Nucleic acid delivery systems and their use
Isolated nucleic acids encoding RNAs, combined with tissue-specific targeting proteins and encapsulated in exosomes, address the challenges of RNAi therapy delivery by ensuring safe and efficient targeting to inhibit gene expression, improving therapy efficacy and compliance with GMP standards.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-03-29
- Publication Date
- 2026-04-09
AI Technical Summary
Current RNAi therapy faces challenges in delivering siRNA safely, accurately, and efficiently to target tissues due to issues with existing delivery systems, which are easily removed by the host's circulatory system, can trigger immunogenic reactions, and are toxic to certain cell types, leading to high clinical costs and inability to meet GMP standards.
A method involving isolated nucleic acids encoding RNAs such as miRNA, shRNA, siRNA, or sgRNA, combined with tissue-specific targeting proteins, encapsulated in exosomes for targeted delivery to inhibit gene expression, using exosomes' innate ability to protect and deliver across biological barriers.
This approach provides safe, accurate, and efficient delivery of RNA to target tissues, enhancing RNAi therapy effectiveness while complying with GMP standards and reducing clinical costs.
Smart Images

Figure 0007843053000035 
Figure 0007843053000036 
Figure 0007843053000037
Abstract
Description
Cross-reference of related applications
[0001] This application claims priority to the following Chinese patent applications filed on March 29, 2021, with application number 202110335617.9 and title of invention "RNA plasmid delivery system and use thereof", the following Chinese patent application filed on March 29, 2021, with application number 202110336982.1 and title of invention "RNA delivery system based on a viral vector and use thereof", and the following Chinese patent application filed on March 29, 2021, with application number 202110336983.6 and title of invention "Genetic circuit, RNA delivery system and use thereof", all of which are incorporated into this application by reference. [Technical Field]
[0002] This invention relates to the fields of molecular biology and pharmaceuticals. Specifically, it relates to nucleic acid molecules capable of treating diseases, their delivery systems, and their use in the treatment of diseases. [Background technology]
[0003] RNA interference (RNAi) therapy has been considered a promising strategy for treating human diseases since its invention, but it faces many clinical challenges, and progress in this therapy has been far slower than expected.
[0004] RNA is not thought to be able to exist stably outside the cell for long periods of time. Since RNA is degraded and fragmented by RNases, which are abundant outside the cell, it is necessary to find a way to keep RNA stably outside the cell and to target its uptake into specific tissues in order for RNAi therapy to be effective.
[0005] Currently, there is a great deal of research related to siRNA, mainly focusing on the following areas: 1. Designing therapeutically effective siRNA. 2. Chemically modifying siRNA to increase its stability in vivo and improve yield. 3. Designing various artificial vectors (e.g., lipid nanoparticles, cationic polymers, and viruses) to improve the efficiency of siRNA delivery in vivo. Many patents focus on the third area, and the fundamental reason for this is that researchers recognize the lack of appropriate siRNA delivery systems for safely, accurately, and efficiently delivering siRNA to target tissues, and that this problem is a core limitation of RNAi therapy.
[0006] Chinese patent publication number CN108624590A discloses an siRNA capable of inhibiting the expression of the DDR2 gene. Chinese patent publication number CN108624591A discloses an siRNA capable of silencing the ARPC4 gene, which is α-phosphorus-selenium modified. Chinese patent publication number CN108546702A discloses an siRNA targeting the long non-coding RNA DDX11-AS1. Chinese patent publication number CN106177990A discloses an siRNA precursor that can be used for the treatment of various tumors. All of these patents design specific siRNAs targeting certain diseases caused by genetic alterations.
[0007] Chinese patent publication number CN108250267A discloses polypeptides and polypeptide-siRNA-induced coassemblies, using polypeptides as vectors for siRNA. Chinese patent publication number CN108117585A discloses polypeptides that target and introduce siRNA to promote apoptosis in breast cancer cells, similarly using polypeptides as vectors for siRNA. Chinese patent publication number CN108096583A discloses nanoparticle vectors that can carry siRNA having a breast cancer therapeutic effect while also containing a chemotherapy drug. All of these patents are inventions relating to siRNA vectors, but the technical designs share a common feature: both the vector and the siRNA are pre-assembled in vitro before being introduced into the host body. In practice, most delivery technologies currently designed are similar to the above. However, these artificially synthesized exogenous delivery systems have common problems: they can be easily removed by the host's circulatory system, can trigger immunogenic reactions, and are even toxic to certain cell types and tissues.
[0008] The research team of this invention discovered that endogenous cells can selectively encapsulate miRNAs in exosomes, and that these exosomes deliver the miRNAs to receptor cells, which can potently block the expression of target genes even at relatively low concentrations. Exosomes are biocompatible with the host immune system and possess an innate ability to protect and deliver miRNAs across biological barriers in vivo, thus offering a potential solution to overcome problems associated with siRNA delivery. For example, Chinese patent publication number CN110699382A discloses a method for producing exosomes for siRNA delivery, disclosing a technique for separating exosomes from plasma and encapsulating siRNA in exosomes by electroporation.
[0009] However, such technologies for isolating or producing exosomes in vitro require obtaining large quantities of exosomes through cell culture and then adding the step of siRNA encapsulation. This results in extremely high clinical costs for large-scale application of this product, making it unaffordable for the average patient. Furthermore, the complex manufacturing and purification processes of exosomes make it virtually impossible to comply with GMP standards.
[0010] To date, no drugs containing exosomes as active ingredients have received CFDA approval, and the lack of guaranteed consistency in exosome products has been a central problem, directly leading to the inability to obtain manufacturing authorization for such products. Solving this problem would be extremely significant for promoting RNAi therapy.
[0011] Therefore, the development of safe, accurate, and efficient siRNA delivery systems is essential to enhance the effectiveness of RNAi therapy and advance RNAi therapy. [Overview of the project] [Problems that the invention aims to solve]
[0012] The present invention provides a method and drug for effectively, safely, and simply treating a disease by delivering RNA that inhibits gene expression to a target tissue or its cells, which may, if necessary, form a complex structure within an organ or tissue. [Means for solving the problem]
[0013] Specifically, in one aspect of the present invention, an isolated nucleic acid comprising a nucleotide sequence encoding RNA capable of inhibiting gene expression, (a) A nucleotide sequence comprising a nucleotide sequence encoding one or more RNAs that inhibit gene expression, wherein the RNA is a miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, or any combination thereof.
[0014] In one embodiment of the present invention, the isolated nucleic acid further comprises (b) a nucleotide sequence encoding a targeting protein. In one embodiment of the present invention, the targeting protein is a tissue-specific protein.
[0015] In one embodiment of the present invention, (a) is the nucleotide sequence that encodes a single RNA that inhibits gene expression.
[0016] In one embodiment of the present invention, (a) is a nucleotide sequence encoding a plurality of RNAs that inhibit gene expression. For example, the plurality of RNAs that inhibit gene expression are 2 to 4 RNAs that inhibit gene expression.
[0017] As used herein, “isolated” means that a substance is isolated from its original environment (for a natural substance, the original environment is its natural environment). For example, polynucleotides and polypeptides in their natural state within living cells are not isolated or purified, but similar polynucleotides or polypeptides are isolated or purified if they are separated from other substances present in their natural state.
[0018] In one embodiment of the present invention, the RNA that inhibits gene expression is an RNA that inhibits the expression of the EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, mHTT gene, Lrrk2 gene, and α-synuclein gene.
[0019] In one embodiment of the present invention, (a) is siRNA. siRNA, also known as short interfering RNA or silent RNA, is a double-stranded RNA molecule, typically 20–29 base pairs long, with each strand extending two nucleotides beyond the other end of the RNA. siRNA is generally produced by simulating the miRNA production mechanism, but such siRNA can be fabricated from precursor RNA (pre-RNA). Precursor RNA can generally be folded into a stable stem-loop (hairpin) structure with a length between 50–100 bp. The stem portion of the stem-loop structure contains two substantially complementary sequences on both sides.
[0020] siRNA may be substantially complementary to at least a portion of the sequence of the mRNA encoding the gene. “Substantially complementary” means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming a secondary structure. Typically, two “substantially complementary” nucleotide sequences are complementary by at least 70% of their nucleotides, preferably at least 80%, more preferably at least 90%, and even more preferably at least 95%, e.g., 98%, 99%, or 100%, of their nucleotides. Functionally, siRNA interferes with degraded mRNA after transcription of a particular gene expressing the complementary nucleotide sequence, thereby preventing translation.
[0021] In one embodiment of the present invention, (a) is siRNA for the EGFR gene, siRNA for the KRAS gene, siRNA for the VEGFR gene, siRNA for the mTOR gene, siRNA for the TNF-α gene, siRNA for the integrin-α gene, siRNA for the B7 gene, siRNA for the TGF-β1 gene, siRNA for the H2-K gene, siRNA for the H2-D gene, siRNA for the H2-L gene, siRNA for the HLA gene, siRNA for the GDF15 gene, antisense strand of miRNA-21, antisense strand of miRNA-214, siRNA for the TNC gene, siRNA for the PTP1B gene, siRNA for the mHTT gene, siRNA for the Lrrk2 gene, and siRNA for the α-synuclein gene.
[0022] The siRNAs for each of the above genes are RNA sequences that have the function of inhibiting the expression of the respective gene. Any of the above RNA sequences that have the function of inhibiting gene expression can be used in the present invention. The following are some of the RNA sequences that are highly effective.
[0023] The IgG siRNAs for the EGFR gene include UGUUGCUUCUCUUAAUUCCU, AAAUGAUCUUCAAAAGUGCCC, UCUUUAAGAAGGAAAGAUCAU, AAUAUUCGUAGCAUUUAUGGA, and UAAAAAUCCUCACAUAUACUU.
[0024] The siRNAs for the KRAS gene include UGAUUUAGUAUUAUUUAUGGC, AAUUUGUUCUCUAUAAUGGUG, UAAUUUGUUCUCUAUAAUGGU, UUAUGUUUUCGAAUUUCUCGA, and UGUAUUUACAUAAUUACACAC.
[0025] The siRNAs for the VEGFR gene include AUUUGAAGAGUUGUAUUAGCC, UAAUAGACUGGUAACUUUCAU, ACAACUAUGUACAUAAUAGAC, UUUAAGACAAGCUUUUCUCCA, and AACAAAAGGUUUUUCAUGGAC.
[0026] The siRNAs for the mTOR gene include AGAUAGUUGGCAAAUCUGCCA, ACUAUUUCAUCCAUAUAAGGU, AAAAUGUUGUCAAAGAAGGGU, AAAAAUGUUGUCAAAGAAGGG, and UGAUUUCUUCCAUUUCUUCUC.
[0027] The siRNAs for the TNF-α gene include AAAACAUAAUCAAAAGAAGGC, UAAAAAACAUAAUCAAAAGAA, AAUAAUAAAUAAUCACAAGUG, UUUUCACGGAAAACAUGUCUG, and AAACAUAAUCAAAAGAAGGCA.
[0028] The siRNA for the integrin-α gene includes AUAAUCAUCUCCAUUAAUGUC, AAACAAUUCCUUUUUUAUCUU, AUUAAAACAGGAAACUUUGAG, AUAAUGAAGGAUAUACAACAG, and UUCUUUAUUCAUAAAAGUCUC.
[0029] The siRNAs for the B7 gene include UUUUCUUUGGGUAAUCUUCAG, AGAAAAAUUCCACUUUUUCUU, AUUUCAAAGUCAGAUAUACUA, ACAAAAAUUCCAUUUACUGAG, and AUUAUUGAGUUAAGUAUUCCU.
[0030] The siRNAs for the TGF-β1 gene include ACGGAAAUAACCUAGAUGGGC, UGAACUUGUCAUAGAUUUCGU, UUGAAGAACAUAUAUAUGCUG, UCUAACUACAGUAGUGUUCCC, and UCUCAGACUCUGGGGCCUCAG.
[0031] The siRNAs for the H2-K gene include AAAAACAAAUCAAUCAAACAA, UCAAAAAAACAAAUCAAUCAA, UAUGAGAAGACAUUGUCUGUC, AACAAUCAAGGUUACAUUCAA, and ACAAAACCUCUAAGCAUUCUC.
[0032] The siRNAs for the H2-D gene include AAUCUCGGAGAGACAUUUCAG, AAUGUUGUGUAAAGAGAACUG, AACAUCAGACAAUGUUGUGUA, UGUUAACAAUCAAGGUCACUU, and AACAAAAAAACCUCUAAGCAU.
[0033] The siRNAs for the H2-L gene include GAUCCGCUCCCAAUACUCCGG, AUCUGCGUGAUCCGCUCCCAA, UCGGAGAGACAUUUCAGAGCU, UCUCGGAGAGACAUUUCAGAG, and AAUCUCGGAGAGACAUUUCAG.
[0034] The HLA gene siRNAs include AUCUGGAUGGUGUGAGAACCG, UGUCACUGCUUGCAGCCUGAG, UCACAAAGGGAAGGGCAGGAA, UUGCAGAAACAAAGUCAGGGU, and ACACGAACACAGACACAUGCA.
[0035] The siRNA for the GDF15 gene includes UAUAAAUACAGCUGUUUGGGC, AGACUUAUAUAAAUACAGCUG, AAUUAAUAAUAAAUAACAGAC, AUCUGAGAGCCAUUCACCGUC, and UGCAACUCCAGCUGGGGCCGU.
[0036] The siRNAs for the TNC gene include UAUGAAAUGUAAAAAAAGGGA, AAUCAUAUCCUUAAAAUGGAA, UAAUCAUAUCCUUAAAAUGGA, UGAAAAAUCCUUAGUUUUCAU, and AGAAGUAAAAAACUAUUGCGA.
[0037] The siRNA for the PTP1B gene includes UGAUAUAGUCAUUAUCUUCUU, UCCAUUUUUAUCAAACUAGCG, AUUGUUUAAAUAAAUAUGGAG, AAUUUUAAUACAUUAUUGGUU, and UUUAUUAUUGUACUUUUUGAU.
[0038] The siRNAs for the mHTT gene include UAUGUUUUCACAUAUUGUCAG, AUUUAGUAGCCAACUAUAGAA, AUGUUUUUCAAUAAAUGUGCC, UAUGAAUAGCAUUCUUAUCUG, and UAUUUGUUCCUCUUAAUACAA.
[0039] The siRNAs for the Lrrk2 gene include AUUAACAUGAAAAUAUCACUU, UUAACAAUAUCAUAUAAUCUU, AUCUUUAAAAUUUGUUAACGC, UUGAUUUAAGAAAAUAGUCUC, and UUUGAUAACAGUAUUUUUCUG.
[0040] The siRNAs for the α-synuclein gene include AUAUAUUAACAAAUUUCACAA, AAGUAUUAUAUAUUAACAA, AUAACUUUAUAUUUUUGUCCU, UAACUAAAAAAUUAUUUCGAG, and UCGAAUAUUAUUUAUUGUCAG.
[0041] Those skilled in the art will understand that the RNA sequences that can be used in the present invention also include RNA sequences having more than 80% homology to the aforementioned RNAs. For example, the homologies may be 85%, 88%, 90%, 95%, 98%, etc.
[0042] In one embodiment of the present invention, the nucleotide sequences encoding the one or more RNAs in the isolated nucleic acid that inhibit gene expression include RNA fragment sequences for the gene. The RNA fragment sequence is typically an RNA sequence complementary to the target nucleotide sequence of the gene. If the RNA is an siRNA, the RNA fragment sequence is the sense strand sequence of the siRNA.
[0043] In one embodiment of the present invention, the length of the sequence encoding one or more RNAs in the isolated nucleic acid that inhibit gene expression is 15 to 29 nucleotides (nt), preferably 18 to 22 nt, for example, 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. Extensive testing has shown that when the RNA sequence length is shorter than 18 nt, especially shorter than 15 nt, the RNA sequence is almost ineffective and does not exert any effect. However, when the RNA sequence length is longer than 22 nt, especially longer than 25 nt, not only does the cost of the circuit increase significantly, but the effect is not superior to that of RNA sequences with a length of 18 to 22 nt, resulting in poor economic performance. Therefore, the most effective balance between cost and effect is achieved when the RNA sequence length is 15 to 25 nt, especially 18 to 22 nt.
