Mutant glucose dehydrogenase

Abstract

The present invention provides a glucose dehydrogenase having an improved specific activity. A polypeptide comprising an amino acid sequence having such a structure that an amino acid residue at position-578 is substituted by a valine residue or a phenylalanine residue in the amino acid sequence represented by SEQ ID NO: 1, and a variant of the polypeptide have an improved glucose dehydrogenase activity.

Description

Technical Field

[0001] The present invention relates to mutant glucose dehydrogenase. More specifically, the present invention relates to a polypeptide with improved glucose dehydrogenase specific activity, DNA encoding the polypeptide, a recombinant vector, a transformant, an enzyme agent, and uses of the polypeptide.

Background Art

[0002] The number of diabetic patients is increasing year by year. Diabetic patients, especially insulin-dependent patients, need to routinely monitor their blood glucose levels for blood glucose control. In recent years, self-blood glucose monitors (glucose sensors) using electrochemical biosensors that can be easily and accurately measured using enzymes have been widely used.

[0003] As enzymes used in glucose sensors, glucose oxidase (hereinafter also referred to as "GO") or glucose dehydrogenase (hereinafter also referred to as "GDH") that uses glucose as a substrate is utilized.

[0004] GO has the advantages of high specificity for glucose and excellent thermal stability. However, in measurements using it, it is easily affected by dissolved oxygen in the measurement sample, and problems such as the influence of dissolved oxygen on the measurement results have been pointed out. To solve this problem, FAD-dependent GDH (hereinafter referred to as FAD-GDH) has been developed. However, since FAD-GDH is known to react with xylose, in view of the fact that during diabetes diagnosis tests, not only oral glucose tolerance tests but also oral xylose tolerance tests and intravenous xylose tolerance tests are performed, when using FAD-GDH, it has become a problem that it affects blood glucose levels during the above-mentioned tolerance tests.

[0005] Therefore, as an enzyme that compensates for the drawbacks of both GO and GDH, it has been reported in Patent Document 1 that FAD-GDH obtained by mutating GO into GDH was obtained.

Prior Art Documents

[0006] [Patent Document 1] International Publication No. 2011 / 068050 [Overview of the project] [Problems that the invention aims to solve]

[0007] FAD-GDH, a mutant of GO, overcomes the shortcomings of both GO and GDH, resulting in an enzyme with excellent substrate specificity; however, there is room for improvement in its specific activity.

[0008] Therefore, the present invention aims to provide glucose dehydrogenase with improved specific activity. [Means for solving the problem]

[0009] The inventors performed X-ray crystal structure analysis of FAD-GDH (SEQ ID NO: 1), a molecule with a mutated GO molecule, and focused on the possibility that the histidine at position 538 was sterically hindered. To resolve this steric hindrance, they investigated introducing a mutation to the nearby methionine at position 578. As a result, they found that introducing a specific mutation could improve the specific activity. This invention is based on this finding. Specifically, this invention provides the invention in the following embodiments.

[0010] Item 1. polypeptides shown in any of the following (1) to (3): (1) A polypeptide consisting of an amino acid sequence in which the amino acid residue at position 578 in the amino acid sequence shown in Sequence ID No. 1 is replaced with a valine residue or a phenylalanine residue. (2) A polypeptide having improved glucose dehydrogenase activity compared to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid residue at position 578 in the amino acid sequence shown in SEQ ID NO: 1 is substituted with a valine residue or a phenylalanine residue, and one or more amino acid residues other than the amino acid residue into which the substitution is introduced are substituted, added, inserted or deleted, and (3) A polypeptide having an amino acid sequence in which the amino acid residue at position 578 of the amino acid sequence shown in SEQ ID NO: 1 is substituted with a valine residue or a phenylalanine residue, wherein the sequence identity with respect to the amino acid sequence shown in SEQ ID NO: 1, excluding the amino acid residue into which the substitution was introduced, is 70% or more, and the glucose dehydrogenase activity is improved compared to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1. Item 2. DNA encoding the polypeptide described in Item 1. Item 3. An expression cassette or recombinant vector containing the DNA described in Item 2. Item 4. A transformant obtained by transforming a host with the expression cassette or recombinant vector described in Item 3. Item 5. A method for producing the polypeptide according to Item 1, comprising the step of culturing the transformant described in Item 4. Item 6. An enzyme preparation containing the polypeptide described in Item 1. Item 7. A reagent for glucose measurement, comprising the polypeptide described in Item 1. Item 8. A glucose measurement method comprising the step of measuring glucose in a sample using the polypeptide described in Item 1. Item 9. A glucose measurement kit containing the glucose measurement reagents described in Item 7. Item 10. A glucose sensor comprising an insoluble support and a polypeptide according to Item 1 immobilized on the insoluble support. Item 11. A glucose reducing agent comprising the polypeptide described in Item 1. Item 12. A method for producing a glucose-reduced composition, comprising the step of reducing glucose in a composition selected from the group consisting of food compositions, cosmetic compositions, and pharmaceutical compositions, using the polypeptide described in Item 1. [Effects of the Invention]

[0011] According to the present invention, a glucose dehydrogenase with improved specific activity is provided. [Brief explanation of the drawing]

[0012] [Figure 1] This shows the enzyme activity of a GDH 578-position mutant consisting of the amino acid sequence shown in Sequence ID No. 1. [Modes for carrying out the invention]

[0013] The present invention will be described in detail below. Note that, outside of sequence listings, the 20 amino acid residues in the amino acid sequence may be represented by a single letter abbreviation. Specifically, glycine (Gly) is G, alanine (Ala) is A, valine (Val) is V, leucine (Leu) is L, isoleucine (Ile) is I, phenylalanine (Phe) is F, tyrosine (Tyr) is Y, tryptophan (Trp) is W, serine (Ser) is S, threonine (Thr) is T, cysteine ​​(Cys) is C, methionine (Met) is M, aspartic acid (Asp) is D, glutamic acid (Glu) is E, asparagine (Asn) is N, glutamine (Gln) is Q, lysine (Lys) is K, arginine (Arg) is R, histidine (His) is H, and proline (Pro) is P.

[0014] In this specification, the amino acid sequences shown are defined with the leftmost end being the N-terminus and the rightmost end being the C-terminus.

