12D-FM-F was able to preserve WT expression (Figure 18). Notably, not all siRNAs were equivalent in suppressing G12D KRAS or preserving wild-type KRAS. As shown in Figure 19, some mutant-specific (MS) repeats (shaded bars) of the “parent” D1, D2, and D4 sequences were found to be more potent (Panel 1). Some of the MS sequences, unlike pan-KRAS Seq2, were found to reduce mutants more potently than WT sequences (see D1-G13D and D4-G13D) (Panel 2). Finally, these MS sequence FM repeats were found to retain silencing activity against mutant KRAS more effectively than WT-KRAS expression (e.g., D2-G13D-FM and D2-G13D-FM-F) (Panel 3).
[0221] The effect of G12D-targeted siRNA on cell viability was tested using A427 (KRAS-G12D) lung cancer cells. Cells were transfected with siRNA, and cell viability was measured after 5 (D5) or 8 (D8) days using CELLTITER_GLO® luminescence readout. As shown in Figure 20, the results clearly demonstrate that D2-G12D Hi2F and D4-G12D Hi2F siRNAs are highly potent against the G12D strain.
[0222] We conducted a similar experiment and learned about IC for siRNA. 50 The (i.e., GI50) value was determined. The results are shown in Table 5 and Figure 21.
[0223] [Table 5]
[0224] Similar cell viability studies were conducted in HCT116 (KRAS-G13D) colon cancer cells using G13D-targeted siRNA. As shown in Figure 22, the results clearly demonstrate that all D2-G13D fully modified siRNAs are highly potent in inhibiting cancer cell viability.
[0225] We conducted a similar experiment and learned about IC for siRNA. 50 The values were determined. The results are shown in Figure 23. In addition, qPCR experiments were performed on A431 WT and KRAS-G13D models, and the most potent siRNA, EFTX-G13D-F2, showed up to 5-fold preservation of wild-type KRAS (Figure 23).
[0226] To study in vivo efficacy, HCT116 (KRAS-G13D) tumors were used as xenografts in thymic-deficient nude mice, with tumors measuring approximately 125 mm in size. 3 The tumors were established to a certain size and then treated with either PBS or EGFR-targeting ligand (GE11) conjugated to D2-G13D-Hi2F siRNA with the indicated linker (Figure 24). Mice were subcutaneously treated with GE11-siRNA (5 mg / kg) suspended in sterile PBS. The results showed up to 50–70% silencing of KRAS in the tumors at the indicated time points (Figure 24). Each group and time point shown represents five independent tumors.
[0227] The effect of G12V-targeted siRNA on cell viability was tested using SKC01 (KRAS-G12V) colon cancer cells. Cells were transfected with siRNA, and cell viability was measured after 5 (D5) or 8 (D8) days using CELLTITER_GLO® luminescence readout. As shown in Figure 25, the results demonstrate substantial anticancer activity from both V1-G12V and V4-G12V fully modified siRNAs.
[0228] We conducted a similar experiment and learned about IC for siRNA. 50The values were determined. The results are shown in Figure 26. In addition, qPCR experiments were performed on the A431 WT and KRAS-G12V models, demonstrating the preservation of wild-type KRAS by EFTX-3G12V1 and EFTX-3G12V4 (Figure 26).
[0229] The effect of EFTX-D1 on KRAS expression was tested in NIH3T3 cells. Figure 27A shows Western blots 36 hours after transient transfection with 20 nM NC siRNA, Seq2 siRNA, or EFTX-D1 siRNA of NIH3T3 cells stably expressing HA-tagged KRAS WT or G12C. Cell lysates were blotted for HA(KRAS) and β-actin (loading control). Concentration measurements are shown on the right, and the results are normalized for NC siRNA transfection and β-actin expression. Figure 27B shows Western blots 48 hours after transient transfection with 20 nM NC siRNA, Seq2 siRNA, or EFTX-D1 siRNA of A431 cells stably expressing HA-tagged KRAS WT, G12C, or G12D. Cell lysates were blotted for HA(KRAS) and vinculin (loading control). The concentration measurements are shown on the right, and the results, normalized for NC siRNA transfection and vinculin expression, reveal that EFTX-D1 more strongly silences mutant KRAS expression, while preserving wild-type levels of protein.