[0044] In the present invention, the isolated nucleic acid further includes its variants and derivatives. Those skilled in the art can modify the nucleic acid using general methods. Modification methods include, but are not limited to, methylation modification, hydrocarbyl modification, glycosyl modification (e.g., 2-methoxyglycosyl modification, hydrocarbyl-glycosyl modification, sugar ring modification, etc.), nucleation modification, peptide segment modification, lipid modification, halogen modification, nucleic acid modification (e.g., "TT" modification). In one embodiment of the present invention, the modification is selected from internucleotide bonds, for example, phosphorothioates, 2'-O-methoxyethyl (MOE), 2'-fluoro, alkylphosphonates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamides, carboxymethyl esters, and combinations thereof. In one embodiment of the present invention, the modification is a nucleotide modification, for example, selected from peptide nucleic acids (PNA), linear nucleic acids (LNA), arabinose nucleic acids (FANA), analogs, derivatives, and combinations thereof. Preferably, the modification is a 2'-fluoropyrimidine modification. The 2'-fluoropyrimidine modification replaces the 2'-OH group of the pyrimidine nucleotide on the RNA with a 2'-F group. The 2'-F group makes the RNA less recognizable by RNA enzymes in the body, thereby increasing the stability of RNA fragment delivery in the body.
[0045] In one embodiment of the present invention, the nucleotides encoding the one or more RNAs in the isolated nucleic acid that inhibit gene expression further include one or more of the following: flanking sequences (e.g., 5' flanking sequences and 3' flanking sequences), stem-loop sequences, and compensation sequences for RNA sequences.
[0046] The compensation sequence is the reverse complementary sequence of the RNA fragment sequence. In one embodiment of the present invention, the compensation sequence is the reverse complementary sequence of the RNA fragment sequence, with any bases at positions 1 to 5 deleted. In yet another embodiment of the present invention, the compensation sequence is the reverse complementary sequence of the RNA fragment sequence, with any bases at positions 1 to 3, particularly a sequence of bases at positions 1 to 3 deleted. Most preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, with bases at positions 9 and / or 10 deleted. Generally, the RNA sequence is expressible at the target receptor, while the compensation sequence is not expressible at the target receptor.
[0047] A flanking sequence is a sequence used to help shear RNA molecules, such as siRNA molecules, into the correct final sequence. In this invention, a flanking structure of a natural miRNA precursor may be used as the flanking structure for the RNA molecule of the present invention. For example, the flanking structure of pre-miR-155 is used.
[0048] In one embodiment of the present invention, the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence having more than 80% homology thereto, for example, sequences having 85%, 90%, 92%, 95%, 98%, or 99% homology.
[0049] In one embodiment of the present invention, the 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence having more than 80% homology thereto, such as sequences having 85%, 90%, 92%, 95%, 98%, or 99% homology. The stem-loop structure is a spacer sequence that encodes a hairpin structure capable of maintaining RNA stability. In one embodiment of the present invention, the sequence of the stem-loop structure is preferably gttttggccactgactgac or a sequence having more than 80% homology thereto.
[0050] In one embodiment of the present invention, the sequences encoding one or more RNAs in the isolated nucleic acid that inhibit gene expression are, in order: a 5' flanking sequence, an RNA fragment sequence, a stem-loop sequence, a compensation sequence, and a 3' flanking sequence. In one embodiment of the present invention, the 5' end of the RNA has a promoter.
[0051] The inventors of this application have discovered and experimentally demonstrated that the above-mentioned specific combination of flanking sequence, compensation sequence, and stem-loop structure sequence allows for the maximum transcription, cleavage, and encapsulation of a desired RNA sequence within an exosome.
[0052] In one embodiment of the present invention, (a) in the nucleic acid is a nucleotide sequence encoding the plurality of RNAs that inhibit gene expression. For example, the plurality of RNAs that inhibit gene expression are 2 to 4 RNAs that inhibit gene expression. When (a) is a nucleotide sequence encoding the plurality of RNAs that inhibit gene expression, the plurality of RNAs are linked via a linker. The structure of the linker is, for example, sequence 1-sequence 2-sequence 3. Here, sequence 1 is preferably CAGATC, sequence 2 may be a sequence consisting of 5 to 80 bases, preferably a sequence consisting of 10 to 50 bases, and more preferably a sequence consisting of 20 to 40 bases. Sequence 3 is preferably TGGATC. In one embodiment of the present invention, the sequence of the linker is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
[0053] In one embodiment of the present invention, the targeting protein is a target tissue-specific targeting peptide.
[0054] In one embodiment of the present invention, the targeting protein is a fusion protein of a target tissue-specific targeting peptide and a membrane protein.
[0055] In one embodiment of the present invention, the specific targeting peptide is selected from RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide.
[0056] In one embodiment of the present invention, the targeting protein is a membrane protein, selected from, for example, a cell receptor protein (e.g., a growth factor receptor), LAMP1 or LAMP2 (e.g., LAMP2B), an antibody, or a cleavage thereof.
[0057] In one embodiment of the present invention, the targeting protein is an RVG-LAMP2B fusion protein, a GE11-LAMP2B fusion protein, a PTP-LAMP2B fusion protein, a TCP-1-LAMP2B fusion protein, or an MSP-LAMP2B fusion protein.
[0058] In one embodiment of the present invention, the target tissue is the brain, pineal gland, pituitary gland, eye, ear, nose, mouth, pharynx, parotid gland, tonsil, esophagus, trachea, thyroid gland, thymus, breast, lung, heart, stomach, intestine, appendix, liver, gallbladder, spleen, pancreas, kidney, ureter, bladder, urethra, uterus, ovary, fallopian tube, vagina, vas deferens, prostate, penis, testicles, anus, bone, muscle, connective tissue, nerve, lymph, colorectal, blood, bone marrow, and / or skin. In one embodiment of the present invention, the target cell is a cell of the above target tissue.
[0059] In one aspect of the present invention, the nucleic acid, after being administered to a mammal, enriches tissues (including the liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, particularly the liver), and its expression products are encapsulated in large quantities in exosomes produced and secreted by the cells of these tissues, and delivered to target tissues to exert a therapeutic effect. Therefore, the targeting protein encoded by the nucleic acid needs to select an available targeting tag depending on the target tissue, while ensuring that the targeting tag stably appears on the surface of the exosome in order to reach its target function.
[0060] Targeting peptides suitable for use in the present invention include, but are not limited to, the RVG targeting peptide (nucleotide sequence indicated by SEQ ID No: 1), the GE11 targeting peptide (nucleotide sequence indicated by SEQ ID No: 2), the PTP targeting peptide (nucleotide sequence indicated by SEQ ID No: 3), the TCP-1 targeting peptide (nucleotide sequence indicated by SEQ ID No: 4), and the MSP targeting peptide (nucleotide sequence indicated by SEQ ID No: 5). Targeting proteins include, but are not limited to, RVG-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 7), PTP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 9), and MSP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 10).
[0061] Among these, the RVG targeting peptide and RVG-LAMP2B fusion protein can accurately target brain tissue. The GE11 targeting peptide and GE11-LAMP2B fusion protein can accurately target EGFR-highly expressing organ tissues, such as EGFR-mutated lung cancer tissue. The PTP targeting peptide and PTP-LAMP2B fusion protein can accurately target the plectin-1 protein, which is specifically expressed in the pancreas, particularly in human and mouse-derived pancreatic cancer tissue. The TCP-1 targeting peptide and TCP-1-LAMP2B fusion protein can accurately target the colon. The MSP targeting peptide and MSP-LAMP2B fusion protein can accurately target muscle tissue.
[0062] In practical applications, targeting proteins can be combined with various different RNAs that inhibit gene expression to inhibit their specific target genes in various tissues. For example, RVG targeting peptides and RVG-LAMP2B fusion proteins can be combined with siRNA for the EGFR gene, siRNA for the TNC gene, or a combination of both to treat glioblastoma; combined with siRNA for the PTP1B gene to treat obesity; combined with siRNA for the mHTT gene to treat Huntington's disease; and combined with siRNA for the LRRK2 gene to treat Parkinson's disease. GE11 targeting peptides and GE11-LAMP2B fusion proteins can be combined with siRNA for the EGFR gene to treat diseases such as lung cancer induced by high expression or mutations of the EGFR gene. TCP-1 targeting peptides or TCP-1-LAMP2B fusion proteins can be combined with siRNA for the TNF-α gene, siRNA for the integrin-α gene, siRNA for the B7 gene, or any combination of these three to treat colitis or colon cancer, etc.
[0063] In one embodiment of the present invention, (a) in the nucleic acid is a nucleotide sequence encoding the plurality of RNAs that inhibit gene expression. The plurality of RNAs that inhibit gene expression can be administered to the target of treatment simultaneously or separately. In one embodiment of the present invention, the plurality of RNAs can each be located in different plasmid vectors or viral vectors. For example, one plasmid or viral vector may include a promoter and a targeting tag, and the other plasmid may include a promoter and an RNA fragment. That is, the targeting tag and the RNA fragment are incorporated into different vectors, and two or more vectors are injected into the body simultaneously or separately. More preferably, when injecting the two or more different vectors into the host, the vector incorporating the RNA sequence may be injected first, and then the vector containing the targeting tag may be injected (for example, 1 to 2 hours later), thereby achieving a better targeting effect.
[0064] In one embodiment of the present invention, the nucleic acid is enriched in the liver of a mammal, and the product is encapsulated in exosomes within hepatocytes.
[0065] In one aspect of the present invention, (a) A nucleotide sequence encoding one or more RNAs that inhibit gene expression, wherein the RNA is a miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, or any combination thereof, Optionally, we provide a vector of RNA that inhibits gene expression, comprising (b) a nucleotide sequence encoding a targeting protein.
[0066] In one embodiment of the present invention, the vector comprises the isolated nucleic acid according to the present invention described above, which encodes a nucleotide sequence of RNA that can inhibit gene expression.
[0067] In one embodiment of the present invention, the vector is a plasmid. In one embodiment of the present invention, after administration to a mammal, the plasmid becomes enriched in tissues (including the liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, particularly the liver) and can transcribe and / or express the RNA fragment of the present invention, the RNA fragment being encapsulated in exosomes within the cells of the tissue.
[0068] In one embodiment of the present invention, the vector is a viral vector. For example, it may be a baculovirus expression vector, an adenovirus vector, a retrovirus vector, a herpesvirus vector, or a lentivirus vector.
[0069] In one embodiment of the present invention, the vector is an adenovirus vector. Preferably, the adenovirus is adenovirus-associated virus type 5, adenovirus-associated virus type 8, or adenovirus-associated virus type 9. More preferably, the adenovirus is adenovirus-associated virus type 5.
[0070] In one embodiment of the present invention, the plasmid or viral vector, after being administered to a mammal, becomes enriched and expressed in the liver, and its products are encapsulated in large quantities in exosomes.
[0071] One aspect of the present invention provides an exosome having RNA that inhibits gene expression, including the nucleic acid or vector described above. In one embodiment of the present invention, the exosome is derived from human tissue or cells. The tissues include the liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph, thyroid gland, reproductive organs, blood cells, or lymphocytes. In one embodiment of the present invention, the exosome is derived from the liver or liver cells.
[0072] One aspect of the present invention provides a pharmaceutical composition comprising the nucleic acid, vector, or exosome described above. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient for target delivery of the nucleic acid, vector, or exosome.
[0073] The administration methods of the drug include oral administration, inhalation administration, subcutaneous injection, intramuscular injection, and intravenous injection. That is, the drug can be administered by any of the following methods: oral administration, inhalation administration, subcutaneous injection, intramuscular injection, or intravenous injection. The dosage form of the drug may be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc. After administration to a mammal, the plasmid or viral vector in the drug becomes enriched in tissues (including the liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, especially the liver), and its expression products are encapsulated in large quantities in exosomes within the cells of the tissue, delivered to the target tissue, and exert a therapeutic effect.
[0074] The aforementioned pharmaceutical composition is useful for treating various diseases, including tumors, acute and chronic infections, or other acute and chronic diseases. The acute and chronic infections include viral diseases such as viral influenza, viral hepatitis, AIDS, and SARS, bacterial diseases (e.g., tuberculosis, bacterial pneumonia), and acute and chronic infections caused by various other pathogenic microorganisms. The other acute and chronic diseases include respiratory diseases, immune system diseases, blood and hematopoietic system diseases, circulatory system diseases such as cardiovascular and cerebrovascular diseases, endocrine and metabolic diseases, digestive system diseases, nervous system diseases, urinary tract diseases, reproductive system diseases, and musculoskeletal diseases. For example, the diseases include cancer, pulmonary fibrosis, colitis, obesity, cardiovascular diseases caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.
[0075] One aspect of the present invention provides a method for treating a disease, comprising administering the above-mentioned nucleic acids, vectors, or exosomes to a target. The disease includes tumors, acute and chronic infections, or other acute and chronic diseases.
