Synthetic binders to limit mucus permeability
Patent Information
- Application Number
- JP2021540374
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-09-21
- Filing Date
- 2019-09-23
- Publication Date
- 2026-04-08
- Estimated Expiration
- 2039-09-23
AI Technical Summary
Existing methods for enhancing the mucosal immune response are insufficient in preventing infections, particularly for sexually transmitted infections like HIV, herpes, and gonorrhea, and there is a need for improved contraceptives that can effectively block sperm penetration through mucus.
Development of synthetic binding agents comprising multimeric antibodies with multiple Fab domains linked to human or humanized IgG, which specifically bind to targets like viruses, bacteria, or sperm, increasing aggregation and trapping in mucus to prevent penetration and replication.
The synthetic binding agents significantly reduce the mobility of pathogens and sperm in mucus, enhancing mucus trapping and preventing infections or fertilization by at least 50%, offering a potent contraceptive effect.
Abstract
Description
[Cross-reference to related applications] This patent application claims priority to U.S. Provisional Patent Application No. 62 / 734,771 (titled "SYNTHETIC BINDING AGENTS FOR MUCOSAL TRAPPING") filed on September 21, 2018. , which is incorporated herein by reference in its entirety. INCORPORATION BY REFERENCE All publications and patent applications mentioned herein are hereby incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Incorporated herein by reference in their entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with federal support under Grant Numbers R56HD095629 and U54HD096957 awarded by the National Institutes of Health. The Government has certain rights in this invention. [Reference to Sequence Listing] This application contains a sequence listing. A sequence listing in electronic format is submitted with this application. FIELD: The present disclosure generally relates to increased aggregation of a target, to prevent conception (e.g., for contraception), and / or to prevent or treat infections, including viral, bacterial, and / or fungal infections. The present invention relates to methods and compositions for promoting enchaining and / or targeted muco-trapping. The mucosal barrier plays an important potential protective role as a barrier to prevent foreign substances from entering the body. The mucosal barrier can be further enhanced by local immunization, which allows a strong immune system response to occur in the mucous membranes of the intestines, genitourinary tract and respiratory system, ie surfaces in contact with the external environment. The mucosal immune system may provide protection against pathogens, but maintains tolerance to harmless commensal microorganisms and benign environmental agents. Since the mucosa is the first point of contact between the host and its environment, many secondary lymphoid tissues are found there. Mucosa-associated lymphoid tissue, or MALT, provides an important component of the mucosal immune response. The mucosal immune system has three main functions: acting as the body's first line of defense against antigens and infections, and preventing systemic immune responses to commensal bacteria and food antigens (mainly in the gut-associated lymphoid tissues). dietary proteins, so-called oral tolerance), and provide for the regulation of appropriate immune responses against routinely encountered pathogens. Unfortunately, mucosal immune responses can be insufficient and it is often difficult to generate the necessary immune response for a sufficient duration. An example is the lack of effective vaccines for most sexually transmitted infections, including HIV, herpes, chlamydia and gonorrhea. As a result, enhancing the mucus barrier and mucosal immune system by directly delivering antibodies has been suggested as one way to treat or prevent infections. See, for example, US20150284451, which describes the use of compositions for preventing pathogen infections by applying antibodies capable of interacting with mucus. Some antibodies have been shown to interact with mucin and immobilize pathogens in mucus by adhesively cross-linking pathogens coated by individual antibodies to mucin (a process often referred to as mucus trapping). However, it would be beneficial to provide antibodies or antibody constructs that have an even improved ability to more effectively prevent foreign substances, including viruses and bacteria, from penetrating mucus and reaching target cells. Additionally, such improved constructs can be effectively used as contraceptives by blocking or restricting passage of sperm to eggs within the female reproductive system. In addition to cross-linking foreign entities to mucin, by improving the aggregation and / or enchainment of the foreign entities in a manner that limits their effective penetration through the mucus. It is possible to further increase the titer of antibodies. Nearly half of pregnancies in the United States are unintended, highlighting the critical need for additional contraceptive options. Non-hormonal contraceptives have specific uses. Methods and compositions (modified / synthetic binder compositions) are described herein. In general, synthetic binding agents for increasing target aggregation and / or mucus trapping, and methods of increasing target aggregation and / or mucus trapping using any of these synthetic binding agents are described herein. be done. The target typically has one or more epitopes and may be a virus, bacterium, fungus, sperm or parasite. The synthetic binding agents described herein are multimers with multiple epitope binding regions. All of these epitope binding regions may be immunoglobulin fragment antigen binding (Fab) regions or fragments, and may include a core of human or humanized immunoglobulin G (IgG) with Fab and Fc domains. All Fab fragments / domains (including those of the core humanized IgG) can recognize foreign bodies directed against the same epitope. Accordingly, synthetic binding agents for increasing aggregation and / or mucus trapping as described herein may comprise a human or humanized IgG linked to one or more additional Fab domains, where: The one or more additional Fab domains and the parent IgG Fab domain all bind specifically to the target epitope with high affinity, altering the target's mobility in the mucus compared to its native mobility in the mucus. It can be reduced to less than about 50%. A synthetic binding agent may be a recombinant (eg, modified) antibody. Any of the synthetic binding agents described herein can be further configured (or selected) to increase mucin cross-linking upon binding to a target, but otherwise free to diffuse through the mucus. (e.g., has a low affinity for mucin). As used herein, the term "native mobility" refers to a target (e.g., sperm, virus, etc.) in the same environment (e.g., mucus, saline, etc.) in the absence of synthetic binding agents or antibodies. , bacteria, etc.). Also described herein are methods and compositions (including compositions of modified / synthetic binders) that can provide bactericidal and / or microbicidal effects by more effectively collecting pathogens that undergo cell division. and thereby bacteria and / or give rise to chains of other pathogens, potentially inhibiting replication, causing cell death, e.g., forming aggregates (including multi-pathogen aggregates in some variations), and / or or aggregates or enchained prevent the spread of infectious diseases through growth). In particular, synthetic binding agents constructed as recombinant antibodies that can be used as contraceptives are described herein. Although synthetic binding agents for contraception may be referred to herein as human contraceptives (HCAs), these methods may also be used for contraception in non-humans (eg, animals). For example, contraceptive methods and HCA compositions are described herein that include recombinant engineered antibodies (Abs) that can block sperm penetration through mucus. The main effector functions for Abs in mucus are to inhibit the forward movement of foreign substances such as viruses and highly motile bacteria, and to block them from reaching target cells. This functionality can be achieved in two ways. First, if foreign bodies frequently collide due to high concentrations of foreign entities, Abs can bridge two or more foreign bodies together, resulting in hydrodynamic This results in not only an increase in diameter but also an effective neutralization of the net forward motion of swimming bodies. This process is commonly called flocculation. Second, when collisions between foreign bodies are relatively rare because the concentration of the foreign substance is not large, Abs can interact with foreign bodies through multiple Fc-mucin bonds. Immobilization can be achieved by direct cross-linking to the mucin matrix present within mucus. This process is referred to herein as mucin cross-linking or mucin trapping, and the affinity between each Ab molecule and mucin is much too weak to effectively bind individual foreign bodies to mucin. The process remained widely unrecognized because it was long thought that it could not be done. However, vaginal administration of antigen-specific IgG, tuned to possess weak affinity for mucin, may result in the formation of multiple weakly adhesive bonds between the virus and the mucin mesh. can trap viruses in mucus (similar to VELCRO® patches with individually weak hooks). Finally, for foreign bodies that can divide naturally (e.g. bacteria, fungi, etc.), bacterial aggregates are formed by enchaining the dividing bacterial daughter cells with the mother cell. , i.e., by tethered growth. The final result is a mass of foreign bodies (similar to those formed by agglomeration), but does not require independent and distinct foreign bodies to collide with each other. Sperm concentration varies widely within the female reproductive system, with maximum concentrations in the semen immediately after ejaculation and lower concentrations in more distal sites such as the cervix. The various HCA constructs described herein are configured to act by blocking sperm penetration through mucus, thereby preventing sperm from reaching the egg, thus reducing aggregation and mucus. Both mechanisms of trapping can be used. Multivalent Ig such as sIgA and IgM are significantly more potent aggregation agents than IgG (IgM is approximately 1000 times more potent in aggregation than IgG). Unfortunately, large-scale production of IgM or sIgA remains extremely challenging, and both IgM and sIgA suffer from stability issues. IgG represents the predominant isotype of Abs under clinical development and has an outstanding track record of safety in humans. Therefore, from a translational development perspective, IgG represents the most logical platform to develop more potent HCAs. Higher titers not only require lower doses of HCA, but also maximize the potential effectiveness of HCA-based contraception. To date, no multimeric Ab constructs have been developed to generate more potent HCAs. A modified multimeric Ab is presented herein that can radically improve current monomeric IgG1-based HCAs by aggregating sperm more strongly and thus by achieving a stronger block of mucus permeation. It is written in the book. For example, a synthetic binding agent to increase aggregation and / or mucus trapping of a target with an epitope may include a human or humanized immunoglobulin G (IgG) with a set of Fab domains, where a human or The humanized IgG is linked to one or more additional immunoglobulin fragment antigen binding (Fab) domains, where the one or more additional Fab domains and the IgG All Fab domains specifically bind to the epitope of the target, allowing the synthetic binding agent to bind to the target with high affinity and improve the mobility of the target in mucus (or in some variations, (in water) to less than about 50% of its original mobility. Reduced mobility in mucus may be due to increased aggregation by synthetic binding agents (constructs) and / or may be due to increased tethering of targets that can be disrupted. In any variation described herein, the one or more additional Fab domains and the IgG Fab domain may bind different epitopes on the same target (eg, a pathogen). Any number (preferably an even number) of additional Fab domains may be included. For example, the one or more additional Fab domains may include 2, 4, 6 or 8 additional Fab domains. In some variations, the synthetic binding agent is a contraceptive synthetic binding agent (e.g., a contraceptive antibody), the target is sperm, and the one or more Fab domains and the IgG Fab domain are all on the sperm. repeating poly-n-acetyllactosaminyl structure, specifically binds to the N-linked glycosylated form of SEQ ID NO: 1 (e.g., an amino acid sequence comprising GQNDTSQTSSPS), where the glycan is poly-n-acetyllactosaminyl It's Samin. This target is referred to herein as CD52g. The additional Fab domains each have a heavy chain (HC) having (i) a variable region (VH) containing complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:4 (e.g., (HC CDR sequence as SEQ ID NO: 7); and / or (ii) a light chain (LC) having a variable region (VL) comprising the amino acid sequence SEQ ID NO: 7 (e.g., an LC CDR sequence as SEQ ID NO: 7) may include. In some variations, said at least one additional Fab domain of the synthetic binding agent is linked to a Fab domain of a set of Fab domains of IgG; An additional Fab domain of the IgG may be linked to the Fc region of the IgG. An IgG may include at least one Fc region that is a naturally occurring sequence. In some variations, the Fc sequence may be modified (eg, to prolong systemic circulation and reduce interaction with other immune cells), as described below. The amino acid sequences of the additional Fab domains need not be identical to each other or to the IgG Fab domain, although they may all bind the same antigen with approximately the same affinity. One of the reasonable techniques in the art can apply known methods to alter the sequence while retaining substantially all binding affinity. For example, conservative amino acid substitutions may be made (eg, exchanges between two amino acids separated by a small physicochemical distance).For example, in any of the variations described herein, the additional Fab domain has an amino acid sequence of (i) 100% to 75% (e.g., 100% to 80%, 100% to 85%, 100% to 100%) of the IgG Fab domain; %~90%, 100%~95%, etc.) identical amino acid sequences (e.g., for the CD52g synthetic binding peptide, the amino acid sequence of SEQ ID NO: 4, e.g. HC as SEQ ID NO: 4). have an amino acid sequence that is 100% to 75% (e.g., 100% to 80%, 100% to 85%, 100% to 90%, 100% to 95%, etc.) identical to the CDR sequence), complementarity determining regions (multiple ) (CDRs); and / or (ii) IgG Has an amino acid sequence that is 100% to 75% (e.g., 100% to 80%, 100% to 85%, 100% to 90%, 100% to 95%, etc.) identical to the amino acid sequence of the Fab domain light chain VL (e.g. , for the CD52g synthetic binding peptide, the amino acid sequence of SEQ ID NO:7, e.g. LC as SEQ ID NO:7 The amino acid sequence is 100% to 75% (e.g., 100% to 80%, 100% to 85%, 100% to 90%, 100% to 95%, etc.) identical to the CDR sequence), The light chain (LC) may include a variable region (VL) containing a light chain (LC). In some variations, one or more additional Fab domains are attached to IgG via a flexible linker that includes an amino acid sequence containing an n-pentapeptide repeat consisting of glycine (G) and serine (S). can be concatenated, where n is 2 to 15 (e.g., 2 to 14, 2 to 13, 2 to 12, 2 to 11, 2 to 10, 2 to 9, 2 to 8, 3 to 15, 3 to 14, 3~13, 3~12, 3~11, 3~10, 3~9, 3~8, etc.). Other linkers (not limited to amino acid / peptide linkers) may be used, such as non-amino acid polymers such as polynucleotide linkers and other synthetic linkers. In general, linkers do not need to be identical. The linkers may be one set of glycine serine linkers used to join one Fab, while the other set of linkers may be used, for example with (EAAAK)3, and / or a further set of linkers. uses the (Ala-Pro)n(10-34aa) linker. Also described herein are isolated nucleic acid molecules encoding any of the synthetic binding agents described herein. Also described herein are vectors containing any of these nucleic acid molecules, and / or isolated host cells or non-human organisms transformed or transfected with the nucleic acid molecules. Also described are compositions that include an optional synthetic binder and a pharmaceutically acceptable carrier. Although many of the variations described herein are directed specifically to compositions (e.g., synthetic binding agents) and methods for contraception, any of these compositions and methods may be directed to contraceptives (e.g., viruses, It should be understood that it may be intended for the treatment or prevention of infections caused by bacteria, fungi, etc.). For example, methods are described herein for increasing aggregation and / or mucus trapping of targets (e.g., sperm, viruses, bacteria, fungi, etc.) having epitopes, which methods include the steps of administering to a patient a synthetic binding agent. The synthetic binding agent contains a set of Fab domains. a human or humanized immunoglobulin G (IgG), wherein the human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen binding (Fab) domains, wherein one or multiple additional Fab domains and IgG All Fab domains specifically bind to the epitope of the target, thereby allowing the synthetic binding agent to bind to the target with high affinity and increase aggregation and / or mucus trapping of the target in the patient's mucus. Mobility, e.g., less than about 50% (e.g., less than about 40%, 30%, 20%, 10%, etc.) of its natural mobility in mucus, or in some variations of its natural mobility in water. ). In some variations, the synthetic binding agents described herein bind the fraction of progressively motile sperm, e.g., >95% (90%) compared to the fraction of progressively motile sperm in a control. or more, 85% or more, 80% or more, 75% or more, 70% or more, 65% or more, 60% or more). For example, >50% reduction in the population of forwardly motile spermatozoa. As mentioned above, any number (preferably an even number) of additional Fab domains may be included. For example, the one or more additional Fab domains may include 2, 4, 6 or 8 additional Fab domains. In particular, the target may be sperm, and the Fab domain or domains and the IgG Fab domain may all specifically bind to an epitope of CD52g. Sperm mobility is slowed by at least 50% (eg, less than about 40%, 30%, 20%, or 10% of its natural mobility) (eg, compared to its natural mobility in mucus). Generally, administration involves administering vaginally to the patient. In some variations (e.g., directed to the respiratory system or other infections or infectious routes), administration is via topical administration, such as, but not limited to, inhalation (e.g., aerosol), orally, eye drops, lavage, etc. administration. In any of these variations, administration may involve administering systemically to the patient, including systemic delivery for mucosal (eg, vaginal, respiratory, gastrointestinal) applications. In some variations, administration includes delivery from an intravaginal ring (IVR) or vaginal film. In some variations, administering includes delivering to the pulmonary mucosa using a nebulizer. Any suitable amount of synthetic binding agent may be administered. For example, administration may include delivering the synthetic binding agent at 0.01 mg to 100 mg / day. For example, when using a synthetic binding agent for contraception, administration may include administering an amount sufficient to aggregate the target and increase its overall ability to limit passage of sperm through mucus. In some variations, the synthetic binding agents described herein are synthetic binding agents for inhibiting sperm mobility through mucus. For example, a synthetic binding agent for inhibiting sperm mobility through mucus may include a human or humanized immunoglobulin G (IgG) with a set of Fab domains, where the human or humanized IgG is , one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein the one or more additional Fab domains and the IgG All Fab domains specifically bind to an epitope of CD52g, whereby the synthetic binding agent reduces sperm mobility in mucus to less than approximately 50% of its native mobility in mucus, and / or , reducing the forward motile sperm fraction by 50%. In some variations, the one or more additional Fab domains may include, for example, 2, 4, 6 or 8 additional Fab domains. Epitopes of CD52g may include the N-linked glycosylated form of SEQ ID NO:1. In any variation described herein, the additional Fab domains each include (i) a heavy chain having a variable region (VH) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO: 4; (HC); and / or (ii) a light chain (LC) having a variable region (VL) containing complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:7. One or more additional Fab domains may be linked to the Fab domain of the set of Fab domains of the IgG. For example, the at least one additional Fab domain may be linked to the Fc region of an IgG. An IgG may include at least one Fc region that is a naturally occurring sequence. One or more additional Fab domains may be linked to the IgG via a flexible linker comprising an amino acid sequence containing n pentapeptide repeats consisting of glycine (G) and serine (S), where n is It is 3-8. Also, an isolated nucleic acid molecule encoding a synthetic binding agent, and / or a vector containing the corresponding nucleic acid molecule, and / or an isolated host cell or non-human transformed or transfected with the nucleic acid molecule. Organisms are also described herein. Any synthetic binder described herein may be part of a composition that includes the synthetic binder and a pharmaceutically acceptable carrier. Any suitable delivery device may be used with the compositions and / or synthetic binders described herein. For example, an intravaginal ring (IVR) or vaginal film may be used. Described herein are methods of providing contraception in female subjects. These methods include applying any synthetic binding agent (particularly one that binds to sperm selection markers, including CD52g, as described herein) to the mucosa of a subject's reproductive system in an amount effective to provide contraception. may include the step of administering. For example, methods of inhibiting the mobility of sperm in the mucus of the reproductive system of a female subject are described herein, which methods include: contacting (including via a delivery device) an amount effective to inhibit the mobility of at least 80% of spermatozoa present within the mucus. In some variations, sperm mobility may be slowed by at least 50% compared to its normal or native mobility in the mucus and / or reduce the fraction of forwardly motile sperm by 50%. . The synthetic binding agent or composition may be delivered via vaginal administration (e.g., using an intravaginal ring (IVR)); alternatively or in addition, the synthetic binding agent or composition may be delivered via systemic administration. can be delivered via. The IVR can be configured to release an effective amount for at least 15 days. In some variations, the composition may be delivered in a film that dissolves intravaginally to release the synthetic binder. Generally, Fab fragments may be present at the N- or C-terminus of the core IgG. For example, additional Fab domain(s) may be inserted at the N-terminus (ie, from which another Fab arm extends) or at the C-terminus (ie, after the Fc domain). In some variations, the synthetic binding agent may include at least two additional Fab domains (also referred to herein as Fab fragments) before and / or after the human or humanized IgG.In particular, a set of synthetic binding agents to increase aggregation, tethering and / or mucus trapping of epitope-bearing targets (containing epitopes specific to sperm and thus effective in trapping sperm) may include a human or humanized immunoglobulin G (IgG) having a Fab domain (and a set of Fc domains), where the human or humanized IgG is linked to four additional Fab domains, and the IgG The Fab domain and additional Fab domains all bind specifically to the epitope of the target, such that the synthetic binding agent binds to the target with high affinity, altering the target's mobility in mucus from its native migration in mucus. reduction in sex to less than approximately 50%. In this example, the synthetic binding agent includes additional Fabs on either side of the core IgG (eg, two at the N-terminus and two at the C-terminus, for a total of 6 Fabs on the molecule). In variations configured as contraceptives, the potency of the binding agent is a synthetic binding agent that can effectively agglomerate sperm and prevent them from freely swimming (i.e. remaining as forward motile sperm). may be determined in part by the minimum concentration of In general, synthetic binding agents with a total of 6 or more Fab fragments should have an order of magnitude higher potency (e.g. agglutination titer) than IgG alone (including IgG that is glycosylated to increase mucosal binding). has been found. In particular, many of the synthetic binding agents configured as contraceptives described herein, at greater than 10x lower binding agent concentrations, inhibit naturally motile spermatozoa. of IgG to a similar extent (e.g., 95% versus untreated controls). Binding agent potency may also be determined in part by increased "mucus trapping," which is a synthetic binding agent that cross-links a larger fraction of sperm to mucin compared to native IgG, or Refers to a synthetic binding agent that crosslinks a fraction of sperm to mucin comparable to IgG at lower binding agent concentrations. The human or humanized IgG that forms the core of the synthetic binding agents described herein may contain a non-native Fc region (e.g., an Fc region modified to increase stability / half-life in the body, an immunogenic Fc regions modified to reduce activity). For example, the Fc region of the IgG portion of a synthetic binding agent may be modified to contain one or more specific mutations, thereby modifying specific immune functions. For example, the Fc region may have increased FcRn affinity to prolong hemodynamics. For example, mutations in human IgG (e.g. IgG1) of T250Q / M428L can increase binding to FcRn and increase half-life, and / or mutations in M252Y / S254T / T256E+H433K / N434F can increase binding to FcRn and increase half-life. , may increase binding to FcRn and increase half-life. In some variations, synthetic binding agents contain modified Fc regions with reduced FcR affinity, which may help prevent the Ab from stimulating the immune system to express antibodies against sperm. may help ensure that the Ab does not prime the immune system to develop antibodies against sperm). For example, one or more mutations in a human IgG (e.g., IgG1) that reduce binding to an FcR (e.g., FcγR) may include, e.g., E233P / L234V / L235A / G236+A327G / A330S / P331S, L234A / L235A / P329G, and / or K322A. For example, as described above, a method of increasing aggregation and / or mucus trapping of a target having an epitope may include administering to a subject a synthetic binding agent, the synthetic binding agent having a set of Fab domains. a human or humanized immunoglobulin