[0015] In this specification, expressions such as "A120G" are notations for amino acid substitutions. For example, "A120G" means that in a particular amino acid sequence, the 120th amino acid A from the N-terminus is substituted with amino acid G.

[0016] In this specification, "non-polar amino acids" include alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine, and tryptophan. "uncharged amino acids" include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. "acidic amino acids" include aspartic acid and glutamic acid. "basic amino acids" include lysine, arginine, and histidine.

[0017] In this specification, "substitution" includes not only the case where an artificial substitution of an amino acid residue is introduced, but also the case where a natural substitution of an amino acid residue is introduced, that is, the case where the amino acid residues were originally different. In this specification, the substitution of an amino acid residue may be an artificial substitution or a natural substitution, but an artificial substitution is preferred.

[0018] 1. Polypeptide The polypeptide of the present invention is a polypeptide represented by any one of the following (1) to (3).

[0019] (1) A polypeptide consisting of an amino acid sequence in which the amino acid residue at the 578th position in the amino acid sequence shown in SEQ ID NO: 1 is substituted with a valine residue or a phenylalanine residue. (2) In the amino acid sequence in which the amino acid residue at the 578th position in the amino acid sequence shown in SEQ ID NO: 1 is substituted with a valine residue or a phenylalanine residue, one or several amino acid residues other than the amino acid residue into which the substitution has been introduced are substituted, added, inserted or deleted, and the glucose dehydrogenase activity is improved as compared with the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, and (3) A polypeptide having an amino acid sequence in which the amino acid residue at position 578 of the amino acid sequence shown in SEQ ID NO: 1 is substituted with a valine residue or a phenylalanine residue, wherein the sequence identity with respect to the amino acid sequence shown in SEQ ID NO: 1, excluding the amino acid residue in which the substitution is introduced, is 90% or more, and the glucose dehydrogenase activity is improved compared to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1.

[0020] The polypeptides described in (1) to (3) above have improved glucose dehydrogenase activity compared to the polypeptide of Sequence ID No. 1.

[0021] The polypeptide of Sequence ID No. 1 is a D446H and V582P double mutant of glucose oxidase (GO) derived from Aspergillus niger (hereinafter, D446H and V582P will also be referred to as "double mutants" separately from the amino acid substitution mutation at position 578 mentioned above).

[0022] The polypeptides described in (1) to (3) above include not only polypeptides obtained by artificial substitution, but also polypeptides that originally possess such amino acid sequences.

[0023] Hereinafter, in the polypeptides of (2) and (3) above, all amino acid residues other than the 578th position of SEQ ID NO: 1 may be referred to as "optional difference sites." In this specification, the term "optional difference site" refers to a site where differences are acceptable as long as they do not significantly affect the properties of the polypeptide. In this specification, a polypeptide that, compared to the polypeptide of (1) above, shows differences in the amino acid sequence at the optional difference site, but exhibits improved glucose dehydrogenase activity compared to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, is referred to as a variant of the polypeptide of (1) above. The polypeptides of (2) and (3) above are variants of the polypeptide of (1) above. Furthermore, it is more preferable that the variants of the polypeptides, compared to the polypeptide of (1) above, show differences in the amino acid sequence at the optional difference site, but have substantially the same properties as the polypeptide. Furthermore, the phrase "substantially identical polypeptide properties" means that the glucose dehydrogenase activity is equivalent. Specifically, this means that the glucose dehydrogenase activity is approximately 0.8 to 1.2 times, preferably 0.9 to 1.1 times, and more preferably 0.95 to 1.05 times, that of the polypeptide in (1) above.

[0024] The amino acid differences in the polypeptide of (2) above may consist of only one type of difference (e.g., substitution) from among substitution, addition, insertion, and deletion, or it may consist of two or more types of differences (e.g., substitution and insertion). In the polypeptide of (2) above, the number of amino acid differences at any difference site may be one or several, for example, 1 to 60 or 1 to 50, preferably 1 to 20, 1 to 10, 1 to 8, 1 to 7, 1 to 6, 1 to 5, or 1 to 4, more preferably 1 to 3, and particularly preferably 1 or 2 or 1.

[0025] Furthermore, in the polypeptide of (3) above, the sequence identity excluding the site where the amino acid substitution is made relative to each amino acid sequence shown in SEQ ID NO: 1 may be 70% or more, 80% or more, 85% or more, or 90% or more, but is preferably 92% or more or 94% or more, more preferably 95% or more, 96% or more, 97% or more, or 98% or more, even more preferably 99% or more, even more preferably 99.5% or more, and particularly preferably 99.8% or more.

[0026] Here, in the polypeptide of (3) above, the sequence identity excluding the site where the amino acid substitution is made relative to each amino acid sequence shown in Sequence ID No. 1 is the sequence identity calculated by extracting only the arbitrary difference site from each amino acid sequence shown in Sequence ID No. 1 and comparing only that arbitrary difference site. Furthermore, "sequence identity" refers to the value of amino acid sequence identity obtained by the bl2seq program (Tatiana A. Tatsusova, Thomas L. Madden, FEMS Microbiol. Lett., Vol. 174, p247-250, 1999) of BLASTPACKAGE [sgi32 bit edition, Version 2.0.12; available from National Center for Biotechnology Information (NCBI)]. The parameters should be set to Gap insertion Cost value: 11 and Gap extension Cost value: 1.

[0027] When an amino acid substitution is introduced at an arbitrary different site in the polypeptides of (2) and (3) above, a conservative substitution is one example of the form of the amino acid substitution. Specifically, examples of amino acid substitutions introduced at an arbitrary different site in the polypeptides of (2) and (3) include substitution with another nonpolar amino acid if the amino acid before substitution is a nonpolar amino acid, substitution with another noncharged amino acid if the amino acid before substitution is an uncharged amino acid, substitution with another acidic amino acid if the amino acid before substitution is an acidic amino acid, and substitution with another basic amino acid if the amino acid before substitution is a basic amino acid.