[0230] [Example 5] Additional fully modified CiNii sequence siRNAs containing the sequence of SEQ ID NO: 50 or SEQ ID NO: 51 were used as positive controls in the experiments described in Example 1. Fully modified versions of these siRNAs were prepared and their specificity and potency were tested. The sequences of the FM siRNAs are shown in Table 4. HCT116 (colon cancer, KRAS-G13D) and LU65 (lung cancer, KRAS-G12C) cell lines were transfected with either 20 nM unmodified Seq2 or Seq3, or fully chemically modified (FM) Seq2-FM or Seq3-FM siRNA sequences. Surprisingly, both Seq2-FM and Seq3-FM maintained complete silencing of KRAS activity, particularly 48 hours after treatment (Figure 28).
[0231] All publications, patents, and patent applications are incorporated herein by reference, as is specifically and individually indicated, each individual publication, patent, or patent application being incorporated by reference.
[0232] Although the above invention has been described in some detail by means of examples and illustrations for the purpose of clarifying understanding, it will be apparent that certain changes and modifications may be made within the scope of the above embodiments and the enumeration of the accompanying claims.
Claims
1. Antisense oligonucleotides targeted to synthetic human KRAS-mRNA encoding missense mutations G12C, G12D, and G13D, having a length of 16 to 25 nucleotides and containing the sequence TCTTGCCTACGTCATA (SEQ ID NO: 114).
2. The antisense oligonucleotide according to claim 1, having a length of 20 nucleotides.
3. An antisense oligonucleotide according to claim 1 or 2, comprising the sequence CACTCTTGCCTACGTCATAA (SEQ ID NO: 115).
4. An antisense oligonucleotide according to claim 1 or 2, comprising the sequence GCACTCTTGCCTACGTCATA (sequence number 116).
5. An antisense oligonucleotide according to any one of claims 1 to 4, comprising at least one phosphorothioate bond.
6. The antisense oligonucleotide according to claim 5, comprising only a phosphorothioate bond.
7. An antisense oligonucleotide according to any one of claims 1 to 6, comprising at least one modified nucleotide at or near its 5' and / or 3' end.
8. The antisense oligonucleotide according to claim 7, comprising at least three modified nucleotides at each of its 5' and 3' ends.
9. The antisense oligonucleotide according to claim 7 or 8, wherein the modified nucleotide is a 2'-O-methoxyethyl (2'-MOE) modified nucleotide.
10. The antisense oligonucleotide according to claim 9, comprising at least three 2'-MOE modified nucleotides at each of its 5' and / or 3' ends. 【Request Item 11】 【Chemistry 1】 (In the sequence, * indicates a phosphorothioate bond, and bold indicates a 2'-MOE modified nucleotide.) The antisense oligonucleotide according to claim 10, comprising a sequence selected from the above.
12. The antisense oligonucleotide according to any one of claims 7 to 9, wherein at least one modified nucleotide is a locked nucleic acid.
13. Antisense oligonucleotides targeted to native human KRAS-mRNA encoding mutations selected from G12C, G12D, G12V, and G13D, having a length of 16 to 25 nucleotides, a) TCTTGCCTACGCCACA (SEQ ID NO: 117), which targets human KRAS-mRNA encoding the G12C mutation. b) TCTTGCCTACGCCATC (SEQ ID NO: 118), which targets human KRAS-mRNA encoding the G12D mutation. c) TCTTGCCTACGCCAAC (SEQ ID NO: 119), which targets human KRAS-mRNA encoding the G12V mutation. d) TCTTGCCTACGTCACC (SEQ ID NO: 120), which targets human KRAS-mRNA encoding the G13D mutation, or e) A sequence that is at least 90% identical to any one of a) to d). An antisense oligonucleotide comprising a sequence selected from and containing at least one non-natural chemical modification.