[0076] Those skilled in the art understand that the actual dose will vary depending on various factors, including the vector, target cells or tissues, the general condition of the subject being treated, the degree of transformation / modification desired, the route of administration, the method of administration, and the type of transformation / modification desired. [Brief explanation of the drawing]
[0077] [Figure 1] This is a comparative diagram of plasmid distribution and metabolic status in a mouse according to one embodiment of the present invention. [Figure 2] This is a comparative diagram of protein expression levels in mice according to one embodiment of the present invention. [Figure 3] This is a comparative diagram of the levels of related siRNAs in the body of a mouse according to one embodiment of the present invention. [Figure 4] This is a comparative diagram of absolute siRNA levels in various mouse tissues according to one embodiment of the present invention. [Figure 5]This is a comparative diagram showing the effect of plasmid dose on mouse siRNA levels according to one embodiment of the present invention. [Figure 6] This is a comparative diagram of the metabolic status of precursors and mature products in the liver of mice after plasmid injection, according to one embodiment of the present invention. [Figure 7] This is a comparative diagram of the dynamics and distribution of siRNA in various mouse tissues according to one embodiment of the present invention. [Figure 8] This is a comparative diagram showing the effects of various promoters on siRNA, according to one embodiment of the present invention. [Figure 9] This is a comparative diagram of eGFP fluorescence intensity in various mouse tissues according to one embodiment of the present invention. [Figure 10] This is a comparative diagram of the content of alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, and creatinine, as well as the thymus weight, spleen weight, and peripheral blood cell percentages in mice according to one embodiment of the present invention. [Figure 11] This is a comparative diagram of the therapeutic effect of one embodiment of the present invention on mouse EGFR-mutated lung cancer tumors. [Figure 12] These are HE staining diagrams, immunohistochemical staining diagrams, and colored statistical diagrams of mice according to one embodiment of the present invention. [Figure 13] This is a comparative diagram of the therapeutic effect of one embodiment of the present invention on mouse KRAS-mutated lung cancer tumors. [Figure 14] These are HE staining diagrams, immunohistochemical staining diagrams, and colored statistical diagrams of mice according to one embodiment of the present invention. [Figure 15]The figure shows the fluorescence signals of six different RNA plasmids after lung cancer treatment according to one embodiment of the present invention. In the figure, A is the fluorescence detection result for CMV-siRE and Albumin-siRE, B is the fluorescence detection result for CMV-siRT and Albumin-siRT, C is the fluorescence detection result for CMV-miR7 and AlbuminmiR7, D is the fluorescence detection result for CMV-shRE and Albumin-shRE, E is the fluorescence detection result for CMV-shRT and Albumin-shRT, and F is the fluorescence detection result for CMV-miR133b and Albumin-miR133b. [Figure 16] This is a statistical analysis of fluorescence signals after lung cancer treatment with four groups of plasmids consisting of any two RNA sequences from six types of RNA according to one embodiment of the present invention. In all cases, the RNA was linked with CMV or Albumin. In the figure, A is the fluorescence detection result for siRE+shRT, B is the fluorescence detection result for shRE+miR133b, C is the fluorescence detection result for siRT+miR7, and D is the fluorescence detection result for shRT+miR133b. [Figure 17] This is a statistical analysis of fluorescence signals after lung cancer treatment with three groups of plasmids consisting of any three RNA sequences from the six types of RNA described in the examples of this application. In all cases, the RNA was linked with CMV or Albumin. In the figure, A is the fluorescence detection result for siRE+shRT+miR7, B is the fluorescence detection result for siRT+shRE+miR7, and C is the fluorescence detection result for shRE+siRT+miR133b. [Figure 18] The figures show the enrichment results of siRNA in the liver, lungs, plasma, and exosomes when plasmid CMV-siRE and plasmid MV-GE11-siRE were intravenously injected according to one embodiment of the present invention. In the figures, A represents the EGFR siRNA content in the liver and lungs with and without the targeting peptide GE11, and B represents the EGFR siRNA content in the plasma and exosomes with and without the targeting peptide GE11. [Figure 19]The figures show the results of detecting the expression levels of EGFR protein and mRNA when plasmid CMV-siRE and plasmid MV-GE11-siRE are intravenously injected, respectively, according to one embodiment of the present invention. In the figure, A represents the EGFR protein content detected with and without the targeting peptide GE11, and B represents the EGFR mRNA content detected with and without the targeting peptide GE11. [Figure 20] The enrichment and therapeutic effects in the lungs of a plasmid containing a sequence having more than 80% homology to the 5' flanking sequence, according to one embodiment of the present invention, in which A is the EGFR siRNA content of two 5' flanking homology sequences with and without the targeting tag RVG, B is the detection result of the fluorescence signal of one 5' flanking homology sequence with and without the targeting tag RVG, and C is the detection result of the fluorescence signal of another 5' flanking homology sequence with and without the targeting tag RVG. [Figure 21] The enrichment and therapeutic effects in the lungs of a plasmid containing a sequence having more than 80% homology of the loop sequence, according to one embodiment of the present invention, where A is the EGFR siRNA content of two loop homology sequences with and without the targeting tag RVG, B is the detection result of the fluorescence signal of one loop homology sequence with and without the targeting tag RVG, and C is the detection result of the fluorescence signal of another loop homology sequence with and without the targeting tag RVG. [Figure 22] The enrichment and therapeutic effects in the lungs of a plasmid containing a sequence having more than 80% homology to the 3' flanking sequence, according to one embodiment of the present invention, where A is the EGFR siRNA content of two 3' flanking homology sequences with and without the targeting tag RVG, B is the detection result of the fluorescence signal of one 3' flanking homology sequence with and without the targeting tag RVG, and C is the detection result of the fluorescence signal of another 3' flanking homology sequence with and without the targeting tag RVG. [Figure 23]The following are the results of detecting the EGFR siRNA content in lung tissue 9 hours after intravenous injection of a plasmid containing sequence 4 and two sequences 4-1 and 4-2, respectively, which have more than 80% homology to sequence 4, according to one embodiment of the present invention. The RNA is siRE / siRT. In the figure, A is the result of detecting the EGFR siRNA content of sequence 4, B is the result of detecting the EGFR siRNA content of sequence 4-1, and C is the result of detecting the EGFR siRNA content of sequence 4-2. [Figure 24] In one embodiment of the present invention, the EGFR expression levels were detected after intravenous injection of three plasmids containing RNA sequences of lengths 18, 20, and 22. In the figure, A represents the detection result for EGFR protein content, and B represents the detection result for EGFR mRNA content. [Figure 25] This figure shows a treatment of mouse lung cancer based on KRAS siRNA according to one embodiment of the present invention. [Figure 26] This figure shows a treatment of mouse lung cancer based on EGFR siRNA according to one embodiment of the present invention. [Figure 27] This is a comparative diagram of the enzyme content of multiple mouse species according to one embodiment of the present invention. [Figure 28] This image shows the enrichment effect of a lentiviral vector in the liver, lungs, plasma, and exosomes, as well as the EGFR gene expression level, according to one embodiment of the present invention. A represents the enrichment effect of EGFR siRNA in the liver and lungs after intravenous injection of the lentiviral vector, B represents the enrichment effect of EGFR siRNA in plasma and exosomes after intravenous injection of the lentiviral vector, C represents the expression effect of EGFR protein after intravenous injection of the lentiviral vector, and D represents the expression effect of EGFR mRNA after intravenous injection of the lentiviral vector. [Figure 29]This embodiment of the present invention detects the enrichment effect of an adenovirus vector in the liver, lungs, plasma, and exosomes, as well as the EGFR gene expression level. A represents the enrichment effect of EGFR siRNA in the liver and lungs after intravenous injection of an adenovirus vector, B represents the enrichment effect of EGFR siRNA in plasma and exosomes after intravenous injection of an adenovirus vector, C represents the expression effect of EGFR protein after intravenous injection of an adenovirus vector, and D represents the expression effect of EGFR mRNA after intravenous injection of an adenovirus vector. [Figure 30] The figure shows the fluorescence signal statistics when lung cancer was treated with six different RNAs constructed in adeno-associated virus vectors according to one embodiment of the present invention. In the figure, A is the fluorescence signal statistics when lung cancer was treated with siRE constructed in an adeno-associated virus vector, B is the fluorescence signal statistics when lung cancer was treated with siRT constructed in an adeno-associated virus vector, C is the fluorescence signal statistics when lung cancer was treated with miR-7 constructed in an adeno-associated virus vector, D is the fluorescence signal statistics when lung cancer was treated with shRE constructed in an adeno-associated virus vector, E is the fluorescence signal statistics when lung cancer was treated with shRT constructed in an adeno-associated virus vector, and F is the fluorescence signal statistics when lung cancer was treated with miR-133b constructed in an adeno-associated virus vector. [Figure 31] The following are statistics of fluorescence signals when lung cancer was treated by constructing four groups of RNA fragments, each consisting of any two RNA sequences from six different RNAs, into an adeno-associated virus vector according to one embodiment of the present invention. In the figure, A is the statistics of fluorescence signals when lung cancer was treated by constructing siRE+shRT into an adeno-associated virus vector, B is the statistics of fluorescence signals when lung cancer was treated by constructing siRT+miR-7 into an adeno-associated virus vector, C is the statistics of fluorescence signals when lung cancer was treated by constructing shRE+miR-133b into an adeno-associated virus vector, and D is the statistics of fluorescence signals when lung cancer was treated by constructing shRT+miR-133b into an adeno-associated virus vector. [Figure 32] The figures show the statistics of fluorescence signals when lung cancer was treated by constructing three groups of RNA fragments, each consisting of any three RNA sequences from six different RNAs, into adeno-associated virus vectors according to the embodiments of the present invention. In the figures, A is the statistics of fluorescence signals when lung cancer was treated by constructing siRE+shRT+miR-7 into an adeno-associated virus vector, B is the statistics of fluorescence signals when lung cancer was treated by constructing siRT+shRE+miR-7 into an adeno-associated virus vector, and C is the statistics of fluorescence signals when lung cancer was treated by constructing shRE+siRT+miR-133b into an adeno-associated virus vector. [Figure 33] The figures show the enrichment results of siRNA in the liver, lungs, plasma, and exosomes after intravenous injection according to one embodiment of the present invention, as well as the detection results of EGFR protein and mRNA expression levels. In the figures, A shows the enrichment results of AAV-siRE and AAV-GE11-siRE in the liver and lungs, B shows the enrichment results of AAV-siRE and AAV-GE11-siRE in plasma and exosomes, C shows the EGFR protein expression level of AAV-siRE and AAV-GE11-siRE, and D shows the EGFR mRNA expression level of AAV-siRE and AAV-GE11-siRE. [Figure 34] This figure shows the enrichment and therapeutic effects in the lungs when two sequences having more than 80% homology to the 5' flanking sequence are constructed in an AAV vector according to one embodiment of the present invention. In the figure, A is the enrichment result in the lungs indicated by the EGFR siRNA content, B is the therapeutic effect of one of the sequences, and C is the therapeutic effect of the other sequence. [Figure 35] The figures show the enrichment and therapeutic effects in the lungs when a sequence having more than 80% homology to a loop sequence is constructed in an AAV vector according to one embodiment of the present invention. In the figures, A shows the enrichment results in the lungs depending on the EGFR siRNA content, B shows the therapeutic effect of one of the sequences, and C shows the therapeutic effect of the other sequence. [Figure 36]This figure shows the enrichment and therapeutic effects in the lungs when a sequence having more than 80% homology to the 3' flanking sequence is constructed in an AAV vector according to one embodiment of the present invention. In the figure, A shows the enrichment effect in the lungs depending on the EGFR siRNA content, B shows the therapeutic effect of one of the sequences, and C shows the therapeutic effect of the other sequence. [Figure 37] The following are the results of detecting the EGFR siRNA content in lung tissue 9 hours after intravenous injection of sequence 4 and two sequences 4-1 and 4-2, which have more than 80% homology to sequence 4, in one embodiment of the present invention. In the figure, A is the detection result for sequence 4, B is the detection result for sequence 4-1, and C is the detection result for sequence 4-2. [Figure 38] This figure shows the EGFR expression level after intravenous injection of a gene circuit containing three RNA sequences of different lengths according to one embodiment of the present invention. In the figure, A represents the result for EGFR protein content, and B represents the result for EGFR mRNA content. [Figure 39] This is a comparative image of mouse renal cancer tumor images according to the embodiments of the present invention. [Figure 40] This is a comparative diagram showing the progression of mouse renal cancer tumors according to one embodiment of the present invention. [Figure 41] This diagram illustrates the in vivo enrichment (plasma, exosome) and self-assembly of an adeno-associated virus (AAV) vector containing RNA fragments, and its therapeutic effect on colorectal cancer, pancreatic cancer, glioblastoma, lung cancer, and kidney cancer (indicated by siRNA content), according to one embodiment of the present invention. [Figure 42] This invention describes the in vivo enrichment, self-assembly, and therapeutic effects on lung cancer, kidney cancer, pancreatic cancer, obesity, and glioblastoma of adeno-associated virus (AAV) when used as a viral vector containing siRE, siRV, siRK, and siRE+T, as shown in one embodiment of the present invention. In the figure, A to E are the detection results of fluorescence signals for lung cancer, kidney cancer, pancreatic cancer, obesity, and glioblastoma, respectively. [Figure 43]Other embodiments of the present invention demonstrate the in vivo enrichment, self-assembly, and therapeutic effects on lung cancer, kidney cancer, pancreatic cancer, obesity, and glioblastoma when lentivirus (LV) is used as a viral vector containing siRE, siRV, siRK, and siRE+T. In the figure, A to E represent the detection results of fluorescence signals for lung cancer, kidney cancer, pancreatic cancer, obesity, and glioblastoma, respectively. [Figure 44] In one embodiment of the present invention, when multiple RNA fragments are supported in a viral vector delivery system, all of them exhibit enrichment, self-assembly, and therapeutic effects against lung cancer in vivo. In the figure, A shows the tumor volume effect when an RNA sequence acts alone, and B shows the tumor volume effect when 2-3 RNA fragments constitute an RNA sequence and act together. [Figure 45] In one embodiment of the present invention, when multiple RNA fragments are supported on a viral vector delivery system, all of them exhibit enrichment, self-assembly, and therapeutic effects against renal cancer in vivo. In the figure, A shows the tumor volume effect when an RNA sequence acts alone, and B shows the tumor volume effect when 2-3 RNA fragments constitute an RNA sequence and act together. [Figure 46] In one embodiment of the present invention, when multiple RNA fragments are supported on a viral vector delivery system, all of them exhibit enrichment, self-assembly, and therapeutic effects against colorectal cancer in vivo. In the figure, A shows the tumor volume effect when an RNA sequence acts alone, and B shows the tumor volume effect when 2-3 RNA fragments constitute an RNA sequence and act together. [Figure 47] In one embodiment of the present invention, when multiple RNA fragments are supported in a viral vector delivery system, all of them exhibit enrichment, self-assembly, and therapeutic effects against pancreatic cancer in vivo. In the figure, A shows the tumor volume effect when an RNA sequence acts alone, and B shows the tumor volume effect when 2-3 RNA fragments constitute an RNA sequence and act together. [Figure 48]In one embodiment of the present invention, when multiple RNA fragments are supported on a viral vector delivery system, all of them exhibit enrichment, self-assembly, and therapeutic effects against glioblastoma in vivo. In the figure, A shows the tumor volume effect when an RNA sequence acts alone, and B shows the tumor volume effect when 2-3 RNA fragments constitute an RNA sequence and act together. [Figure 49] Even when the adenovirus vector delivery system according to one embodiment of the present invention contains 1-2 RNA fragments and 1-2 targeting tags, it exhibits in vivo enrichment, self-assembly, and cancer therapeutic effects. In the figure, A represents the therapeutic effect of the delivery system on pancreatic cancer, the vector is AAV, and the supported circuit is siRK or PTP-siRK. B represents the therapeutic effect of the delivery system on glioblastoma, the vector is AAV, and the supported circuit is siRE+T or RVG-siRE+T. [Figure 50] In one embodiment of the present invention, when an adenovirus vector contains multiple different 5' flanking sequences / loop sequences / 3' flanking sequences, it exhibits enrichment, self-assembly, and therapeutic effects against lung cancer, kidney cancer, pancreatic cancer, and glioblastoma. In the figure, A shows the effect on lung cancer tumor volume when two different 5' flanking sequences / loop sequences / 3' flanking sequences are linked with a siRE sequence and RVG is linked versus when it is not linked, and B shows the effect of two different 5' flanking sequences / loop sequences / 3' flanking sequences Figure C shows the effect on renal cancer tumor volume when ranking sequences are linked with an siRV sequence and RVG is linked versus not linked. Figure D shows the effect on pancreatic cancer tumor volume when two different 5' flanking sequences / loop sequences / 3' flanking sequences are linked with an siRP sequence and RVG is linked versus not linked. Figure D shows the effect on glioblastoma tumor volume when two different 5' flanking sequences / loop sequences / 3' flanking sequences are linked with an siRE+T sequence and RVG is linked versus not linked. [Figure 51]In one embodiment of the present invention, when an adenovirus vector carries multiple different 5' flanking sequences / loop sequences / 3' flanking sequences, it exhibits