G (IgG), wherein the human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen binding (Fab) domains, and wherein the human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains; Additional Fab domains and IgG All Fab domains specifically bind to the epitope of the target, thereby allowing the synthetic binding agent to bind to the target with high affinity and increasing the ability of the target mucus to restrict passage of the target through the mucus. reducing the target's mobility to less than about 50% of its native mobility in the mucus, or reducing the fraction of motile target to less than 50% of untreated controls. reflected by this. The one or more additional Fab domains include 2, 4, 6 or 8 additional Fab domains. In some variations, particularly methods of contraception, the target may be sperm. In some variations, the antigen is CD52g. Mobility of sperm in mucus can be slowed down by at least 50% compared to the original mobility of sperm in mucus. In some variations, the target may be a pathogen, eg, one or more Fab domains and the IgG Fab domain may all specifically bind to a pathogen. For example, pathogens include Acinetobacter baumannii; Bacteroides fragilis; Burkholderia cepacia; Clostridium difficile; Clostridium sordellii; carbapenem-resistant Enterobacteriaceae; Enterococcus faecalis; Escherichia coli; Hepatitis A; Hepatitis B ; Hepatitis C; Human immunodeficiency viruses HIV-1 and HIV-2 (HIV, AIDS); Influenza; Klebsiella pneumoniae; Methicillin-resistant Staphylococcus aureus; Morganella morganii; Mycobacterium abscessus; Norovirus; Pseudomonas aeruginosa ( Psuedomonas aeruginosa); Staphylococcus aureus; Stenotrophomonas maltophilia; Mycobacterium tuberculosis; Vancomyin-resistant Staphylococcus aureus; Vancomyin-resistant Enterococcus; Neisseria gonorrhoeae ( gonorrhea); Chlamydia trachomatis (venereal lymphogranulomatosis); Treponema pallidum (syphilis); Haemophilus ducreyi (chancroid); Klebsiella granuloma granulomatis) or granuloma Callimatobacterium (inguinal lymphogranulomatosis), Mycoplasma genitalium, Ureaplasma urealyticum (Mycoplasma); HTLV-1 (T-lymphotropic virus type 1); Herpes simplex virus types 1 and 2 Type (HSV-1 and HSV-2) ;Epstein-Barr virus; cytomegalovirus; human herpesvirus 6; varicella-zoster virus; human papilloma virus (genital warts); hepatitis A virus, hepatitis B virus, hepatitis C virus (viral hepatitis); Molluscum contagiosum virus (MCV); Trichomonas vaginalis vaginalis) (trichomoniasis); and yeast, such as Candida albicans (vulvar candidiasis). In some variations, the pathogen includes a fungus such as Aspergillus. Administration may include administering by any suitable route or routes. For example, administering may include administering to the subject vaginally (eg, from an intravaginal ring, IVR). Administration may include administering systemically to a subject. Administration may include administering to the subject as a vaginal film. Administration may include administering from a nebulizer. Administration may include administering by inhalation. Administration may include eye drops. Administration may include oral capsules or pills. Administration may include mouthwash. In some variations, administration may include delivering the synthetic binding agent at 0.01 mg to 100 mg / day. Administration may include administering in an amount sufficient to aggregate or tether the target while maintaining or increasing mucus trapping, reducing the permeability of the target through mucus, and / or reducing the target's permeability through mucus. with an overall net effect of decreasing proliferation or presence. As mentioned above, an IgG Fab domain may have an amino acid sequence that is not identical to one or more additional Fab domains. For example, IgG domains may have amino acid sequences that are 100% (identical) to 75%, 80%, 85%, 90%, 95%, etc. Generally, the IgG Fab and additional Fab domains recognize the same antigen with approximately the same affinity, regardless of sequence. For example, methods of inhibiting fertilization and / or conception by sperm aggregation and / or mucus trapping are described herein, and the methods may include administering to a subject a synthetic binding agent, wherein the synthetic binding agent is , a human protein with a set of Fab domains. or humanized immunoglobulin G (IgG), wherein the human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein one or more Further Fab domains and IgG All Fab domains specifically bind epitopes on sperm, whereby the synthetic binding agent binds sperm with high affinity and increases sperm aggregation and / or mucus trapping in mucus. The net effect is either a reduction in the fraction of forwardly motile sperm and / or a reduction in the mobility of motile sperm. As mentioned above, the one or more additional Fab domains may include 2, 4, 6 or 8 additional Fab domains. Mobility of sperm in mucus can be slowed down by at least 50% compared to the original mobility of sperm in mucus. In some variations, the mobility of the target (e.g., sperm, pathogen, etc.) can be at least 40% slower compared to the target's native mobility, and at least 30% slower compared to the target's native mobility. can be at least 20% slower compared to native mobility, can be at least 15% slower compared to native mobility, and so on. In some variations, the synthetic binding agents described herein reduce the fraction of progressively motile sperm of total sperm by more than a decrease in the fraction of progressively motile sperm relative to a control (vs.). also, for example, by >95% (90% or more, 85% or more, 80% or more, 75% or more, 70% or more, 65% or more, 60% or more, etc.). For example, >50% reduction in the population of forwardly motile spermatozoa. As mentioned above, any suitable route of administration may be used. For example, administration may include administering to the subject via one or more of the following: vaginally (eg, from an intravaginal ring), topically, systemically, as a vaginal film, from a nebulizer.Administration may include administering in an amount sufficient for aggregation of the target and / or mucus trapping of the target, with the overall effect of reducing penetration of the target through mucus. Also described herein are methods of treating or preventing infections caused by pathogens, the methods comprising administering to a subject a synthetic binding agent, wherein the synthetic binding agent has a set of Fab domains. or a humanized immunoglobulin G (IgG), wherein the human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen binding (Fab) domains, and wherein the human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen binding (Fab) domains. Additional Fab domains and IgG All Fab domains specifically bind to a single epitope of a pathogen, thereby allowing the synthetic binding agent to bind to the pathogen with high affinity, increasing target aggregation and tethering of the target in the subject's mucus. Induce proliferation and / or target mucus trapping. The one or more additional Fab domains include 2, 4, 6 or 8 additional Fab domains. Mobility of the pathogen in the mucus is slowed by at least 10% (such as at least 50%, at least 40%, at least 30%, at least 20%, at least 15%, etc.) compared to the original mobility of the pathogen in the mucus. Pathogens include influenza (including influenza A, B, and C); severe acute respiratory syndrome (SARS); respiratory syncytial virus (RSV); parainfluenza; adenoviruses; human rhinoviruses; coronaviruses; and noroviruses. It may be one or more of them. The pathogen may be one or more of Salmonella and E. coli. The pathogens are Neisseria gonorrhoeae (gonorrhea); Chlamydia trachomatis (venereal lymphogranulomatosis); Treponema pallidum (syphilis); Haemophilus ducreyi (chancroid); Klebsiella granulomatosis (venereal lymphogranulomatosis); granulomatis) or granuloma Callimatobacterium (inguinal lymphogranulomatosis), Mycoplasma genitalium, Ureaplasma urealyticum (Mycoplasma); Human immunodeficiency viruses HIV-1 and HIV-2 (HIV, AIDS); HTLV-1 ( T lymphotropic virus type 1); herpes simplex virus type 1 and Type 2 (HSV-1 and HSV-2); Epstein-Barr virus; cytomegalovirus; human herpesvirus 6; varicella-zoster virus; human papillomavirus (genital warts); hepatitis A virus, hepatitis B virus , hepatitis C virus (viral hepatitis); molluscum contagiosum virus (MCV); Trichomonas vaginalis vaginalis) (trichomoniasis); and yeasts, such as Candida albicans (vulvar candidiasis). Administration may be any type of delivery described herein, including, but not limited to: systemic, oral, intramuscular injection, intravascular injection, subcutaneous injection, parenteral, inhalation (e.g. from a nebulizer), Including topical administration. Administration involves delivering the synthetic binding agent at 0.01 mg to 100 mg / day. Administration may include administering in an amount sufficient to aggregate the pathogen and / or maintain or even increase mucus trapping of the pathogen. In some variations, administering may include administering in an amount sufficient to cause tethered growth, ligating together bacteria that are dividing from the same mother bacteria into one long chain. , which has the effect of forming a mass that is too large to penetrate mucus. In some variations, administering may include administering in an amount sufficient to cause tethered growth, ligating together bacteria that are dividing from the same mother bacteria into one long chain. , which has the effect of forming large clumps, limiting their spread throughout the body and / or limiting their growth rate. As mentioned above, an IgG Fab domain may have an amino acid sequence that is not identical to one or more additional Fab domains. Any synthetic binding agent described herein for increasing aggregation, tethering and / or mucus trapping of a target with an epitope may be a human or humanized immunoglobulin G (IgG) with a set of Fab domains. ), where humans or The humanized IgG is linked by a linker (e.g. an amino acid / peptide linker) to one or more further immunoglobulin fragment antigen binding (Fab) domains, where the one or more further Fab domains and the IgG All Fab domains may bind specifically to the epitope of the target, such that the synthetic binding agent binds to the target with high affinity and reduces the mobility of the target in mucus (e.g., its native mobility in mucus (e.g., less than about 15%, 20%, 30%, 40%, 50%, etc.). The one or more additional Fab domains may include 2, 4, 6 or 8 additional Fab domains. The target may be a sperm and the one or more Fab domains and the IgG Fab domain all target an epitope of CD52g (e.g., the repeating poly-n-acetyllactosaminyl structure on sperm, the N-linked form of SEQ ID NO: 1). glycosylated form). As described above, each additional Fab domain of the synthetic binding agent targeting CD52g comprises (i) complementarity determining regions (CDRs) having an amino acid sequence between 100% and 80% identical to the amino acid sequence of SEQ ID NO: 4; Containing variable region ( and / or (ii) a variable region (VL) containing complementarity determining regions (CDRs) with an amino acid sequence 100% to 80% identical to the amino acid sequence of SEQ ID NO: 7. ) with a light chain (LC). For example, a synthetic binding agent for inhibiting sperm mobility through mucus may include a human or humanized immunoglobulin G (IgG) with a set of Fab domains, where the human or humanized IgG is , one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein the one or more additional Fab domains and the IgG All Fab domains specifically bind to epitopes of CD52g, whereby the synthetic binding agents reduce sperm mobility in mucus to less than about 50% of its native mobility in mucus. The one or more additional Fab domains may include 2, 4, 6 or 8 additional Fab domains. The epitope of CD52g may be the N-linked glycosylated form of the repeating poly-n-acetyllactosaminyl structure, SEQ ID NO:1. Each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) containing complementarity determining regions (CDRs) having an amino acid sequence between 100% and 80% identical to the amino acid sequence of SEQ ID NO: 4; ); and / or (ii) a light chain (LC) having a variable region (VL) containing complementarity determining regions (CDRs) having an amino acid sequence 100% to 80% identical to the amino acid sequence of SEQ ID NO: 7. may include. Also described herein are specific examples of synthetic binding agents that target bacterial pathogens, such as, in one non-limiting example, Klebsiella bacillus. For example, the IgG can be directed against an antigen of Klebsiella (e.g., an example of which is provided in SEQ ID NO: 39 to SEQ ID NO: 45), and the additional Fab domains are each directed against (i) the HC of the IgG. A heavy chain (HC) having a variable region (VH) containing complementarity determining regions (CDRs) having an amino acid sequence identical or similar to the VH region (e.g., for examples of SEQ ID NO: 39 to SEQ ID NO: 45, No. 41); and (ii) A light chain (LC) having a variable region (VL) containing complementarity determining regions (CDRs) with an amino acid sequence identical or similar to that of IgG (e.g., with respect to the examples of SEQ ID NO: 39 to SEQ ID NO: 45, SEQ ID NO: 44). For example, a synthetic binding agent directed to a Klebsiella antigen may have additional Fab domains, each of which has (i) a complementarity determining region having an amino acid sequence between 100% and 80% identical to the amino acid sequence of SEQ ID NO: 41; Contains (CDRs) a heavy chain (HC) having a variable region (VH); and / or (ii) a variable region comprising complementarity determining regions (CDRs) having an amino acid sequence 100% to 80% identical to the amino acid sequence of SEQ ID NO: 44; It contains a light chain (LC) with a region (VL). For example, a synthetic binding agent for treating or preventing infections caused by Klebsiella pathogens may include a human or humanized immunoglobulin G (IgG) with a set of Fab domains, where a human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen binding (Fab) domains, wherein the one or more additional Fab domains and the IgG All Fab domains specifically bind to epitopes specific to Klebsiella bacilli, whereby the synthetic binding agent reduces the mobility of Klebsiella bacilli in mucus. The one or more additional Fab domains may include 2, 4, 6 or 8 additional Fab domains. Each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) containing complementarity determining regions (CDRs) having an amino acid sequence between 100% and 80% identical to the amino acid sequence of SEQ ID NO: 41; ); and / or (ii) a light chain (LC) having a variable region (VL) containing complementarity determining regions (CDRs) having an amino acid sequence 100% to 80% identical to the amino acid sequence of SEQ ID NO: 44. may include. Another non-limiting example of a synthetic binding agent that targets a bacterial pathogen is a synthetic binding agent that targets Salmonella bacillus. The IgG portion of the synthetic binding agent may be directed against a Salmonella antigen (e.g. as set forth in SEQ ID NOs: 67-73), and the additional Fab domain (directed against the same target antigen) may contain amino acids similar or identical to the Fab domain of the IgG. It may have an array. For example, the additional Fab domains each include (i) a heavy chain (HC) having a variable region (VH) containing complementarity determining regions (CDRs) having the amino acid sequence of an IgG (e.g., SEQ ID NO: 69); and / or or (ii) a light chain (LC) having a variable region (VL) containing complementarity determining regions (CDRs) having the amino acid sequence of an IgG (eg, SEQ ID NO: 72).In some variations, the synthetic binding agent directed to a Salmonella antigen comprises an additional Fab domain, each comprising: (i) a complementarity determining region having an amino acid sequence between 100% and 80% identical to the amino acid sequence of SEQ ID NO: 69; (Including CDRs) a heavy chain (HC) with a variable region (VH); and / or (ii) a complementarity determining region (CDRs) having an amino acid sequence 100% to 80% identical to the amino acid sequence of SEQ ID NO: 72. Contains a light chain (LC) with a variable region (VL). For example, a synthetic binding agent for treating or preventing infections caused by Salmonella bacillus pathogens may include a human or humanized immunoglobulin G (IgG) with a set of Fab domains, where a human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen binding (Fab) domains, wherein the one or more additional Fab domains and the IgG All Fab domains specifically bind to epitopes specific to Salmonella bacilli, whereby the synthetic binding agents reduce the mobility of Salmonella bacilli in mucus. The one or more additional Fab domains may include 2, 4, 6 or 8 additional Fab domains. Each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) containing complementarity determining regions (CDRs) having an amino acid sequence between 100% and 80% identical to the amino acid sequence of SEQ ID NO: 69; ); and / or (ii) a light chain (LC) having a variable region (VL) containing complementarity determining regions (CDRs) having an amino acid sequence 100% to 80% identical to the amino acid sequence of SEQ ID NO: 72. may include. Another non-limiting example of a synthetic binding agent that targets a bacterial pathogen is a synthetic binding agent that targets Neisseria gonorrhoeae. The IgG portion of the synthetic binding agent can be directed against a Neisseria gonorrhoeae antigen (e.g. as set forth in SEQ ID NOs: 102-108), and the additional Fab domain (directed against the same target antigen) can be similar or identical to the Fab domain of IgG. It may have an amino acid sequence. For example, the additional Fab domains each have a heavy chain (HC) having a variable region (VH) containing complementarity determining regions (CDRs) with (i) an amino acid sequence similar or identical to the HC VH of IgG (e.g. SEQ ID NO: 104); and / or (ii) LC of IgG It may include a light chain (LC) (eg, SEQ ID NO: 107) having a variable region (VL) containing complementarity determining regions (CDRs) having an amino acid sequence similar or identical to that of the VL. For example, a synthetic binding agent directed against Neisseria gonorrhoeae contains an IgG directed against an antigen of Neisseria gonorrhoeae and (i) complementarity determining regions (CDRs) having an amino acid sequence that is 100% to 80% identical to the amino acid sequence of the IgG; Heavy chain (HC) with variable region (VH) (e.g. SEQ ID NO: 104) and / or (ii) a light chain (LC) having a variable region (VL) containing complementarity determining regions (CDRs) with an amino acid sequence 100% to 80% identical to that of an IgG (e.g. Additional Fab domains may be included, each comprising SEQ ID NO: 107). For example, a synthetic binding agent for treating or preventing infections caused by Neisseria gonorrhoeae may include a human or humanized immunoglobulin G (IgG) with a set of Fab domains, where the human or humanized IgG is one or more additional immunoglobulin fragment antigen binding (Fab) domains, wherein the one or more additional Fab domains and the IgG All Fab domains specifically bind to N. gonorrhoeae-specific epitopes, whereby the synthetic binding agents reduce the mobility of N. gonorrhoeae in mucus. The one or more additional Fab domains may include 2, 4, 6 or 8 additional Fab domains. The additional Fab domains each include (i) a heavy chain (HC) having a variable region (VH) containing complementarity determining regions (CDRs) having an amino acid sequence between 100% and 80% identical to the amino acid sequence of SEQ ID NO: 104; ); and / or (ii) a light chain (LC) having a variable region (VL) containing complementarity determining regions (CDRs) having an amino acid sequence 100% to 80% identical to the amino acid sequence of SEQ ID NO: 107. may include. Any synthetic binding agent described herein may include at least one additional Fab domain linked to a Fab domain of a set of Fab domains of IgG; In addition, any synthetic binding agent described herein may include at least one additional additional Fab domain linked to the Fc region of an IgG. An IgG may include at least one Fc region that is a naturally occurring sequence. An IgG may include at least one Fc region containing one or more mutations that increase or decrease binding to an Fc receptor. The one or more additional Fab domains include a linker, such as a flexible peptide linker, comprising an amino acid sequence comprising an n-pentapeptide repeat consisting of glycine (G) and serine (S), as described herein. where n is 3-8. Generally, an IgG Fab domain may have an amino acid sequence that is not identical to one or more additional Fab domains, but still recognizes the same antigen with the same (or nearly equivalent) affinity. Also described herein are isolated nucleic acid molecules encoding any of these synthetic binding agents, and / or vectors containing such isolated nucleic acid molecules. In some variations, the nucleotide sequence encoding the additional IgG (e.g., HV and / or LC) may differ from the nucleotide sequence encoding the region of the IgG with the corresponding binding affinity; the resulting amino acid sequence is May be identical or nearly identical (e.g., having 75% or more homology, 80% or more homology, 85% or more homology, 90% or more homology, 95% or more homology, etc.) , with corresponding substitutions). Also described herein are isolated host cells or non-human organisms transformed or transfected with these nucleic acid molecules. Also described herein are compositions of any of these synthetic binders and pharmaceutically acceptable carriers. Novel features of the invention are pointed out along with the features in the following claims. The features and advantages of the present invention may be better understood by reference to the following detailed description and accompanying drawings that illustrate exemplary embodiments in which the principles of the invention are employed. Figure 2 is a schematic example of a mAb directed against an epitope that can form the core of a synthetic binding agent (eg, a recombinant mAb) with increased aggregation and / or mucus trapping. In some variations, the core antibody is directed against an antigen associated with sperm (particularly human sperm). Alternatively, other epitopes are used, including viral or bacterial epitopes. Examples of synthetically modified constructs for targeted epitopes with increased aggregation and / or mucus trapping are shown using the core shown in FIG. 1A. FIG. 1B is an example of a Fab-IgG variation (eg, overlapping Fab domain(s) linked to the amino terminus of a core IgG). Figure 1C is an example of an IgG-Fab variation (eg, overlapping Fab domain(s) linked to the carboxyl terminus of a core IgG). Figure ID is an example of a Fab-IgG-Fab variation (eg, overlapping Fab domains linked to both the carboxyl and amino termini of the core IgG). Figure 1E is an example of a Fab-IgG-Fab-Fab variation (eg, overlapping Fab domains linked to both the carboxyl and amino termini of the core IgG). Figure 1F is an example of a Fab-Fab-IgG-Fab-Fab variation of the synthetic binding agents described herein (e.g., 10-mer, with 4 additional sets of Fab domain(s), 2 2 are linked to the carboxyl terminus and 2 to the amino terminus of the core IgG). 1A-1E is a schematic table further illustrating the structural characteristics of the core IgG and synthetic constructs shown in FIGS. 1A-1E. FIG. Mucus trapping will be schematically explained. In this example the target is a virus; other targets may include bacteria and sperm. In FIG. 2A, the diagram shows how a target (eg, a virus) can easily spread through native mucus (absent any virus-specific Abs). Figure 2B shows how anti-viral Abs, particularly antibodies that only weakly (unbound) interact with mucin and therefore freely diffuse through mucus, target their targets in mucus by adhesive interactions. Indicates whether it can be trapped. Arrows indicate the small fraction of free (no virus bound) Ab interacting with mucin at any given time. Showing aggregation of human sperm. Figure 3 shows the trapping of sperm in mucus (e.g., cervicovaginal mucus (CVM) and endocervical mucus (CM)). Figure 3 shows SDS-PAGE analysis of an example synthetic binding agent (termed MM-006) with increased potency of aggregation and / or mucus trapping compared to unmodified IgG. In this example, the synthetic binding agent is constructed as a Fab-IgG-Fab construct and compared against HCA (eg, IgG). Figure 4A shows a color-matched SEC / MALS analysis of MM-006. The SEC curve (solid curve, right y-axis) shows a homogeneous expression profile, and the MALS data (thicker line, left y-axis) confirms the desired molecular weight (MW). Figure 4A-4B shows the application of the construct (MM-006) to reduce sperm mobility / motility. Figure 5A is a bright field image of spermatozoa 30 seconds after exposure to MM-006. Figure 5B shows sperm agglutination titers of MM-006 and HCA compared to PBS. * indicates p<0.05; ** indicates p<0.01; *** indicates p<0.001. An example of a device for delivering a construct (eg, a contraceptive synthetic binding agent with multiple Fab repeats) is shown. FIG. 6A shows a perspective view of a ring with four capsules inserted within the ring cavity. Figure 6B shows an exploded and assembled view of a sustained-release capsule: coated antibody pellet (center region, top), closed distal capsule piece (right end of capsule), and capsule cap with release window (capsule (left end) is shown. Daily (top) and cumulative (bottom) release of human IgG over at least 28 days using different sustained release capsule formulations is shown. Silver-stained gel showing human IgG recovered from capsules remaining intact even after 4 weeks of exposure to human CVM (changed every 5 days to maintain a degradable environment). Pure IgG bands and PBS are shown as controls; all incubations were at 37 °C. Each band represents IgG recovered from an individual capsule. Figure 3 shows sperm aggregation in the presence of one of the synthetic binding agents with multiple Fab repeats described herein (configured as HCA). Figure 8A shows a light microscopy image of aggregated spermatozoa with round cells (indicated by arrows). Figure 8B is a fluorescence image of the same field; the construct in this example (HCA) was conjugated to Dylight633 (red) and the entire length of all spermatozoa were labeled. Semen leukocytes labeled with CMFDA (Live CellTracker Green) were also positive for HCA as shown by co-labeling (white arrow). FIG. 3 is a graph showing differential scanning calorimetry of an exemplary synthetic binding agent with multiple Fab repeats (eg, Fab-IgG, bottom) and scFv-IgG (top) constructs. The scFv construct exhibits unfolding at much lower temperatures than synthetic binders with multiple Fab repeats (Fab-IgG) due to the lack of CH1 / CL domains. Analytical analysis of core only (IgG, bottom), scFv-IgG construct (middle), and an exemplary synthetic binder with multiple Fab repeats (Fab-IgG, top) after single-step Protein A purification. Figure 3 shows a graph of size exclusion chromatography. Both IgG and Fab-IgG constructs showed a single sharp peak at their expected molecular weights. The scFv-IgG construct exhibits the formation of high molecular weight aggregates. Figure 2 shows SDS-PAGE analysis of multimeric synthetic binders with multiple Fab repeats. In this example, the multimeric construct is an HCA (e.g., contraceptive) synthetic binder with multiple Fab repeats, where all Fabs are directed against the same epitope of CD52g (e.g., all target the same shared array). Figure 11A is a color-matched SEC / MALS analysis of different multimeric HCA constructs. The SEC curves (solid curve, right y-axis) for each construct show a homogeneous expression profile, and the MALS data (dotted line, left y-axis) confirm the desired molecular weight of each construct (also relative to core IgG). compared). Whole sperm ELISA is shown confirming that different multimeric synthetic binders (configured as HCA constructs) with multiple Fab repeats possess functional Fabs that bind to sperm. 