[0028] Furthermore, when an amino acid substitution is introduced at any different site of the polypeptides described in (2) and (3) above, other examples of the forms of amino acid substitution include the following other predetermined substitutions. In other words, substitutions of one or more amino acids selected from the group consisting of positions 115 (L), 131 (G), 132 (T), 193 (V), 353 (T), 436 (F), 444 (S), 472 (Y), 511 (I), 535 (P), 537 (Y), and 583 (M) in the amino acid sequence shown in Sequence ID No. 1, as well as substitutions of position 582 (P) to S, R, or L (hereinafter referred to as "other predetermined substitutions"), are thought to contribute to the expression of glucose dehydrogenase activity, or to the expression of said activity and the suppression of reactivity to xylose. Therefore, these other substitutions may be introduced at any differing site of the polypeptides (2) and (3) above. Other preferred examples of such predetermined substitutions include the substitution of position 446 (H) and position 582 (P) with S, R, or L; and the substitution of position 444 (S) with R, Q, or E.

[0029] If the polypeptides of (2) and (3) above do not contain the other predetermined substitutions, it is desirable not to introduce substitutions or deletions at positions 446 (H) and 582 (P) in the amino acid sequence shown in SEQ ID NO: 1, as these positions are thought to contribute to the expression of glucose dehydrogenase activity and the suppression of reactivity to xylose.

[0030] If the polypeptides of (2) and (3) above contain the other predetermined substitutions, these other predetermined substitutions are thought to contribute to the expression of glucose dehydrogenase activity, or to the expression of such activity and the suppression of reactivity to xylose. Therefore, substitutions or deletions may be introduced at either or both of the 446th position (H) and the 582nd position (P) in the amino acid sequence shown in SEQ ID NO: 1. Specific examples of the polypeptides of (2) and (3) above that have the other predetermined substitutions and have substitutions or deletions introduced at either or both of the 446th position (H) and the 582nd position (P) include the polypeptides of [a] and [b] below. [a] A polypeptide comprising the following characteristics in Sequence ID No. 1: the 446th position (H) is not substituted; the 582nd position (P) is substituted with S, R, or L; and the 578th position (M) is substituted with V or P. [b] A polypeptide comprising the following characteristics in Sequence ID No. 1: position 444 (S) is substituted with R, Q, or E; position 446 (H) is substituted with another amino acid (e.g., D); position 582 (P) is left unsubstituted; and position 578 (M) is substituted with V or F.

[0031] In the polypeptides of (2) and (3) above, the degree of glucose dehydrogenase activity of the polypeptide having improved glucose dehydrogenase activity compared to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 is not particularly limited as long as it is higher than the glucose dehydrogenase activity of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, but is 1.10 times or more, preferably 1.15 times or more, and more preferably 1.20 times or more than the glucose dehydrogenase activity of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1. There is no particular upper limit to the degree of glucose dehydrogenase activity of the polypeptides of (2) and (3) above, but is 1.40 times or less, 1.35 times or less, or 1.30 times or less than the glucose dehydrogenase activity of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1.

[0032] The polypeptide of the present invention catalyzes the oxidation of the hydroxyl group of glucose to produce glucono-δ-lactone in the presence of an electron acceptor. The "glucose dehydrogenase activity" of the polypeptide of the present invention can be measured using this principle of action, for example, by using the following system with phenazine methosulfate (PMS) and 2,6-dichloroindophenol (DCIP) as electron acceptors.

[0033]

number

[0034] In reaction 1 above, PMS (reduced form) is produced as glucose is oxidized. Subsequently, in reaction 2 above, DCIP is reduced as PMS (reduced form) is oxidized. The degree of disappearance of this "DCIP (oxidized form)" is detected as the change in absorbance at a wavelength of 600 nm, and glucose dehydrogenase activity can be determined based on this change.

[0035] Specifically, 2.05 mL of 50 mmol / L phosphate buffer (pH 6.5), 0.60 mL of 1 mol / L glucose solution, 0.10 mL of 15 mmol / L PMS solution, and 0.15 mL of 2 mmol / L DCIP solution are mixed and incubated at 37°C for 5 minutes. Then, 0.1 mL of enzyme solution diluted with 50 mmol / L phosphate buffer (pH 6.5) containing 0.1% BSA is added to start the reaction. The decrease in absorbance at 600 nm per minute (ΔA600) as the enzymatic reaction progresses is determined, and the GDH activity is calculated according to the following formula. In this case, GDH activity is defined as the amount of enzyme that reduces 1 μmol of DCIP per minute in the presence of D-glucose, with 1 U being defined as the amount of enzyme that reduces 1 μmol of DCIP per minute.

[0036]

number

[0037] In the formula, Vt is the total volume (mL) of the reaction reagent solution and enzyme solution, and 16.3 is the extinction coefficient (cm²) per μmol of reduced DCIP under these activity measurement conditions.2 ( / μmol), 0.1 is the volume of the enzyme solution (mL), 1.0 is the optical path length of the cell (cm), ΔA600blank is the decrease in absorbance per minute at 600 nm when the buffer used to dilute the enzyme is added instead of the enzyme solution to start the reaction, and df represents the dilution factor.

[0038] 2. DNA The DNA encoding the polypeptide of the present invention (hereinafter sometimes referred to as "the DNA of the present invention") can be appropriately designed by those skilled in the art according to the amino acid sequence of the polypeptide of the present invention. The DNA of the present invention may be obtained, for example, by introducing mutations corresponding to the aforementioned amino acid mutations into DNA encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, or by introducing mutations corresponding to the aforementioned double mutation and the aforementioned amino acid mutations into DNA encoding glucose oxidase (GO) derived from Aspergillus niger, i.e., a polypeptide in which the aforementioned double mutation has not been introduced into the amino acid sequence of SEQ ID NO: 1, or by artificial synthesis based on a total gene synthesis method.

[0039] The DNA encoding the polypeptide consisting of the amino acid sequence shown in Sequence ID No. 1 is known, for example, as the nucleotide sequence shown in Sequence ID No. 2, and this nucleotide sequence can be obtained, for example, from nucleic acid constructs such as plasmids into which this nucleotide sequence is incorporated by a standard PCR method. Furthermore, the DNA encoding glucose oxidase (GO) from A. niger is also known and can be isolated from A. niger genomic DNA by a standard PCR method.