enrichment, self-assembly, and therapeutic effects against colorectal cancer in vivo. The figure shows the effect on tumor volume of colorectal cancer when two different 5' flanking sequences / loop sequences / 3' flanking sequences are linked with an siRV sequence and RVG is linked, and when it is not linked. [Figure 52] In the embodiments of this application, when the ligated sequence is sequence 4, and sequences 4-1 and 4-2 which have more than 80% homology to sequence 4, the delivery system containing the above sequences also has the corresponding enrichment, self-assembly, and cancer therapeutic effects. The figure shows the detection results of the EGFR siRNA content of sequences 4 / 4-1 / 4-2, respectively, and the ligated RNAs are siRE and siRT, respectively. [Figure 53] In one embodiment of the present invention, when the RNA sequences are 18, 20, and 22 in length, the delivery system containing the RNA sequences also has corresponding enrichment, self-assembly, and cancer therapeutic effects. In the figure, A is the EGFR protein content detected after injection of the delivery system constructed with RNA sequences of three different lengths, and B is the EGFR mRNA content detected after injection of the delivery system constructed with RNA sequences of three different lengths. [Figure 54] This is a comparative diagram showing the progression of colitis in mice according to one embodiment of the present invention. [Figure 55] This is a comparative diagram of HE staining of mouse colons according to one embodiment of the present invention. [Figure 56] This is a comparative diagram showing the progression of colitis in mice according to one embodiment of the present invention. [Figure 57] This is a comparative diagram of HE staining of mouse colons according to one embodiment of the present invention. [Figure 58] This is a comparative diagram of the treatment of mouse colitis and RNA expression levels according to one embodiment of the present invention. [Figure 59] This is a comparative diagram of cytokine concentrations and HE staining of the colon in mice according to one embodiment of the present invention. [Figure 60]This is a comparative diagram of the treatment of colitis in mice according to one embodiment of the present invention. [Figure 61] This is a comparative diagram of the disease activity index and levels of multiple siRNAs in mice according to one embodiment of the present invention. [Figure 62] This is a comparative diagram of siRNA and mRNA levels of multiple mouse species according to one embodiment of the present invention. [Figure 63] This is a comparative diagram of HE staining of mouse colons according to one embodiment of the present invention. [Figure 64] This figure shows the results of enriching mice with TNF-α siRNA in vivo by injection of TNF-α siRNA according to one embodiment of the present invention. In the figure, A represents the enrichment results of the liver, B represents the enrichment results of the plasma, and C represents the enrichment results of the colon. [Figure 65] This figure shows the results of determining the spontaneously formed complex structure by injecting a TNF-α siRNA-lentivirus into mice according to one embodiment of the present invention and detecting TNF-α siRNA from plasma exosomes. [Figure 66] This figure shows the results of the therapeutic effect of injecting mice with TNF-α siRNA-lentivirus according to one embodiment of the present invention. In the figure, A is the disease index score, B is the result of detecting inflammatory factors, and C is the result of detecting mRNA of the target gene. [Figure 67] This figure shows the results of in vivo enrichment when a viral vector containing six different RNAs—miR-19a (target gene TNF-α), miR-124-3p (target gene TNF-α), B7-siRNA-1, B7-siRNA-2, integrin α4 shRNA-1, and integrin α4 shRNA-2—is injected into mice according to one embodiment of the present invention. In the figure, A is the result of small RNA expression detected in the liver, B is the result of small RNA expression detected in the plasma, and C is the result of small RNA expression detected in the colon. [Figure 68]This figure shows the results of a specific therapeutic effect obtained by injecting mice with a viral vector containing six different RNAs: miR-19a (target gene TNF-α), miR-124-3p (target gene TNF-α), B7-siRNA-1, B7-siRNA-2, integrin α4 shRNA-1, and integrin α4 shRNA-2, according to one embodiment of the present invention. In the figure, A is the disease index score and B is the result of detecting inflammatory factors. [Figure 69] This figure shows the in vivo enrichment results when a viral vector containing four different RNA fragments is injected into mice according to one embodiment of the present invention. Each of the four RNA fragments contains any two RNA sequences, specifically miR-19a (target gene TNF-α) + B7-siRNA-1, miR-124-3p (target gene TNF-α) + B7-siRNA-2, B7-siRNA-1 + integrin α4 shRNA-1, and B7-siRNA-2 + integrin α4 shRNA-2. In the figure, A shows the results of small RNA (sequence 1) expression detected in the liver, B shows the results of small RNA (sequence 1) expression detected in the plasma, and C shows the results of small RNA (sequence 1) expression detected in the colon. [Figure 70] This figure shows the in vivo enrichment results when a viral vector containing four different RNA fragments is injected into mice according to another embodiment of the present invention. Each of the four RNA fragments contains any two RNA sequences, specifically miR-19a (target gene TNF-α) + B7-siRNA-1, miR-124-3p (target gene TNF-α) + B7-siRNA-2, B7-siRNA-1 + integrin α4 shRNA-1, and B7-siRNA-2 + integrin α4 shRNA-2. In the figure, A shows the results of small RNA (sequence 2) expression detected in the liver, B shows the results of small RNA (sequence 2) expression detected in the plasma, and C shows the results of small RNA (sequence 2) expression detected in the colon. [Figure 71]This figure shows the results of a specific therapeutic effect obtained by injecting mice with a viral vector containing four different RNA fragments according to one embodiment of the present invention. Each of the four RNA fragments contains any two RNA sequences, specifically miR-19a (target gene TNF-α) + B7-siRNA-1, miR-124-3p (target gene TNF-α) + B7-siRNA-2, B7-siRNA-1 + integrin α4 shRNA-1, and B7-siRNA-2 + integrin α4 shRNA-2. In the figure, A is the disease index score and B is the result of detecting inflammatory factors. [Figure 72] This figure shows the in vivo enrichment results when a viral vector containing three different RNA fragments is injected into mice according to one embodiment of the present invention. Each of the three RNA fragments contains any three RNA sequences, specifically miR-19a (target gene TNF-α) + B7-siRNA-1 + integrin α4 shRNA-1, miR-124-3p (target gene TNF-α) + B7-siRNA-2 + integrin α4 shRNA-2, and miR-19a (target gene TNF-α) + B7-siRNA-1 + integrin α4 shRNA-2. In the figure, A is the result of small RNA (sequence 1) expression detected in the liver, B is the result of small RNA (sequence 1) expression detected in the plasma, and C is the result of small RNA (sequence 1) expression detected in the colon. [Figure 73]This figure shows the in vivo enrichment results when a viral vector containing three different RNA fragments is injected into mice according to another embodiment of the present invention. Each of the three RNA fragments contains any three RNA sequences, specifically miR-19a (target gene TNF-α) + B7-siRNA-1 + integrin α4 shRNA-1, miR-124-3p (target gene TNF-α) + B7-siRNA-2 + integrin α4 shRNA-2, and miR-19a (target gene TNF-α) + B7-siRNA-1 + integrin α4 shRNA-2. In the figure, A is the result of small RNA (sequence 2) expression detected in the liver, B is the result of small RNA (sequence 2) expression detected in the plasma, and C is the result of small RNA (sequence 2) expression detected in the colon. [Figure 74] This figure shows the in vivo enrichment results when a viral vector containing three different RNA fragments is injected into mice according to yet another embodiment of the present invention. Each of the three RNA fragments contains any three RNA sequences, specifically miR-19a (target gene TNF-α) + B7-siRNA-1 + integrin α4 shRNA-1, miR-124-3p (target gene TNF-α) + B7-siRNA-2 + integrin α4 shRNA-2, and miR-19a (target gene TNF-α) + B7-siRNA-1 + integrin α4 shRNA-2. In the figure, A is the result of small RNA (sequence 3) expression detected in the liver, B is the result of small RNA (sequence 3) expression detected in the plasma, and C is the result of small RNA (sequence 3) expression detected in the colon. [Figure 75]This figure shows the results of a specific therapeutic effect obtained by injecting mice with a viral vector containing three different RNA fragments according to one embodiment of the present invention. Each of the three RNA fragments contains any three types of RNA sequences, specifically miR-19a (target gene TNF-α) + B7-siRNA-1 + integrin α4 shRNA-1, miR-124-3p (target gene TNF-α) + B7-siRNA-2 + integrin α4 shRNA-2, and miR-19a (target gene TNF-α) + B7-siRNA-1 + integrin α4 shRNA-2. In the figure, A is the disease index score and B is the result of detecting inflammatory factors. [Figure 76] This figure shows the in vivo enrichment results when a viral vector containing RNA sequences of different lengths is injected into mice according to one embodiment of the present invention. The RNA sequences of different lengths are TNF-α-siRNA-1 (siRNA length 18 bp), TNF-α-siRNA-2 (siRNA length 20 bp), and TNF-α-siRNA-3 (siRNA length 22 bp), respectively. In the figure, A represents the results of siRNA expression detected in the liver, B represents the results of siRNA expression detected in the plasma, and C represents the results of siRNA expression detected in the colon. [Figure 77] This figure shows the results of a specific therapeutic effect obtained by injecting mice with viral vectors containing RNA sequences of different lengths according to another embodiment of the present invention. The RNA sequences of different lengths are TNF-α-siRNA-1 (siRNA length 18 bp), TNF-α-siRNA-2 (siRNA length 20 bp), and TNF-α-siRNA-3 (siRNA length 22 bp), respectively. In the figure, A is the disease index score, B is the detection result of inflammatory factors, and C is the detection result of mRNA of the target gene. [Figure 78]This figure shows the in vivo enrichment results when a viral vector containing three homologous TNF-α-siRNA sequences is injected into mice according to one embodiment of the present invention. The homologous TNF-α-siRNA sequences are TNF-α-siRNA-4, TNF-α-siRNA-5, and TNF-α-siRNA-6, respectively. In the figure, A represents the results of TNF-α-siRNA expression detected in the liver, B represents the results of TNF-α-siRNA expression detected in plasma, C represents the results of TNF-α-siRNA expression detected in the colon, and D represents the results of TNF-α-siRNA expression detected in plasma exosomes. [Figure 79] This figure shows the in vivo enrichment results when a viral vector containing three homologous B7-siRNA sequences is injected into mice according to another embodiment of the present invention. The homologous B7-siRNA sequences are B7-siRNA-1, B7-siRNA-2, and B7-siRNA-3, respectively. In the figure, A represents the results of B7-siRNA expression detected in the liver, B represents the results of B7-siRNA expression detected in the plasma, C represents the results of B7-siRNA expression detected in the colon, and D represents the results of B7-siRNA expression detected in plasma exosomes. [Figure 80] This figure shows the in vivo enrichment results when a viral vector containing three homologous integrin α4 siRNA sequences is injected into mice according to yet another embodiment of the present invention. The homologous integrin α4 siRNA sequences are integrin α4 siRNA-1, integrin α4 siRNA-2, and integrin α4 siRNA-3, respectively. In the figure, A shows the results of integrin α4 siRNA expression detected in the liver, B shows the results of integrin α4 siRNA expression detected in the plasma, C shows the results of integrin α4 siRNA expression detected in the colon, and D shows the results of integrin α4 siRNA expression detected in plasma exosomes. [Figure 81]This figure shows the results of a specific therapeutic effect obtained by injecting mice with a viral vector containing nine homologous siRNA sequences, according to one embodiment of the present invention. The homologous siRNA sequences are TNF-α-siRNA-4, TNF-α-siRNA-5, TNF-α-siRNA-6, B7-siRNA-1, B7-siRNA-2, B7-siRNA-3, integrin α4 siRNA-1, integrin α4 siRNA-2, and integrin α4 siRNA-3, respectively. In the figure, A is the disease index score and B is the result of detecting inflammatory factors. [Figure 82] This figure shows the in vivo enrichment results when RNA fragments containing different flanking sequences, loop sequences, and reverse complementary sequences are injected into mice according to one embodiment of the present invention. The sequences are, respectively, two distinct sequences with more than 80% homology to the identified 5' flanking sequence, two distinct sequences with more than 80% homology to the identified loop sequence, two distinct sequences with more than 80% homology to the identified 3' flanking sequence, a reverse complementary sequence of one normal sequence, and a reverse complementary sequence of a distinct sequence with more than 80% homology to the identified 5' flanking sequence. In the figure, A is the result of TNF-α-siRNA expression detected in the liver, B is the result of TNF-α-siRNA expression detected in plasma, and D is the result of TNF-α-siRNA expression detected in plasma exosomes. [Figure 83] This figure shows the results of a specific therapeutic effect obtained by injecting mice with a viral vector containing RNA fragments including different flanking sequences, loop sequences, and reverse complementary sequences, according to one embodiment of the present invention. The sequences are, respectively, two distinct sequences having more than 80% homology to the identified 5' flanking sequence, two distinct sequences having more than 80% homology to the identified loop sequence, two distinct sequences having more than 80% homology to the identified 3' flanking sequence, a reverse complementary sequence to one normal sequence, and one distinct sequence having more than 80% homology to the identified 5' flanking sequence. In the figure, A is the disease index score, B is the detection result of inflammatory factors, and C is the detection result of mRNA of the target gene. [Figure 84] This figure shows the enrichment results in vivo in mice when, according to one embodiment of the present invention, multiple circuits are supported on an adenovirus vector, and adjacent circuits are linked by sequence 1-sequence 2-sequence 3, with sequence 2 being 5 nucleotides, 10 nucleotides, 20 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, and 80 nucleotides, respectively. A shows the results of TNF-α-siRNA expression detected in the liver, B shows the results of TNF-α-siRNA expression detected in the plasma, and C shows the results of TNF-α-siRNA expression detected in the colon. [Figure 85] This figure shows the enrichment results in vivo in mice when, according to other embodiments of the present invention, multiple circuits are supported on an adenovirus vector, and adjacent circuits are linked by sequence 1-sequence 2-sequence 3, with sequence 2 being 5 nucleotides, 10 nucleotides, 20 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, and 80 nucleotides, respectively. A shows the results of B7-1-siRNA expression detected in the liver, B shows the results of B7-1-siRNA expression detected in the plasma, and C shows the results of B7-1-siRNA expression detected in the colon. [Figure 86] This figure shows the enrichment results in vivo in mice when, according to yet another embodiment of the present invention, multiple circuits are supported on an adenovirus vector, and adjacent circuits are linked by sequence 1-sequence 2-sequence 3, with sequence 2 being 5 nucleotides, 10 nucleotides, 20 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, and 80 nucleotides, respectively. In the figure, A is the result of integrin α4-siRNA expression detected in the liver, B is the result of integrin α4-siRNA expression detected in the plasma, and C is the result of integrin α4-siRNA expression detected in the colon. [Figure 87] This figure shows the enrichment results in vivo in mice when, according to one embodiment of the present invention, multiple circuits are supported on an adenovirus vector, and the ligation sequence is sequence 4 and two sequences having more than 80% homology to sequence 4. In the figure, A is the result of TNF-α-siRNA expression detected in the liver, B is the result of TNF-α-siRNA expression detected in the plasma, and C is the result of TNF-α-siRNA expression detected in the colon. [Figure 88] This figure shows the in vivo enrichment results in mice when, according to another embodiment of the present invention, multiple circuits are supported on an adenovirus vector, and the ligation sequence is sequence 4 and two sequences having more than 80% homology to sequence 4. In the figure, A is the result of B7-1-siRNA expression detected in the liver, B is the result of B7-1-siRNA expression detected in the plasma, and C is the result of B7-1-siRNA expression detected in the colon. [Figure 89] This figure shows the enrichment results in vivo in mice when, according to yet another embodiment of the present invention, multiple circuits are supported on an adenovirus vector, and the ligation sequence is sequence 4 and two sequences having more than 80% homology to sequence 4. In the figure, A is the result of integrin α4-siRNA expression detected in the liver, B is the result of integrin α4-siRNA expression detected in the plasma, and C is the result of integrin α4-siRNA expression detected in the colon. [Figure 90] This figure shows the results of specific therapeutic effects in mice when, according to one embodiment of the present invention, multiple circuits are supported on an adenovirus vector, and the ligation sequence is sequence 4 and two sequences having more than 80% homology to sequence 4. In the figure, A is the disease index score, and B is the detection result of mRNA of the target gene. [Figure 91] This figure shows the enrichment results of TNF-α-siRNA supported on a viral vector in a mouse, when adenovirus-related viruses types 2, 7, and 8 are used as viral vectors according to one embodiment of the present invention. In the figure, A is the result of TNF-α-siRNA expression detected in the liver, B is the result of TNF-α-siRNA expression detected in the plasma, and C is the result of TNF-α-siRNA expression detected in the colon. [Figure 92]This figure shows the results of a specific therapeutic effect obtained by expressing TNF-α-siRNA supported on adenovirus-related viruses types 2, 7, and 8 as viral vectors in mice, according to one embodiment of the present invention. In the figure, A is the disease index score, B is the detection result of inflammatory factors, and C is the detection result of target gene mRNA. [Figure 93] This is a comparative diagram of the hydroxyproline content in mice according to one embodiment of the present invention. [Figure 94] This is a fluorescent staining image of a mouse lung according to one embodiment of the present invention. [Figure 95] This is a Masson three-color stained image of a mouse lung according to one embodiment of the present invention. [Figure 96] This is an HE stained image of a mouse lung according to one embodiment of the present invention. [Figure 97] This is a comparative diagram of some mouse proteins and mRNA levels according to one embodiment of the present invention. [Figure 98] This figure shows data on the therapeutic effect of a plasmid delivery system containing RNA fragments on pulmonary fibrosis according to one embodiment of the present invention. In the figure, A is the result of detecting the relative mRNA amount of PTP1B after injection of a plasmid delivery system containing six types of RNA sequences, RNA fragments consisting of any two of the six types of RNA sequences, and RNA fragments consisting of any three of the six types of RNA sequences. B is the result of detecting the relative protein amount of PTP1B after injection of a plasmid delivery