1 minute after treatment with PBS (Figure 12B) or 30 seconds after treatment with a multimeric synthetic binder with multiple Fab repeats (e.g., configured as a Fab-IgG-Fab HCA construct) (Figure 12C) A bright field image of spermatozoa is shown. Pegylated nanoparticles (PS-PEG) in human CVM without Ab, control IgG (Ctrl IgG) or with multiple Fab repeats compared to uncoated nanoparticles (PS-COOH) in untreated CVM The mucus-trapping potency of Fab-IgG is shown as reflected by the ensemble geometric mean of the effective diffusivity (Deff) of a multimeric synthetic binder (eg, anti-PEG Fab-IgG construct). Data are plotted for individual samples (indicated by differently colored circles) and the average is shown by the solid line. * indicates a statistically significant difference (p<0.05). The heavy chain sequence of core IgG directed against an epitope (CD52g) on human sperm compared to the germline sequence (e.g. native IgG) (Figure 14A; the VH portion of SEQ ID NO: 3 is the VH of the germline sequence 14B; the VL portion of SEQ ID NO: 7 is compared to the VL portion of the germline sequence. An example of production and characterization of multimeric anti-sperm IgG antibodies is shown. Figure 15A schematically shows examples of anti-sperm IgG, Fab, Fc, Fab-IgG, and IgG-Fab. Figure 15B is a gel showing non-reduced IgG, Fab-IgG, and IgG-Fab. Figure 15C shows reduced SDS-Page analysis comparing IgG, Fab-IgG, and IgG-Fab after expression in Expi293 cells and purification by protein A / G chromatography. FIG. 15D is a graph showing the purity and homogeneity of purified multimeric antibodies (IgG compared to Fab-IgG and IgG-Fab) via analytical SEC-MALS analysis. Figure 3 shows the characterization of multimeric anti-sperm IgG antibodies. Figure 16A shows the molar mass versus time of IgG, Fab-IgG and IgG-Fab, each determined by SEC-MALS. Figure 16B shows melting temperature (Tm) and aggregation temperature (Tagg) values determined by nanoDSF by measuring changes in protein intrinsic fluorescence and back reflection, respectively. Figure 16C is a graph showing whole sperm ELISA analysis to assess binding titer of the indicated antibodies. Motavizumab (anti-RSV IgG1) is used as an isotype control. ELISA was performed in triplicate and repeated three times with three unique samples. Lines indicate arithmetic mean concentration and standard error of the mean. Sperm agglutination titers of parental IgG, Fab-IgG and IgG-Fab using purified motile sperm (10 x 10 forward motile sperm / mL) are shown. Figure 17A shows the measurement of parental and multimeric anti-sperm IgG by quantifying the percentage of sperm maintaining forward motility after Ab treatment at different concentrations compared to the pre-treatment condition. The agglutination titer is shown graphically. Figure 17B shows the percentage of processive sperm that avoided aggregation after treatment, normalized to the negative control for further comparison. Data represent 6 unique sperm samples. Lines indicate arithmetic mean concentration and standard error of the mean. Sperm aggregation kinetics of parental IgG, Fab-IgG and IgG-Fab using purified motile sperm (10 x 10 forward motile sperm / mL) is shown. FIG. 18A is a graph showing quantification of the time required to achieve 90% aggregation of processive sperm compared to untreated controls. CASA analysis was obtained every 30 seconds up to 90 seconds after the procedure. Figure 18B shows the percentage of sperm aggregation for the indicated anti-sperm antibodies by quantifying the percentage of aggregated sperm after Ab treatment at three different time points compared to before treatment.Data represent 6 unique sperm samples. Lines indicate arithmetic mean concentration and standard error of the mean. Showing mucus trapping titers of parental IgG, Fab-IgG and IgG-Fab using pH-neutralized female CVM and purified motile sperm (1 x 10 forward motile sperm / mL). . The mucus trapping potency of the indicated antibodies was evaluated by performing real-time video microscopy on fluorescently labeled sperm suspended in Ab-treated (25 ug / ml) CVM. A neural network tracker customized with standardized sperm motility parameters was used in all recorded videos to quantify the percentage of forwardly motile sperm present within the mucus sample. Figure 2 shows the production and characterization of multimeric anti-sperm IgG antibodies. Figure 20A schematically shows anti-sperm Fab, Fc, IgG, Fab-IgG-Fab (FIF), Fab-IgG-Fab-Fab (FIFF) and Fab-Fab-IgG-Fab-Fab (FFIFF). . In this example, the N-terminal and C-terminal Fab / s of FIF, FIFF, and FFIFF contain fully intact anti-sperm Fab / s with VH, VL, CH1, and CL. Figure 20B is a gel showing non-reduced FIF, FIFF and FFIFF (compared to IgG). Figure 20C is a reduced SDS-Page analysis of the indicated antibodies (IgG, FIF, FIFF, and FFIFF) after expression in Expi293 cells and purification by protein A / G chromatography. FIG. 20D is a graph showing the purity and homogeneity of purified multimeric antibodies via analytical SEC-MALS analysis. Further characterization of multimeric anti-sperm IgG antibodies is shown. Figure 21A shows the molar mass versus time of IgG, FIF, FIFF and FFIFF, each determined by SEC-MALS. FIG. 21B graphically depicts the melting temperature (Tm) and aggregation temperature (Tagg) values of the indicated antibodies as determined by nanoDSF by measuring changes in protein intrinsic fluorescence and back reflection, respectively. Figure 21C is a graph depicting whole sperm ELISA analysis to assess binding titer of the indicated antibodies. Motavizumab (anti-RSV IgG1) is used as an isotype control. ELISA was performed in triplicate and repeated three times with three unique samples. Lines indicate arithmetic mean concentration and standard error of the mean. Sperm agglutination titers of parental IgG and multimeric constructs are shown using purified motile sperm (10 x 10 forward motile sperm / mL) and whole semen. Figure 22A shows the percentage of sperm maintaining forward motility after Ab treatment compared to pre-treatment condition using purified motile sperm (10 x 10 forward motile sperm / mL). Figure 3 is a graph showing sperm agglutination titers of parental IgG, FIF, FIFF and FFIFF by quantifying . Figure 22B shows the percentage of processive spermatozoa that avoided aggregation after Ab treatment using purified motile spermatozoa normalized to negative control for further comparison. Figure 22C shows the measured sperm agglutination of parental IgG and FFIFF by quantifying the percentage of sperm maintaining forward motility after Ab treatment compared to the pre-treatment condition using whole semen. It is a graph showing the value. Figure 22D shows the percentage of processive sperm that avoided aggregation after Ab treatment using whole semen, normalized to negative control for further comparison. Data represent 6 unique sperm samples. Lines indicate arithmetic mean concentration and standard error of the mean. Sperm aggregation kinetics of parental IgG and multimeric constructs are shown using purified motile sperm (10 x 10 forward motile sperm / mL) and whole semen. Figure 23A shows the time required to achieve 90% aggregation of processive sperm compared to untreated controls using purified motile sperm (10 x 10 processively motile sperm / mL). Figure 2 shows the aggregation kinetics of parental IgG, FIF, FIFF and FFIFF as determined by quantifying . CASA analyzes were obtained every 30 seconds up to 90 seconds after the procedure. Figure 23B quantifies the percentage of aggregated sperm after Ab treatment at three different time points compared to before treatment using purified motile sperm (10 x 10 forward motile sperm / mL). The percentage of sperm aggregation of parental IgG, FIF, FIFF and FFIFF is shown. Figure 23C shows aggregation kinetics of parental IgG and FFIFF using whole semen and quantifying the time required to achieve 90% aggregation of processive sperm compared to untreated controls. CASA analyzes were obtained every 30 seconds up to 90 seconds after the procedure. Figure 23D is a graph showing the percentage of sperm aggregation of parental IgG and FFIFF by quantifying the percentage of aggregated sperm after Ab treatment at three different time points compared to before treatment using whole semen. . Data represent 6 unique sperm samples. Lines indicate arithmetic mean concentration and standard error of the mean. Figure 3 shows sperm aggregation kinetics of parental IgG and FFIFF using low and high concentrations of purified motile sperm (2 x 10 and 50 x 10 processive sperm / mL). Figure 24A shows the aggregation kinetics of IgG and FFIFF by quantifying the time required to achieve 90% aggregation of processive sperm compared to untreated controls. CASA analysis was obtained every 30 seconds up to 90 seconds after treatment using purified motile sperm (2 x 10 processive sperm / mL). Figure 24B quantifies the percentage of aggregated sperm after Ab treatment at three different time points compared to before treatment using purified motile sperm (2 x 10 processive sperm / mL). The percentage of sperm aggregation of IgG and FFIFF is shown. Figure 24C quantifies the time required to achieve 90% aggregation of processive sperm using purified motile sperm (50 x 10 processive sperm / mL) compared to untreated controls. The aggregation kinetics of IgG and FFIFF are shown. CASA analyzes were obtained every 30 seconds up to 90 seconds after the procedure. Figure 24D quantifies the percentage of aggregated sperm after Ab treatment at three different time points compared to before treatment using purified motile sperm (50 x 10 processive sperm / mL). The percentage of sperm aggregation of IgG and FFIFF is shown. Data represent 6 unique sperm samples. Lines indicate arithmetic mean concentration and standard error of the mean. 1 is a graph showing the sperm agglutination titer of parental IgG, FIF, and FFIFF using whole semen in a sheep test. Agglutination titers of IgG, FIF and FFIFF were determined in vivo by intravaginally injecting Abs in sheep followed by injection of human semen to simulate sexual intercourse. Sperm motility was immediately assessed in fluid from the sheep vagina. Data represent three unique sheep trials for FIF and FFIFF and one sheep trial for IgG at both 33ug / ml and 333ug / ml. Lines indicate arithmetic mean concentration and standard error of the mean. Agglutination titers of exemplary films of parental IgG and FIF (e.g., films produced from Nicotiana sp.) using purified motile sperm (10 × 10 processive sperm / mL) and whole semen. show. Figure 26 shows the percentage of sperm maintaining forward motility after Ab treatment compared to pre-treatment condition using purified motile sperm (10 x 10 forward motile sperm / mL). Figure 2 shows the sperm agglutination titer of the parental IgG-film and FIF-film by quantifying the . Figure 27A shows the percentage of processive sperm that avoided aggregation after Ab treatment using purified motile sperm; data are normalized to the negative control. Using whole semen, we demonstrate sperm agglutination titers of parental IgG- and FIF-films by quantifying the percentage of sperm maintaining forward motility after Ab treatment compared to pre-treatment conditions. . The percentage of processive sperm that avoided aggregation (normalized to negative control) after Ab treatment using whole semen is shown. Data represent 6 unique sperm samples. Lines indicate arithmetic mean concentration and standard error of the mean. Aggregation kinetics of exemplary films of parental IgG and FIF (e.g., films produced from Nicotiana sp.) using purified motile sperm (10 × 10 forwardly motile sperm / mL) and whole semen. shows. Figure 28A shows the time required to achieve 90% aggregation of progressively motile sperm compared to untreated controls using purified motile sperm (10 x 106 progressively motile sperm / mL). Figure 3 shows the aggregation kinetics of the indicated antibodies by quantifying . CASA analysis was obtained every 30 seconds up to 90 seconds after the procedure. Figure 28B quantifies the percentage of aggregated sperm after Ab treatment at three different time points compared to before treatment using purified motile sperm (10 x 10 forward motile sperm / mL). The percentage of sperm agglutination for the indicated anti-sperm antibodies is shown. Figure 28C is a graph showing the aggregation kinetics of the indicated antibodies using whole semen and quantifying the time required to achieve 90% aggregation of processive sperm compared to untreated controls. be. CASA analysis was obtained every 30 seconds up to 90 seconds after the procedure. Figure 28D shows the measured percentage of sperm aggregation for the indicated anti-sperm antibodies (whole semen is used to quantify the percentage of aggregated sperm after Ab treatment at three different time points compared to before treatment). shows. Data represent 6 unique sperm samples. Lines indicate arithmetic mean concentration and standard error of the mean. Exemplary films of parental IgG and FIF (e.g., produced from Nicotiana sp. Figure 2 shows the aggregation kinetics of the film). Figure 29A shows the time required to achieve 90% aggregation of processive sperm compared to untreated controls using purified motile sperm (2 x 10 processively motile sperm / mL). Figure 3 shows the aggregation kinetics of the indicated antibodies based on quantification of . CASA analysis was obtained every 30 seconds up to 90 seconds after the procedure. Figure 29B quantifies the percentage of aggregated sperm after Ab treatment at three different time points compared to before treatment using purified motile sperm (2 x 10 forward motile sperm / mL). The percentage of sperm aggregation for the indicated anti-sperm antibodies as determined by chromatography is shown.Figure 29C shows the time required to achieve 90% aggregation of processive sperm compared to untreated controls using purified motile sperm (50 x 10 processively motile sperm / mL). Figure 3 shows the aggregation kinetics of the indicated antibodies by quantification. CASA analysis was obtained every 30 seconds up to 90 seconds after the procedure. Figure 29D quantifies the percentage of aggregated sperm after Ab treatment at three different time points compared to before treatment using purified motile sperm (50 x 10 forward motile sperm / mL) The percentage of sperm agglutination for the indicated anti-sperm antibodies is shown. Data represent 6 unique sperm samples. Lines indicate arithmetic mean concentration and standard error of the mean. Exemplary films of parental IgG and FIF in an acidic environment (e.g., produced from Nicotiana sp. Figure 2 shows the aggregation kinetics of the film. Aggregation kinetics of antibodies treated with lactic acid was assessed by quantifying the time required to achieve 90% aggregation of processive spermatozoa compared to untreated controls. CASA analysis was obtained every 30 seconds up to 90 seconds after the procedure. Data represent two unique sperm samples. NOTE: Antibodies treated with lactic acid (LA) were neutralized with seminal plasma (SP) and subsequently diluted with SP or saline medium or MHM. Post-spray characterization of FIF-film (Film of Fab-IgG-Fab synthetic binder) produced from Nicotiana sp. and FFIFF (e.g. Fab-Fab-IgG-Fab-Fab) synthetic binder produced from Expi293 shows. Figure 31A shows non-reduced SDS-Page analysis of the indicated antibodies before and after nebulization using a mesh nebulizer, and Figure 31B shows reduction of the indicated antibodies before and after nebulization using a mesh nebulizer. Showing SDS-Page analysis. In Figures 31C and 31D, whole-sperm ELISA analysis was used to evaluate the binding titer of FIF-film (shown in Figure 31A) and after spraying of FFIFF (Figure 31D). ELISA was performed in triplicate and repeated twice using the same donor sample. Lines indicate arithmetic mean concentration and standard error of the mean. Figure 2 shows the production and characterization of multimeric anti-RSV IgG antibodies. Figure 32A shows non-reducing gel and reducing SDS-Page analysis of multimeric IgG against RSV (motavizumab as the parent IgG) after expression in Expi293 cells and purification by protein A / G chromatography. Figure 32B is an RSV ELISA analysis to assess the binding titer of the indicated antibodies. Synagis / palivizumab (anti-RSV IgG1) is used as a positive control. ELISA was conducted in Mie. Methods and compositions described herein, including multimeric synthetic binding agents with multiple Fab repeats to increase aggregation, promote tethered growth, and / or improve mucus trapping is based, in part, on the finding that foreign bodies, including pathogens such as viruses and bacteria, and sperm, can be more strongly trapped by mucus after binding by multimeric antibody-based constructs. Constructs can be modified to impede penetration of targets (e.g., pathogens, sperm, etc.) through mucus by improving agglutination titers, promoting tethered growth of pathogens, and / or allowing mucus trapping. may be used to prevent and / or treat infection and / or provide contraception. The invention will be explained in more detail below. This description is not intended to be a detailed catalog of all the different ways in which the invention can be implemented, or all the features that can be added to the invention. For example, features described with respect to one implementation may be incorporated into other embodiments, and features described with respect to a particular implementation may be deleted from that implementation. Furthermore, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of this disclosure and do not depart from the invention. Therefore, the following specification is intended to describe some particular embodiments of the invention and is not intended to exhaustively identify all permutations, combinations, and variations thereof. It is expressly intended that the various features of the invention described herein may be used in any combination, unless the context dictates otherwise. Furthermore, the invention also contemplates that any feature or combination of features set forth herein may be excluded or omitted in some embodiments of the invention. By way of example, if the specification states that the complex includes components A, B, and C, any of A, B, or C, or any combination thereof, alone or in any combination, may be omitted and negated. is clearly intended to be obtained. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in describing the invention is for the purpose of describing particular embodiments only and is not intended to limit the invention. Unless otherwise indicated, standard methods known to those skilled in the art are used for the production of recombinant and synthetic polypeptides, antibodies or antigen-binding fragments thereof, manipulation of nucleic acid sequences, and production of transformed cells. can be used. Such techniques are known to those skilled in the art. For example, SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (Cold Spring Harbor, N.Y., 1989); F. M. AUSUBEL et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley&Sons, Inc., New York). All publications, patent applications, patents, nucleotide sequences, amino acid sequences, and other references mentioned herein are incorporated by reference in their entirety. As used in the description of this invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise. Ru. As used herein, "and / or" refers to any and all possible combinations of one or more of the listed items to which it pertains, as well as when interpreted as an alternative ("or"). Refers to the absence of combinations and includes them. Furthermore, the invention also contemplates that any feature or combination of features set forth herein may be excluded or omitted in some embodiments of the invention. The term "about" as used herein when referring to a measurable value, e.g., amount of a compound or agent of the invention, dosage, time, temperature, etc., refers to ±10%, ±10%, ±10% of the specified amount, etc. It is meant to encompass a variation of 5%, ±1%, ±0.5%, or even ±0.1%. Unless otherwise indicated, all numbers used in this specification and claims expressing properties such as amounts of ingredients, reaction conditions, etc. are modified in all cases by the term "about." should be understood. Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that may vary depending on the desired properties sought to be obtained by the subject matter disclosed herein. . Ranges, as used herein, can be expressed as from "about" one particular value, and / or to "about" another particular value. It is also understood that there are multiple values disclosed herein, and that each value is also disclosed herein as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. The transitional phrase "consisting essentially of" means that the scope of the claim extends from the defined materials or steps recited in the claim to the essential and novel features of the claimed invention (singular (or more than one) shall be construed as including those that do not materially affect. As used herein, the term "polypeptide" includes both peptides and proteins, unless otherwise specified. A "nucleic acid" or "nucleotide sequence" is a sequence of nucleotide bases, which may be RNA, DNA or a DNA-RNA hybrid sequence (including both naturally occurring and non-naturally occurring nucleotides), but preferably one Either stranded or double-stranded DNA sequences. As used herein, an "isolated" antibody refers to at least some other component of an organism or virus of natural origin, such as a component of a cellular structure or other component commonly found in association with the antibody. Refers to an antibody that is separated or substantially free from polypeptides or nucleic acids. The term also includes synthetically prepared antibodies. The terms "treat," "treating," or "treatment of" (or grammatical equivalents) mean that the severity of the condition in question is reduced or at least partially ameliorated or means that an improvement is achieved and / or that some alleviation, alleviation or reduction in at least one clinical symptom is achieved and / or that the progression of a condition is delayed. As used herein, the terms "prevent", "prevents" or "prevention" and "inhibit", "inhibits" or "inhi ``bition'' (and its grammatical equivalents) is not meant to imply complete disappearance of the disease, but rather to reduce the incidence of symptoms, delay the onset of symptoms, and / or reduce symptoms after onset. includes any type of prophylactic treatment that reduces the symptoms associated with. As used herein, an "effective," "prophylactically effective," or "therapeutically effective" amount is an amount sufficient to provide some improvement or benefit to a subject. Stated another way, an "effective," "prophylactically effective," or "therapeutically effective" amount is one that delays, alleviates, alleviates, or reduces at least one clinical symptom in a subject. is the amount provided. Those skilled in the art understand that the effect need not be complete or curative so long as some benefit is provided to the subject. The term "trapping titer" as used herein refers to the ability of an antibody to specifically bind to a target pathogen or sperm and inhibit the pathogen or sperm from moving through mucus. Trapping titer can be measured as disclosed herein by methods known in the art. The trapping titer is, for example, at least 50% (e.g., at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, etc.) of the pathogen or sperm within the mucus gel. Also, the amount of antibody required to reduce its native mobility in solutions (e.g., saline) and / or mucus by a factor of two (e.g., by a factor of 4, 10, etc.) For example, it can be quantified as the concentration of antibody in mucus). For spermatozoa, the trapping titer is defined as e.g. at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, etc.)) can also be quantified as the amount of antibody required to reduce (eg, the concentration of antibody in mucus). Mobility in mucus can be measured as described herein using techniques well known in the art. Alternatively, trapping titer can be quantified as the decrease in the percentage of pathogens or sperm passing through the mucus. The term "increase trapping titer" refers to an increase relative to core antibody (eg, core IgG). Furthermore, any multimeric synthetic binder with multiple Fab repeats described herein can be constructed using a biantennary co-glycan structure Manα1-6(Manα1-3)Manβ1-4GlcNAcβl- with terminal N-acetylglucosamine on each branch. Can be selected or further configured to increase mucin cross-linking by including a glycosylation pattern that includes 4G1cNAcβ1. This glycosylation pattern may be on the Fc region of the core Ab (eg core IgG). Alternatively or additionally, compositions of synthetic binders having multiple Fab repeats as described herein provide that at least x% of the synthetic binders having multiple Fab repeats have a terminal N -Biantennary co-glycan structure with acetylglucosamine Manα1-6(Manα1-3)Manβ1-4Glc may be selected or configured to have a glycosylation pattern comprising NAcβl-4G1cNAcβ1, where x% is 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% , 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or substantially all).For example, compositions in which more than 40% of the synthetic binders with multiple Fab repeats described herein also carry oligosaccharides that increase mucin cross-linking (to increase aggregation potency) , compared to the core IgG found naturally before any modification and / or selection, may be particularly beneficial with respect to mucus trapping of the target upon binding to the target. As used herein, the term "bind specifically" or "specifically binds" in reference to antibodies in the subject matter disclosed herein means that the antibodies of the invention It means binding to an epitope (including one or more epitopes) of a target pathogen or sperm, but not substantially binding to other unrelated epitopes or molecules. In certain embodiments, the term refers to at least about 60% binding to a target epitope as compared to binding to other unrelated epitopes or molecules, such as at least about 70%, 80%, 90%, or Refers to antibodies that show 95% binding. The antibodies, compositions, and methods described herein may include methods for inhibiting and / or treating pathogen infections, removing pathogens from mucosal surfaces, and providing contraception. In particular, the subject matter disclosed herein promotes aggregation and / or tethered growth of pathogens and sperm and traps pathogens and sperm within mucus, thereby allowing pathogens or sperm to traverse or pass through mucus secretions. Synthetic binding agents with multiple Fab repeats and compositions thereof that are capable of inhibiting migration, which may result in the destruction and / or natural elimination of these pathogens and / or spermatozoa. Any synthetic binding agent with multiple Fab repeats described herein is directed against a non-neutralizing epitope of a pathogen; in some variations, any synthetic binding agent with multiple Fab repeats described herein is directed against a non-neutralizing epitope of a pathogen; The binding agent is directed to a neutralizing epitope of the pathogen. Antibodies are naturally found in mucus. Synthetic binders with multiple Fab repeats described herein can generally diffuse rapidly through mucus and are only slightly slowed by weak transient adhesive interactions with mucin within the mucus. It will be. This rapid diffusion causes synthetic binders with multiple Fab repeats to rapidly accumulate on the surface of pathogens or sperm. When multiple synthetic binding agents accumulate on the surface of a pathogen or sperm, the adhesive interaction between multiple antibodies and the mucus is sufficient to trap the bound pathogen or sperm within the mucus, thereby preventing infection. Providing prevention / contraception. Moreover, somewhat surprisingly, binding multiple pathogens using the same synthetic binder with multiple Fab repeats is not possible either by aggregating separate pathogens / sperm together or by tethered multiplication of pathogens. complexes formed by multiple pathogens / sperm and synthetic binding agents may be more efficiently trapped. Pathogens or spermatozoa trapped within the CVM are unable to reach their target cells on the mucosal surface and are instead removed by postcoital excretion and / or are removed by naturally occurring thermal degradation and defensin release. (Cole, Curr. Top. Microbiol. Immunol. 