[0040] Methods for introducing specific mutations at specific sites in a base sequence are publicly known, and for example, site-directed mutagenesis (SMU) for DNA can be used. Specific methods for converting bases in DNA include the use of commercially available kits (e.g., QuickChange Lightning Site-Directed Mutagenesis kit: Stratagene, KOD-Plus-Mutagenesis kit: Toyobo).

[0041] DNA into which mutations have been introduced into the base sequence can be sequenced using a DNA sequencer. Once the base sequence is determined, the DNA encoding the polypeptide can then be obtained by chemical synthesis, PCR using a cloned probe as a template, or hybridization using a DNA fragment containing the sequence as a probe.

[0042] Furthermore, mutant versions of the DNA encoding the peptide that have the same function as the original DNA can be synthesized by site-directed mutagenesis or the like. The mutation can be introduced into the DNA encoding the peptide using known methods such as the Kunkel method, gapped duplex method, or megaprimer PCR.

[0043] The DNA of the present invention is preferably optimized for the host in terms of codon utilization frequency, and more preferably optimized for Aspergillus microorganisms in terms of codon utilization frequency.

[0044] As an indicator of codon utilization frequency, the sum of the host-optimal codon utilization frequencies for each codon should be adopted. An optimal codon is defined as the codon with the highest utilization frequency among codons corresponding to the same amino acid. Codon utilization frequency is not particularly limited as long as it is optimized for the host.

[0045] An example of the DNA of the present invention is DNA containing the base sequence shown in SEQ ID NO: 3 or 4. The DNA consisting of the base sequence shown in SEQ ID NO: 3 or 4 respectively encodes a polypeptide in which the 578th position of the polypeptide in (1) above is substituted with a valine residue or a phenylalanine residue.

[0046] Another example of the DNA of the present invention is a DNA that encodes a polypeptide having improved glucose dehydrogenase activity compared to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, and that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the DNA consisting of the base sequence shown in SEQ ID NO: 3 or 4.

[0047] Here, "stringent conditions" refers to conditions in which the samples are incubated at 50°C to 65°C for 4 hours to overnight in 6×SSC (1×SSC is 0.15M NaCl, 0.015M sodium citrate, pH 7.0) containing 0.5% SDS, 5×Denhartz's [Denhartz's, 0.1% bovine serum albumin (BSA), 0.1% polyvinylpyrrolidone, 0.1% Ficol 400] and 100 μg / ml salmon sperm DNA.

[0048] Hybridization under stringent conditions is specifically performed by the following method: A nylon membrane immobilizing a DNA library or cDNA library is prepared, and the nylon membrane is blocked at 65°C in a pre-hybridization solution containing 6×SSC, 0.5% SDS, 5×Denharts, and 100 μg / ml salmon sperm DNA. Then, 32 Each probe labeled with P is added and incubated overnight at 65°C. After washing this nylon membrane in 6×SSC for 10 minutes at room temperature, in 2×SSC containing 0.1% SDS for 10 minutes at room temperature, and in 0.2×SSC containing 0.1% SDS for 30 minutes at 45°C, autoradiography can be performed to detect DNA that specifically hybridizes with the probe.

[0049] Further examples of the DNA of the present invention include DNA encoding a polypeptide having improved glucose dehydrogenase activity compared to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, and having 70% or more, 80% or more, 85% or more, or 90% or more homology to DNA consisting of the base sequence shown in SEQ ID NO: 3 or 4. The homology is preferably 92% or more or 94% or more, more preferably 95% or more, 96% or more, or 97% or more, even more preferably 98% or more or 99% or more, more preferably 99.5% or more, and particularly preferably 99.8% or more.

[0050] Here, DNA "homology" is calculated using publicly available or commercially available software with an algorithm that compares a reference sequence to a query sequence. Specifically, BLAST, FASTA, or GENETYX (manufactured by Software Development Co., Ltd.) can be used, and these can be used with their default parameters set.

[0051] 3. Expression cassette or recombinant vector An expression cassette or recombinant vector containing DNA encoding the polypeptide of the present invention (hereinafter also referred to as "expression cassette of the present invention" or "recombinant vector of the present invention") can be obtained by linking a promoter and a terminator to the DNA of the present invention, or by inserting the expression cassette of the present invention or the DNA of the present invention into an expression vector.

[0052] The expression cassette or recombinant vector of the present invention may, as regulatory factors, include a promoter and a terminator, as well as, if necessary, transcription elements such as enhancers, CCAAT boxes, TATA boxes, and SPI sites. These regulatory factors only need to be operably ligated to the DNA of the present invention. Operable ligation means that the various regulatory factors that regulate the DNA of the present invention and the DNA of the present invention are ligated in a manner that allows them to function in a host cell.

[0053] For the recombinant vector of the present invention, the expression vector is preferably one constructed for genetic recombination from a phage, plasmid, or virus that can autonomously proliferate within a host. Such expression vectors are well known, and commercially available examples include pUC vectors (Takara Bio Inc.), pQE vectors (Qiagen Inc.), pDR540, pRIT2T (GE Healthcare Biosciences Corporation), and pET vectors (Merck KGaA). The expression vector should be selected and used in an appropriate combination with the host cell.

[0054] 4. Transformed organism A transformant (hereinafter sometimes referred to as "the transformant of the present invention") can be obtained by transforming a host using the expression cassette or recombinant vector of the present invention.

[0055] The host used to produce the transformant is not particularly limited as long as it allows for gene introduction, the expression cassette or recombinant vector is stable, it is capable of autonomous proliferation, and it can express the traits of the gene containing the DNA of the present invention. For example, microorganisms belonging to the Aspergillus genus such as Aspergillus oryzae, the Escherichia genus such as Escherichia coli, the Bacillus genus such as Bacillus subtilis, and the Pseudomonas genus such as Pseudomonas putida; yeast, etc., are preferred examples, but animal cells, insect cells, plant cells, etc., may also be used. Among these, microorganisms of the Aspergillus genus are particularly preferred.