system containing six types of RNA sequences, RNA fragments consisting of any two of the six types of RNA sequences, and RNA fragments consisting of any three of the six types of RNA sequences. [Figure 99] The figure shows the metabolic distribution after intravenous injection of CMV-siRNA-1+2 according to one embodiment of the present invention. In the figure, A represents the enrichment effect in the lungs, and B represents the enrichment effect in the blood. [Figure 100]The figures show the metabolic distribution after intravenous injection of CMV-GE11-siRNA-1+2 and (CMV-GE11-siRNA-1+CMV-GE11-siRNA-2) having the targeting tag GE11, according to one embodiment of the present invention. In the figures, A and C represent the enrichment effects of CMV-GE11-siRNA-1+2 in the lungs and plasma, respectively, and B and D represent the enrichment effects of CMV-GE11-siRNA-1+CMV-GE11-siRNA-2 in the lungs and plasma, respectively. [Figure 101] This figure shows data on the therapeutic effect of intravenous injection of CMV-GE11-siRNA-1, CMV-GE11-siRNA-1+2, and CMV-GE11-siRNA-1+ CMV-GE11-siRNA-2, each having a targeting tag GE11, on pulmonary fibrosis according to one embodiment of the present invention. In the figure, A and C represent the TGFb1 protein content and mRNA content of CMV-GE11-siRNA-1 and CMV-GE11-siRNA-1+2, respectively, and B and D represent the TGFb1 protein content and mRNA content of CMV-GE11-siRNA-1 and CMV-GE11-siRNA-1+ CMV-GE11-siRNA-2, respectively. [Figure 102] This figure illustrates the enrichment effect in the blood after plasmid injection containing sequence fragments of three different 5' flanking sequences, loop sequences, and 3' flanking sequences, according to one embodiment of the present invention (embodied as siRNA content). [Figure 103] This figure illustrates the enrichment effect (embodied as siRNA content) in the blood after injection of a plasmid delivery system containing multiple linked sequences of different base numbers (sequence 2) according to one embodiment of the present invention. [Figure 104] This figure shows the enrichment effect (embodied as siRNA content) in the blood after injection of a plasmid delivery system containing multiple linked sequences (sequence 4) having more than 80% homology, according to one embodiment of the present invention. In the figure, the horizontal axis of sequence 4-1 is the base sequence 4, and sequences 4-2 / 4-3 / 4-4 are homologous sequences with more than 80% homology to sequence 4-1 (sequence 4), respectively. [Figure 105]This describes the therapeutic effect of one embodiment of the present invention on pulmonary fibrosis when the RNA sequence lengths in the plasmid delivery system are 18, 19, and 21, respectively. In the figure, A represents the TGFb1 mRNA content, and B represents the TGFb1 protein content. [Figure 106] This is the result of detecting the hydroxyproline content in one embodiment of the present invention when the gene circuit contains the antisense strand of miRNA-21 and five TGF-β1 gene siRNAs. [Figure 107] This is a comparative diagram of hydroxyproline content and mRNA levels in mice according to one embodiment of the present invention. [Figure 108] This figure shows the detection of in vivo enrichment, self-assembly, and pulmonary fibrosis therapeutic effects when adenovirus and lentivirus are used as viral vectors and carry RNA fragments, according to one embodiment of the present invention. The viral vector is adenovirus / lentivirus, and the enrichment result is shown by the siRNA content. In the figure, A is the detection figure of enrichment in the lungs after injection of the delivery system (siRNA-1), B is the detection figure of enrichment in the lungs after injection of the delivery system (siRNA-2), C is the detection figure of enrichment in the blood after injection of the delivery system (siRNA-1), and D is the detection figure of enrichment in the blood after injection of the delivery system (siRNA-2). [Figure 109] This figure shows the detection of in vivo enrichment, self-assembly, and pulmonary fibrosis therapeutic effects when adenovirus and lentivirus are used as viral vectors and supported with RNA fragments, according to another embodiment of the present invention. The viral vector is adenovirus / lentivirus, and the enrichment result is shown by the siRNA content. In the figure, A is the detection of enrichment in the lungs after injection of the targetless peptide (GE11) delivery system, B is the detection of enrichment in the lungs after injection of the targetless peptide (GE11) delivery system, C is the detection of enrichment in the blood after injection of the targetless peptide (GE11) delivery system (siRNA-1), and D is the detection of enrichment in the blood after injection of the targetless peptide (GE11) delivery system (siRNA-2). [Figure 110]This figure shows the results of detecting the in vivo enrichment, self-assembly, and therapeutic effects on pulmonary fibrosis when a viral vector system carrying multiple different R-NA fragments is supported, according to one embodiment of the present invention. In the figure, A is the result of detecting the relative amount of mRNA of P-TP1B, and B is the result of detecting the relative amount of protein of P-TP1B. [Figure 111] In one embodiment of the present invention, a viral vector delivery system contains multiple RNA fragments and multiple targeting tags (CMV-siRNA-1+2). The results of detecting enrichment, self-assembly, and therapeutic effects on pulmonary fibrosis in vivo via intravenous injection are shown. In the figure, A represents the enrichment effect in the lungs (indicated by siRNA content), and B represents the enrichment effect in the blood (indicated by siRNA content). [Figure 112] The following are the results of detecting in vivo enrichment, self-assembly, and pulmonary fibrosis therapeutic effects by intravenous injection when a viral vector delivery system containing multiple RNA fragments and multiple targeting tags (CMV-GE11-siRNA-1+2, CMV-GE11-siRNA-1+CMV-GE11-siRNA-2) is included in other embodiments of the present application. In the figure, A and B represent the enrichment effect in the lungs (indicated by siRNA content), and C and D represent the enrichment effect in plasma (indicated by siRNA content). [Figure 113] In yet another embodiment of the present invention, the viral vector delivery system contains multiple RNA fragments and multiple targeting tags (CMV-GE11-siRNA-1+2, CMV-GE11-siRNA-1+CMV-GE11-siRNA-2), and the results of detecting the therapeutic effect of intravenous injection on pulmonary fibrosis are shown. In the figure, A and B are the results of detecting the protein content of TGFb1, and C and D are the results of detecting the mRNA content of TGFb1. [Figure 114] This figure shows the results of detecting in vivo enrichment (indicated by siRNA content in blood) when an adenovirus vector delivery system according to one embodiment of the present invention contains three 5' flanking sequences / loop sequences / 3' flanking sequences having more than 80% homology. [Figure 115] This figure shows the results of detecting in vivo enrichment of the constructed delivery system when, according to one embodiment of the present invention, multiple circuits are supported on an adenovirus vector, adjacent sequences are linked by sequence 1-sequence 2-sequence 3, and sequence 2 contains multiple bases (indicated by siRNA content in blood). [Figure 116] This figure shows the results of detecting in vivo enrichment in the constructed delivery system when the linked sequence is sequence 4 and a sequence having more than 80% homology to sequence 4, according to one embodiment of the present invention (shown as siRNA content in blood). [Figure 117] This figure shows the detection results of the therapeutic effect on pulmonary fibrosis in a delivery system constructed according to one embodiment of the present invention, where the RNA sequences are 18, 20, and 21 in length, respectively. In the figure, A is the detection result of the relative amount of PTP1B mRNA for RNA sequences of different lengths, and B is the detection result of the relative amount of PTP1B protein for RNA sequences of different lengths. [Figure 118] This is the result of detecting the hydroxyproline content in one embodiment of the present invention when the gene circuit contains the antisense strand of miRNA-21 and five TGF-β1 gene siRNAs. [Figure 119] This is a comparative diagram of mouse siRNA-related expression according to one embodiment of the present invention. [Figure 120] This is a comparative diagram showing the treatment status of mouse glioblastoma according to one embodiment of the present invention. [Figure 121] This is a comparative diagram of mouse brain immunohistochemical staining according to one embodiment of the present invention. [Figure 122] This figure illustrates the effects of in vivo enrichment and spontaneous formation of complex structures when a single RNA fragment is supported in a plasmid delivery system, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of plasmids containing different RNA fragments, and B represents the in vivo self-assembly effect indicated by the expression levels of the different RNA fragments. [Figure 123]This figure illustrates the verification of the in vivo enrichment and spontaneous formation of complex structures when any two types of RNA fragments are supported on a plasmid delivery system, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of a plasmid containing different combinations of RNA fragments, and B represents the in vivo self-assembly effect indicated by the expression levels of the different combinations of RNA fragments. [Figure 124] This figure illustrates the effects of in vivo enrichment and spontaneous formation of complex structures when any three types of RNA fragments are supported on a plasmid delivery system, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of plasmids containing different combinations of RNA fragments, and B represents the in vivo self-assembly effect indicated by the expression levels of the different combinations of RNA fragments. [Figure 125] This figure illustrates the effects of in vivo enrichment and spontaneous formation of complex structures when any two types of RNA fragments are supported on a plasmid delivery system, according to other embodiments of the present invention. Here, A represents the in vivo enrichment effect of plasmids containing different combinations of RNA fragments, and B represents the in vivo self-assembly effect indicated by the expression levels of the different combinations of RNA fragments. [Figure 126] This figure shows the verification of the in vivo enrichment effect when a plasmid delivery system carries 1-2 random RNA fragments and 1-2 targeting tags, and both are located in the same circuit, according to one embodiment of the present invention. [Figure 127] This figure shows the verification of the in vivo enrichment effect when a plasmid delivery system carries 1-2 random RNA fragments and 1-2 targeting tags, and both are located in different circuits, according to another embodiment of the present invention. [Figure 128]This figure illustrates the effects of in vivo enrichment and spontaneous formation of complex structures when a revealed 5' flanking sequence and at least two distinct sequences having more than 80% homology thereto are supported on a plasmid delivery system, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of plasmids containing different 5' flanking sequences, and B represents the in vivo self-assembly effect indicated by the RNA fragment expression levels of the different 5' flanking sequences. [Figure 129] This figure shows the effect of spontaneously forming a complex structure enriched in vivo when a plasmid delivery system according to one embodiment of the present invention has a clear loop sequence and at least two clear sequences with greater homology than 80%, where A is the effect of in vivo enrichment of plasmids containing different loop sequences, and B is the in vivo self-assembly effect shown by the expression levels of RNA fragments of different loop sequences. [Figure 130] This figure illustrates the effects of in vivo enrichment and spontaneous formation of complex structures when a plasmid delivery system is supported by an identified 3' flanking sequence and at least two distinct sequences having more than 80% homology, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of plasmids containing different 3' flanking sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of different 3' flanking sequence RNA fragments. [Figure 131] This figure illustrates the effects of in vivo enrichment and spontaneous formation of complex structures when a plasmid delivery system is supported with an RNA sequence of a reverse complementary sequence lacking one of the bases at positions 1, 2, 3, 4, or 5, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of plasmids containing different complementary sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of different complementary sequence RNA fragments. [Figure 132] This figure shows the effect of spontaneous formation of a composite structure when four of the aforementioned circuits are supported in a plasmid delivery system according to one embodiment of the present invention, and adjacent circuits are linked together by sequence 1-sequence 2-sequence 3. [Figure 133] This figure shows the effect of spontaneous formation of a composite structure when four of the aforementioned circuits are supported in a plasmid delivery system according to one embodiment of the present invention, and adjacent circuits are linked by sequence 1-sequence 2-sequence 3, with sequence 2 consisting of 5 bases, 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, and 80 bases, respectively. [Figure 134] This figure shows the effect of spontaneous formation of a composite structure according to one embodiment of the present invention, when the linked sequence included in the plasmid delivery system is sequence 4 and there are at least two sequences having more than 80% homology to sequence 4. [Figure 135] This figure shows the verification of the in vivo enrichment effect when a plasmid delivery system contains only a targeting peptide tag, according to one embodiment of the present invention. [Figure 136] This figure shows the verification of the in vivo enrichment effect when a plasmid delivery system contains only a targeting protein tag, according to one embodiment of the present invention. [Figure 137] This figure illustrates the verification of the in vivo enrichment and spontaneous formation of complex structures that occur when a gene circuit contains siRNA of the EGFR gene, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of gene circuits containing different EGFR gene siRNA sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of the gene circuits containing different EGFR gene siRNA sequences. [Figure 138] This figure illustrates the verification of the effects of in vivo enrichment and spontaneous formation of complex structures when a gene circuit contains siRNA of a TNC gene, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of a gene circuit containing different TNC gene siRNA sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of the gene circuit containing different TNC gene siRNA sequences. [Figure 139]This figure illustrates the verification of the in vivo enrichment and spontaneous formation of complex structures when a delivery system contains two different ribose-modified RNA sequences, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of the delivery system of different ribose-modified RNAs, and B represents the in vivo self-assembly effect indicated by the expression levels of the different ribose-modified RNAs. [Figure 140] This is a comparative diagram of mouse survival and tumor evaluation according to one embodiment of the present invention. [Figure 141] This figure shows the verification of the in vivo enrichment and self-assembly effects of three other viral vectors according to one embodiment of the present invention. In the figure, A is the result of in vivo enrichment of other viral vector 1, B is the result of in vivo enrichment of other viral vector 2, C is the result of in vivo enrichment of other viral vector 3, and D is the result of in vivo self-assembly of the other three types of viral vectors. [Figure 142] This figure illustrates the verification of the in vivo enrichment and self-assembly effects of a viral vector when each of the six RNA fragments is individually supported, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of a vector containing different RNA fragments, and B represents the in vivo self-assembly effect indicated by the expression levels of the different RNA fragments. [Figure 143] This figure illustrates the verification of in vivo enrichment and self-assembly effects when a viral vector carries four groups of RNA fragments, each containing any two RNA sequences, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of vectors containing different RNA fragments, and B represents the in vivo self-assembly effect indicated by the expression levels of the different RNA fragments. [Figure 144] This figure illustrates the verification of in vivo enrichment and self-assembly effects when a viral vector carries three groups of RNA fragments, each containing three arbitrary RNA sequences, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of vectors containing different RNA fragments, and B represents the in vivo self-assembly effect indicated by the expression levels of the different RNA fragments. [Figure 145]This figure illustrates the verification of in vivo enrichment and self-assembly effects when a viral vector carries two groups of RNA fragments, each containing any two other RNA sequences, according to another embodiment of the present invention. Here, A represents the in vivo enrichment effect of vectors containing different RNA fragments, and B represents the in vivo self-assembly effect indicated by the expression levels of the different RNA fragments. [Figure 146] This figure illustrates the verification of in vivo enrichment and self-assembly effects when a viral vector carries 1-2 random RNA fragments and 1-2 targeting tags, and both are in the same circuit, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of a vector containing different RNA fragments and targeting tags, and B represents the in vivo self-assembly effect indicated by the expression levels of different RNA fragments. [Figure 147] This figure illustrates the verification of in vivo enrichment and self-assembly effects when a viral vector carries 1-2 random RNA fragments and 1-2 targeting tags, and these are located in different circuits, according to another embodiment of the present invention. Here, A represents the in vivo enrichment effect of a vector containing different RNA fragments and targeting tags, and B represents the in vivo self-assembly effect indicated by the expression levels of the different RNA fragments. [Figure 148] This figure illustrates the verification of in vivo enrichment and self-assembly effects when a viral vector is supported with a revealed 5' flanking sequence and at least two distinct sequences having more than 80% homology, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of vectors containing different 5' flanking sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of different 5' flanking sequence RNA fragments. [Figure 149] This figure illustrates the verification of in vivo enhancement and self-assembly effects when a viral vector is supported with a revealed loop sequence and at least two distinct sequences having more than 80% homology, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of vectors containing different loop sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of different loop sequence RNA fragments. [Figure 150] This figure illustrates the verification of in vivo enrichment and self-assembly effects when a viral vector is supported with a revealed 3' flanking sequence and at least two distinct sequences having more than 80% homology, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of vectors containing different 3' flanking sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of different 3' flanking sequence RNA fragments. [Figure 151] This figure illustrates the verification of the in vivo enrichment and self-assembly effects when an RNA