306:199(2006); Doss et al., J. Leukoc. Biol. 87:79 (2010)). As disclosed herein, the agglutination and / or trapping activity of this pathogen provides protection without neutralization, at sub-neutralizing doses, and / or with antibodies against non-neutralizing epitopes of the pathogen. can be used to effectively inhibit infection. The low-affinity interactions that can be formed between synthetic binding agents with multiple Fab repeats described herein and mucins are not only Fc-dependent but can also be influenced by antibody glycosylation. . Accordingly, the synthetic binding agents with multiple Fab repeats described herein may include oligosaccharides at the glycosylation site, which are associated with (provide) high trapping titers of antibodies in mucus. comprising, consisting essentially of, or consisting of a pattern in which the antibody specifically binds to an epitope of a target (eg, a pathogen or sperm). The unique glycosylation pattern / unique oligosaccharide component of the antibody allows synthetic binding agents to be combined without unduly interfering with the ability of unconjugated synthetic binding agents to easily diffuse through mucus and rapidly bind to the target. The trapping potency of a synthetic binding agent may be maximized once the binding agent forms a complex with one or more targets (eg, a pathogen or sperm). In certain embodiments, the synthetic binding agents with multiple Fab repeats described herein have at most about 50% of their native mobility in solution (e.g., mucus, saline, or water), e.g. that is reduced no more than about 50%,e.g.,no more than about 40%,30%,20%,10%,or 5%,relative to its native mobility), exhibits mobility in mucus and can effectively target pathogens or sperm in mucus upon complexing with one or more targets. (e.g., at least 50% of the targets are at least on half slow). In some embodiments, a synthetic binding agent with multiple Fab repeats described herein comprises at least 50% of the target, e.g., at least 50%, 60%, 70%, 80%, or 90% of the target. % or more mobility than or more or less. In other embodiments, the synthetic binding agents with multiple Fab repeats described herein increase the percentage of targets (e.g., pathogens or sperm) that can pass through mucus by at least 10%, e.g., at least Decrease by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. For example, synthetic binders with multiple Fab repeats described herein may be less than 10 mg / ml (e.g., less than 5 mg / ml, less than 1 mg / ml, less than 0.1 mg / ml, less than 50 μg / ml, less than 30 Less than 20, less than 10, less than 5, less than 2.5 , less than 1, less than 0.5, less than 0.1 μg / ml, etc.), the target epitope will bind the target pathogen or sperm in the mucus within 1 hour (e.g., within 30 minutes or within 15 minutes). may have sufficient binding efficiency to trap. In some embodiments, a synthetic binding agent having multiple Fab repeats described herein provides an N-linked glycosylation site within the Fc region of the synthetic binding agent (e.g., the core IgG portion of the synthetic binding agent). may include an oligosaccharide component attached to. The N-linked glycosylation site may be an asparagine residue on the core Fc region, eg, the Asn297 asparagine residue. Amino acid numbers are with respect to the standard amino acid structure of human IgG molecules. The N-glycan structure may be in the G0 / G0F form, or in the pure GnGn form (eg, with terminal N-acetylglucosamine on each branch and no terminal galactose or sialic acid). In some embodiments, the oligosaccharide component, or glycan, added to the antibody comprises, consists essentially of, or consists of a core structure that does not include any fucose residues. In other embodiments, the glycan does not include any galactose residues. In some embodiments, the glycan does not include galactose. Synthetic binders with multiple Fab repeats described herein may include mixtures of synthetic binders with different oligosaccharide components. In some embodiments, the mixture comprises at least about 30%, e.g., at least about 40%, 50%, 60%, 70%, 80%, 90% or more G0 / G0F co-glycan structures (e.g. , with or without fucose residues) as described herein. In some embodiments, the synthetic binding agents with multiple Fab repeats described herein are derived from human cell lines, e.g., the 293 cell line, e.g., the 293T cell line, other mammalian cell lines (e.g., CHO). , plants (eg Nicotiana spp.), or other microorganisms (eg Trichoderma spp.). Synthetic binding agents with multiple Fab repeats described herein may be useful for binding to a target and trapping the target within mucus to inhibit infection or fertilization by the target. In variations where the target is a pathogen, the synthetic binding agents with multiple Fab repeats described herein can be directed to any pathogen capable of infecting a subject through mucus membranes. Pathogens may be within the categories of algae, bacteria, fungi, parasites (helminths, protozoa), viruses, and subviral agents. Target pathogens further include synthetic systems containing antigens with epitopes, such as particles or microparticles (eg polystyrene beads) containing attached proteins, such as those used in bioterrorism. Pathogens include, but are not limited to, those that cause sexually transmitted diseases (listed along with diseases caused by such pathogens); Neisseria gonorrhoeae (gonorrhea); Chlamydia trachomatis (Chlamydia, venereal lymphogranulomatosis); syphilis Treponema (syphilis); Haemophilus ducreyi (chancre); Klebsiella granuloma granulomatis) or granuloma Callimatobacterium (inguinal lymphogranulomatosis), Mycoplasma genitalium, Ureaplasma urealyticum (Mycoplasma); Human immunodeficiency viruses HIV-1 and HIV-2 (HIV, AIDS); HTLV-1 ( T lymphotropic virus type 1); herpes simplex virus type 1 and Type 2 (HSV-1 and HSV-2); Epstein-Barr virus; cytomegalovirus; human herpesvirus 6; varicella-zoster virus; human papillomavirus (genital warts); hepatitis A virus, hepatitis B virus , hepatitis C virus (viral hepatitis); molluscum contagiosum virus (MCV); Trichomonas vaginalis vaginalis) (trichomoniasis); and yeasts, such as Candida albicans (vulvar candidiasis). The antibodies and compositions are also active against other diseases transmitted by contact with body fluids (and can also be transmitted by sexual contact) that can be prevented by administration of the compositions according to the invention. could be.The phrase "sexually transmitted disease (STD)" is therefore interpreted herein to include any disease that can be transmitted in the route of sexual contact, whether the site of pathology occurring is the reproductive tract or not. should be done. Pathogens also include those that cause respiratory illnesses, including, but not limited to, influenza (including influenza A, B, and C); severe acute respiratory syndrome (SARS); respiratory syncytial virus (RSV); parainfluenza. including adenoviruses; human rhinoviruses; coronaviruses; and noroviruses. Other pathogens include, but are not limited to, Salmonella and E. coli. Other pathogens include Klebsiella bacilli. Pathogens can be caused by non-human animals such as livestock, such as pigs (e.g., porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), rotavirus, swine fever virus (CSFV), porcine circovirus type 2 ( PCV2 ), encephalomyocarditis virus (EMCV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine parvovirus (PPV), pseudorabies virus (PRV), Japanese encephalitis virus (JEV), Brucella, Leptospira, Salmonella , and Lawsonia intracellularis, Pasteurella multocida, Brachyspira hyodysenteriae, Mycoplasma hyopneumoniae), ruminants (e.g., bovine viral diarrhea virus (BVDV), boda disease virus (BDV), bovine papulostomatitis virus (BPSV), pseudocowpox virus (PCPV), Pasteurella haemolytica, Pasteurella multocida, Haemophilus somnus, Haemophilus agni (Haemophilus agnii), Moraxella bovis, Mycoplasma mycoides, Theileria annulata, Mycobacterium avium paratuberculosis)), ungulates (e.g. Brucella abortus, Mycobacterium bovis, Theileria parva, Rift Valley fever virus, foot and mouth disease virus, lumpy skin disease virus), horses (e.g. Rhodococcus equi, Salmonella choleresuis, Pasteurella multocida, equine herpesvirus-1, cormorant herpesvirus-4, equine influenza virus, Streptococcus equi), poultry (e.g., fowlpox virus, Newcastle disease virus, Marek's disease virus, avian influenza virus, infectious bursal disease virus (IBDV), avian infectious bronchus may include those that affect the virus (IBV), etc. The terms "virus and viral pathogen" are used interchangeably herein and further refer to various viral strains, e.g., influenza includes new strains of influenza that can be readily identified by one of ordinary skill in the art. is included. The terms "bacterium, bacteria, and bacterial pathogen" are used interchangeably herein and further refer to antibiotic-resistant or multidrug-resistant strains of bacterial pathogens. The term "antibiotic-resistant strain" or "multidrug-resistant strain" as used herein when referring to a bacterial pathogen is used in the art to treat a bacterial pathogen (i.e., a non-resistant strain of a bacterial pathogen). Refers to bacterial pathogens that can resist the effects of antibiotics or drugs. In some embodiments, the synthetic binding agents with multiple Fab repeats described herein bind broadly to viruses that contain a lipid envelope (not necessarily specific to one virus). is considered possible. In variations where the synthetic binding agents with multiple Fab repeats described herein specifically bind to neutralizing epitopes of the target pathogen, sub-neutralizing doses may be used. A sub-neutralizing dose is a dose less than that required to achieve effective neutralization. For example, for polyclonal anti-HSV gG antibodies targeting HSV, as described herein below, the effective neutralizing dose is approximately 5 μg / ml. However, effective aggregation and / or trapping using the synthetic binders with multiple Fab repeats described herein can be achieved at doses lower than 5 μg / ml and even lower than 1 μg / ml. Even doses can be achieved. As will be understood by those skilled in the art, doses suitable for aggregating and / or trapping bacterial pathogens may be higher in some embodiments than doses suitable for trapping viral pathogens. Furthermore, it is understood that appropriate doses may vary between pathogens, mucosal surfaces, and even between individuals. It is also understood that different subjects and different mucosal surfaces may have different optimal glycan patterns and optimal antibody-mucin affinities, contributing to different optimal doses. It has been demonstrated herein that target pathogens can be effectively trapped in mucus using synthetic binding agents having multiple Fab repeats described herein that selectively bind to non-neutralizing epitopes of target pathogens. Further suggestions are made in the book. Thus, in some embodiments, a synthetic binding agent having multiple Fab repeats specifically binds a non-neutralizing epitope, eg, one or more non-neutralizing epitopes. The subject matter disclosed herein further includes synthetic binding agents having multiple Fab repeats that selectively bind to conserved epitopes of a target. The advantage of targeting conserved epitopes is that the efficacy of synthetic binders with multiple Fab repeats is maintained against new strains of pathogens. Targeting of such epitopes was previously avoided as they were considered to be ineffective targets, but in view of the disclosure herein, such epitopes may act as effective targets. You can. Synthetic binding agents with multiple Fab repeats described herein may be particularly useful for binding to and trapping sperm in mucus and inhibiting fertilization of eggs by sperm. Sperm-specific antigens that can be used as antibody targets are well known in the art. See, e.g., U.S. Patent No. 8,211,666; U.S. Patent No. 8,137,918; U.S. Patent No. 8,110,668; U.S. Patent No. 8,012,932; Invoked by. As described herein, one particular epitope region for human sperm may include the N-linked glycans of the sperm CD52 glycoform. See also US Patent Nos. 5,227,160 and 6,355,235, each of which is incorporated herein by reference in its entirety. The low affinity binding interactions that synthetic binders with multiple Fab repeats described herein form with mucins can be influenced by glycosylation and can also be Fc-dependent. Thus, synthetic binding agents with multiple Fab repeats described herein may have conserved and / or modified Fc regions within the core IgG region. Such synthetic binding agents may be of one or more subclasses of IgG, such as IgG1, IgG2, IgG3, IgG4, or any combination thereof. In some embodiments, synthetic binding agents having multiple Fab repeats described herein are less than about 10 mg / mL (e.g., less than about 5 mg / mL, less than 2 mg / mL, less than about 1 mg / mL, about Less than 0.1mg / mL, less than about 50μg / ml, less than about 40μg / ml, less than about 30μg / ml, less than about 20μg / ml, less than about 10μg / ml, about 5μ 1 hour after administration of a synthetic binding agent having multiple Fab repeats as described herein at a concentration of less than about 1 μg / ml, less than about 1 μg / ml, less than about 0.5 μg / ml, less than about 0.1 μg / ml, etc. have sufficient binding rate and / or binding affinity for the epitope of the target to cause it to accumulate on the surface of the target at a level sufficient to trap the target. The term "trapping" in this case refers to a reduction in further movement through the mucus. In some embodiments, the target (e.g., pathogen or sperm) is isolated within about 30 minutes, e.g., about 25, 20, 15 minutes after administration of a synthetic binding agent having multiple Fab repeats as described herein. , can be trapped within 10, 5 or 1 minute. In some embodiments, the synthetic binding agent is about 5 mg / ml, 2.5 mg / ml, 1 mg / ml, 100 μg / ml, 50 μg / ml, 10 μg / ml, 5 μg / ml, 4 μg / ml, 3 μg / ml, Trap targets at synthetic binder concentrations of 2 μg / ml, or less than 1 μg / ml. Although the following discussion is presented as a general overview of techniques available for producing synthetic binders with multiple Fab repeats, those skilled in the art will recognize that many variations to the following methods are known. are. The term "antibody" or "antibodies" as used herein refers to all types of immunoglobulins, including IgG, IgM, IgA, IgD, and IgE. Antibodies may be monoclonal or polyclonal, may be of any species origin, including (for example) mouse, rat, rabbit, horse, goat, sheep, camel, or human, or may be chimeric or humanized. It's fine. See, eg, Walker et al., Molec. Immunol. 26:403 (1989). The antibody may be a recombinant monoclonal antibody produced according to the methods disclosed in U.S. Patent No. 4,474,893 or U.S. Patent No. 4,816,567; the antibody may also be chemically constructed according to the method disclosed in U.S. Patent No. 4,676,980. good. Antibody fragments included within the scope of the invention include, for example, Fab, Fab', F(ab)2, and Fv fragments; domain antibodies, diabodies; nanobodies; vaccibodies, linear includes antibodies; single chain antibody molecules (scFv); and multispecific antibodies formed from multiple antibody fragments. Such fragments can be produced by known techniques. For example, F(ab')2 fragments can be produced by pepsin digestion of antibody molecules, and Fab fragments can be produced by reducing the disulfide bridges of F(ab')2 fragments. Alternatively, construction of Fab expression libraries allows for the rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse et al., Science 254:1275 (1989)).In some embodiments, the term "antibody fragment" as used herein may include any protein construct capable of binding a target. Antibodies comprising core Abs that form part of the synthetic binding agents with multiple Fab repeats described herein may be humanized or camelized. Humanized forms of non-human (e.g. mulin) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (e.g. Fv, Fab, Fab', F(ab ')2 or other antigen-binding subsequence of the antibody). Humanized antibodies are human immunoglobulins (recipient antibodies) in which residues from the recipient's complementarity determining regions (CDRs) have the desired specificity, affinity, and potency, such as mouse, rat, or rabbit antibodies. Includes those substituted with residues from CDRs of non-human species (donor antibody). In some cases, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may contain residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody comprises substantially all of at least one, and typically two, variable domains, wherein all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin; All or substantially all of the framework (FR) regions (ie, the sequences between the CDR regions) are of the human immunoglobulin consensus sequence. Humanized antibodies optimally also include at least a portion of an immunoglobulin constant region (Fe), typically that of a human immunoglobulin (Jones et al., Nature 321:522 (1986); Riechmann et al. ,Nature,332:323(1988);and Presta,Curr.Op.Struct.Biol.2:593(1992)). Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced from a source that is non-human. These non-human amino acid residues are often referred to as "import" residues, and they are typically obtained from "import" variable domains. Humanization is essentially the method of Winter and coworkers (Jones et al., Nature 321:522 (1986); Riechmann et al., Nature 332:323 (1988); Verhoeyen et al., Science 239:1534 (1988)) by substituting the rodent CDRs or CDR sequences with respect to the corresponding sequences of the human antibody. Such "humanized" antibodies are therefore chimeric antibodies (US Pat. No. 4,816,567), in which substantially less than intact human variable domains have been replaced by corresponding sequences from a non-human species. In practice, humanized antibodies typically have some CDR residues (e.g., all CDRs or portions thereof) and possibly some FR residues derived from similar sites in rodent antibodies. A human antibody that has been substituted with a group. The human antibodies and synthetic binding agents with multiple Fab repeats based on human or humanized IgG described herein can be obtained from phage display libraries (Hoogenboom and Winter, J. Mol. Biol. 227:381 (1991); They can also be produced using a variety of techniques known in the art, including Marks et al., J. Mol. Biol. 222:581 (1991)). The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol. 147:86 (1991)). Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, such as mice, in which endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, the production of human antibodies is observed, which closely resembles that seen in humans in all respects, including gene rearrangements, assembly, and antibody repertoire. This approach has been demonstrated, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 368:856(1994);Morrison,Nature 368:812(1994);Fishwild et al.,Nature Biotechnol.14:845(1996);Neuberger,Nature Biotechnol.14:826(1996);Lonberg and Huszar, Intern. Rev. Immunol. 13:65 (1995). Immunogens (antigens) are used to produce antibodies that specifically react with a target polypeptide. For example, recombinant or synthetic polypeptides and peptides of at least 5 (eg, at least 7 or 10) amino acids or longer are preferred immunogens for producing monoclonal or polyclonal antibodies. In one embodiment, immunogenic polypeptide conjugates are also included as immunogens. Peptides are used in either pure, partially pure, or impure form. Suitable polypeptides and epitopes for target pathogens and sperm are well known in the art. Polynucleotide and polypeptide sequences are available in public sequence databases such as GENBANK® / GENPEPT®. A number of neutralizing and non-neutralizing antibodies that specifically bind target pathogens and spermatozoa have been described in the art and can be used as starting materials for preparing antibodies of the invention. Alternatively, novel antibodies are generated against the target pathogen and sperm using techniques described herein and well known in the art. Recombinant polypeptides are expressed in eukaryotic or prokaryotic cells and purified using standard techniques. The polypeptide, or synthetic version thereof, is then injected into an animal capable of producing antibodies. Either monoclonal or polyclonal antibodies can be produced for subsequent use in immunoassays to measure the presence and amount of polypeptides. Methods of producing polyclonal antibodies are known to those skilled in the art. Briefly, an immunogen, e.g., a purified or synthetic peptide, a peptide linked to a suitable carrier (e.g., glutathione-S-transferase, keyhole limpet hemanocyanin, etc.), or a recombinant vaccinia virus. The peptide incorporated into such an immunization vector is optionally mixed with an adjuvant and the mixture is used to immunize the animal. The animal's immune response to the immunogen preparation is monitored by test bleeding to determine the titer of reactivity to the peptide of interest. When suitably high titers of antibodies against the immunogen are obtained, blood is taken from the animal and antiserum is prepared. If desired, further fractionation of the antiserum is performed to enrich it for antibodies reactive with the peptide. For example, antibodies against the polypeptide (its binding fragments and single chain recombinant versions thereof) can be generated by immunizing an animal with an immunogenic conjugate comprising the polypeptide covalently linked (conjugated) to a carrier protein as described above. ) is produced. Typically, the immunogen of interest is a polypeptide of at least about 10 amino acids, in another embodiment the polypeptide is at least about 20 amino acids long, and in another embodiment the fragment is at least about 30 amino acids long. It is the length. For example, the polypeptide may include 1-200 amino acid residues from the N-terminus of the papillomavirus L2 protein. Immunogenic conjugates are typically prepared by linking the polypeptide to a carrier protein (eg, as a fusion protein), or alternatively, expressed recombinantly in an immunization vector. Monoclonal antibodies are prepared from cells that secrete the desired antibody. These antibodies are screened for binding to normal or modified peptides, or screened for agonist or antagonist activity. Specific monoclonal and polyclonal antibodies typically bind with a KD of at least about 50mM, such as at least about 1mM, such as at least about 0.1mM, or better. In some cases, it is desirable to prepare monoclonal antibodies from a variety of mammalian hosts, such as mice, rodents, primates, humans, and the like. A description of techniques for preparing such monoclonal antibodies can be found in Kohler and Milstein 1975 Nature 256:495-497. Briefly summarized, the method is carried out by injecting an immunogen, such as an immunogenic peptide (alone or optionally linked to a carrier protein), into an animal. The animal is then sacrificed and cells obtained from its spleen and fused with myeloma cells. The result is a hybrid cell or "hybridoma" that can be reproduced in vitro. The population of hybridomas is then screened to isolate individual clones, each of which secretes a single antibody species against the immunogen. In this way, the individual antibody species obtained are derived from immortalized and cloned single B cells from immunized animals produced in response to recognized specific sites on the immunogenic substance. It is a product. Other methods of immortalization include transformation with Epstein-Barr virus, oncogenes, or retroviruses, or other methods known in the art. Colonies produced from a single immortalized cell are screened for production of antibodies of desired specificity and affinity for the antigen, and the yield of monoclonal antibodies produced by such cells is (mammalian) hosts by a variety of techniques including intraperitoneal injection.Polypeptides and antibodies of the invention may be used with or without modification, including chimeric antibodies, such as humanized mulin antibodies. Other suitable techniques include selection of libraries of recombinant antibodies in phage or similar vectors. See Huse et al. 1989 Science 246:1275-1281; and Ward et al. 1989 Nature 341:544-546. Antibodies specific for target polypeptides can also be obtained by phage display technology known in the art. Synthetic binding agents with multiple Fab repeats described herein can be labeled by covalently or non-covalently attaching a substance that provides a detectable signal. A wide variety of labels and conjugation techniques are known and widely reported in both the scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like. Synthetic binding agents with multiple Fab repeats described herein can be useful for detecting or diagnosing the presence of targets where antigens are found. Methods for making synthetic binding agents with multiple Fab repeats described herein with a desired glycosylation pattern can be accomplished by any method known to those skilled in the art. For example, in some embodiments, mammalian cells such as Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK) cells, and NS0- and SP2 / 0-mouse myeloma cells are used to perform the desired glycosylation. Antibodies with patterns can be produced. In certain embodiments, human cell lines such as 293 cells can be used. In some embodiments, non-mammalian cells can be used. Cell lines can be genetically modified to produce