[0056] The transformant of the present invention can be obtained by introducing the recombinant vector of the present invention into a host. The site in which the DNA of the present invention is introduced is not particularly limited as long as the target gene can be expressed, and may be on a plasmid or on the genome. Specific methods for introducing the expression cassette or recombinant vector of the present invention include, for example, recombinant vector methods and genome editing methods. The conditions for introducing the expression cassette or recombinant vector into the host may be set appropriately depending on the type of host, etc. If the host is a microorganism, for example, methods using competent cells treated with calcium ions, electroporation, spheroplasts, and lithium acetate methods can be used. If the host is an animal cell, for example, electroporation, calcium phosphate, and lipofection methods can be used. If the host is an insect cell, for example, calcium phosphate, lipofection, and electroporation methods can be used. If the host is a plant cell, for example, electroporation, Agrobacterium, particle gun, and PEG methods can be used.

[0057] Whether or not the expression cassette or recombinant vector of the present invention has been incorporated into the host can be confirmed by PCR, Southern hybridization, Northern hybridization, or the like.

[0058] To confirm whether the expression cassette or recombinant vector of the present invention has been incorporated into a host by PCR, for example, the genomic DNA, expression cassette, or recombinant vector can be isolated and purified from the transformant.

[0059] The isolation and purification of expression cassettes or recombinant vectors are performed, for example, based on the lysate obtained by lysing bacteria when the host is a bacterium. Lysis is performed by treating the bacteria with a lytic enzyme such as lysozyme, and if necessary, proteases, other enzymes, and surfactants such as sodium lauryl sulfate (SDS) are used in combination.

[0060] Furthermore, physical disruption methods such as freeze-thaw cycles and French presses may be combined. DNA isolation and purification from lysates can be performed, for example, by deproteinization using phenol and protease treatments, ribonuclease treatments, alcohol precipitation, and by using commercially available kits in appropriate combinations.

[0061] DNA cleavage can be performed according to standard methods, for example, using restriction enzyme digestion. For example, type II restriction enzymes that act on specific nucleotide sequences can be used. Binding of DNA to an expression cassette or expression vector can be performed, for example, using a DNA ligase.

[0062] Subsequently, using the separated and purified DNA as a template, primers specific to the DNA of the present invention are designed and PCR is performed. The amplification product obtained by PCR is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, etc., stained with ethidium bromide and SYBR Green solution, and the transformation can be confirmed by detecting the amplification product as a band.

[0063] Furthermore, PCR can be performed using primers pre-labeled with fluorescent dyes or the like to detect the amplified product. In addition, a method may be employed in which the amplified product is bound to a solid phase such as a microplate and confirmed by fluorescence and enzymatic reactions.

[0064] 5. Method for producing polypeptides The polypeptide of the present invention can be obtained by a manufacturing method that includes the step of culturing the transformant of the present invention.

[0065] The culture conditions for the transformants should be set appropriately considering the nutritional and physiological properties of the host, but liquid culture is preferred. Furthermore, in the case of industrial production, aerated and agitated culture is preferred.

[0066] Nutrients required for the growth of the transformants can be used as nutrients in the culture medium. Any carbon compound that can be assimilated can be used as a carbon source, such as glucose, sucrose, lactose, maltose, molasses, and pyruvate.

[0067] Any nitrogen compound that can be assimilated can be used as a nitrogen source, such as peptone, meat extract, yeast extract, casein hydrolysate, and soybean meal alkali extract.

[0068] In addition to carbon and nitrogen sources, salts such as phosphates, carbonates, sulfates, magnesium, calcium, potassium, iron, manganese, and zinc, certain amino acids, and certain vitamins may be used as needed.

[0069] The culture temperature can be appropriately set within a range in which the transformants of the present invention can grow and produce the polypeptide of the present invention, but is preferably around 15 to 37°C. The culture should be completed at an appropriate time, timed to coincide with the period when the polypeptide of the present invention reaches its maximum yield, and the culture time is usually around 12 to 48 hours.

[0070] The transformant of the present invention is cultured, the culture supernatant or bacterial cells are collected from the culture medium by methods such as centrifugation, the bacterial cells are treated by mechanical methods such as ultrasound and French press or by lytic enzymes such as lysozyme, and if necessary, solubilized by using enzymes such as proteases or surfactants such as sodium lauryl sulfate (SDS) to obtain a water-soluble fraction containing the polypeptide of the present invention.

[0071] Furthermore, by selecting an appropriate expression vector and host, the expressed polypeptide of the present invention can be secreted into the culture medium.

[0072] The water-soluble fraction containing the polypeptide of the present invention obtained as described above may be subjected to purification treatment as is, or the polypeptide of the present invention in the water-soluble fraction may be concentrated before being subjected to purification treatment.

[0073] Concentration can be carried out, for example, by vacuum concentration, membrane concentration, salting-out treatment, or fractional precipitation using hydrophilic organic solvents (e.g., methanol, ethanol, and acetone).

[0074] The purification process of the polypeptide of the present invention can be carried out by appropriately combining methods such as gel filtration, adsorption chromatography, ion exchange chromatography, and affinity chromatography.

[0075] The aforementioned purification process is already known and can be carried out by referring to appropriate literature, journals, and textbooks. The polypeptide of the present invention thus purified can be powdered by freeze-drying, vacuum drying, spray-drying, etc., as needed, and distributed to the market.

[0076] 6. Enzyme preparations The polypeptide of the present invention can be provided in the form of an enzyme preparation. Accordingly, the present invention also provides an enzyme preparation containing the polypeptide of the present invention as an active ingredient.

[0077] The content of the polypeptide of the present invention in the enzyme preparation of the present invention is not particularly limited and can be appropriately set within a range in which the glucose dehydrogenase activity of the active ingredient is exerted.

[0078] The enzyme preparation of the present invention may contain other components in addition to the polypeptide of the present invention, to the extent that they do not affect the effects of the present invention. Examples of other components include other enzymes other than the polypeptide of the present invention, additives, and culture residues generated by the above manufacturing method.

[0079] Other enzymes can be appropriately determined depending on the application of the polypeptide of the present invention, but examples include amylase (α-amylase, β-amylase, glucoamylase), glucosidase (α-glucosidase, β-glucosidase), galactosidase (α-galactosidase, β-galactosidase), protease (acid protease, neutral protease, alkaline protease), peptidase (leucine peptidase, aminopeptidase), lipase, esterase, cellulase, phosphatase (acid phosphatase, alkaline phosphatase), nuclease, deaminase, oxidase, dehydrogenase (other than the above active ingredients), glutaminase, pectinase, catalase, dextranase, transglutaminase, protein deamide enzyme, pullulanase, etc. These other enzymes may be included individually or in combination of multiple types.