14. The antisense oligonucleotide according to claim 13, having a length of 20 nucleotides.
15. a) GCACTCTTGCCTACGCCACA (SEQ ID NO: 124), which targets human KRAS-mRNA encoding the G12C mutation. b) GCACTCTTGCCTACGCCATC (SEQ ID NO: 125), which targets human KRAS-mRNA encoding the G12D mutation. c) GCACTCTTGCCTACGCCAAC (SEQ ID NO: 126), which targets human KRAS-mRNA encoding the G12V mutation, or d) GCACTCTTGCCTACGTCACC (SEQ ID NO: 127), which targets human KRAS-mRNA encoding the G13D mutation. An antisense oligonucleotide according to claim 13 or 14, comprising a sequence selected from the above.
16. An antisense oligonucleotide according to any one of claims 13 to 15, comprising at least one phosphorothioate bond.
17. The antisense oligonucleotide according to claim 16, comprising only a phosphorothioate bond.
18. An antisense oligonucleotide according to any one of claims 13 to 17, comprising at least one modified nucleotide at or near its 5' and / or 3' end.
19. The antisense oligonucleotide according to claim 18, comprising at least three modified nucleotides at each of its 5' and 3' ends.
20. The antisense oligonucleotide according to claim 18 or 19, wherein the modified nucleotide is a 2'-MOE modified nucleotide.
21. The antisense oligonucleotide according to claim 20, comprising at least three 2'-MOE modified nucleotides at each of its 5' and / or 3' ends. 【Request Item 22】 【Chemistry 2】 (In the sequence, * indicates a phosphorothioate bond, and bold indicates a 2'-MOE modified nucleotide.) The antisense oligonucleotide according to claim 21, comprising a sequence selected from the above.
23. The antisense oligonucleotide according to any one of claims 18 to 20, wherein at least one modified nucleotide is a locked nucleic acid. 【Request Item 24】 【Chemistry 3】 (In the sequence, * indicates a phosphorothioate bond, bold indicates a 2'-methoxymethyl modified nucleotide, and + indicates that the subsequent nucleotide is a locked nucleic acid.) The antisense oligonucleotide according to claim 23, comprising a sequence selected from the above.
25. A nucleic acid construct comprising an antisense oligonucleotide according to any one of claims 1 to 4 or 13 to 15.
26. A nucleic acid molecule encoding an antisense oligonucleotide according to any one of claims 1 to 4.
27. A nucleic acid construct comprising the nucleic acid molecule described in claim 26.
28. A composition comprising an antisense oligonucleotide according to any one of claims 1 to 24.
29. A composition comprising two or more antisense oligonucleotides according to any one of claims 1 to 24 in any combination, wherein each of the two or more antisense oligonucleotides comprises a different sequence.
30. The composition according to claim 28 or 29, further comprising nanoparticles.
31. The composition according to claim 30, wherein the nanoparticles are nanoliposomes.
32. A pharmaceutical composition comprising an antisense oligonucleotide according to any one of claims 1 to 24, a nucleic acid construct according to claim 25 or 27, and / or a composition according to any one of claims 28 to 31, and a pharmaceutically acceptable carrier.
33. A method for inhibiting the expression of a mutant human KRAS gene containing one or more missense mutations G12C, G12D, G12V, and G13D in vitro cells, comprising the step of contacting the cells with an antisense oligonucleotide according to any one of claims 1 to 24, a nucleic acid construct according to claim 25 or 27, a composition according to any one of claims 28 to 31, and / or a pharmaceutical composition according to claim 32, thereby inhibiting the expression of the mutant human KRAS gene in the cells.
34. A pharmaceutical composition for treating cancer in a subject requiring treatment for cancer, wherein the cancer comprises a mutant human KRAS gene containing one or more missense mutations G12C, G12D, G12V, and G13D, and the pharmaceutical composition comprises an antisense oligonucleotide according to any one of claims 1 to 24, a nucleic acid construct according to claim 25 or 27, a composition according to any one of claims 28 to 31, and / or the pharmaceutical composition according to claim 32.
35. The pharmaceutical composition according to claim 34, wherein the pharmaceutical composition is delivered systemically.
Citation Information
Patent Citations
K-rassiRNA-containing compositions and methods for using the same
JP2010538678A