antibodies with the desired oligosaccharides. Such cell lines may have altered expression of one or more enzymes that affect glycosylation patterns, such as glycosyltransferases. Glycosyltransferases include, but are not limited to, galactosyltransferase, fucosyltransferase, glucosyltransferase, N-acetylgalactosaminyltransferase, N-acetylglucosaminyltransferase , glucuronic acid transferase, sialyltransferase, mannosyltransferase, glucuronic acid transferase, galacturonic acid transferase, oligosaccharyltransferase, or any combination thereof. Specific examples include, without limitation, oligosaccharyltransferase, UDP-N-acetyl-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase, GDP-fucose protein: O-fucosyltransferase 1, GDP-fucose protein: O-fucosyltransferase 2, protein protein: O-glucosyltransferase, UDP-N-acetylglucosamine: peptide N-acetylglucosaminyl transferase, protein: O-mannosyltransferase, β1,4 galactosyltransferase, and any combination thereof. Enzymes involved in protein glycosylation are well known in the art and can be manipulated using routine techniques. See, e.g., U.S. Pat. Referenced in the book. In other embodiments, glycans can be synthesized in specific patterns and linked to synthetic binding agents having multiple Fab repeats as described herein. In a further embodiment, synthetic binding agents having multiple Fab repeats described herein with mixed glycosylation patterns can be separated to isolate antibodies with the desired glycosylation pattern. As one of skill in the art will appreciate, the synthetic binding agents with multiple Fab repeats described herein may be suitable for composition, e.g., to act as a contraceptive and / or to target pathogens. It can also be formed into a pharmaceutical composition for administration to a subject to treat or prevent a disease or disorder resulting from infection caused by or infection by a target pathogen. The composition may comprise, consist essentially of, or may consist of a prophylactically or therapeutically effective amount of a synthetic binding agent having multiple Fab repeats as described herein and a pharmaceutically acceptable carrier. It may consist of Pharmaceutical compositions containing synthetic binders with multiple Fab repeats as described herein can be prepared using conventional materials for this purpose, such as saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation may be formulated in combination with any suitable pharmaceutical vehicle, excipient or carrier commonly used in the art, including. As one of skill in the art will recognize, the particular vehicle, excipient or carrier used will vary depending on the subject and the subject's condition, and various modes of administration may be used to treat multiple Fab repeats as described herein. is suitable for compositions of synthetic binders with Suitable methods of administration of any pharmaceutical composition disclosed in this application include, but are not limited to, topical, oral, intranasal, buccal, inhalation, anal, and vaginal administration; such administration Enables delivery of antibodies to mucus membranes. The composition may be of any type suitable for delivering the synthetic binding agents with multiple Fab repeats described herein to mucosal surfaces, and may be in solid, semi-solid, or liquid form. or in a variety of forms known in the art, including the form of lotions (oil-in-water or water-in-oil emulsions) in aqueous gel compositions. The compositions include, but are not limited to, gels, pastes, suppositories, douches, ovules, foams, films, sprays, ointments, pessaries, capsules, tablets, jellies, creams, milks, dispersions, liposomes, powders / talc or other solids, suspensions, solutions, emulsions, microemulsions, nanoemulsions, liquids, aerosols, microcapsules, time-release capsules, controlled-release formulations, sustained-release formulations or bioadhesive gels (e.g., mucoadhesive heat-sensitive gelling compositions), or antibodies to the surface being applied or contacted. including any other form embedded within a matrix for delayed or controlled release of. If topical administration is desired, the compositions may be formulated as appropriate in a suitable form, e.g., ointments, creams, gels, lotions, drops (e.g., eye and ear drops), or solutions (e.g., mouthwashes). It's fine. The compositions may include conventional additives, such as preservatives, solvents to promote permeability, and emollients. Topical formulations may include conventional carriers such as cream or ointment bases, ethanol, or oleyl alcohol. Other formulations for administration are contemplated for use in connection with the subject matter disclosed herein, including intranasal administration and the like. Delivering a synthetic binding agent having multiple Fab repeats as described herein or a composition comprising a synthetic binding agent having multiple Fab repeats as described herein to one or more mucus membranes of a subject. All formulations, devices, and methods known to those skilled in the art that are suitable for use can be used in connection with the subject matter disclosed herein. Any composition described herein may include mixtures of synthetic binders with multiple Fab repeats described herein, including mixtures with different numbers of Fab repeats (e.g., some have 4 Fab repeats, some have 6 Fab repeats, etc.). The compositions used in the methods described herein may inhibit the components of the compositions, including antibodies, antimicrobials, and / or sperm function inhibitors, and / or have a negative effect on contraceptive effectiveness or other may contain other drugs that do not affect the For example, solid, liquid, or mixed solid and liquid pharmaceutically acceptable carriers, diluents, vehicles, or excipients can be used in the pharmaceutical compositions. Suitable physiologically acceptable, substantially inert carriers include water, polyethylene glycol, mineral oil or petrolatum, propylene glycol, hydroxyethyl cellulose, carboxymethyl cellulose, cellulose derivatives, polycarboxylic acids, bound polyacrylic acids, e.g. and other polymers such as poly(lysine), poly (glutamic acid), poly(maleic acid), polylactic acid), thermal polyaspartates, and aliphatic-aromatic resins; glycerin, starch, lactose, calcium sulfate dihydrate, terra alba, sucrose, talc, gelatin, pectin, Contains acacia, magnesium stearate, stearic acid, syrup, peanut oil, olive oil, saline, etc. Pharmaceutical compositions described herein useful in the methods of the invention include diluents, fillers, binders, colorants, stabilizers, fragrances, gelling agents, antioxidants, humectants, preservatives, It may further include acids and other elements known to those skilled in the art. For example, suitable preservatives are well known in the art and include, for example, methylparaben, propylparaben, butylparaben, benzoic acid and benzyl alcohol. For injection, carriers are typically sterile pyrogen-free water, pyrogen-free phosphate-buffered saline, bacteriostatic water, or Cremophor EL® (BASF, Parsippany, N.J.). Yes, it can be a liquid. For other methods of administration, the carrier can be either solid or liquid. For oral administration, the synthetic binders with multiple Fab repeats described herein can be administered in solid dosage forms such as capsules, tablets, and powders, or as elixirs, syrups, and suspensions. It can be administered in a liquid dosage form. The compositions contain inert ingredients and powdered carriers such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcan, magnesium carbonate, etc. in a gelatin capsule. May be enclosed together. Examples of additional inert ingredients that may be added to provide desirable color, taste, stability, buffering capacity, dispersibility or other known desirable characteristics are red iron oxide, silica gel, sodium lauryl sulfate, titanium dioxide. , edible white ink, etc. Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of time.Compressed tablets may be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration may contain color and flavor to increase acceptance by the patient. Compositions suitable for buccal (sublingual) administration include tablets or lozenges containing the antibody in a flavored base, usually sucrose and acacia or tragacanth; and gelatin and glycerin or sucrose and acacia. Included are lozenges containing the antibody within an inert base. Compositions may include orally dissolvable or degradable compositions. Alternatively, the composition may include a powder or an aerosolized or atomized solution or suspension containing the antibody. Such powdered, aerosolized, or atomized compositions, when dispersed, preferably have an average particle or droplet size within the range of about 0.1 to about 200 nanometers. Compositions of synthetic binders with multiple Fab repeats described herein suitable for parenteral administration include sterile aqueous and non-aqueous injections of synthetic binders with multiple Fab repeats described herein. Preferably, the preparation is isotonic with the blood of the intended recipient. These preparations may contain antioxidants, buffers, bacteriostatic agents, and solutes that render the composition isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions may contain suspending agents and thickening agents. The compositions may be presented in unit / dose or multi-dose containers, such as sealed ampoules and vials, to which a sterile liquid carrier, such as saline or water for injection, may be added immediately before use (freeze-dried). It can be stored in a lyophilized state. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets of the kind previously described. For example, in one aspect, a stable sterile injectable composition is provided that includes a synthetic binding agent having multiple Fab repeats as described herein in a sealed container in unit dosage form. The synthetic binding agents with multiple Fab repeats described herein can be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for its injection into a subject. It can be provided in the form of a lyophilizate. Compositions suitable for rectal administration may be presented as unit dose suppositories. These are prepared by mixing a synthetic binder with multiple Fab repeats as described herein with one or more conventional solid carriers, such as cocoa butter, and then shaping the resulting mixture. You can. Synthetic binding agents with multiple Fab repeats described herein may alternatively be formulated for intranasal administration or otherwise administered to the lungs of a subject by any suitable means. and administered by, for example, an aerosol suspension of respirable particles containing a synthetic binding agent having multiple Fab repeats as described herein that is inhaled by a subject. Respirable particles may be liquid or solid. The term "aerosol" includes any gas-borne suspended phase that can be inhaled into the bronchioles or nasal passages. In particular, an aerosol comprises a suspension of droplets with a gas that can be produced in a metered dose inhaler or nebulizer, or in a mist nebulizer. Aerosols also include dry powder compositions suspended in air or other carrier gas, which can be delivered by inhalation of gas from, for example, an inhaler device. Ganderton & Jones, Drug Delivery to the Respiratory Tract, Ellis Harwood (1987); Gonda (1990) Critical Reviews in Therapeutic Drug Carrier Systems 6:273-313; and Raeburn et al., J.Pharmacol.Toxicol.Meth.27:143 (1992). Aerosols of liquid particles containing synthetic binders with multiple Fab repeats as described herein can be prepared by any suitable means, such as a pressure-driven aerosol nebulizer or an ultrasonic nebulizer known to those skilled in the art. can be produced by. See, eg, US Patent No. 4,501,729. Solid particulate aerosols containing synthetic binders with multiple Fab repeats as described herein can similarly be produced using any solid particulate drug aerosol generator by techniques known in the pharmaceutical art. . Alternatively, the synthetic binding agents with multiple Fab repeats described herein can be administered locally rather than in a systemic manner, eg, in a depot or sustained release formulation. A synthetic binder having multiple Fab repeats as described herein may be coated or impregnated onto a device (or containing a synthetic binder having multiple Fab repeats as described herein). composition may be coated or impregnated). The device may be for delivering synthetic binders having multiple Fab repeats and compositions of synthetic binders described herein to mucous membranes, such as the vagina or uterus. In one embodiment, the device includes a solid support adapted for insertion into the vagina. The support may be impregnated or coated with a composition of synthetic binders having multiple Fab repeats as described herein. Release of synthetic binders from devices can be controlled by the materials from which these devices are constructed, such as silicone elastomers, ethylene vinyl acetate, and polyurethane polymers. Devices such as uterovaginal and rectal devices include, without limitation, rings, rods, applicators, sponges, cervical caps, tampons, pessaries, or intrauterine devices. The applicator may be one currently used commercially to deliver spermicidal gels or anti-yeast compounds, including, without limitation, plunger-type applicators, pessaries, nebulizers, squeeze tubes, vaginal rings. , cervical rings, sponges, etc. All such means for delivery are intended to be encompassed by this invention. As described herein, the synthetic binding agents with multiple Fab repeats described herein can diffuse through mucus when unbound and target (e.g., pathogens or sperm) It is possible to bind a synthetic binder having multiple Fab repeats to a desired proportion. When the synthetic binding agents with multiple Fab repeats described herein bind to the target, the cumulative effect of antibody-mucin interactions effectively traps pathogens or sperm in the mucus and / or , it is also desirable to aggregate the target. To facilitate this objective, in some embodiments it may be desirable to provide a composition comprising more than one synthetic binder having multiple Fab repeats as described herein, Here, each synthetic binding agent specifically binds to a different epitope of the pathogen or sperm. Such compositions may provide the ability for many synthetic binding agents with multiple Fab repeats to bind to pathogens or sperm, thereby creating antibodies-mucin that act to trap pathogens or sperm in the mucus. The interaction becomes stronger. In some embodiments, the composition comprises a first synthetic binder having a plurality of Fab repeats as described herein and a second synthetic binder having a plurality of Fab repeats as described herein. including here wherein the first synthetic binding agent specifically binds to a first epitope of the target, and the second binding agent specifically binds to a second epitope of the target, where the first epitope is different from the second epitope. In certain embodiments, the composition comprises three or more different synthetic binders having a plurality of Fab repeats as described herein, e.g., 3, 4, having a plurality of Fab repeats as described herein. It includes 5, 6, 7, 8, 9, 10, or more different synthetic binding agents, where each synthetic binding agent specifically binds to a different epitope of the target. It would also be desirable to provide compositions that can provide treatment or prevention of infections caused by more than one target pathogen. In some embodiments of the subject matter disclosed herein, the composition comprises a first synthetic binding agent having a plurality of Fab repeats and a second synthetic binding agent having a plurality of Fab repeats, wherein the first synthetic binding agent has a plurality of Fab repeats; One synthetic binding agent specifically binds to an epitope of a first target pathogen, and a second synthetic binding agent specifically binds to an epitope of a second target pathogen. In certain embodiments, the composition comprises three or more different synthetic binders with multiple Fab repeats, e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more different synthetic binders. binding agents, where each synthetic binding agent specifically binds to a different target epitope. As mentioned above, in some variations, the targets may be the same, but synthetic binding agents with multiple Fab repeats may have different numbers of Fab repeats. In other embodiments, the composition provides both contraception and treatment or prevention of infection by one or more target pathogens. In some embodiments, the composition comprises a first synthetic binding agent with multiple Fab repeats and a second synthetic binding agent with multiple Fab repeats, wherein the first synthetic binding agent is sperm and the second synthetic binding agent specifically binds to an epitope of the target pathogen. In certain embodiments, the composition comprises three or more different synthetic binders with multiple Fab repeats as described herein, e.g., 3, 4, 5, 6, 7, 8 with multiple Fab repeats. , contains 9, 10, or more different synthetic binders, and here , one or more synthetic binding agents with multiple Fab repeats bind to different epitopes in sperm, and one or more synthetic binding agents with multiple Fab repeats bind to one target pathogen or multiple targets. Binds specifically to epitopes of pathogens. In some embodiments, the pharmaceutical composition may further include additional active agents, such as prophylactic or therapeutic agents. For example, the additional active agent may be an antimicrobial agent as known to those skilled in the art. Antimicrobial agents may be active against algae, bacteria, fungi, parasites (helminths, protozoa), viruses, and subviral agents. Thus, the antimicrobial agent may be an antibacterial, antifungal, antiviral, antiparasitic, or antiprotozoal agent. Antimicrobial agents are preferably active against infectious diseases.Suitable antiviral agents include, for example, virus inactivators such as nonionic, anionic and cationic surfactants, and C31 G (amine oxides and alkyl betaines), polybiguanides, docosanol, acylcarnitine analogs, octyl Contains glycerol and antimicrobial peptides such as megainin, gramicidin, protegrin, and retrocycline. Mild surfactants, such as sorbitan monolaurate, may be advantageously used as antiviral agents in the compositions described herein. Other antiviral agents that may be advantageously used in the compositions described herein include nucleotide or nucleoside analogs such as tenofovir, acyclovir, amantadine, didanosine, foscarnet, ganciclovir, ribavirin, vidarabine, zalcitabine, and zidovudine. Including. Additional antiviral agents that may be used include non-nucleoside reverse transcriptase inhibitors such as UC-781 (thiocarboxyanilide), pyridinones, TIBO, nevaripine, delavirdine, calanolide A, capavirine and efavirenz. From these reverse transcriptase inhibitors, drugs and their analogs that have been shown to have low oral bioavailability, in combination with the antibodies and compositions of the present invention, for the prevention of sexual transmission of HIV. It is particularly suitable for administration to mucosal tissues. Other antiviral agents that may be used are those in the category of HIV entry blockers, such as cyanovirin-N, cyclodextrins, carregeenans, sulfated or sulfonated polymers. -, mandelic acid-enriched polymers, monoclonal antibodies, chemokine receptor antagonists such as TAK-779, SCH-C / D, and AMD-3100, and fusion inhibitors such as T-20 and 1249. Suitable antibacterial agents include antibiotics, such as aminoglycosides, cephalosporins (including first, second and third generation cephalosporins); erythromycin, penicillins (natural penicillins, penicillinase-resistant Macrolides, including sulfonamides, tetracyclines, fluoroquinolones, metronidazole, and urinary tract preservatives. Suitable antifungal agents include amphotericin B, nystatin, griseofulvin, flucytosine, fluconazole, potassium iodide, intraconazole, clotrimazole, miconazole, ketoconazole, and tolnaftate. Suitable antiprotozoal agents include antimalarials, such as chloroquine, primaquine, pyrimethamine, quinine, fansidar, and mefloquine; antiamoebic drugs, such as dioloxamide, emetine, iodoquinol, metronidazole, paromomycin and quinacrine; pentamidine Contains isethionate, atovaquone, and eflornithine. In certain embodiments, the additional active agent is a sperm function inhibitor, e.g., capable of inhibiting sperm function, otherwise inhibiting fertilization of an egg by a sperm, and / or otherwise For example, it may be an agent that has the ability to prevent pregnancy by killing and / or functionally inactivating sperm or by other effects on sperm activity. In some embodiments, the active agent may have at least dual function, such as acting as a sperm function inhibitor and an antimicrobial agent. Sperm function inhibitors include surfactants, including, without limitation, nonionic surfactants, cationic surfactants, and anionic surfactants; spermicides, such as nonoxynol-9 (α-(4- nonylphenyl)-ω-hydroxynona(oxyethylene); other sperm inactivating factors, e.g. sulfuric acid modified or sulfonated polymers such as polystyrene sulfonic acid, mandelic acid enriched polymers, cyclodextrins; antimicrobial peptides such as gramicidins, megainins, indolicidin, and melittin; and acid buffer compositions such as BufferGel and AcidFor. Nonionic surfactants include, for example, sorbitan monolaurate, nonylphenoxypolyethoxyethanol, p-diisobutyphenoxypolyethoxyethanol, polyoxyethylene (10) oleyl ether. and onyx-ol. Suitable anionic surfactants include, without limitation, sodium alkylsulfonates and sodium alkylbenzenesulfonates.Cationic surfactants include, for example, quaternary ammonium surfactants. For example, cetylpyrimidinium chloride (cetylpyrimidinium chloride) pyrimidinium) and benzalkonium chloride, such as acylcarnitine analogs and C31G, are particularly suitable for the subject matter disclosed herein due to their mild skin and mucosal irritation properties. Synthetic binders with multiple Fab repeats as described in or herein In some embodiments, the kit may further include a composition comprising a synthetic binding agent having multiple Fab repeats as described; and a device for administering the synthetic binding agent or composition. The kit comprises a plurality of synthetic binding agents having multiple Fab repeats and / or compositions containing such synthetic binding agents. In some embodiments, each of the plurality of synthetic binding agents provided in such a kit can specifically bind to a different epitope of the target, e.g., a pathogen or sperm. In other embodiments, multiple Fab repeats as described herein are provided in such kits. Each of the number of synthetic binding agents can specifically bind to a different target pathogen epitope or sperm epitope. In some embodiments, the kit includes an additional active agent, e.g. an antimicrobial agent such as an antibiotic. , antiviral agents, or other antibacterial agents, or sperm function inhibitors known to those skilled in the art. Synthetic Binding Agents with Multiple Fab Repeats In general, the synthetic binding agents with multiple Fab repeats described herein may include a core IgG directed to a target epitope. Synthetic binding agents with multiple Fab repeats can be constructed by linking multiple additional copies identical (or identical parts) to the Fab domain of the IgG core. In some embodiments, the additional Fab may not be identical to the Fab domain of the IgG core, but still binds the same epitope. Additional copies may be added to the amino and / or carboxyl termini of the IgG core. This is illustrated schematically in Figures 1A to 1G. Additionally, the core IgG contains an Fc region that may be glycosylated in a pattern that increases mucus trapping, e.g. in the G0 glycosylated form (or compositions containing synthetic binding agents with multiple Fab repeats may be (can be selected to enrich glycosylation). For example, FIGS. 1A to 1E show different multimeric constructs ("synthetic binders with multiple Fab repeats") that can be produced and characterized, and aggregation and mucus trapping potencies measured. For example, one or more constructs with the highest potency may be used in combination. Figure IA shows an example of a core IgG containing a pair of Fab and Fc regions. As shown in Figures 1B-1E, identical Fab regions are combined in pairs (e.g., 2 additional, 4 additional, 6 additional, 8 additional, 10 additional, etc.) in the core IgG to form a synthetic binding agent with multiple Fab repeats. Synthetic binders for contraception with multiple Fab repeats There is strong unmet demand for non-hormonal contraceptives: According to the CDC, nearly half of the approximately 30 million women ages 20 to 35 in the United States Requires a form of reversible contraception (eg, pill, IUD, condom, ring, etc.). Although socio-social issues undoubtedly contribute to the limited understanding and adherence to common contraceptive methods; nevertheless, a great deal of research has shown that alternative contraceptive methods, especially non-hormonal The need for options is also shown. Most women begin with hormonal contraceptives, which are readily available and highly effective. However, many women are naturally reluctant to use exogenous hormones despite counseling. More than half of women (mostly 3 to 6 (within 1 month), emphasizing the need for non-hormonal contraception. Also, both oral and IUD-based hormonal contraception frequently result in intermenstrual "spotting" (light bleeding in the week before a period). While this may be seen as a simple inconvenience in Western society, many women / couples find it extremely unpleasant. Spotting can significantly limit the use of hormonal contraception among certain populations, as men touching women's menstrual blood can be a significant taboo for religious reasons (e.g., Muslims and Orthodox Jews). The synthetic binding agents with multiple Fab repeats described herein may be non-hormonal contraceptives that can block sperm from passing through mucus. The main effector functions for Abs in mucus are to inhibit the forward movement of foreign substances such as viruses and highly motile bacteria and to block them from reaching target cells. This functionality can be achieved in two ways. First, if foreign bodies frequently collide due to high concentrations of foreign entities, Abs can bridge two or more foreign bodies together, resulting in a hydrodynamic It produces not only an increase in diameter, but also, more importantly, an effective neutralization of the net forward motion of swimming bodies. This process is commonly referred to as aggregation (see, e.g., Figure 3A). Second, when collisions between foreign bodies are relatively rare because the concentration of the foreign substance is not large, Abs can bind foreign bodies through multiple Fc-mucin bonds. Immobilization can be achieved by direct cross-linking to the mucin matrix present within mucus (see, eg, Figure 3B).This process is referred to herein as mucus trapping, and the affinity between each Ab molecule and mucin is far too weak to effectively bind individual foreign bodies to mucin. This process remained widely unrecognized, as it was thought that Antigen-specific IgG administered vaginally can trap the virus in the mucus by forming multiple