[0080] The additives can be appropriately determined depending on the application of the polypeptide of the present invention and the formulation form of the enzyme preparation, but examples include excipients, buffers, suspending agents, stabilizers, preservatives, antiseptics, and physiological saline. Examples of excipients include starch, dextrin, maltose, trehalose, lactose, D-glucose, sorbitol, D-mannitol, sucrose, and glycerol. Examples of buffers include phosphates, citrates, and acetates. Examples of stabilizers include propylene glycol and ascorbic acid. Examples of preservatives include phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, and methylparaben. Examples of antiseptics include ethanol, benzalkonium chloride, parahydroxybenzoic acid, and chlorobutanol. These additives may be included individually or in combination of multiple types.

[0081] Culture residues include components derived from the culture medium, contaminating proteins, and bacterial cell components.

[0082] The formulation form of the enzyme preparation of the present invention is not particularly limited, and examples include liquid, solid (powder, granules, etc.). These formulation forms of enzyme preparations can be prepared by generally known methods.

[0083] Specific examples of the enzyme preparations of the present invention include the glucose measurement reagent and glucose reducing agent described later.

[0084] 7.Applications The polypeptide of the present invention can be applied to applications that utilize glucose dehydrogenase activity. Such applications include applications aimed at measuring glucose in a target sample and applications aimed at reducing glucose in a target composition.

[0085] When the polypeptide of the present invention is applied to an application aimed at measuring glucose in a target sample, more specifically, the polypeptide of the present invention can be used as an active ingredient in a glucose measuring reagent or as a recognition element in a glucose sensor. Furthermore, when the polypeptide of the present invention is applied to an application aimed at reducing glucose in a target composition, the polypeptide of the present invention can be used as an active ingredient in a glucose reducing agent.

[0086] In other words, the present invention also provides a glucose measurement reagent, a glucose sensor, and a glucose reducing agent containing the polypeptide of the present invention described above. Regarding the glucose measurement reagent and the glucose reducing agent, other components and formulation forms that may be included besides the active ingredient are the same as those described for the enzyme preparation of the present invention, and their specific usage methods will be described in detail in "8. Glucose Measurement Method" below. Furthermore, the glucose sensor and its specific usage methods will be described in detail in "10. Glucose Sensor" below.

[0087] 8. Glucose measurement methods As described above, the polypeptide of the present invention can be used as a reagent for glucose measurement. Accordingly, the present invention also provides a glucose measurement method that includes the step of measuring glucose in a sample using the polypeptide of the present invention.

[0088] Examples of samples include samples for which blood glucose levels should be measured (specifically, blood samples), samples for which the amount of glucose in food products should be measured (specifically, seasonings, beverages, etc.), and samples for which the degree of fermentation should be measured during the manufacturing process of fermented foods (specifically, vinegar, alcohol, etc.).

[0089] In the glucose measurement method of the present invention, the amount of glucose in a sample can be measured by utilizing the oxidation-reduction reaction of the polypeptide of the present invention. Specifically, a sample containing glucose can be brought into contact with the polypeptide of the present invention to perform an enzymatic reaction, and the amount of glucose reacted can be measured based on the signal change that monitors the enzymatic reaction.

[0090] More specifically, the polypeptide of the present invention can be brought into contact with a glucose-containing sample together with an electron acceptor (2,6-dichlorophenolindophenol (DCPIP), phenazine methosulfate (PMS), etc.), and, if necessary, a reaction accelerator (e.g., N-(2-acetamide)imide diacetic acid (ADA), bis(2-hydroxyethyl)iminotris(hydroxymethyl)methane (Bis-Tris), sodium carbonate, imidazole, etc.), a pH buffer, and / or a chromogenic reagent, and reacted for a certain period of time. During this time, signal changes (e.g., changes in absorbance) based on the reduction change of the electron acceptor or the polymerization of the dye by receiving electrons from the electron acceptor can be monitored. From the signal changes up to the point when all the glucose in the sample has been oxidized, the glucose concentration in the sample can be calculated based on a calibration curve prepared in advance using a standard concentration glucose solution.

[0091] The conditions for the above enzymatic reaction are appropriately determined based on the optimal temperature and pH of the polypeptide of the present invention.

[0092] 9. Glucose measurement kit The present invention also provides a glucose measurement kit used to perform the glucose measurement method described above. The glucose measurement kit of the present invention includes the glucose measurement reagents described in "7. Applications" above.

[0093] The glucose measurement kit of the present invention may include, in addition to the glucose measurement reagent, other items such as buffers, electron acceptors, reaction accelerators, and / or chromogenic reagents necessary for the assay, as well as glucose standard solutions for preparing calibration curves. Specific examples of these other items and their usage are described in "8. Glucose Measurement Method" above. The glucose measurement kit of the present invention may contain one of these other items alone or a combination of several items.

[0094] 10. Glucose sensor As described above, the polypeptide of the present invention can be used as a recognition element of a glucose sensor. Accordingly, the present invention also provides a glucose sensor comprising an insoluble support and the polypeptide of the present invention immobilized on the insoluble support.

[0095] The methods of immobilizing polypeptides are not particularly limited and include physical immobilization by attachment, adsorption, absorption, encapsulation, swelling, etc., chemical or biochemical immobilization by specific non-covalent bonding, and chemical immobilization by covalent bonding.

[0096] Furthermore, the polypeptide may be immobilized on the insoluble support in its own form, or it may be immobilized on the insoluble support in the form of a composition together with other components. A specific embodiment of the case where the polypeptide is immobilized on the insoluble support in the form of a composition is one in which the composition is physically immobilized on the insoluble support.

[0097] The insoluble support is composed of a solid substance or solid material whose surface, at least, does not dissolve in the reaction system between the polypeptide of the present invention and glucose and can immobilize the polypeptide. Specific examples of materials constituting at least the surface of the insoluble support include swelling materials (e.g., polymer matrices such as gelatin), porous substrates (e.g., porous bodies such as cellulose, nonwoven sheets such as filter paper), resins, glass, redox polymers (i.e., polymers to which redox mediators are bound), metals, carbon, and the like.