sequence of the reverse complementary sequence, with one of the bases at positions 1, 2, 3, 4, or 5 deleted, is supported on a viral vector, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of vectors containing different complementary sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of different complementary sequence RNA fragments. [Figure 152] This figure shows the verification of the self-assembly effect when four circuits are supported on a viral vector and adjacent circuits are linked by sequence 1-sequence 2-sequence 3, according to one embodiment of the present invention. [Figure 153] This figure shows the verification of the self-assembly effect in one embodiment of the present invention, where a viral vector carries four circuits, adjacent circuits are linked by sequence 1-sequence 2-sequence 3, and sequence 2 consists of 5 bases, 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, and 80 bases, respectively. [Figure 154] This figure shows the verification of the self-assembly effect according to one embodiment of the present invention, when the linked sequences contained in a viral vector are sequence 4 and at least two sequences having more than 80% homology to sequence 4. [Figure 155] This figure shows the verification of the in vivo enrichment effect when a viral vector contains different targeting peptide tags, according to one embodiment of the present invention. [Figure 156] This figure shows the verification of the in vivo enrichment effect when a viral vector contains different targeting protein tags, according to one embodiment of the present invention. [Figure 157]This figure illustrates the verification of the in vivo enrichment and self-assembly effects when a gene circuit contains siRNA of the EGFR gene, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of a gene circuit containing different EGFR gene siRNA sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of the gene circuits containing different EGFR gene siRNA sequences. [Figure 158] This figure illustrates the verification of the in vivo enrichment and self-assembly effects when a gene circuit contains siRNA of a TNC gene, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of a gene circuit containing different TNC gene siRNA sequences, and B represents the in vivo self-assembly effect indicated by the expression levels of the gene circuits containing different TNC gene siRNA sequences. [Figure 159] This figure illustrates the verification of in vivo enrichment and self-assembly effects when a viral vector delivery system contains two different ribose-modified RNA sequences, according to one embodiment of the present invention. Here, A represents the in vivo enrichment effect of the viral vector delivery system with different ribose-modified RNAs, and B represents the in vivo self-assembly effect indicated by the expression levels of the different ribose-modified RNAs. [Figure 160] These are fluorescence microscopy images of the hypothalamus and liver of a mouse according to one embodiment of the present invention. [Figure 161] This is a comparative diagram showing the treatment status of mouse obesity according to one embodiment of the present invention. [Figure 162] This is a comparative diagram showing the treatment status of obese mice with fatty liver disease according to one embodiment of the present invention. [Figure 163] This is a comparative diagram showing the treatment status of obesity in mice according to one embodiment of the present invention. [Figure 164] This is a comparative diagram of various obesity indicators in mice according to one embodiment of the present invention. [Figure 165] This figure shows the detection of the in vivo enrichment effect of an RNA delivery system constructed using adenovirus and lentivirus as viral vectors, according to one embodiment of the present invention. In the figure, A is the result of detecting the siRNA content in the blood after injection of the delivery system, and B is the result of detecting the siRNA content in the hypothalamus after injection of the delivery system. [Figure 166] This figure shows the detection of the in vivo enrichment effect of an RNA delivery system constructed using adenovirus and lentivirus as viral vectors, according to another embodiment of the present invention. The figure shows the detection results of the siRNA content in blood exosomes after injection of the delivery system. [Figure 167] This figure shows the detection of the in vivo self-assembly effect and obesity treatment effect of an RNA delivery system constructed using adenovirus and lentivirus as viral vectors according to one embodiment of the present invention. In the figure, A is the detection result of the mRNA content of PTP1B, B is the detection result of the protein content of PTP1B, and C is the change in body weight over the number of days. [Figure 168] This figure shows the results of detecting the in vivo enrichment, self-assembly, and therapeutic effects on obesity when a viral vector system carrying multiple different RNA fragments is supported, according to one embodiment of the present invention. In the figure, A is the result of detecting the relative amount of mRNA of PTP1B, and B is the result of detecting the relative amount of protein of PTP1B. [Figure 169] This figure shows the results of detecting in vivo enrichment, self-assembly, and obesity treatment effects when an adenovirus vector delivery system containing multiple RNA fragments and multiple targeting tags is used in one embodiment of the present invention. Here, the targeting tag is RVG, and the RNA fragments are siRNA-1, siRNA-2, and siRNA-1+siRNA-2, respectively. In the figure, A is the detection result of the relative mRNA amount of PTP1B, B is the detection result of the relative protein amount of PTP1B, and C is the change in body weight over the number of days. [Figure 170] This figure shows the in vivo enrichment detection results when an adenovirus vector delivery system according to one embodiment of the present invention contains three 5' flanking sequences / loop sequences / 3' flanking sequences with more than 80% homology (indicated by siRNA content in blood). [Figure 171]A diagram showing the detection results of enrichment in vivo in the constructed delivery system when multiple circuits are carried on an adenovirus vector and adjacent sequences are linked as sequence 1 - sequence 2 - sequence 3 and sequence 2 contains multiple bases (shown by the siRNA content in blood). [Figure 172] A diagram showing the detection results of enrichment in vivo in the constructed delivery system when the linked sequence is sequence 4 and a sequence having more than 80% homology with sequence 4 (shown by the siRNA content in blood). [Figure 173] A diagram showing the detection results of the obesity treatment effect in the constructed delivery system when the lengths of the RNA sequences are 18, 20, and 21 respectively. In the diagram, A shows the detection results of the relative amount of PTP1B mRNA of RNA sequences with different lengths, and B shows the detection results of the relative amount of PTP1B protein of RNA sequences with different lengths. [Figure 174] A comparison diagram of the treatment status of Huntington's disease in mice according to an embodiment of the present invention. [Figure 175] A comparison diagram of siRNA and proteins in the liver, cortex, and striatum of mice according to an embodiment of the present invention. [Figure 176] A comparison diagram of the treatment status of Huntington's disease in mice according to an embodiment of the present application. [Figure 177] A comparison diagram of mHTT protein and toxic aggregates in the striatum and cortex of mice according to an embodiment of the present invention. [Figure 178] A comparison diagram of the treatment status of Huntington's disease in mice according to an embodiment of the present application. [Figure 179] A diagram showing the effect of enrichment in vivo of a lentivirus vector carrying siRNA according to an embodiment of the present application. [Figure 180] A diagram showing the effect of in vivo self - assembly of a lentivirus vector carrying siRNA according to an embodiment of the present application. [Figure 181] A diagram showing the electrophoresis results of the treatment effect of lentinton disease with siRNA carried according to an embodiment of the present application. [Figure 182] This diagram illustrates the effect of in vivo enrichment of siRNA-supported adenovirus-related virus types 1, 4, and 7 vectors according to one embodiment of the present invention. [Figure 183] This is an electrophoretic graph showing the therapeutic effect of siRNA-supported adenovirus-related virus types 1, 2, and 7 vectors on Huntington's disease, according to one embodiment of the present invention. [Figure 184] This is a datagram showing the therapeutic effects of siRNA-supported adenovirus-related virus types 1, 2, and 7 vectors on Huntington's disease according to one embodiment of the present invention. In the datagram, the effects are compared at the HTT mRNA level. [Figure 185] This diagram illustrates the effect of in vivo enrichment of an adenovirus-related virus type 8 vector carrying six different RNA sequences, according to one embodiment of the present invention. [Figure 186] This diagram illustrates the effect of in vivo enrichment of an adenovirus-related virus type 9 vector carrying six different RNA sequences, according to one embodiment of the present invention. [Figure 187] This is an electrophoretic graph showing the therapeutic effect of an adenovirus-related virus type 9 vector carrying six different RNA sequences on Huntington's disease, according to one embodiment of the present invention. [Figure 188] This is a datagram showing the therapeutic effect of an adenovirus-associated virus type 8 vector carrying RNA fragments of any two RNA sequences on Huntington's disease, according to one embodiment of the present invention. In the datagram, the comparison is made at the HTT mRNA level. [Figure 189] This is an electrophoretic result diagram of the therapeutic effect of an adenovirus-related virus type 9 vector carrying RNA fragments of any two types of RNA sequences on Huntington's disease, according to one embodiment of the present invention. [Figure 190] This is a datagram showing the therapeutic effect of an adenovirus-related virus type 8 vector carrying RNA fragments of any three different RNA sequences on Huntington's disease, according to one embodiment of the present invention. In the datagram, the comparison is made at the HTT mRNA level. [Figure 191]This is an electrophoretic result diagram of the therapeutic effect of an adenovirus-related virus type 9 vector carrying RNA fragments of any three types of RNA sequences on Huntington's disease, according to one embodiment of the present invention. [Figure 192] These are datagrams of the in vivo enrichment of adenovirus-related virus type 9 sequences containing siRNA and RVG according to one embodiment of the present invention. [Figure 193] This diagram illustrates the efficacy of HTT mRNA expression data for the treatment of Huntington's disease when the sequence of adenovirus-related virus type 9, according to one embodiment of the present invention, contains siRNA and RVG. [Figure 194] This is a comparative graph of data regarding the therapeutic effect of RVG-LAMP2B fusion protein and other fusion proteins on an adenovirus vector for Huntington's disease, according to one embodiment of the present invention. This data is indicated by the relative levels of HTT mRNA. [Figure 195] This is a data graph showing the in vivo enrichment of three RNA sequences that have more than 80% homology to the siRNA sequence of the HTT gene, in an adenovirus vector system according to one embodiment of the present invention. [Figure 196] This is a comparative graph of data regarding the therapeutic effect of Huntington's disease when an adenovirus vector system according to one embodiment of the present invention contains three RNA sequences having more than 80% homology to the siRNA sequence of the HTT gene, and the data are shown by the relative levels of HTT mRNA. [Figure 197] This is a comparative diagram showing the treatment status of Parkinson's disease in transgenic mice according to one embodiment of the present invention. [Figure 198] This is a datagram of in vivo enrichment when plasmid 1 contains six different RNAs individually, according to one embodiment of the present invention. [Figure 199] This is a datagram of in vivo enrichment in another embodiment of the present invention, where plasmid 2 contains six different RNAs individually. [Figure 200]A data diagram of in-vivo self-assembly when exosomes contain six types of RNAs individually according to an embodiment of the present application. [Figure 201] An effect diagram of Parkinson's treatment based on the expression results of the LRRK2 gene when a plasmid contains six types of RNAs individually according to an embodiment of the present application. [Figure 202] A data diagram of enrichment in vivo when plasmid 1 contains any two types of R-NA sequences respectively according to an embodiment of the present application. [Figure 203] A data diagram of in-vivo self-assembly when exosomes contain any two types of RNA sequences respectively according to an embodiment of the present application. [Figure 204] An effect diagram of Parkinson's treatment based on the expression data of LRRK2 mRNA when plasmid 1 contains any two types of RNA sequences respectively according to an embodiment of the present application. [Figure 205] An effect diagram of Parkinson's treatment based on the expression results of the LRRK2 gene when plasmid 2 contains any two types of RNA sequences respectively according to another embodiment of the present application. [Figure 206] An effect diagram of Parkinson's treatment based on the expression data of LRRK2 mRNA when plasmid 1 contains any three types of RNA sequences respectively according to an embodiment of the present application. [Figure 207] An effect diagram of Parkinson's treatment based on the expression results of the LRRK2 gene when plasmid 2 contains any three types of RNA sequences respectively according to another embodiment of the present application. [Figure 208] A data graph of enrichment in vivo of a plasmid when the sequence in the plasmid contains siRNA and RVG according to an embodiment of the present application. [Figure 209] An effect diagram of Parkinson's treatment based on the expression data of LRRK2 mRNA when the sequence in the plasmid contains siRNA and RVG according to an embodiment of the present application. [Figure 210]This is a comparative graph of data on the efficacy of RVG-LAMP2B fusion protein and other fusion proteins in plasmid vectors for the treatment of Parkinson's disease, according to one embodiment of the present invention. This data is shown by the relative levels of LRRK2 mRNA. [Figure 211] This is a datagram of in vivo enrichment in one embodiment of the present invention, where the gene circuit contains three RNA sequences having more than 80% homology to the siRNA sequence of the LRRK2 gene. [Figure 212] This is a comparative graph of data regarding the efficacy of Parkinson's disease treatment in one embodiment of the present invention, where the gene circuit includes three RNA sequences having more than 80% homology to the siRNA sequence of the LRRK2 gene. The data are shown by the relative levels of LRRK2 mRNA. [Figure 213] This diagram illustrates the effect of in vivo enrichment of an siRNA-supported lentiviral vector according to one embodiment of the present invention. [Figure 214] This diagram illustrates the effect of in vivo self-assembly of an siRNA-supported lentiviral vector according to one embodiment of the present invention. [Figure 215] This figure shows the data results for the therapeutic effect of an siRNA-supported lentiviral vector on Parkinson's disease according to one embodiment of the present invention. In the datagram, the comparison is made at the LRRK2 mRNA level. [Figure 216] This diagram illustrates the effect of in vivo enrichment of siRNA-supported adenovirus-related virus types 1, 4, and 7 vectors according to one embodiment of the present invention. [Figure 217] This diagram illustrates the effect of in vivo self-assembly of siRNA-supported adenovirus-related virus types 1, 4, and 7 vectors according to one embodiment of the present invention. [Figure 218] This figure shows the data results for the therapeutic effects of adenovirus-related virus types 1, 4, and 7 vectors carrying siRNA on Parkinson's disease, according to one embodiment of the present invention. The datagrams compare the effects at the LRRK2 mRNA level. [Figure 219]This diagram illustrates the effect of in vivo enrichment of an adenovirus-related virus type 8 vector carrying six different RNA sequences, according to one embodiment of the present invention. [Figure 220] This diagram illustrates the effect of in vivo self-assembly of adenovirus-related virus type 8 and type 9 vectors carrying six different RNA sequences, according to one embodiment of the present invention. [Figure 221] This diagram illustrates the effect of in vivo enrichment of an adenovirus-related virus type 9 vector carrying RNA fragments of any two types of RNA sequences, according to one embodiment of the present invention. [Figure 222] This diagram illustrates the effect of in vivo self-assembly of adenovirus-related virus type 8 and type 9 vectors carrying RNA fragments of any two types of RNA sequences, according to one embodiment of the present invention. [Figure 223] This is an electrophoretic result diagram of the Parkinson's disease therapeutic effect of an adenovirus vector carrying RNA fragments of any three different RNA sequences, according to one embodiment of the present invention. [Figure 224] This is a datagram of in vivo enrichment when the sequence of adenovirus-related virus type 9 contains siRNA and RVG, according to one embodiment of the present invention. [Figure 225] This diagram illustrates the efficacy of Parkinson's disease treatment based on LRRK2 mRNA expression data when the sequence of adenovirus-related virus type 9 includes siRNA and RVG, according to one embodiment of the present invention. [Figure 226] This is a datagram of the in vivo enrichment of adenovirus vectors carrying RVG-LAMP2B fusion protein and other fusion proteins according to one embodiment of the present invention. [Figure 227] This figure shows a comparison of data on the efficacy of RVG-LAMP2B fusion protein and other fusion proteins in adenovirus vectors for the treatment of Parkinson's disease, according to one embodiment of the present invention. This data is indicated by the relative levels of LRRK2 mRNA. [Figure 228]This is a data graph of in vivo enrichment when an adenovirus vector system according to one embodiment of the present invention contains three RNA sequences having more than 80% homology to the siRNA sequence of the LRRK2 gene. [Figure 229] This is a comparative graph of data on the efficacy of Parkinson's disease treatment when an adenovirus vector system, according to one embodiment of the present invention, contains three RNA sequences having more than 80% homology to the siRNA sequence of the LRRK2 gene. The data are shown by the relative levels of LRRK2 mRNA. [Figure 230] This figure shows the change in whole blood siRNA concentration in a cynomolgus monkey according to one embodiment of the present invention. [Figure 231] This is a comparative diagram showing the effects of chemical modifications on mouse siRNA levels according to the embodiments of the present invention. [Figure 232] This diagram shows a schematic of a system for delivering RNA that inhibits gene expression according to the present invention, and experimental results of one embodiment thereof. [Figure 233] This is a schematic diagram of the structure of an exemplary plasmid CMV-siRE according to the present invention. [Figure 234] This is a schematic diagram of the structure of an exemplary plasmid U6-siRE according to the present invention. [Modes for carrying out the invention]
[0078] The substantial content and beneficial effects of the present invention will be further explained below with reference to examples, but these examples are not limitations of the present invention and are used solely for the purpose of illustrating the present invention.