weakly adhesive bonds between the virus and the mucin mesh (Velcro with individually weak hooks). (Same as the registered trademark patch). IgG-mediated trapping effectively reduced the flux of virus reaching target cells and directly blocked vaginal herpes transmission in mice. Sperm concentration varies widely within the female reproductive system, with maximum concentrations in the semen immediately after ejaculation and lower concentrations in more distal sites such as the cervix. Therefore, an ideal human contraceptive Ab (HCA, i.e., an Ab molecule that can block sperm penetration through mucus and prevent sperm from reaching the egg) would be able to prevent sperm from aggregating and / or trapping in mucus. should be used. Multivalent Ig such as sIgA and IgM are significantly more potent aggregation agents than IgG (IgM is approximately 1000 times more potent in aggregation than IgG). Unfortunately, large-scale production of IgM or sIgA remains extremely challenging, with IgG representing the predominant isotype of Abs under clinical development. However, using IgG may be beneficial. Synthetic conjugates with multiple Fab repeats have higher agglutination titers than current monomeric IgG1-based HCAs (see e.g. JPS638400A) by creating multimeric HCAs that can more strongly aggregate spermatozoa. Agents are described herein. Accordingly, multimeric HCA constructs (eg, synthetic binders with multiple Fab repeats) with high aggregation potency are described herein. These synthetic binding agents may include Fabs derived from human IgM, which bind to a unique antigen (CD52g) that is restricted only to sperm and cells within the male reproductive system and is thought to be universal to all men. (See, eg, Norton et al., Tissue Antigens 2002, 60:354-364, August 14, 2002). This Fab can serve as the basis for HCA molecules (eg, synthetic binding agents). As mentioned above, different synthetic binding agents with multiple Fab repeat constructs can be formed from Fab domains of increased valency compared to traditional IgG while maintaining their original mucus-trapping potency ( may be formed,comprised of). Different synthetic binding agents may include Fab-IgG, IgG-Fab, Fab-IgG-Fab, and Fab-IgG-Fab-Fab; core IgG may be used as a control. See Figures 1A-1G above. All of these synthetic binder constructs were analyzed by (i) ELISA and biolayer interferometry for antigen affinity, (ii) gel electrophoresis and SEC to assess further Fab domain incorporation, and (iii) conventional Expression and activity studies were performed, including verification of the ability to purify different HCA constructs using Protein A / G columns. Described herein are synthetic binding agents with multiple Fab repeats that can be formed as described above with respect to FIGS. 1A-1G. For example, in FIG. 1A, the core antibody may be an IgG form of the HCA-UNC antibody that targets CD52g glycans, as described in more detail below. In some variations, a synthetic binder containing multiple Fab repeats includes a core IgG and a set of Fab repeats attached to the amino terminus, as shown in Figure 1B, or to the carboxyl terminus, as shown in Figure 1C. Contains an additional copy of Fab (copied from the IgG core). In some variations, additional Fab copies are shown in Figure 1D (additional Fab copies at both the amino and carboxyl termini) and Figure 1E (2 additional Fab copies at the amino terminus and 4 additional Fab copies at the carboxyl terminus). It is added to either or both of the amino terminus and / or carboxyl terminus so that Figure 1G shows examples of these structures. The attached sequence listing provides example sequences for each of these five structures. For example, SEQ ID NO: 9 is an exemplary list of full-length Fab-IgG heavy chain portions, and SEQ ID NO: 13 is the corresponding full-length Fab-IgG light chain amino acid sequence. Similarly, SEQ ID NO: 15 and SEQ ID NO: 19 show examples of the heavy and light chain amino acid sequences, respectively, of an IgG-Fab synthetic binder with multiple Fab repeats. SEQ ID NO: 21 and SEQ ID NO: 25 show examples of the heavy chain and light chain amino acid sequences, respectively, of a Fab-IgG-Fab synthetic binder with multiple Fab repeats. Additionally, SEQ ID NO: 27 and SEQ ID NO: 31 show examples of the amino acid sequences of the heavy chain and light chain, respectively, of a Fab-IgG-Fab-Fab synthetic binder with multiple Fab repeats. These various synthetic binders with multiple Fab repeats were tested against each other and against core IgG (eg, encoded by the amino acid sequences of SEQ ID NO: 3 and SEQ ID NO: 7). These synthetic binders were also tested against single chain variable fragment (scFv) moieties or camel-derived Nanobodies. Multimeric Ab constructs based on scFvs often suffer from low stability, heterogeneous expression, and reduced affinity and specificity due to removal of the CH1 / CL interface present in full-length Fabs ( Figure 9). In contrast, synthetic binders containing multiple Fab repeats exhibit higher aggregation potential compared to HCA-UNC targeting the same antigen. These synthetic binders with multiple Fab repeats have increased valency, span, and directional separation (in opposite directions) of the Fabs. Because all Fabs bind the same target epitope and have essentially the same amino acids, synthetic binding agents are typical for creating multimeric bispecific antibodies that target two separate epitopes. The use of scFv-based designs is not limited by incorrect heavy and light chain pairings. Instead, these multimeric Ab constructs (synthetic binders with multiple Fab repeats) link the entire Fab domain to the IgG. These Fab-based HCA constructs offer improved stability and manufacturability, conserved binding affinity for specific epitopes, and conserved Fc-mucin affinity compared to scFv-based constructs. Possible. For example, initial studies using Fab-IgG (a form of synthetic binder with multiple Fab repeats) showed that analytical size exclusion chromatography results after single-step protein A purification were compared to IgG (bottom), scFv -IgG (middle) As shown in Figure 10 for , and Fab-IgG (top), these molecules can be assembled using industry standard techniques while avoiding the formation of aggregates commonly seen in scFv-based multimeric constructs. It was shown that the protein can be expressed and purified using the following methods. Both IgG and Fab-IgG formats show a single sharp peak at their expected molecular weight, while scFv-IgG shows the formation of high molecular weight aggregates. Therefore, synthetic binding agents with multiple Fab repeats can be used in IgG-based HCAs for contraception. At least 10 times more IgG than IgA was present in the CVM, suggesting that IgG is the mAb of choice for vaginal protection in humans. Undiluted physiological human genital secretions were used in ex vivo testing of sperm and STI trapping of multiple synthetic binders containing Fab repeats targeting the CD52g epitope. We observed sperm trapping in fresh, minimally perturbed ex vivo samples of CVM and CM, confirming that our observations reflected physiological conditions as closely as possible. Synthetic binding agents with multiple Fab repeats (eg, Fab-IgG, IgG-Fab, Fab-IgG-Fab) configured as multimeric HCA constructs were created using standard cloning methods. Briefly, a gene encoding the HCA VH / VL domain and a flexible linker (GSSSS×3 (SEQ ID NO: 32)) was synthesized to in-house HCA The constructs were expressed by transient expression in 30 mL cultures of Expi293 cells and the corresponding HCA constructs were purified using protein-A affinity chromatography. Purity was verified by (Figure 11A; Note: We used in-house IgG HCA and IgG independently prepared by Mapp Biopharmaceutical We also performed size exclusion chromatography / multi-angle light scattering (SEC / MALS) on each multimeric HCA construct to confirm uniform expression of the desired antibody constructs (Fig. 11B) In all examples, the constructs were produced in high yield with minimal (<10%) aggregation. A synthetic binding agent with multiple Fab repeats organized as multimeric HCA binds to and aggregates sperm. Multimeric HCA was first shown to bind to sperm. Whole sperm ELISA assays were performed using equimolar amounts of each construct (1.5 nM), followed by anti-Fc Our pilot assay showed that each of the multimeric constructs tested (Fab-IgG, IgG-Fab, Fab-IgG-Fab) was not superior to native IgG. demonstrated to have comparable, if not comparable, binding to sperm. (FIG. 12A), showing that a novel HCA construct (a synthetic binder containing multiple Fab repeats directed against CD52g) is indeed able to bind to spermatozoa and mediate aggregation. To further validate the IgG-Fab We mixed HCA and PBS in semen and imaged the distribution of cells in semen 1 minute later, and found that IgG-Fab HCA strongly aggregated cells (Figures 12B to 12C). shows the PBS control and Figure 12C shows the aggregation caused by a synthetic binder with multiple Fab repeats (IgG-Fab) for CD52g after 1 min, as quantified by the fraction of forward motile sperm. show.Mucus trapping was demonstrated using an IgG-Fab construct. The synthetic binder with multiple Fab domains maintains its mucus-trapping potency, as confirmed by microscopy testing with anti-HER2 showed that it was possible to immobilize PEG-coated nanoparticles (PS-PEG). The anti-PEG Fab portion is functional and binds the antigen of interest (PEG), and the IgG-Fab structure maintains sufficient mucus affinity to trap virus-sized particles in the mucus. This is illustrated in FIG. PS-PEG in native CVM (no Ab) and CVM treated with control IgG-Fab (anti-HER2 × anti-VSVG) were both only several times slower than their theoretical rate in pure water. , showed rapid spread. In contrast, addition of PEG-conjugated IgG-Fab to CVM resulted in extensive trapping of PS-PEG, with the fraction of mobile particles decreasing from 71% to only 3% and mucoadhesive coating. It was comparable to nanoparticles (PS-COOH) that were not treated. The extent of trapping was similar to levels we previously showed using native anti-PEG IgG. These results highlight the potential of IgG-Fab and other synthetic binding agents with multiple Fabs to facilitate trapping foreign bodies within mucus, including viruses, bacteria and sperm. Sperm trapping and aggregation observed within fresh, minimally perturbed ex vivo samples of CVM and CM provides evidence of physiological plausibility. As discussed herein, the aggregation potential of native IgG1 HCA (e.g., IgG-UNC) was demonstrated in various synthetic binders with multiple Fab repeats directed against epitopes of CD52g. . HCA constructs with different multivalencies (ie, number of Fab domains per molecule) were constructed and tested as shown in Figures 1B-1F. Preliminary results show that higher agglutination titers are achieved by increasing the number of CD52g-binding Fab domains along the IgG backbone and that our Fab-IgG-Fab-Fab and Fab-Fab- We suggest that aggregation titers comparable to native IgM molecules can be achieved using IgG-Fab-Fab constructs. Evaluation of both Fab-IgG and IgG-Fab formats (differing only in the position of the attached Fab fragments) has shown that geometrical orientation and sterics (particularly of the Fab) in sperm aggregation and trapping titers Provides further information regarding the importance of separation of Fabs, or "spanning" ability. By using whole Fab domains rather than scFvs, we expect that the multimeric HCA construct will maintain stability and that each Fab domain will possess equally high affinity for the CD52g antigen. We expect HCA constructs with identical Fc-N-glycan profiles to native IgG molecules to possess comparable mucus trapping potency. Using the baseline IgG1 HCA construct, additional identical Fab domains for CD52g were incorporated at different positions along the heavy chain. The heavy and light chain gene sequences for each of the IgG control antibodies and Fab-based multimeric antibodies can be codon-optimized, synthesized, and cloned into mammalian expression vectors (Integrated DNA Technologies). . For each format, the Fab-component is a flexible peptide linker (e.g., a flexible linker comprising an amino acid sequence containing n pentapeptide repeats consisting of glycine (G) and serine (S), where n is 3 to 8 may be separated by amino acids, such as the six repeating units of GSSSS (SEQ ID NO: 33), GGGGS (SEQ ID NO: 34), etc.). During cloning validation, small batches (30-60 mL) of each HCA construct are expressed by transient transfection in Expi293 mammalian cells. After 3 days of cell growth, various HCA constructs are purified from the culture supernatant by protein A affinity chromatography. Expression yield was quantified by BCA assay using human IgG as standard using absorbance at 280 nm, and purified products were subjected to SDS-PAGE electrophoresis under both reducing and non-reducing conditions for purity. It is evaluated using Correct assembly, thermal stability and binding kinetics for each multimeric HCA format can be verified; for example, correct assembly can be determined by molecular weight assessment by size exclusion chromatography / multi-angle light scattering (Wyatt et al. DAWN HELEOS II; e.g., see Figure 10). Thermal stability (Tm) can be measured using a differential scanning calorimeter (MicroCal VP-DSC; see Figure 9). Antibodies that express and purify less than 95% of the correctly assembled product, or that are destabilized at >10°C from the parent sequence, are not further tested unless optimized. Different HCA mAbs may be quantified using whole sperm ELISA. First, high-affinity 96-well half-area plates (Thermo Scientific, Rockford, IL) were prepared using 50 uL of 106 / ml sperm per well (measured using a cytometer) overnight at 4°C. Can be coated. Wash plates three times with 0.05% Tween in PBS (PBS-T), block with 5% milk for at least 1 hour, and incubate for at least 2 hours with serial dilutions of each HCA mAb. After three PBS-T washes, plates are incubated for 1 hour with F(ab')2 anti-human IgG Fc(goat)-HRP conjugate (709-1317; Rockland, Gilbertsville, PA). Develop HRP-conjugated IgG using 1-step Ultra TMB substrate (Thermo Scientific, Rockford, IL) for 15 minutes, followed by quenching with 2N sulfuric acid. Measure absorbance at 450 nm using a BioTek Synergy 2 plate reader. Binding kinetics to sperm were also assessed by biolayer interferometry (Octet Red384) using an anti-hIgG Fc capture biosensor immersed in TritonX-100-treated sperm lysate (which serves as the source of HCA antigen). be done. We expect HCA to be structurally intact and stable and to bind to spermatozoa. The synthetic binding agents with multiple Fab repeats described herein are obtained from fully human Abs derived from immunoinfertile but otherwise healthy women (Isojim et al.). Epitopes may include glycosylated structures; antibodies such as H6-3C4 may specifically recognize poly-n-acetyllactosamine regions (e.g., repeating poly-n-acetyllactosaminyl structures); , can bind to the internal stretch of N-acetyllactosamine and, unlike antibodies against blood group I, are not affected by terminal sialylation. This glycoform (called CD52g) is thought to be specific for cells of male origin (eg sperm). The Fab can therefore bind to this CD52g (see SEQ ID NO: 1) glycoprotein, which is unique to the male reproductive tract and is present on the surface of all spermatozoa and other cells in the seminal fluid. CD52g shares a short peptide backbone with leukocyte CD52, but HCA-UNC, used as a core IgG, does not bind to CD52 and lines the lumen of the epididymis, vas deferens, and seminal vesicles ( lining) binds only to a unique form of CD52g that is produced and secreted only by epithelial cells. CD52g contains a glycosylphosphatidylinositol (GPI) anchor and translocates to the cell membrane of sperm during maturation in the epididymis. As shown in Figures 8A-8B, HCA also co-aggregates leukocytes within the semen; these cells become latently HIV-infected 'trojans' that can act as motile vectors for HIV transmission. ``Horse leukocytes,'' implying that HCA may also confer some protection against cell-mediated infections. The WHO-supported anti-sperm vaccine workshop has identified CD52g due to its unique expression in the male reproductive system, strong antigenicity, and its ability to induce infertility in otherwise healthy individuals. It has been identified as a promising contraceptive vaccine candidate. Importantly, this HCA target appears to be ubiquitous in men: we analyzed fresh semen samples from 100 men (73% Caucasian, 26% African American, and 1% Asian). All samples tested showed that >90% of the spermatozoa were agglutinated within seconds by the original HCA. Synthetic binding agents with multiple Fab repeats described herein can be produced in CHO cells, Nicotiana plants, and Trichoderma (for the latter two, engineered plants containing the human glycosylation pathway or yeast It is possible to create a fully human mAb, such as ZMapp in Nicotiana). The total dose of a synthetic binding agent with multiple Fab repeats (e.g., HCA) for contraception can be about 20-80 mg, e.g., to maintain about 400 μg / mL HCA in the CVM for 28 days. . In the synthetic binders with multiple Fab repeats described herein, the delivered concentration is substantially higher, e.g. by improving the aggregation titer by just 10-fold over HCA-UNC. It can be lowered. These synthetic binders with multiple Fab repeats were then tested to measure sperm aggregation and trapping titers in vitro. Sperm aggregation and trapping potency was tested for different synthetic binders with multiple Fab repeats (referred to as HCA constructs in this example). Using fresh human vaginal mucus (CVM) and interphase endocervical mucus (CM), we measured real-time mobility for thousands of individual sperm cells in mucus treated with different HCA constructs. We determined the exact extent to which sperm mobility and mobile fractions in mucus decrease over time due to aggregation and mucus trapping.The ovine vaginal model can further be used to assess the potency of HCAs to reduce freely motile sperm by aggregating and / or trapping human sperm in vaginal mucus. The anatomy of the sheep vagina is similar to the human vagina and is the most available animal model for preclinical evaluation of vaginal products. To test potential in vivo efficacy, aggregation and trapping of fresh human semen in sheep vaginas can be evaluated at different times after semen administration, for example 2 minutes after deposition. Sperm must swim through mucus to reach the egg. In some infertile women with no other known reason for infertility, Abs that bind to the surface of living sperm and block them from passing through the mucus have been isolated, and of the naturally occurring Abs, IgM provided the most potent combination of aggregation and trapping (e.g., Isojima et al., “Establishment and characterization of a human hybridoma secreting monoclonal antibody with high titers of sperm immobilizing and agglutinating activities against human seminal plasma.” J Reprod Immunol,1987.10(1):p.67-78;and Tsuji et al.,“Human sperm carbohydrate antigens defined by an antisperm human monoclonal antibody derived from an infertile woman bearing antisperm antibodies in her serum.”J Exp Med,1988.168( 1):p.343-56.PMCID:2188971). In good agreement with human studies, animal studies have also shown that IgG, sIgA and IgM binding to vaginal sperm can provide contraception. This natural mechanism of infertility can be used to design synthetic binding agents with multiple Fab repeats that enable non-hormonal contraception. A fully human called HCA-UNC (or “HCA Original”) that binds to a well-validated and well-characterized antigenic target that is ubiquitously present only on the surface of sperm and cells within the male reproductive system. The mAb was used to form a synthetic binding agent core IgG containing multiple Fab repeats for use as a contraceptive. A multimeric HCA construct (eg, a synthetic binder with multiple Fab repeats) was constructed with multiple Fab domains linked to a parent IgG molecule. The overall goal was to possess an IgM-like agglutination titer, yet be suitable for industrial IgG purification processes, e.g. using Protein A / G, to be cost-effective and highly sought after by women around the world. The aim is to create HCAs that enable potent, local, non-hormonal contraception through HCAs, which is needed in the United States. Antibodies can bind to antigens on the sperm surface in the context of immune infertility. Immunoinfertility refers to a wide range of immune mechanisms that can contribute to infertility and can be mediated by a variety of antibodies including anti-phospholipid, anti-thyroid and anti-sperm antibodies (ASA). ASA refers to a broad range of antibodies that can bind to any sperm-associated antigen. The majority of naturally occurring ASA binds to cytoplasmic antigens that are only accessible after sperm death and are therefore irrelevant for contraception. However, some Abs isolated from women who are immunoinfertile can cause infertility without directly blocking sperm-egg interactions, including the IgM isolated from infertile women by Isojima. molecules (which serve as the basis for our current HCA). HCA-UNC, which can be used as the basis for the synthetic binding agents with multiple Fab repeats described herein, binds to accessible surface antigens that are unique to sperm and cells within the male reproductive system, and in the mucus of spermatozoa. By aggregating and / or fixing the sperm, sperm can be prevented from reaching the egg. Indeed, increased barrier function conferred by sperm-bound Abs in the mucus is part of the reason why sperm motility in CM is often measured in clinical evaluations of infertility. Other ASAs may form the basis for other HCAs (eg, core IgG) using the principles described herein. HCAs delivered vaginally have the potential to provide highly effective and safe contraception. Sperm must swim through mucus to reach and fertilize the egg. Not surprisingly, low sperm motility in cervical mucus generally correlates well with infertility, and sperm motility in mucus remains the gold standard test for diagnosing infertility. By extension, blocking sperm motility in the mucus by directly reducing the number of sperm that reach the egg through antibodies that can aggregate and immobilize individual sperm in the mucus may be an effective contraceptive. It should provide a similar format. Indeed, such sperm-binding Abs have been isolated from the vaginal secretions of infertile women. These sperm-bound Abs (IgG, IgA or IgM) are actively transported in the cervical mucus without interfering with the apparatus of sperm motility (sperm coated with Abs swim freely in the buffer). Studies have shown that they can trap motile sperm and that the trapped sperm will oscillate in place within the mucus for hours before dying. This "shaking phenomenon" has been, and continues to be, a standard clinical diagnosis for the causes of infertility in humans, and local delivery of sperm-bound Abs is highly effective and highly effective in vivo. Reduces egg fertilization by at least 95% in a highly fertile rabbit model. The female reproductive system is covered with a much smaller volume of mucus (approximately 1-2 mL) than the volume of circulating blood (approximately 5,000 mL). Thus, by delivering HCA locally, contraceptive concentrations can be achieved with much lower amounts of HCA than with systemic delivery. mAbs delivered vaginally are poorly absorbed into the systemic circulation, further reducing the amount of HCA needed to maintain contraceptive levels in the female reproductive system. HCA delivered intravaginally is very unlikely to cause systemic toxicity because: HCA is a fully human IgG; HCA is less likely to be absorbed into the systemic circulation. , the vagina is poorly responsive to immunization, and HCA's target antigens are found exclusively within cells from the male reproductive system and are absent in females. Very limited systemic uptake may result in a satisfactory safety profile for HCA. Vaginal secretions possess very low complement activity and have very few, if any, viable white blood cells due to the continuous acidification of the vagina to approximately pH 4 by lactic acid from commensal lactic acid bacteria. (white blood cells are effectively immobilized or killed at pH<6). Therefore, HCA is less likely to cause toxicity or inflammation in local vaginal tissues and remains effective at vaginal pH, especially when delivered in doses lower than the total IgG present within the CVM. Weak and transient mucin binding with synthetic binders containing multiple Fab repeats may allow the synthetic binders to diffuse freely most of the time in the mucus and rapidly accumulate on pathogens. As a result, the array of bound Abs on the Ab / pathogen complex can form a sufficient number of weak cross-links with the mucin mesh to trap the pathogen with durable binding. The interaction between IgG and mucin is thought to occur through N-glycans on IgG-Fc. IgG can be utilized to trap even highly motile bacterial pathogens, allowing pathogen trapping in different mucus secretions (including those from the respiratory tract as well as the GI and female reproductive systems), making it a universal mucosal agent. Highlights pathogen trapping by IgG-mucin affinity as a protective mechanism. Our multimeric HCA construct maintains mucus trapping titer compared to IgG and effectively immobilizes individual sperm in mucus. Example of a Release Device: Intravaginal Ring FIGS. 6A-6C illustrate a capsule-IVR (intravaginal ring) system that can be used with the synthetic binders with multiple Fab repeats described herein. This delivery device uses a conventional pill process to manufacture a capsule that can be implanted within the IVR to facilitate sustained release of the synthetic binder. In FIG. 6A, the device is a ring that can be placed intravaginally (eg, in the uterus) and a plurality of time-release capsules (FIG. 6B) can be carried therein. Capsules maintain structural stability of synthetic binders with multiple Fab repeats for at least 4 weeks when immersed in human CVM at 37 °C (CVM replaced every 3-4 days) It was shown that This is illustrated in Figure 6C, which shows both daily and cumulative release over a month. Release rates can be easily adjusted over a wide range of release rates over 28 days, including as low as 0.1-0.3 mg / day (Figure 4C; Formulation D). Capsules may be formulated to provide a higher release rate during the 2-6 day window (Formulation A & B); such that a larger dose of HCA is delivered just before the fertility window. may be desirable. Synthetic binding agents containing multiple Fab repeats configured as HCAs described herein are not only non-hormonal but also economically viable and daily or enable reliable and safe contraceptive products that do not require coitally-associated administration. Example: Sequences Synthetic binding agents described herein typically include multiple additional copies of the Fab region, as described above. As described above in Figures 1A-1G, these synthetic binding agents may be arranged in a variety of different configurations of the core IgG (including Fc and Fab domains), where duplicate copies of the Fab domain (core IgG (directed to the same target epitope as the Fab domain above) are added to either or both the NH2 and / or COOH terminus. Any Fab domain may be used