[0098] The shape of the insoluble carrier is not particularly limited and examples include substrate-like, flake-like, stick-like, and bead-like forms.

[0099] A preferred example of the insoluble support described above is an electrode whose surface is made of the above material (e.g., a gold electrode, a platinum electrode, a carbon electrode, etc.). Preferably, a polypeptide is physically immobilized on such an electrode, and more preferably, the polypeptide is physically immobilized in the form of a composition containing other components together with other components (e.g., a mediator such as ferrocene or ferricyanide, phenazine methosulfate, etc.).

[0100] Specific embodiments of the glucose sensor of the present invention may be any form used as a biosensor, such as a sensor chip, a microtiter plate, a test strip, or an electrochemical flow cell.

[0101] Glucose sensing in such specific embodiments can be performed in accordance with the method described in "8. Glucose Measurement Method" above, particularly by the following method: A buffer solution is placed in a constant temperature cell and maintained at a constant temperature. An electrode immobilized with the polypeptide of the present invention is used as the working electrode, and a counter electrode (e.g., a platinum electrode) and a reference electrode (e.g., an Ag / AgCl electrode) are used. A constant voltage is applied to the electrodes, and after the current becomes steady, a sample containing glucose (preferably a blood sample, more preferably autologous blood) is brought into contact with the electrodes and the increase in current is measured. The glucose concentration in the sample can be calculated according to a calibration curve created with a standard concentration glucose solution.

[0102] 11. Method for producing a composition with reduced glucose content As described above, the polypeptide of the present invention can be used as a glucose reducing agent. Accordingly, the present invention also provides a method for producing a glucose-reduced composition, which includes a step of reducing glucose in a composition selected from the group consisting of food compositions, cosmetic compositions, and pharmaceutical compositions using the polypeptide of the present invention described above.

[0103] In the production method of the present invention, the amount of glucose can be reduced by converting glucose in the composition to glucono-δ-lactone using the oxidation-reduction reaction of the polypeptide of the present invention. Specifically, the composition containing glucose can be brought into contact with the polypeptide of the present invention and an enzymatic reaction can be carried out. The conditions for the enzymatic reaction are appropriately determined based on the optimal temperature and optimal pH of the polypeptide of the present invention.

[0104] Food compositions, cosmetic compositions, and pharmaceutical compositions obtained by the manufacturing method of the present invention, which have reduced glucose content, can suppress discoloration due to the Maillard reaction. [Examples]

[0105] The present invention will be described in detail below with reference to examples, but the present invention is not limited to the following examples.

[0106] Test Example 1 X-ray crystal structure analysis of glucose dehydrogenase (D446H and V582P double mutant of glucose oxidase from Aspergillus niger; hereinafter also referred to as "GDH1") consisting of the amino acid sequence of Sequence ID No. 1 revealed the possibility that the histidine at position 538 is sterically hindered by the introduction of a mutation at amino acid position 582. To resolve this steric hindrance, we investigated introducing a mutation to methionine at position 578, near the histidine at position 538.

[0107] Based on the nucleotide sequence shown in Sequence ID No. 2, which encodes the amino acid sequence of Sequence ID No. 1, the following mutation primers were designed.

[0108] Primer 1 for M578A mutation: ACGCAAGCCTCGTCCCATCCTATGACG (SEQ ID NO: 5) Primer 2 for M578A mutation: GGACGAGGCTTGCGTAGGGGGAATAGA (SEQ ID NO: 6) Primer 1 for M578N mutation: ACGCAAAACTCGTCCCATCCTATGACG (SEQ ID NO: 7) Primer 2 for M578N mutation: GGACGAGTTTTGCGTAGGGGGAATAGA (SEQ ID NO: 8) Primer 1 for M578V mutation: ACGCAAGTGTCGTCCCATCCTATGACG (SEQ ID NO: 9) Primer 2 for M578V mutation: GGACGACACTTGCGTAGGGGGAATAGA (SEQ ID NO: 10) Primer 1 for M578L mutation: TACGCAACTGTCGTCCCATCCTATG (SEQ ID NO: 11) Primer 2 for M578L mutation: GACGACAGTTGCGTAGGGGGAATAG (SEQ ID NO: 12) Primer 1 for M578K mutation: ACGCAAAAGTCGTCCCATCCTATGACG (SEQ ID NO: 13) Primer 2 for M578K mutation: GGACGACTTTTGCGTAGGGGGAATAGA (SEQ ID NO: 14) Primer 1 for M578D mutation: ACGCAAGATTCGTCCCATCCTATGACG (SEQ ID NO: 15) Primer 2 for M578D mutation: GGACGAATCTTGCGTAGGGGGAATAGA (SEQ ID NO: 16) Primer 1 for M578F mutation: ACGCAATTCTCGTCCCATCCTATGACG (SEQ ID NO: 17) Primer 2 for M578F mutation: GGACGAGAATTGCGTAGGGGGAATAGA (SEQ ID NO: 18) Primer 1 for M578W mutation: ACGCAATGGTCGTCCCATCCTATGACG (SEQ ID NO: 19) Primer 2 for M578W mutation: GGACGACCATTGCGTAGGGGGAATAGA (SEQ ID NO: 20) Primer 1 for M578Y mutation: ACGCAATACTCGTCCCATCCTATGACG (SEQ ID NO: 21) Primer 2 for M578Y mutation: GGACGAGTATTGCGTAGGGGGAATAGA (SEQ ID NO: 22)

[0109] Using a plasmid inserted into DNA consisting of the base sequence of Sequence ID No. 2 as a template, PCR was performed using the designed primers and DNA polymerase to obtain amplified DNA fragments.

[0110] The amplification products after PCR were treated with the restriction enzyme Dpn I, and after digesting the unmutated plasmid, ligation was performed to obtain the mutant plasmid. The mutant plasmid was transformed into E. coli DH5α, and plasmid extraction was performed to prepare the mutant plasmid. The obtained mutant plasmid was transformed into Saccharomyces cerevisiae. The resulting transformed strains were cultured in liquid, and the GDH activity of the resulting enzyme solution was examined using the following method.