[0079] Example 1: Materials and Method Hematoxylin-eosin staining, abbreviated as HE staining, is a basic stain that stains basophilic structures in tissues (e.g., ribosomes, nuclei, and ribonucleic acids in the cytoplasm) blue-violet, while iosin is an acidic dye that stains eosinophilic structures in tissues (e.g., intracellular and intercellular proteins, including Lewy bodies, alcohol bodies, and most of the cytoplasm) pink, allowing for a clearer view of the overall morphology of the cell tissue.
[0080] The specific steps of HE staining include fixing and sectioning the sample tissue, dewaxing the tissue sample, hydrating the tissue sample, hematoxylin staining of the tissue sections, differentiation and anti-blue treatment, iosin staining and dehydration of the tissue sections, air drying and sealing of the tissue sample sections, microscopic observation and photography.
[0081] In Masson staining, collagen fibers stain blue (with aniline blue) or green (with brilliant green), while muscle fibers stain red (with acid magenta and Ponceau), depending on the size of the anionic dye molecule and the tissue's permeability. When tissues immobilized with a series of anionic water-soluble dyes are stained sequentially or in combination, it was found that red blood cells are stained with the smallest anionic dye molecules, muscle fibers and cytoplasm are stained with medium-sized anionic dye molecules, and collagen fibers are stained with large anionic dye molecules. This indicates that red blood cells have the lowest permeability to anionic dyes, followed by muscle fibers and cytoplasm, and collagen fibers have the highest permeability. Type I and type III collagen appear green (GBM, TBM, mesangial matrix, and renal interstitium appear green), while ferrohebin, renal tubule cytoplasm, and red blood cells appear red.
[0082] The specific steps for Masson staining include the following: Fix the tissue in Bouin's solution, rinse overnight with running water, and normally dehydrate and embed. Dewax the sections in water (dewax in xylene for 10 min x 3 times, absorbing the liquid with absorbent paper. Dewax in 100% ethanol for 5 min x 2 times, absorbing the liquid with absorbent paper. Dewax in 95% ethanol for 5 min x 2 times, absorbing the liquid with absorbent paper. Run water for 2 min and absorb the moisture with absorbent paper). Stain with Weiger iron hematoxylin for 5-10 min. Rinse lightly with running water and differentiate with 0.5% hydrochloric acid alcohol for 15 s. Rinse with running water for 3 min. Stain with Ponceau acid fuchsin solution for 8 min. Rinse lightly with distilled water. Treat with 1% phosphomolybdic acid aqueous solution for about 5 min. Re-stain with aniline blow solution or brilliant green solution for 5 min without rinsing with water. Treat with 1% glacial acetic acid for 1 minute. Dehydrate with 95% ethanol for 5 minutes twice, and absorb the liquid with absorbent paper. Dehydrate with 100% ethanol for 5 minutes twice, and absorb the liquid with absorbent paper. Clear in xylene for 5 minutes twice, and absorb the liquid with absorbent paper. Seale with neutral rubber.
[0083] Western blotting involves transferring proteins onto a membrane and detecting them using antibodies. For known expressed proteins, the corresponding antibody can be used as the primary antibody for detection, while for the expression products of novel genes, an antibody targeting the fusion region can be used for detection.
[0084] Western Blot electrophoresis uses polyacrylamide gel electrophoresis, where the target substance is a protein, the "probe" is an antibody, and the "chromogenic" agent is a labeled secondary antibody. Protein samples separated by PAGE are transferred to a solid support (e.g., cellulose nitrate film) that can adsorb the protein in a non-covalent manner and maintain the polypeptide type and its biological activity separated by electrophoresis. The protein or polypeptide on the solid support acts as an antigen, undergoing an immunoreaction with the corresponding antibody, reacting with an enzyme or isotope-labeled secondary antibody, and detecting the protein component expressed by the specific target gene separated by electrophoresis through substrate chromogenesis or auto-radiation development. The steps mainly include protein extraction, protein quantification, gel preparation and electrophoresis, membrane transfer, immunolabeling, and development.
[0085] Immunohistochemistry, also known as immunocytochemistry, utilizes the principle of antigen-antibody reactions, that is, the specific binding of antigens and antibodies. It involves identifying intracellular antigens (polypeptides and proteins) by chemically reacting chromogenic agents (fluorescein, enzymes, metal ions, isotopes) that label antibodies, and then studying their localization, qualitative analysis, and relative quantification.
[0086] The main steps of immunohistochemistry include section immersion, overnight drying, xylene dewaxing, gradient alcohol dewaxing (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3 min each time), double distillation, catalase removal by dropwise addition of 3% hydrogen peroxide, washing with water, antigen repair, 1 hour block with dropwise addition of 5% BSA, primary antibody dilution, washing with PBS buffer, secondary antibody incubation, washing with PBS buffer, chromogenic solution development, washing with water, hematoxylin staining, gradient ethanol dehydration, and sealing with neutral rubber. Example 2
[0087] The inventors have devised a system for treating diseases by delivering RNA that inhibits gene expression to organ tissues as needed, enriching it within cells, assembling to form cellular vesicles such as exosomes, and then releasing it from cells before delivering it to target tissues. The system comprises one or more RNAs that inhibit gene expression and a protein that targets target tissues.
[0088] figure 232 Figure a is a schematic diagram of an exemplary system for delivering RNA that inhibits gene expression according to the present invention. The system is a vector (in this embodiment, a plasmid) containing nucleic acids that express RNA that inhibits gene expression and / or a protein that targets a target tissue, allowing for a free combination of different functional modules. In this system, the core circuit (core part) consists of a promoter portion and an siRNA expression portion (Figure 232 It consists of components such as the siRNA-1 backbone and is intended to generate and assemble siRNA as an exosome payload. Other composable parts can be integrated into a system framework including a core gene circuit to achieve plug-and-play functionality. Examples of composable components include two types of action that can optimize siRNA. One is to modify the membrane-anchored proteins of the exons to achieve tissue selectivity (Figure 232 (e.g., a Guiding Tag), on the other hand, a second siRNA can be co-expressed to inhibit two molecular targets simultaneously (Figure) 232 (e.g., siRNA-2 backbone)
[0089] For the core circuit construct, the encoded siRNA expression backbone is optimized under the control of the promoter to maximize guide strand expression while minimizing the expression of undesirable passenger strands.
[0090] In one embodiment, the epidermal growth factor receptor (EGFR) is used as the siRNA target of the core circuit. EGFR is an oncogene that frequently mutates and is highly expressed in various human tumors such as lung cancer and glioblastoma. Human embryonic kidney 293t cells (HEK293T) and mouse hepatocellular carcinoma cells (hep1-6) were selected as the cell chassis cells assembled in vivo. Two designs were compared to optimize the efficiency of siRNA production. One design uses a CMV promoter to drive the expression of a pre-miRNA and then replaces the miRNA sequence with siRNA, resulting in plasmid EGFR siRNA (CMV-siR E (Plasmid structure diagram is shown in Figure) 233 (Referenced from and synthesized and provided by Nanjing Ruizhen Biotechnology Co., Ltd., China), it constructs an operatively linked siRNA sequence that inhibits EGFR after the CMV promoter (it has the nucleotide sequence: UGUGGCUUCUUCCU shown in SEQ IDNO.:1), it has the 5' flanking sequence ggatcctggaggctgaaggctgaattc (SEQ IDNO.:2), and the 3' flanking sequence aatggcccagatctgggccgcactcgag (SEQ IDNO.:3), which has the reverse complementary sequence of the RNA fragment with the bases at positions 9 and / or 10 of the RNA fragment deleted.
[0091] Another method involves using the U6 promoter to drive the expression of short hairpin RNA (shRNA), thereby enabling plasmid EGFR shRNA (U6-siR E (Plasmid structure diagram is shown in the figure) 234 See also. (Synthesized and supplied by Realgene Biotech Company in Nanjing, China)
[0092] EGFR siRNA (CMV-SIR E ) and U6-directed EGFR shRNA (U6-siR) E (figure 232The siRNA production efficiency of CMV-guided pre-miRNA (see b) is similar to driving EGFR siRNA guide strand transcription. The pre-miRNA method produces less or no (in the process of biogenesis of mature guide strands, the passenger strand is degraded) compared to the shRNA method. Therefore, in subsequent experiments, CMV-driven pre-miRNA design can be selected to avoid the detargeting effect. 232 Please refer to b.
[0093] It was investigated whether the core gene circuit could induce siRNA and autonomously load it into exosomes.
[0094] CMV-scr R was constructed. CMV-scr R [[ID=!4]]CMV-siR E As encoding CMV-siR, a nucleotide that encodes siRNA sequences with the same type and number but different nucleotide sequences E is the blank control.
[0095] CMV-scr R or CMV-siR E were transfected into HEK293T cells, and exosomes in the cell culture medium were observed. Nanoparticle tracking analysis (NTA) showed that the number of exosomes secreted by each group was similar, the size distribution was similar, and the peak value was between 128 - 131 nm. Transmission electron microscopy (TEM) proved that the purified exosomes showed a typical circular vesicle morphology and the size was accurate. Also, the enrichment of specific exosome markers (CD63, TSG101, and CD9) was detected only in purified exosomes and not in the cell culture medium. These results suggest that gene circuit transfection does not affect the size, structure, or amount of exosomes produced by HEK293T cells. Finally, a large amount of EGFR siRNA was detected in exosomes derived from HEK293T and Hepa1-6 cells transfected with CMV-siR (Figure E ) 232(See c). When these exosomes were incubated with mouse Lewis Lewis lung cancer (LLC) cells, the dose-dependent reduction in EGFR expression was observed, as shown in Figure. 232 d, Figure 232 Refer to e, which suggests that exosome siRNA has biological function.
[0096] In one embodiment, exosomes are introduced into the brain by using an RVG-Lamp2b fusion protein (with an RVG targeting peptide bound to the N-terminus of the Lamp2b protein) as an anchor protein. Rabies virus glycoprotein (RVG) is a neuronal protein that binds to acetylcholine receptors expressed by nerve cells. RVG has been shown to help exosomes cross the blood-brain barrier and enter nerve cells. E The sequence encoding the RVG-Lamp2b fusion protein was inserted downstream of the CMV promoter and upstream of the SiO2. The amino acid sequence of RVG is shown in SEQ ID NO.:17. The amino acid sequence of the entire RVG-Lamp2b fusion protein is shown in SEQ ID NO.:18.
[0097] We evaluate the efficiency of promoters that initiate the expression of the RVG-Lamp2b fusion protein. The CMV promoter produces RVG-Lamp2b mRNA and the labeled protein eGFP in HEK293T cells. Next, we verify that the inducible targeting tag is correctly expressed on the exosome surface using immunoprecipitation. In the experiment, we temporarily used a Flag tag instead of RVG, and after transfecting HEK293T and Hepa1-6 cells with CMV-guided Flag-Lamp2b, we successfully immunoprecipitated complete exosomes using anti-Flag beads (see figure). 232 Referencing f, we proved the precise localization of the targeting tag.
[0098] In one example, tenascin-C (TNC), an important oncogene associated with many cancers, particularly glioblastoma, is used as the second siRNA target. A TNC-siRNA, in which an siRNA sequence inhibiting TNC is linked to a CMV promoter for later expression, is also incorporated into the pre-miR-155 backbone, forming a plasmid CMV-siRNA. T This is obtained. Of these, the siRNA of the TNC gene has the following nucleotide sequence: UAUGAAAUGUAAAAAAGGGA(SEQIDNO.5)
[0099] Furthermore, EGFR-inhibiting siRNA and TNC-inhibiting siRNA were constructed in series on the same plasmid, TNC-siRNA was inserted downstream of EGFR-siRNA, and cagatctggccgcactcgagtgggatc (SEQ ID NO.:6) was used as a linker between the sequences encoding EGFR-siRNA and TNC-siRNA to construct plasmid CMV siR. E+T We obtained the figure. In the experiment, 232 As shown in g, CMV siR E or CMV siR T Or in series (CMV siR E+T In the transcription, EGFR and TNC siRNA were hardly detected.
[0100] Another immunoprecipitation experiment was performed to evaluate the association between AGO2 and siRNA in exosomes. It was demonstrated that EGFR and TNC siRNA could be readily detected in exosomes precipitated with an AGO2 antibody (anti-AGO2), ensuring the loading of siRNA into RNA-induced silence composites (RISCs) and facilitating the efficient transport of AGO2-bound siRNA into exosomes. Finally, to investigate whether the in vitro assembled siRNA was functional, CMV-RVG-siR E+T Exosomes derived from HEK293T cells transfected with the gene circuit were incubated with U87MG glioblastoma cells. (Figure) 232 i, Figure 232As shown in j, dose-dependent reduction of EGFR and TNC expression was achieved in U87MG cells. Furthermore, it was found that the RVG tag on the exosome surface did not affect the silencing effect on the targets of EGFR and TNC siRNA.
[0101] In this specification, unless otherwise specified, the codename CMV-siR is used. 遺伝子の縮小又は頭文字 The aforementioned CMV-siR E It is a plasmid that differs only in the RNA sequence of the inhibitor gene that codes for the structural configuration. For example, "plasmid CMV-siR T " or "CMV-siR T As previously mentioned, this plasmid has a TNC-inhibiting siRNA sequence linked to the CMV promoter in an expressible manner, with ggatcctggaggctgaattc (SEQ IDNO.:2) as the 5' flanking sequence and gtttggcccactgacaaggcctgaacaatggcccagatctggcccgcactcgag (SEQ IDNO.:3) as the 3' flanking sequence, and within this plasmid is the reverse complementary sequence of the RNA fragment. The bases at positions 9 and / or 10 of the RNA fragment are deleted. Also, the codename is CMV-siR 第1遺伝子の頭文字+第2遺伝子の頭文字 Plasmids representing siRNAs that simultaneously carry an siRNA sequence that inhibits the first gene, such as CMV-siR, and an siRNA sequence that inhibits the second gene. E+T This plasmid, whose structure alone determines the RNA sequences of the inhibitory genes it encodes, has a second siRNA sequence that inhibits a second gene inserted downstream of the first siRNA sequence that inhibits the first gene, and cagatctgggcccgcactcgagtggatc (SEQIDNO.:6) is used as a linker between the sequences encoding TNC-siRNA and EGFR-siRNA. By analogy, this can represent a plasmid that simultaneously carries siRNA sequences that inhibit multiple genes. Also, the code name CMV-guidepeptide abbreviation or initial -siR 遺伝子の縮小又は頭文字 This demonstrates the presence of a guide peptide, such as RVG, downstream of the CMV promoter and upstream of the SiO2 molecule. Example 3
[0102] As shown in Figure 1A, to determine the distribution of the plasmid in the body, a flat panel test was performed in mice after administering plasmid CMV siR. Samples were taken at time points (1h, 3h, 6h, 9h, 12h, 24h, 72h, 168h, 720h), and conversion was performed using plasmid extracted from spectinomycin. The number of clones in the liver, plasma, lungs, brain, kidneys, and spleen was observed. As shown in Figures 1B, 1C, and 1D, the plasmid was most abundantly distributed in the liver of mice, reaching a peak around 3 hours after injection and being essentially metabolized by 12 hours after injection.