and may be linked at the amino or carboxyl terminus via a flexible linker comprising an amino acid sequence containing an n-pentapeptide repeat consisting of glycine (G) and serine (S); Here, n is 3 to 8.As an example, a synthetic binding agent may be directed to the N-linked glycan of a sperm-specific epitope called the CD52 glycoform (“CD52g”). SEQ ID NO: 1 shows an example of an amino acid sequence corresponding to CD52g (see, eg, Diekman et al., FASEB Journal, vol. 13:1303-1313, August 1999). Any antibody variable domain (heavy and / or light chain) directed against a protein containing this sequence can be used and constructed as a synthetic binding agent as described herein. Exemplary synthetic binding agents set forth by SEQ ID NOs: 2-31 represent examples of antibodies directed against sperm-specific epitopes. For example, synthetic binding agents directed against sperm-specific epitopes, such as CD52g (eg, the n-glycosylated form of CD52), include both heavy and light chains. SEQ ID NO: 2 is an exemplary DNA sequence for the heavy chain domain of a core IgG directed to an epitope of CD52g, and SEQ ID NO: 3 is an exemplary amino acid sequence for the heavy chain portion of an IgG. SEQ ID NO: 4 is an example of an amino acid sequence of a Fab fragment for a heavy chain. SEQ ID NO: 5 is an example of the amino acid sequence of a heavy chain Fc fragment. SEQ ID NO: 6 is an example of an exemplary DNA sequence for the light chain domain of core IgG directed to an epitope of CD52g. SEQ ID NO: 7 is an example of an amino acid sequence of a core IgG light chain domain directed to an epitope of CD52g. SEQ ID NO: 8 to SEQ ID NO: 13 are heavy chains of synthetic binding agents (e.g., recombinant mAbs) that can reduce sperm mobility in mucus, with structures similar to those shown in Figure 1B (e.g., Fab-IgG). and exemplary DNA and amino acid sequences for the light chain portion. SEQ ID NO: 8 is an exemplary DNA sequence for the heavy chain domain of a Fab-IgG synthetic binding agent directed to an epitope of CD52g, and SEQ ID NO: 9 is an exemplary amino acid sequence for the heavy chain portion of Fab-IgG. SEQ ID NO: 10 is an example of an amino acid sequence of a Fab fragment for the heavy chain of a synthetic binder containing Fab extending from the N-terminus of a core IgG. SEQ ID NO: 11 is an example of the amino acid sequence of a heavy chain Fc fragment. SEQ ID NO: 12 is an example of an exemplary DNA sequence for the light chain domain of core IgG directed to an epitope of CD52g. SEQ ID NO: 13 is an example of the amino acid sequence of the light chain domain of a synthetic binding agent comprising a Fab extending from the N-terminus of a core IgG directed against an epitope of CD52g. SEQ ID NO: 14 to SEQ ID NO: 19 are heavy chains of synthetic binding agents (e.g., recombinant mAbs) that can reduce sperm mobility in mucus, with structures similar to those shown in Figure 1C (e.g., IgG-Fab). and exemplary DNA and amino acid sequences for the light chain portion. SEQ ID NO: 14 is an exemplary DNA sequence for the heavy chain domain of an IgG-Fab synthetic binder directed to an epitope of CD52g, and SEQ ID NO: 15 is an exemplary amino acid sequence for the heavy chain portion of such an IgG-Fab. It is. SEQ ID NO: 16 is an example of an amino acid sequence of a Fab fragment for the heavy chain of a synthetic binder containing Fab extending from the N-terminus of a core IgG. SEQ ID NO: 17 is an example of the amino acid sequence of a heavy chain Fc fragment. SEQ ID NO: 18 is an example of an exemplary DNA sequence for a light chain domain directed to an epitope of CD52g. SEQ ID NO: 19 is an example of the amino acid sequence of the light chain domain of a synthetic binding agent directed to an epitope of CD52g. SEQ ID NO: 20 to SEQ ID NO: 25 are synthetic binding agents (e.g., recombinant mAbs) that can reduce sperm mobility in mucus that have a structure similar to that shown in Figure 1D (e.g., Fab-IgG-Fab). Exemplary DNA and amino acid sequences for heavy and light chain portions are shown. SEQ ID NO: 20 is an exemplary DNA sequence for the heavy chain domain of a Fab-IgG-Fab synthetic binding agent directed to an epitope of CD52g, and SEQ ID NO: 21 is for the heavy chain portion of such a Fab-IgG-Fab. This is an example of an amino acid sequence. SEQ ID NO: 22 is an example of an amino acid sequence of a Fab fragment for the heavy chain of a synthetic binder directed to an epitope of CD52g. SEQ ID NO: 23 is an example of the amino acid sequence of a heavy chain Fc fragment of a synthetic binding agent directed to an epitope of CD52g. SEQ ID NO: 24 is an example of an exemplary DNA sequence for a light chain domain directed to an epitope of CD52g. SEQ ID NO: 25 is an example of an amino acid sequence of a light chain domain of a synthetic binding agent directed to an epitope of CD52g. SEQ ID NO: 26 to SEQ ID NO: 31 are synthetic binding agents (e.g., recombinant mAbs) that can reduce sperm mobility in mucus with a structure similar to that shown in Figure 1E (e.g., Fab-IgG-Fab-Fab). ) shows exemplary DNA and amino acid sequences for the heavy and light chain portions of . SEQ ID NO: 26 is an exemplary DNA sequence for the heavy chain domain of a Fab-IgG-Fab-Fab synthetic binder directed to an epitope of CD52g, and SEQ ID NO: 27 is an exemplary DNA sequence for the heavy chain domain of a Fab-IgG-Fab-Fab synthetic binding agent directed to an epitope of CD52g. This is an example of an amino acid sequence related to a heavy chain portion. SEQ ID NO: 28 is an example of an amino acid sequence of a Fab fragment for the heavy chain of a synthetic binder directed to an epitope of CD52g. SEQ ID NO: 29 is an example of an amino acid sequence of a heavy chain Fc fragment of a synthetic binding agent directed to an epitope of CD52g. SEQ ID NO: 30 is an example of an exemplary DNA sequence for a light chain domain directed to an epitope of CD52g. SEQ ID NO: 31 is an example of the amino acid sequence of a light chain domain of a synthetic binding agent directed to an epitope of CD52g. Figures 14A and 14B show a comparison between the amino acid sequences of heavy chain (Figure 14A) and light chain (Figure 14B) sequences listed in the sequence listing compared to germline sequences (eg native IgG). The designations for the different constructs are written from NH2 to COOH terminus, with IgG containing Fab-Fc. SEQ ID NO: 32 to SEQ ID NO: 38 are examples of heavy chain and light chain portions of synthetic binding agents (e.g., recombinant mAbs) having the structure Fab-Fab-IgG-Fab-Fab that can reduce sperm mobility in mucus. The specific DNA and amino acid sequences are shown. SEQ ID NO: 32 is an exemplary DNA sequence for the heavy chain domain of a Fab-Fab-IgG-Fab-Fab synthetic binding agent directed against an epitope of CD52g, and SEQ ID NO: 33 is an exemplary DNA sequence for the heavy chain domain of a Fab-Fab-IgG-Fab-Fab synthetic binding agent directed against an epitope of CD52g. This is an example of an amino acid sequence related to the heavy chain portion of Fab-Fab. SEQ ID NO: 34 is an example of a DNA sequence for the light chain of anti-CD53g Fab-Fab-IgG-Fab-Fab synthetic protein. SEQ ID NO: 35 is an example of an amino acid sequence of an anti-CD52g Fab-Fab-IgG-Fab-Fab synthetic binding agent. SEQ ID NO: 36 is the amino acid sequence of the Fab fragment of the Fab-Fab-IgG-Fab-Fab (heavy chain) portion, and SEQ ID NO: 37 is the amino acid sequence of the anti-CD52g Fab fragment of Fab-Fab-IgG-Fab-Fab. It is an array. SEQ ID NO: 38 is an example of an amino acid sequence of a heavy chain Fc fragment of a synthetic binding agent directed to an epitope of CD52g, including one configured as Fab-Fab-IgG-Fab-Fab. In another example, synthetic binding agents that can reduce the fraction of pathogens that can pass through mucus and / or freely divide, particularly as described herein, can (e.g., has anti-Klebsiella activity). For example, a human or humanized IgG (mAb) that specifically recognizes an epitope of Klebsiella pneumoniae O1 may be used. For example, the anti-Klebsiella mAbs shown by SEQ ID NO: 39 to SEQ ID NO: 45 are directed against the D-galactan-II antigen of Klebsiella pneumoniae; other epitopes or other anti-Klebsiella mAbs may be used instead. . For example, SEQ ID NO: 39 is the polynucleotide (DNA) sequence of the heavy chain of anti-Klebsiella IgG. SEQ ID NO: 40 is the amino acid sequence of anti-Klebsiella heavy chain. SEQ ID NO: 43 is the polynucleotide (DNA) sequence of the light chain of anti-Klebsiella IgG; SEQ ID NO: 44 is the amino acid sequence of the anti-Klebsiella light chain. SEQ ID NO: 45 is the amino acid sequence of this anti-Klebsiella IgG light chain Fab fragment, SEQ ID NO: 41 is the amino acid sequence of the anti-Klebsiella heavy chain Fab fragment, and SEQ ID NO: 42 is the amino acid sequence of this anti-Klebsiella IgG light chain Fab fragment. This is the amino acid sequence of the Fc fragment of the heavy chain of . An example of a Klebsiella-specific synthetic binding agent constructed as described herein as a Fab-IgG construct (similar to FIG. 1B) is shown in SEQ ID NO:46-SEQ ID NO:52. SEQ ID NO: 46 is the DNA sequence of anti-Klebsiella Fab-IgG heavy chain, and SEQ ID NO: 47 is the amino acid sequence of the heavy chain of Fab-IgG. SEQ ID NO: 48 is the amino acid sequence of the Fab fragment of this anti-Klebsiella Fab-IgG heavy chain. SEQ ID NO: 49 is the amino acid sequence of the Fc fragment of IgG-Fab. SEQ ID NO: 50 is the DNA sequence of the light chain of Fab-IgG, and SEQ ID NO: 51 is the amino acid sequence of the light chain of Fab-IgG. SEQ ID NO: 52 shows the amino acid sequence of the Fab fragment of Fab-IgG light chain. Another example of a synthetic binding agent specific for Klebsiella constructed as an IgG-Fab construct (similar to Figure 1C) is shown in SEQ ID NO:53-SEQ ID NO:59. SEQ ID NO: 53 is the DNA sequence of anti-Klebsiella IgG-Fab heavy chain, and SEQ ID NO: 54 is the amino acid sequence of the IgG-Fab heavy chain. SEQ ID NO: 55 is the amino acid sequence of the anti-Klebsiella Fab fragment of the IgG-Fab heavy chain. SEQ ID NO: 56 is the amino acid sequence of the Fc fragment of IgG-Fab. SEQ ID NO: 57 is the DNA sequence of the light chain of this IgG-Fab synthetic binding agent, and SEQ ID NO: 58 is the amino acid sequence of the light chain of IgG-Fab. SEQ ID NO: 59 shows the amino acid sequence of the Fab fragment of the IgG-Fab light chain. An example of a Klebsiella-specific synthetic binding agent constructed as described herein as a Fab-IgG-Fab construct (similar to FIG. 1D) is shown in SEQ ID NO: 60-SEQ ID NO: 66. SEQ ID NO: 60 is the DNA sequence of anti-Klebsiella Fab-IgG-Fab heavy chain, and SEQ ID NO: 61 is the amino acid sequence of the heavy chain of Fab-IgG-Fab.SEQ ID NO: 62 is the amino acid sequence of the Fab fragment of this anti-Klebsiella Fab-IgG-Fab heavy chain, and SEQ ID NO: 63 is the amino acid sequence of the Fc fragment of the Fab-IgG-Fab. SEQ ID NO: 64 is the DNA sequence of the light chain of Fab-IgG-Fab, and SEQ ID NO: 65 is the amino acid sequence of the light chain of Fab-IgG-Fab. SEQ ID NO: 66 shows the amino acid sequence of the Fab fragment of Fab-IgG-Fab light chain. An example of a synthetic binding agent specific for Klebsiella constructed as described herein as a Fab-Fab-IgG-Fab-Fab construct (similar to Figure 1F) is shown in SEQ ID NO: 160 to SEQ ID NO: 166. . SEQ ID NO: 160 is the DNA sequence of anti-Klebsiella Fab-Fab-IgG-Fab-Fab heavy chain, and SEQ ID NO: 161 is the amino acid sequence of the heavy chain of Fab-Fab-IgG-Fab-Fab. SEQ ID NO: 162 is the amino acid sequence of the Fab fragment of this anti-Klebsiella Fab-Fab-IgG-Fab-Fab heavy chain. SEQ ID NO: 163 is the amino acid sequence of the Fc fragment of Fab-Fab-IgG-Fab-Fab. SEQ ID NO: 164 is the DNA sequence of the light chain of Fab-Fab-IgG-Fab-Fab, and SEQ ID NO: 165 is the amino acid sequence of the light chain of Fab-Fab-IgG-Fab-Fab. SEQ ID NO: 166 shows the amino acid sequence of the Fab fragment of Fab-Fab-IgG-Fab-Fab light chain. In another example, synthetic binding agents that can reduce the fraction of pathogens that can pass through mucus and / or freely divide, particularly as described herein, can (e.g., has anti-Salmonella activity). For example, a human or humanized IgG (mAb) that specifically recognizes an epitope of Salmonella may be used. For example, the anti-Salmonella mAbs represented by SEQ ID NO: 67 to SEQ ID NO: 73 are directed against Salmonella antigens. Any suitable epitope or other anti-Salmonella mAb may be used. For example, SEQ ID NO: 67 is the polynucleotide (DNA) sequence of the heavy chain of anti-Salmonella IgG. SEQ ID NO: 68 is the amino acid sequence of anti-Salmonella heavy chain. SEQ ID NO: 71 is the polynucleotide (DNA) sequence of the anti-Salmonella IgG light chain; SEQ ID NO: 72 is the amino acid sequence of the anti-Salmonella light chain. SEQ ID NO: 69 is the amino acid sequence of this anti-Salmonella IgG heavy chain Fab fragment, SEQ ID NO: 73 is the amino acid sequence of the anti-Salmonella light chain Fab fragment, and SEQ ID NO: 70 is the amino acid sequence of this anti-Klebsiella IgG heavy chain Fab fragment. This is the amino acid sequence of the Fc fragment of the heavy chain of . An example of a Fab-IgG synthetic anti-Salmonella LP binding agent is shown by SEQ ID NO: 74 to SEQ ID NO: 80, which includes the DNA sequence of a synthetic Fab-IgG heavy chain in SEQ ID NO: 74 (the amino acid sequence of this heavy chain is SEQ ID NO: 75). The amino acid residues of the Fab fragment of the Fab-IgG heavy chain are provided in SEQ ID NO:76 and the amino acid residues of the Fc fragment of Fab-IgG are provided in SEQ ID NO:77. SEQ ID NO: 78 is the DNA sequence of the Fab-IgG (light chain) portion, and the amino acid sequence is SEQ ID NO: 79. SEQ ID NO: 80 describes the amino acid residues of the Fab fragment of the Fab-IgG light chain. An example of an IgG-Fab synthetic anti-Salmonella LPS binding agent is shown by SEQ ID NO: 81 to SEQ ID NO: 87 and includes the DNA sequence of a synthetic Fab-IgG heavy chain in SEQ ID NO: 81 (the amino acid sequence of this heavy chain is SEQ ID NO: 82). The amino acid residues of the Fab fragment of the Fab-IgG heavy chain are provided in SEQ ID NO:83 and the amino acid residues of the Fc fragment of Fab-IgG are provided in SEQ ID NO:84. SEQ ID NO: 85 is the DNA sequence of the Fab-IgG (light chain) portion, and the amino acid sequence is SEQ ID NO: 86. SEQ ID NO: 87 describes the amino acid residues of the Fab fragment of the Fab-IgG light chain. An example of a Fab-IgG-Fab synthetic anti-Salmonella LPS binding agent is shown by SEQ ID NO: 88 to SEQ ID NO: 94, and includes the DNA sequence of a synthetic Fab-IgG heavy chain in SEQ ID NO: 88 (the amino acid sequence of this heavy chain is as shown in SEQ ID NO: 89). The amino acid residues of the Fab fragment of the Fab-IgG heavy chain are provided in SEQ ID NO:90 and the amino acid residues of the Fc fragment of Fab-IgG are provided in SEQ ID NO:91. SEQ ID NO: 92 is the DNA sequence of the Fab-IgG (light chain) portion, and the amino acid sequence is SEQ ID NO: 93. SEQ ID NO: 94 describes the amino acid residues of the Fab fragment of the Fab-IgG light chain. An example of a Fab-Fab-IgG-Fab-Fab synthetic anti-Salmonella LPS binding agent is shown by SEQ ID NO: 95 to SEQ ID NO: 101, and includes the DNA sequence of a synthetic Fab-IgG heavy chain in SEQ ID NO: 95. The amino acid sequence is shown in SEQ ID NO: 96). The amino acid residues of the Fab fragment of the Fab-IgG heavy chain are provided in SEQ ID NO:97 and the amino acid residues of the Fc fragment of Fab-IgG are provided in SEQ ID NO:98. SEQ ID NO: 99 is the DNA sequence of the Fab-IgG (light chain) portion, and the amino acid sequence is SEQ ID NO: 100. SEQ ID NO: 101 describes the amino acid residues of the Fab fragment of the Fab-IgG light chain. In another example, in particular, as described herein, synthetic binding agents that can reduce the fraction of pathogens that can pass through mucus and / or that are free to divide can be used to (e.g., has anti-gonorrhoeal activity). For example, a human or humanized IgG (mAb) that specifically recognizes an epitope of Neisseria gonorrhoeae may be used. For example, the anti-gonorrhoea mAb (2C7) shown by SEQ ID NO: 102 to SEQ ID NO: 108 is directed against the antigen of Neisseria gonorrhoeae. Any suitable epitope or other anti-gonococcal mAb may be used. For example, SEQ ID NO: 102 is the polynucleotide (DNA) sequence of the heavy chain of anti-gonococcal IgG. SEQ ID NO: 103 is the amino acid sequence of anti-gonococcal heavy chain. SEQ ID NO: 106 is the polynucleotide (DNA) sequence of the anti-gonococcal IgG light chain; SEQ ID NO: 107 is the amino acid sequence of the anti-gonococcal light chain. SEQ ID NO: 104 is the amino acid sequence of this anti-gonococcal IgG heavy chain Fab fragment, SEQ ID NO: 108 is the amino acid sequence of the anti-gonococcal light chain Fab fragment, and SEQ ID NO: 105 is the amino acid sequence of this anti-gonococcal IgG heavy chain Fab fragment. This is the amino acid sequence of the Fc fragment of the heavy chain of . An example of a Fab-IgG synthetic anti-Neisseria gonorrhoeae (2C7) binding agent is shown by SEQ ID NO: 109 to SEQ ID NO: 115, and includes the DNA sequence of a synthetic Fab-IgG heavy chain in SEQ ID NO: 109 (the amino acid sequence of this heavy chain is: (as shown in SEQ ID NO: 110). The amino acid residues of the Fab fragment of the Fab-IgG heavy chain are provided in SEQ ID NO: 111 and the amino acid residues of the Fc fragment of Fab-IgG are provided in SEQ ID NO: 112. SEQ ID NO: 113 is the DNA sequence of the Fab-IgG (light chain) portion, and the amino acid sequence is SEQ ID NO: 114. SEQ ID NO: 115 describes the amino acid residues of the Fab fragment of the Fab-IgG light chain. An example of an IgG-Fab synthetic anti-gonococcal binding agent is shown by SEQ ID NO: 116 to SEQ ID NO: 122, which includes the DNA sequence of a synthetic IgG-Fab heavy chain in SEQ ID NO: 116 (the amino acid sequence of this heavy chain is SEQ ID NO: 117). ). The amino acid residues of the Fab fragment of the IgG-Fab heavy chain are provided in SEQ ID NO: 118 and the amino acid residues of the Fc fragment of the IgG-Fab are provided in SEQ ID NO: 119. SEQ ID NO: 120 is the DNA sequence of the IgG-Fab (light chain) portion, and the amino acid sequence is SEQ ID NO: 121. SEQ ID NO: 122 describes the amino acid residues of the Fab fragment of the IgG-Fab light chain. An example of a Fab-IgG-Fab synthetic anti-gonococcal binding agent is shown by SEQ ID NO: 123 to SEQ ID NO: 129 and includes the DNA sequence of the synthetic Fab-IgG-Fab heavy chain in SEQ ID NO: 123 (the amino acid sequence of this heavy chain is , shown in SEQ ID NO: 124). The amino acid residues of the Fab fragment of Fab-IgG-Fab heavy chain are provided in SEQ ID NO: 125 and the amino acid residues of the Fc fragment of Fab-IgG-Fab are provided in SEQ ID NO: 126. SEQ ID NO: 127 is the DNA sequence of the Fab-IgG-Fab (light chain) portion, and the amino acid sequence is SEQ ID NO: 128. SEQ ID NO: 129 describes the amino acid residues of the Fab fragment of the Fab-IgG-Fab light chain. An example of a Fab-Fab-IgG-Fab-Fab synthetic anti-gonococcal binding agent is shown by SEQ ID NO: 153 to SEQ ID NO: 159 and includes the DNA sequence of the synthetic Fab-Fab-IgG-Fab-Fab heavy chain in SEQ ID NO: 153. (The amino acid sequence of this heavy chain is shown in SEQ ID NO: 154). The amino acid residues of the Fab fragment of Fab-Fab-IgG-Fab-Fab heavy chain are provided in SEQ ID NO: 155 and the amino acid residues of the Fc fragment of Fab-Fab-IgG-Fab-Fab are provided in SEQ ID NO: 156. . SEQ ID NO: 157 is the DNA sequence of the Fab-Fab-IgG-Fab-Fab (light chain) portion, and the amino acid sequence is SEQ ID NO: 158. SEQ ID NO: 159 describes the amino acid residues of the Fab fragment of Fab-Fab-IgG-Fab-Fab light chain. In another example, in particular, as described herein, synthetic binding agents that can reduce the fraction of pathogens that can pass through mucus are directed against respiratory syncytial virus (RSV). It's okay to be rejected. For example, a human or humanized IgG (mAb) that specifically recognizes an epitope of RSV may be used. For example, anti-RSV mAbs (modeled after the publication of motavizumab) are shown by SEQ ID NO: 132 to SEQ ID NO: 138 and are directed against antigens of RSV. Any suitable epitope or other anti-RSV mAb may be used. SEQ ID NO: 132 is the polynucleotide (DNA) sequence of the heavy chain of anti-RSV IgG. SEQ ID NO: 133 is the amino acid sequence of anti-RSV heavy chain. SEQ ID NO: 136 is the polynucleotide (DNA) sequence of the anti-RSV IgG light chain; SEQ ID NO: 137 is the amino acid sequence of the anti-RSV light chain. SEQ ID NO: 134 is the amino acid sequence of this anti-RSV IgG heavy chain Fab fragment, SEQ ID NO: 138 is the amino acid sequence of the anti-RSV light chain Fab fragment, and SEQ ID NO: 135 is the amino acid sequence of this anti-RSV IgG heavy chain Fab fragment. Amino acid sequence of heavy chain Fc fragment. An example of a Fab-IgG synthetic anti-RSV binding agent is shown by SEQ ID NO: 139 to SEQ ID NO: 145, which includes the DNA sequence of a synthetic Fab-IgG heavy chain in SEQ ID NO: 139 (the amino acid sequence of this heavy chain is SEQ ID NO: 140). ).The amino acid residues of the Fab fragment of the Fab-IgG heavy chain are provided in SEQ ID NO: 141 and the amino acid residues of the Fc fragment of Fab-IgG are provided in SEQ ID NO: 142. SEQ ID NO: 143 is the DNA sequence of the Fab-IgG (light chain) portion, and the amino acid sequence is SEQ ID NO: 144. SEQ ID NO: 145 describes the amino acid residues of the Fab fragment of the Fab-IgG light chain. An example of an IgG-Fab synthetic anti-RSV binding agent is shown by SEQ ID NO: 146 to SEQ ID NO: 152, which includes the DNA sequence of a synthetic Fab-IgG heavy chain in SEQ ID NO: 146 (the amino acid sequence of this heavy chain is SEQ ID NO: 147). ). The amino acid residues of the Fab fragment of the Fab-IgG heavy chain are provided in SEQ ID NO: 148 and the amino acid residues of the Fc fragment of Fab-IgG are provided in SEQ ID NO: 149. SEQ ID NO: 150 is the DNA sequence of the Fab-IgG (light chain) portion, and the amino acid sequence is SEQ ID NO: 151. SEQ ID NO: 152 describes the amino acid residues of the Fab fragment of the Fab-IgG light chain. Other synthetic binding agents (eg, multimeric constructs) can be directed against Psuedomonas aeruginosa, methicillin-resistant Staphylococcus aureus, Acinetobacter baumannii, and Clostridium difficile. Sequences for IgG mAbs against surface antigens for these (and other pathogens) have been published and synthetic binding agents can be formed as described herein. Thus, although a specific array of exemplary synthetic binding agents that can reduce the fraction of pathogens that can pass through mucus and / or that are free to divide is described above, those skilled in the art will , it can be appreciated that this specification generally teaches how to make synthetic binding agents from IgG (particularly IgG directed against surface antigens) and how to use the same. The synthetic binding agents described herein are synthetic human or humanized immunoglobulin G (IgG) having one set of Fab domains, in contrast to an additional Fab domain directed against the same antigen. , is linked in tandem to one or both end(s) of the IgG Fab domain and / or the IgG Fc region by a flexible linker. The resulting synthetic binding agents have been found to dramatically reduce the mobility of targets (eg, pathogens such as bacteria, viruses, yeast, etc. and / or sperm) in mucus. The synthetic binder was found to be stable across a variety of delivery forms, including nebulized forms. Synthetic binders can be readily produced using the methods and techniques described herein. Starting with virtually any IgG (e.g., IgG1 mAb) that specifically binds with respect to an antigen (or antigenic region) of a target, such as, for example, a sperm or a pathogen (virus, bacteria, yeast, mold, etc.), the present invention Work has been conducted to demonstrate that the synthetic binders described herein can be produced. In some variations, the variable heavy and light chains of the starting IgG1 mAb, and in some cases also the constant heavy and light chain sequences, are humanized using optimization tools such as those provided by GeneArt (ThermoFisher Scientific). (Homo sapiens). The codon-optimized sequences of VH, CH1, VL, and CL may be used to design the gene fragments necessary to assemble the synthetic binding agents described herein (e.g., using software such as Benchling software). ). For example, to assemble a Fab-IgG synthetic binder, a gene fragment consisting of VH-CH1-6xG4S-linker-VH is cloned into a mammalian expression vector consisting of the CH1-CH2-CH3 DNA sequence. It was designed to. Similarly, to assemble Fab-Fab-IgG-Fab-Fab, it consists of VH-CH1-6xG4S linker-VH-CH1-6xG4S linker-VH and 6xG4S linker-VH-CH1-6xG4S linker-VH-CH1. The gene fragment was further designed to be cloned into an IgG1 expression vector. In some embodiments, the DNA sequence for the repeat fragment is codon-optimized, for example by hand, to increase the variability of the DNA sequence in order to minimize synthesis problems that may arise due to repeat sequences; As a result, the complexity associated with gene synthesis may be reduced. Following codon optimization, the gene sequence may be further processed using provided complexity analysis tools (such as those provided by IDT (Integrated DNA Technologies)) to obtain a complexity score. Gene fragments with complexity scores <25 are known to be easily and successfully synthesized via GeneArt gene synthesis. Expression vectors encoding synthetic binding agents can be produced. For example, for an expression plasmid encoding a light chain, a gene fragment consisting of VL and CL (Cλ) DNA sequences can be synthesized using a custom gene synthesis service (e.g., Integrated DNA Technologies) and an empty mammalian expression vector. for example, using the KpnI (5') and EcoRI (3') restriction sites. For construction of expression plasmids encoding heavy chains (HC) for synthetic binders, some examples include VH-CH1-6xG4S linker-VH, VH-CH1-6xG4S linker-VH-CH1-6xG4S linker-VH , 6xG4S Linker-VH-CH1 and 6xG4S Linker-VH-CH1-6xG4S Linker-VH-CH1 Four cloning vectors containing DNA sequences were synthesized using the GeneArt® gene synthesis service (ThermoFisher Scientific). In some examples, for the construction of an expression plasmid encoding HC for IgG, the VH fragment is extracted from a cloning vector containing a VH-CH1-6xG4S linker-VH vector with a forward primer, 5'-. TAAGCAGGTACCGCCACCATGAAGTG -3’ (SEQ ID NO: 130), and reverse primer, 5’- TGCTTAGCTAGCTGGAGAAACTGTC
Claims
1. A method of reducing mucosal penetration of an epitope-bearing target, the method comprising the step of administering to a subject a synthetic binding agent, the synthetic binding agent comprising a human or humanized immunoglobulin G (IgG) having a set of Fab domains, wherein the human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein the one or more additional Fab domains and the IgG Fab domain all specifically bind to the epitope of the target, whereby the synthetic binding agent binds to the target with high affinity and increases aggregation of the target in the subject's mucus, reducing the mobility of the target to less than about 50% of its native mobility in mucus.