[0111] GDH activity evaluation method 2.05 mL of 50 mmol / L phosphate buffer (pH 6.5), 0.60 mL of 1 mol / L glucose solution, 0.10 mL of 15 mmol / L PMS solution, and 0.15 mL of 2 mmol / L DCIP solution were mixed and incubated at 37°C for 5 minutes. Then, 0.1 mL of enzyme solution diluted with 50 mmol / L phosphate buffer (pH 6.5) containing 0.1% BSA was added to start the reaction. The decrease in absorbance at 600 nm per minute (ΔA600) as the enzymatic reaction progressed was determined, and the GDH activity was calculated according to the following formula. In this case, GDH activity was defined as the amount of enzyme that reduces 1 μmol of DCIP per minute in the presence of D-glucose, with 1 U being defined as the amount of enzyme.

[0112]

number

[0113] In the formula, Vt is the total volume (mL) of the reaction reagent solution and enzyme solution, and 16.3 is the extinction coefficient (cm²) per μmol of reduced DCIP under these activity measurement conditions. 2 ( / μmol), 0.1 is the volume of the enzyme solution (mL), 1.0 is the optical path length of the cell (cm), ΔA600blank is the decrease in absorbance per minute at 600 nm when the buffer used to dilute the enzyme is added instead of the enzyme solution to start the reaction, and df represents the dilution factor.

[0114] The GDH activity of the enzyme GDH1 before mutation introduction was set to 100%, and the relative amount (%) of GDH activity of each mutant enzyme was calculated. The results are shown in Figure 1. As shown in Figure 1, an improvement in activity was observed in M578V and M578F. The expression levels of each enzyme were evaluated by SDS-PAGE and confirmed to be at equivalent levels. Therefore, an improvement in specific activity was observed in M578V and M578F.

[0115] Test Example 2 The GDH gene portion was amplified by PCR from a GDH1 plasmid into which the M578V mutation had been introduced. The amplified DNA fragment was then ligated between a modified takaamylase CS3 promoter and the terminator gene of Aspergillus oryzae-derived FAD-dependent glucose dehydrogenase to construct an expression cassette.

[0116] Constructed expression cassette and orotidine 5 derived from Aspergillus oryzae ’ -The phosphate decarboxylase gene (pyrG gene) was inserted into pUC19 to construct an expression plasmid. Using the constructed expression plasmid, a pyrG gene-deficient strain of Aspergillus oryzae RIB40 was transformed, and a transformant was obtained by utilizing uridine requirement. The obtained transformant was cultured in liquid culture to obtain a crude enzyme solution containing M578V. The obtained crude enzyme solution was purified by salting out, hydrophobic coupling chromatography, and ion exchange chromatography, and then freeze-dried to obtain purified enzyme powder of M578V.

[0117] The GDH activity values ​​(U / mg) per unit weight of the purified enzyme powders of M578V and GDH1 were measured in the same manner as in Test Example 1. The relative amount of GDH activity of M578V (relative activity) was calculated, and the relative activity of M578V was derived when the activity value of GDH1 was set to 100%. The results are shown in Table 1.

[0118] [Table 1]

[0119] As shown in Table 1, M578V showed approximately 20% improvement in specific activity compared to GDH1.

[0120] Furthermore, the kinetic parameters (Km [mmol / L] and Vmax [U / mg]) for glucose were determined, and the relative Km and Vmax relative activity of M578V were derived when the Km and Vmax of GDH1 were set to 100%, respectively. The results are shown in Table 2.

[0121] [Table 2]

[0122] As shown in Table 2, M578V showed almost no change in Km for glucose compared to GDH1, but Vmax showed an improvement of approximately 20%. In other words, while M578V's enzyme affinity for glucose substrates was almost the same as GDH1, it was found to have improved enzymatic reaction efficiency. [Sequence Listing Free Text]

[0123] Sequence ID 1 is a D446H and V582P double mutant of glucose oxidase derived from Aspergillus niger. Sequence ID 2 is a DNA encoding the D446H and V582P double mutant of glucose oxidase derived from Aspergillus niger. Sequence ID 3 is the DNA encoding the M578V variant, a double mutant shown in Sequence ID 1. Sequence ID 4 is the DNA encoding the M578F variant, a double mutant shown in Sequence ID 1. Sequence IDs 5-22 are primers for introducing mutations.

Claims

1. Polypeptides shown in any of the following (1) to (3): (1) A polypeptide consisting of an amino acid sequence in which the amino acid residue at position 578 in the amino acid sequence shown in Sequence ID No. 1 is replaced with a valine residue or a phenylalanine residue. (2) A polypeptide having improved glucose dehydrogenase activity compared to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid residue at position 578 in the amino acid sequence shown in SEQ ID NO: 1 is substituted with a valine residue or a phenylalanine residue, and 1 to 60 amino acid residues other than the amino acid residue into which the substitution is introduced are substituted, added, inserted or deleted, and (3) A polypeptide having an amino acid sequence in which the amino acid residue at position 578 in the amino acid sequence shown in SEQ ID NO: 1 is substituted with a valine residue or a phenylalanine residue, wherein the sequence identity with respect to the amino acid sequence shown in SEQ ID NO: 1, excluding the amino acid residue in which the substitution is introduced, is 90% or more, and the glucose dehydrogenase activity is improved compared to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:

1.

2. DNA encoding the polypeptide described in claim 1.

3. An expression cassette or recombinant vector comprising the DNA described in claim 2.

4. A transformant obtained by transforming a host with the expression cassette or recombinant vector described in claim 3.

5. A method for producing a polypeptide according to claim 1, comprising the step of culturing the transformant according to claim 4.

6. An enzyme preparation comprising the polypeptide described in claim 1.

7. A reagent for measuring glucose, comprising the polypeptide described in claim 1.

8. A glucose measurement method comprising the step of measuring glucose in a sample using the polypeptide described in claim 1.

9. A glucose measurement kit comprising the glucose measurement reagent described in claim 7.

10. A glucose sensor comprising an insoluble support and a polypeptide according to claim 1, fixed to the insoluble support.

11. A glucose reducing agent comprising the polypeptide described in claim 1.

12. A method for producing a glucose-reduced composition, comprising the step of reducing glucose in a composition selected from the group consisting of a food composition, a cosmetic composition, and a pharmaceutical composition, using the polypeptide described in claim 1.

Images