2. The method of claim 1, wherein the one or more additional Fab domains comprise 2, 4, 6, or 8 additional Fab domains.
10. The method of claim 1, wherein the target is a spermatozoon.
4. The method of claim 3, wherein the fraction of forward-motile sperm in the mucus is slowed by at least 50% compared to the natural mobility of sperm in the mucus.
4. The method of claim 3, wherein the one or more Fab domains and the IgG Fab domain all specifically bind to CD52g.
4. The method of claim 3, wherein the one or more Fab domains and the IgG Fab domain all specifically bind to a pathogen.
6. The method of claim 5, wherein the pathogen is selected from the group consisting of Acinetobacter baumannii; Bacteroides fragilis; Burkholderia cepacia; Clostridium difficile; Clostridium sordellii; Carbapenem-resistant Enterobacteriaceae; Enterococcus faecalis; Escherichia coli; Hepatitis A; Hepatitis B; Hepatitis C; Human immunodeficiency viruses HIV-1 and HIV-2 (HIV, AIDS); Influenza; Klebsiella pneumoniae; Methicillin-resistant Staphylococcus aureus; Morganella morganii; Mycobacterium abscessus; Norovirus; Pseudomonas aeruginosa aeruginosa; Staphylococcus aureus; Stenotrophomonas maltophilia; Mycobacterium tuberculosis; Vancomycin-resistant Staphylococcus aureus; Vancomycin-resistant Enterococcus; Neisseria gonorrhoeae (gonorrhea); Chlamydia trachomatis (chlamydia, lymphogranulomatosis venereum); Treponema pallidum (syphilis); Haemophilus ducreyi (chancroid); Klebsiella granulomatosis granulomatis); Klebsiella pneumoniae; Granulomatous callimatobacterium (inguinal lymphogranulomatosis), Mycoplasma genitalium, Ureaplasma urealyticum (Mycoplasma); Human immunodeficiency viruses HIV-1 and HIV-2 (HIV, AIDS); HTLV-1 (T-lymphotropic virus type 1); Herpes simplex viruses types 1 and 2 (HSV-1 and HSV-2); Epstein-Barr virus; Cytomegalovirus; Human herpesvirus 6; Varicella-zoster virus; Human papillomavirus (genital warts); Hepatitis A virus, Hepatitis B virus, Hepatitis C virus (viral hepatitis); Molluscum contagiosum virus (MCV); Trichomonas vaginalis (trichomoniasis); and yeast, such as Candida albicans (vulvar candidiasis).
10. The method of claim 1, wherein administering comprises administering vaginally to the subject.
10. The method of claim 1, wherein administering comprises delivering from an intravaginal ring (IVR).
10. The method of claim 1, wherein administering comprises administering systemically to the subject.
10. The method of claim 1, wherein administering comprises orally administering to the subject.
10. The method of claim 1, wherein administering comprises administering to the subject as a vaginal film.
10. The method of claim 1, wherein administering comprises administering from a nebulizer.
10. The method of claim 1, wherein administering comprises administering by inhalation.
15. The method of any one of claims 1 to 14, wherein administering comprises delivering 0.01 mg to 1.5 g of the synthetic binding agent per day.
16. The method of any one of claims 1 to 15, wherein administering comprises administering in an amount sufficient to cause agglutination of the target.
17. The method of any of claims 1 to 16, wherein the IgG Fab domain has an amino acid sequence that is not identical to the one or more additional Fab domains.
1. A method of inhibiting fertilization and conception by reducing sperm penetration through mucus, the method comprising the step of administering to a subject a synthetic binding agent, the synthetic binding agent comprising a human or humanized immunoglobulin G (IgG) having a set of Fab domains, wherein the human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein the one or more additional Fab domains and the IgG Fab domain all specifically bind to epitopes on sperm, whereby the synthetic binding agent binds with high affinity to sperm and reduces the average mobility of sperm in mucus.
20. The method of claim 18, wherein the one or more additional Fab domains comprise 2, 4, 6, or 8 additional Fab domains.
20. The method of claim 18, wherein the motility of sperm in the mucus is slowed by at least 50% compared to the natural motility of sperm in the mucus.
19. The method of claim 18, wherein the one or more Fab domains and the IgG Fab domain all specifically bind to CD52g.
20. The method of claim 18, wherein administering comprises administering to the subject vaginally.
20. The method of claim 18, wherein administering comprises delivering from an intravaginal ring (IVR).
20. The method of claim 18, wherein administering comprises administering systemically to the subject.
20. The method of claim 18, wherein administering comprises administering to the subject as a vaginal film.
20. The method of claim 18, wherein administering comprises administering from a nebulizer.
27. The method of any of claims 18-26, wherein administering comprises delivering between 0.01 mg and 100 mg of the synthetic binding agent per day.
27. The method of any of claims 18-26, wherein administering comprises administering in an amount sufficient to aggregate said targets while maintaining and / or increasing muco-trapping.
27. The method of any of claims 18 to 26, wherein the IgG Fab domain has an amino acid sequence that is not identical to the one or more additional Fab domains.
1. A method of treating or preventing infection by a pathogen, the method comprising the step of administering to a subject a synthetic binding agent, the synthetic binding agent comprising a human or humanized immunoglobulin G (IgG) having a set of Fab domains, wherein the human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein the one or more additional Fab domains and the IgG Fab domain all specifically bind to an epitope of a pathogen, whereby the synthetic binding agent binds with high affinity, increases aggregation of the target, promotes enchained growth of the target, and / or enables mucus trapping of the target.
31. The method of claim 30, wherein the one or more additional Fab domains comprise 2, 4, 6, or 8 additional Fab domains.
31. The method of claim 30, wherein the mobility of the pathogen in mucus is slowed by at least 50% compared to the native mobility of the pathogen in mucus.
31. The method of claim 30, wherein the pathogen is one or more of Salmonella and Escherichia coli, Neisseria gonorrhoeae (gonorrhea); Chlamydia trachomatis (chlamydia, lymphogranulomatosis venereum); Treponema pallidum (syphilis); Haemophilus ducreyi (chancroid); Klebsiella granulomatis; Klebsiella pneumoniae; Granulomatous callimatobacterium (lymphogranulomatosis venereum), Mycoplasma genitalium, Ureaplasma urealyticum (mycoplasma); Trichomonas vaginalis (trichomoniasis); and yeast, such as Candida albicans (vulvar candidiasis).
31. The method of claim 30, wherein the pathogen is one or more of human immunodeficiency viruses HIV-1 and HIV-2 (HIV, AIDS); HTLV-1 (T-lymphotropic virus type 1); herpes simplex viruses types 1 and 2 (HSV-1 and HSV-2); Epstein-Barr virus; cytomegalovirus; human herpesvirus 6; varicella-zoster virus; human papillomavirus (genital warts); hepatitis A virus, hepatitis B virus, hepatitis C virus (viral hepatitis); molluscum contagiosum virus (MCV).
31. The method of claim 30, wherein administering comprises administering systemically to the subject.
31. The method of claim 30, wherein administering comprises administering from a nebulizer.
31. The method of claim 30, wherein administering comprises administering by inhalation.
31. The method of claim 30, wherein administering comprises orally administering.
31. The method of claim 30, wherein administering comprises parenteral administration.
31. The method of claim 30, wherein administering comprises topical administration.
31. The method of claim 30, wherein administering comprises delivering between 0.01 mg and 100 mg of the synthetic binding agent per day.
31. The method of any one of claims 30, wherein administering comprises administering in an amount sufficient to aggregate said pathogens while maintaining and / or increasing mucus trapping.
31. The method of claim 30, wherein the IgG Fab domain has an amino acid sequence that is not identical to the one or more additional Fab domains.
1. A synthetic binding agent for increasing aggregation of an epitope-bearing target, said synthetic binding agent comprising a human or humanized immunoglobulin G (IgG) having a pair of Fab domains, wherein said human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains by amino acid linkers, wherein said one or more additional Fab domains and the IgG Fab domain all specifically bind to an epitope of said target, whereby said synthetic binding agent binds to said target with high affinity and reduces the average mobility of said target in mucus to less than about 50% of its native mobility in mucus.
45. The synthetic binding agent of claim 44, wherein said one or more additional Fab domains comprise 2, 4, 6 or 8 additional Fab domains.
45. The synthetic binding agent of claim 44, wherein the target is sperm and the one or more Fab domains and the IgG Fab domain all specifically bind to an epitope of CD52g.
47. The synthetic binding agent of claim 46, wherein said epitope of CD52g is a repeating poly-n-acetyllactosaminyl structure on sperm, which is an N-linked glycosylated form of SEQ ID NO:
1.
47. The synthetic binding agent of claim 46, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO: 4; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:
7.
47. The synthetic binding agent of claim 46, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO: 4; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO:
7.
45. The synthetic binding agent of claim 44, wherein the target is Klebsiella bacillus.
51. The synthetic binding agent of claim 50, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO: 41; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:
44.
51. The synthetic binding agent of claim 50, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO: 41; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO:
44.
45. The synthetic binding agent of claim 44, wherein the target is Salmonella bacillus.
54. The synthetic binding agent of claim 53, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO: 69; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:
72.
54. The synthetic binding agent of claim 53, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO: 69; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO:
72.
45. The synthetic binding agent of claim 44, wherein the target is Neisseria gonorrhoeae.
57. The synthetic binding agent of claim 56, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO: 104; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:
107.
57. The synthetic binding agent of claim 56, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO: 104; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO:
107.
59. The synthetic binding agent of any one of claims 44 to 58, wherein said at least one further Fab domain is linked to a Fab domain of said set of Fab domains of said IgG.
59. The synthetic binding agent of any one of claims 44 to 58, wherein said at least one additional Fab domain is linked to an Fc region of said IgG.
61. The synthetic binding agent of any one of claims 44 to 60, wherein the IgG comprises at least one Fc region that is a naturally occurring sequence.
61. The synthetic binding agent of any one of claims 44 to 60, wherein the IgG comprises at least one Fc region comprising one or more mutations that increase or decrease binding to an Fc receptor.
63. The synthetic binding agent of any one of claims 44 to 62, wherein the one or more additional Fab domains are linked to the IgG via a flexible linker comprising an amino acid sequence comprising n pentapeptide repeats of glycine (G) and serine (S), where n is between 3 and 8.
64. The synthetic binding agent of any of claims 44 to 63, wherein the IgG Fab domain has an amino acid sequence that is not identical to the one or more further Fab domains.
65. An isolated nucleic acid molecule encoding the synthetic binding agent of any one of claims 44 to 64. A vector comprising the nucleic acid molecule of claim 65.
67. An isolated host cell or non-human organism transformed or transfected with the nucleic acid molecule of claim 65 or the vector of claim 66.
66. A composition comprising the synthetic binding agent of any one of claims 44 to 65 and a pharmaceutically acceptable carrier.
1. A synthetic binding agent for inhibiting sperm motility through mucus, comprising a human or humanized immunoglobulin G (IgG) having a set of Fab domains, wherein said human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein said one or more additional Fab domains and the IgG Fab domain all specifically bind to an epitope of CD52g, whereby said synthetic binding agent reduces sperm motility in mucus to less than about 50% of their native motility in mucus.
70. The synthetic binding agent of claim 69, wherein said one or more additional Fab domains comprise 2, 4, 6 or 8 additional Fab domains.
71. The synthetic binding agent of any one of claims 69 to 70, wherein said epitope of CD52g comprises a repeating poly-n-acetyllactosaminyl structure, an N-linked glycosylated form of SEQ ID NO:
1.
72. The synthetic binding agent of any one of claims 69 to 71, wherein each of said additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO: 4; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:
7.
72. The synthetic binding agent of claims 69 to 71, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO: 4; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO:
7.
74. The synthetic binding agent of any one of claims 69 to 73, wherein said at least one further Fab domain is linked to a Fab domain of said set of Fab domains of said IgG.
75. The synthetic binding agent of any one of claims 69 to 74, wherein said at least one additional Fab domain is linked to an Fc region of said IgG.
76. The synthetic binding agent of any one of claims 69 to 75, wherein the IgG comprises at least one Fc region that is a naturally occurring sequence.
76. The synthetic binding agent of any one of claims 69 to 75, wherein the IgG comprises at least one Fc region comprising one or more mutations that increase or decrease binding to an Fc receptor.
78. The synthetic binding agent of any one of claims 69 to 77, wherein the one or more additional Fab domains are linked to the IgG via a flexible linker comprising an amino acid sequence comprising n pentapeptide repeats of glycine (G) and serine (S), where n is between 3 and 8.
79. An isolated nucleic acid molecule encoding the synthetic binding agent of any one of Claims 69 to 78.
80. A vector comprising the nucleic acid molecule of claim 79.
81. An isolated host cell or non-human organism transformed or transfected with the nucleic acid molecule of claim 79 or the vector of claim 80.
79. A composition comprising the synthetic binding agent of any one of claims 69 to 78 and a pharmaceutically acceptable carrier.
82. A delivery device comprising the synthetic binding agent of any one of claims 69 to 78 or the composition of claim 82.
84. The delivery device of claim 83, configured as an intravaginal ring (IVR) or vaginal film.
1. A synthetic binding agent for treating or preventing infection by the Klebsiella pathogen, said binding agent comprising a human or humanized immunoglobulin G (IgG) having a set of Fab domains, wherein said human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein said one or more additional Fab domains and the IgG Fab domain all specifically bind to epitopes specific for Klebsiella, whereby said synthetic binding agent reduces the mobility of Klebsiella in mucus.
86. The synthetic binding agent of claim 85, wherein said one or more additional Fab domains comprise 2, 4, 6 or 8 additional Fab domains.
87. The synthetic binding agent of any one of claims 85-86, wherein each of said additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO: 41; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:
44.
87. The synthetic binding agent of any one of claims 85-86, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO: 41; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO:
44.
89. The synthetic binding agent of any one of claims 85 to 88, wherein said at least one further Fab domain is linked to a Fab domain of said set of Fab domains of said IgG.
90. The synthetic binding agent of any one of claims 85 to 89, wherein said at least one additional Fab domain is linked to an Fc region of said IgG.
91. The synthetic binding agent of any one of claims 85 to 90, wherein the IgG comprises at least one Fc region that is a naturally occurring sequence.
91. The synthetic binding agent of any one of claims 85 to 90, wherein the IgG comprises at least one Fc region comprising one or more mutations that increase or decrease binding to an Fc receptor.
93. The synthetic binding agent of any one of claims 85 to 92, wherein the one or more additional Fab domains are linked to the IgG via a flexible linker comprising an amino acid sequence comprising n pentapeptide repeats of glycine (G) and serine (S), where n is between 3 and 8.
93. An isolated nucleic acid molecule encoding the synthetic binding agent of any one of claims 85 to 92.
95. A vector comprising the nucleic acid molecule of claim 94.
96. An isolated host cell or non-human organism transformed or transfected with the nucleic acid molecule of claim 94 or the vector of claim 95.
94. A composition comprising the synthetic binding agent of any one of claims 85 to 93 and a pharmaceutically acceptable carrier.
98. A delivery device comprising the synthetic binding agent of any one of claims 85 to 93 or the composition of claim 97.
1. A synthetic binding agent for treating or preventing infection by the Salmonella pathogen, said binding agent comprising a human or humanized immunoglobulin G (IgG) having a set of Fab domains, wherein said human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein said one or more additional Fab domains and the IgG Fab domain all specifically bind to epitopes specific for Salmonella bacilli, whereby said synthetic binding agent reduces the mobility of Salmonella bacilli in mucus.
100. The synthetic binding agent of claim 99, wherein said one or more additional Fab domains comprises 2, 4, 6 or 8 additional Fab domains.
101. The synthetic binding agent of any one of claims 99-100, wherein each of said additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO: 69; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:
72.
101. The synthetic binding agent of any one of claims 99 to 100, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO: 69; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO:
72.
103. The synthetic binding agent of any one of claims 99 to 102, wherein said at least one further Fab domain is linked to a Fab domain of said set of Fab domains of said IgG.
104. The synthetic binding agent of any one of claims 99 to 103, wherein said at least one additional Fab domain is linked to an Fc region of said IgG.
105. The synthetic binding agent of any one of claims 99 to 104, wherein the IgG comprises at least one Fc region that is a naturally occurring sequence.
106. The synthetic binding agent of any one of claims 99-105, wherein the IgG comprises at least one Fc region comprising one or more mutations that increase or decrease binding to an Fc receptor.
107. The synthetic binding agent of any one of claims 99 to 106, wherein the one or more additional Fab domains are linked to the IgG via a flexible linker comprising an amino acid sequence comprising n pentapeptide repeats of glycine (G) and serine (S), where n is between 3 and 8.
108. An isolated nucleic acid molecule encoding the synthetic binding agent of any one of claims 99 to 107. A vector comprising the nucleic acid molecule of claim 108.
109. An isolated host cell or non-human organism transformed or transfected with the nucleic acid molecule of claim 108 or the vector of claim 109.
108. A composition comprising the synthetic binding agent of any one of claims 99-107 and a pharmaceutically acceptable carrier. A delivery device comprising the synthetic binding agent of any one of claims 99-107 or the composition of claim 111.
1. A synthetic binding agent for treating or preventing infection with Neisseria gonorrhoeae, said binding agent comprising a human or humanized immunoglobulin G (IgG) having a set of Fab domains, wherein said human or humanized IgG is linked to one or more additional immunoglobulin fragment antigen-binding (Fab) domains, wherein said one or more additional Fab domains and the IgG Fab domain all specifically bind to epitopes specific to Neisseria gonorrhoeae, whereby said synthetic binding agent reduces the mobility of Neisseria gonorrhoeae in mucus.
114. The synthetic binding agent of claim 113, wherein said one or more additional Fab domains comprise 2, 4, 6 or 8 additional Fab domains.
115. The synthetic binding agent of any one of claims 113-114, wherein each of said additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO: 104; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) having the amino acid sequence of SEQ ID NO:
107.
115. The synthetic binding agent of any one of claims 113 to 114, wherein each of the additional Fab domains comprises: (i) a heavy chain (HC) having a variable region (VH) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO: 104; and / or (ii) a light chain (LC) having a variable region (VL) comprising complementarity determining regions (CDRs) that have an amino acid sequence that is 100% to 80% identical to the amino acid sequence of SEQ ID NO:
107.
117. The synthetic binding agent of any one of claims 113 to 116, wherein said at least one further Fab domain is linked to a Fab domain of said set of Fab domains of said IgG.
118. The synthetic binding agent of any one of claims 113 to 117, wherein said at least one additional Fab domain is linked to an Fc region of said IgG.
119. The synthetic binding agent of any one of claims 113 to 118, wherein the IgG comprises at least one Fc region that is a naturally occurring sequence.
120. The synthetic binding agent of any one of claims 113 to 119, wherein the IgG comprises at least one Fc region comprising one or more mutations that increase or decrease binding to an Fc receptor.
121. The synthetic binding agent of any one of claims 113 to 120, wherein the one or more additional Fab domains are linked to the IgG via a flexible linker comprising an amino acid sequence comprising n pentapeptide repeats of glycine (G) and serine (S), where n is between 3 and 8.
122. An isolated nucleic acid molecule encoding the synthetic binding agent of any one of claims 113 to 121.
123. A vector comprising the nucleic acid molecule of claim 122.
124. An isolated host cell or non-human organism transformed or transfected with the nucleic acid molecule of claim 122 or the vector of claim 123.
108. A composition comprising the synthetic binding agent of any one of claims 99 to 107 and a pharmaceutically acceptable carrier.
112. A delivery device comprising the synthetic binding agent of any one of claims 99 to 107 or the composition of claim 111.