[0103] CMV eGFP siR, co-expressing eGFP protein and EGFR siRNA, was intravenously injected into C57BL / 6J mice. As shown in Figure 2, eGFP fluorescence in the mouse liver gradually increased over time, peaking at approximately 12 hours and decreasing to background levels at 48 hours. No significant eGFP signal was observed in other tissues.
[0104] Control plasmid (CMV-scrR), EGFR siRNA expression plasmid (CMVsiR) E We administered CMV-scrR and CMV-siR to mice, separately detected them, and created in vitro models of administered mouse hepatocytes. As shown in Figure 3A, we found that administering CMV-siR resulted in the presence of siRNA expression in mouse hepatocyte exosomes.
[0105] The results of immunoprecipitation experiments on Ago2 are shown in Figures 3B and 3C. The "Input" sample, detected by directly cleaving exosomes without immunoprecipitation, represents the positive control. Figure 4 shows the tissue-specific distribution of mature siRNA after intravenous injection of plasmid into mice. Figure 4A shows that EGFR-siRNA levels in plasma, exosomes, and exosome-free plasma change in a time-dependent manner. Figure 4B shows that the accumulation of mouse EGFR-siRNA in the liver, lungs, pancreas, spleen, and kidneys is also time-dependent.
[0106] Mice were given either a control plasmid (CMV-scrR) or 0.05 mg / kg of CMV-siR. E Plasmid, CMV-siR 0.5 mg / kg E Plasmid, CMV-siR 5 mg / kg E After administering the plasmid, absolute siRNA (EGFR siRNA) levels were measured in the liver, spleen, heart, lungs, kidneys, pancreas, brain, skeletal muscle, and CD4+ cells of mice. As shown in Figure 5A, there was no siRNA expression in the tissues of mice administered the control plasmid, and CMVsiR E siRNA expression levels and CMV-siR in various tissues of plasmid-treated mice E Plasmid concentrations showed a positive correlation. As shown in Figure 5B, fluorescence in situ hybridization (FISH) similarly confirmed siRNA expression levels and CMV-siR. E Plasmid concentrations showed a positive correlation, meaning that the tissue distribution of EGFR siRNA is dose-dependent.
[0107] When a plasmid enters the body, it expresses a precursor and is processed into a mature product (siRNA). We investigated the metabolism of the precursor and mature product (siRNA) in the liver of mice after plasmid injection, and the results are shown in Figure 6. Six hours after plasmid administration, the expression levels of both the precursor and mature product (siRNA) in the mouse liver reached their peak. Metabolism of the mature product (siRNA) in the mouse liver was completed 36 hours after plasmid administration, and metabolism of the precursor in the mouse liver was completed 48 hours after plasmid administration.
[0108] After injecting exogenous siRNA into the common bile duct of mice, the exosome-free plasma, exosomes, and absolute siRNA levels in the plasma were detected, and the results are shown in Figure 7A. + The levels of siRNA in each cell were detected, and the results are shown in Figure 7B. These two figures reflect that the dynamics of siRNA are nearly the same in different tissues, but there are significant differences in the distribution of siRNA in different tissues.
[0109] siRNAs promoted by albumin (ALB), siRNAs promoted by CMV, and siRNAs without a promoter were intravenously injected into mice. Absolute siRNA levels in the mice were detected at 0, 3, 6, 9, 12, 24, 36, and 48 hours after injection, and the results are shown in Figure 8. The level of siRNA promoted by CMV was the highest in the mice, indicating that the CMV-promoted siRNA was the most effective.
[0110] Inhibition of eGFP levels in mice by self-assembled eGFP siRNA was observed by fluorescence assay as follows: eGFP transgenic mice were given PBS or 5 mg / kg CMV-siR G Or CMV-RVG-siR G The plasmid was intravenously injected, and mice were killed 24 hours after treatment. The eGFP fluorescence level was detected in frozen sections. A representative fluorescence microscopy image is shown in Figure 9A, where green indicates a positive eGFP signal and blue indicates DAPI-stained cell nuclei, with a scale of 100 μm. CMV-RVG-siR G Plasmids were found to have a more pronounced inhibitory effect on mouse eGFP. eGFP transgenic mice were treated with PBS, CMV-scrR, or CMV-siR. EThe plasmid was intravenously injected, and mice were killed 24 hours after treatment. The eGFP fluorescence level was detected in frozen sections, and Figure 9B shows PBS, CMV-siR E CMV-RVG-siR E This bar graph compares the fluorescence intensity of the heart, lungs, kidneys, pancreas, brain, and skeletal muscle of mice injected with [substance name]. It was found that the contrast in fluorescence intensity was even more pronounced in the liver, spleen, lungs, and kidneys of mice.
[0111] PBS, CMV-scrR, CMV-siR E In mice injected with PBS, alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), blood urea nitrogen (BUN), serum alkaline phosphatase (ALP), creatinine (CREA) content, thymus weight, spleen weight, and percentage of peripheral blood cells were detected. The results are shown in Figure 10, with Figures 10A-F representing PBS, CMV-scrR, and CMV-siR, respectively. E Figure 10G compares the alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, and creatinine content of mice injected with each of the following: Figure 10G compares the liver, lung, spleen, and kidney tissues of mice; Figures 10H-I compare the thymus and spleen tissues of mice; and Figure 10J compares the percentage of peripheral blood cells in mice. As a result, PBS, CMV-scrR, and CMV-siR E In mice injected with CMV-siR, the content of ALT, AST, etc., as well as thymus weight, spleen weight, and peripheral blood cell percentage remained almost unchanged. E Mice injected with showed less tissue damage in the liver, lungs, spleen, and kidneys compared to mice injected with PBS.
[0112] Therefore, the RNA delivery system according to this embodiment uses a plasmid as a vector and a plasmid as a mature injector, and its safety and reliability have been thoroughly verified, resulting in excellent drug discovery potential. The RNA sequence that ultimately exerts its effect is delivered encapsulated in an endogenous exosome, and no immune response occurs, eliminating the need to verify the safety of the exosome. This delivery system can deliver various small RNA molecules and is highly versatile. Furthermore, plasmid production is cheaper and more economical than the production of substances such as exosomes, proteins, and polypeptides. The RNA delivery system according to this embodiment can self-assemble in vivo, then tightly bind to AGO2 to enrich and form a complex structure (exosome), which not only prevents premature degradation and maintains stability in circulation, but also facilitates absorption by receptor cells, release in the cytoplasm, and escape from lysosomes, resulting in a low required dose. Example 4
[0113] As shown in Figure 11A, mice were selected and injected with mouse lung cancer cells (LLC cells), followed by PBS buffer / CMV-scrR / gefitinib / CMV-siR. E Mice were treated by injecting the drug every two days, and survival analysis and tumor evaluation were performed on the mice. Treatment was started on day 30 and ended on day 44. Here, CMV-scrR was used as the control plasmid, and CMV-siR was used as the control plasmid. E This represents a plasmid carrying the EGFR siRNA gene circuit.
[0114] As shown in Figure 11B, the horizontal axis represents time and the vertical axis represents survival rate. From this figure, CMV-siR E It was found that mice injected with [the substance] had the highest survival rate.
[0115] As shown in Figure 11C, PBS buffer / CMV-scrR / gefitinib / CMV-siR E When 3D models of the lung tissue of mice injected with CMV-siR were created based on CT images before and after treatment, the results showed that CMV-siR E It was found that tumors were significantly reduced in mice injected with the substance.
[0116] As shown in Figure 11D, this figure represents PBS buffer / CMV-scrR / gefitinib / CMV-siR E Before and after treatment of mice injected with [the drug], tumor volume (mm²) of the mice. 3 This is a comparison diagram of CMV-siR E In mice injected with [the drug], tumor volume was significantly reduced. On the other hand, in mice injected with PBS buffer / CMV-scrR / gefitinib, not only was tumor volume not reduced, but it also increased to varying degrees.
[0117] As shown in Figure 11E, this figure shows a normal mouse and a mouse in PBS buffer / CMV-scrR / gefitinib / CMV-si RE This is a comparative Western blot of mice injected with [a specific substance], showing that mice injected with PBS buffer / CMV-scrR / gefitinib had significantly higher EGFR gene content.
[0118] As shown in Figure 11F, this figure shows a normal mouse and a mouse in PBS buffer / CMV-scrR / gefitinib / CMV-siR E This is a comparative chart of EGFR miRNA levels in mice injected with [a specific substance], showing that mice injected with PBS buffer / CMV-scrR / gefitinib had higher levels of related EGFR miRNA.
[0119] From the above, CMV-siR E It has a remarkable therapeutic effect on EGFR-mutated lung cancer tumors. PBS buffer / CMV-scrR / gefitinib / CMV-siR E HE staining and immunohistochemical staining were performed on each of the injected mice, and as shown in Figures 12A to 12B, EGFR was expressed more in mice injected with PBS buffer / CMV-scrR / gefitinib. Statistical analysis of the stained area of EGFR and PCNA in mice showed that, as shown in Figures 12C to 12D, CMV-scrR EIn mice injected with this drug, the stained area of both EGFR and PCNA was the smallest, indicating the best therapeutic effect against EGFR-mutated lung cancer tumors.
[0120] As shown in Figure 13A, KRAS G12D p53 - / - Select mice and administer PBS buffer / CMV-scrR / gefitinib / CMV-siR from day 50 to day 64 after Adv-Cre inhalation. E Mice were treated by injecting CMV-siR every two days, and survival analysis and tumor evaluation were performed on the mice. K This represents a plasmid carrying the KRAS siRNA gene circuit.
[0121] As shown in Figure 13B, the horizontal axis represents time after infection, and the vertical axis represents survival rate. From this figure, CMV-siR K Mice injected with the drug were found to have a higher survival rate.
[0122] As shown in Figure 13C, CMV-scrR / CMV-siR K When 3D models of the lung tissue of mice injected with CMV-siR were created based on CT images before and after treatment, the results showed that CMV-siR K It was found that injecting this substance significantly inhibits the growth of lung cancer tumors.
[0123] As shown in Figure 13D, this figure represents CMV-scrR / CMV-siR K This is a comparison chart of the number of tumors before and after treatment in mice injected with CMV-siR. K It was found that mice injected with [the substance] showed significantly less increase in tumor numbers.
[0124] As shown in Figure 13E, this figure represents CMV-scrR / CMV-siR K Before and after treatment, the number of tumors (mm²) in mice injected with the drug. 3 This is a comparison diagram of CMV-siR KIn mice injected with [the drug], the increase in tumor volume was slow. On the other hand, in mice injected with CMV-scrR, the increase in tumor volume was significant.
[0125] As shown in Figure 13F, this figure represents CMV-scrR / CMV-siR K This is a comparative Western blot of mice injected with CMV-scrR, showing that mice injected with CMV-scrR had significantly higher KRAS gene content.
[0126] As shown in Figure 13G, this figure represents CMV-scrR / CMV-siR K This is a comparative graph of the associated KRAS mRNA levels in mice injected with CMV-scrR, showing that mice injected with CMV-scrR had higher levels of associated KRAS mRNA.
[0127] From the above, CMV-siR K It has a remarkable therapeutic effect on KRAS-mutated lung cancer tumors. CMV-scrR / CMV-siR K HE staining and immunohistochemical staining were performed on each of the mice injected with CMV-scrR. As shown in Figures 14A, 14D, and 14E, mice injected with CMV-scrR showed higher expression of KRAS, p-AKT, and p-ERK, and a higher staining rate. Western blot detection of the expression levels of related proteins in the mice's bodies showed that mice injected with CMV-scrR expressed more of the related proteins, as shown in Figures 14B and 14C. This also suggests that CMV-scrR... K This suggests that it has a significant inhibitory effect on KRAS-mutated lung cancer tumors.
[0128] The 5' flanking sequence is preferably ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence having more than 80% homology thereto, and includes sequences having 85%, 90%, 92%, 95%, 98%, and 99% homology to ggatcctggaggcttgctgaaggctgtatgctgaattc.
[0129] The loop sequence is preferably gttttggccactgactgac or a sequence having more than 80% homology thereto, and includes sequences having 85%, 90%, 92%, 95%, 98%, 99% homology to gttttggccactgactgac, etc.
[0130] The 3' flanking sequence is preferably accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence having more than 80% homology thereto, and includes sequences having 85%, 90%, 92%, 95%, 98%, and 99% homology to accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag.
[0131] The compensation sequence is the reverse complementary sequence of the RNA fragment, with any bases at positions 1 to 5 deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may also be the reverse complementary sequence of this RNA sequence, with any bases at positions 1 to 5 deleted.
[0132] Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, with any 1-3 bases deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of this RNA sequence, with any 1-3 bases deleted.
[0133] More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, in which any consecutive sequence of bases at positions 1 to 3 is deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of this RNA sequence, in which any consecutive sequence of bases at positions 1 to 3 is deleted.
[0134] Most preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, with the bases at positions 9 and / or 10 deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may also be the reverse complementary sequence of this RNA sequence, with the bases at positions 9 and / or 10 deleted. Deletion of the bases at positions 9 and 10 is most effective.
[0135] Furthermore, the flanking sequences, compensatory sequences, and loop sequences mentioned above were not arbitrarily selected, but were determined based on extensive theoretical research and testing. Therefore, with the cooperation of these specific flanking sequences, compensatory sequences, and loop sequences, the expression rate of RNA fragments can be maximized.
[0136] Any two 5' flanking homologous sequences, two loop homologous sequences, and two 3' flanking homologous sequences are specifically shown in the table below. [Table 1]
[0137] If a plasmid carries two or more circuits, adjacent circuits may be linked via sequence 1-sequence 2-sequence 3. Here, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5 to 80 bases, for example, a sequence of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence of 10 to 50 bases, more preferably a sequence of 20 to 40 bases, and sequence 3 is preferably TGGATC.
[0138] The details of Array 2 are shown in the table below. [Table 2]
[0139] More preferably, if the plasmid carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0140] Detection results of EGFR siRNA content in lung tissue 9 hours after intravenous injection of sequence 4 and sequences 4-1 and 4-2, which have 80% or more homology to sequence 4.
[0141] The details of the array are shown in the table below. [Table 3] Example 5
[0142] Construction of viruses carrying EGFR siRNA / KRAS-siRNA
[0143] We provide nucleic acid construct fragments that encapsulate siRNAs of gene expression inhibitors using AAV-5 adeno-associated virus, which has high affinity for the liver.
[0144] The adenovirus packaging kit and the virus necessary for service construction provided by Hanheng Biotechnology (Shanghai) Co., Ltd. are used, and the packaging method steps include the following: 1. Synthesis or cloning of target nucleic acid fragments 2. Select an enzyme-cleaved support using a suitable restriction endonuclease, and recover the agarose gel to obtain a purified linearized support. 3. Based on the designed primers, the target fragment is enzymatically cleaved, and the agarose gel is recovered to obtain the target fragment of the precise size. 4. The linearization vector and the target fragment are joined according to homologous recombination or T4 linkage methods. 5. Convert the susceptible strain to DH5a or stbl3, spread the bacterial suspension onto a plate, and incubate for 12-16 hours. 6. Select a single-clone mobile colony for testing. 7. Select colonies, verify the correct positive clones, and perform sequencing. 8. Properly sequenced cloned samples are used for plasmid extraction.
[0145] The target vector plasmids provided by Hanheng Biotechnology (Shanghai) Co., Ltd., pAAV-RC vector plasmid and pHelper vector plasmid, and vector plasmid AAV051 carrying the target nucleic acid construct fragment were used, with the nucleic acid construct fragment being CMV-siR. E or CMV-siR K Cloning in a plasmid containing a nucleic acid fragment encoding an siRNA initiated by CMV, wherein an siRNA sequence that inhibits EGFR (having the nucleotide sequence shown in SEQIDNO.:1: UGUGGCUUCUUUAACUCCU) or an siRNA sequence that inhibits KRAS (having the nucleotide sequence shown in SEQIDNO.:7: UGAUUUAUUGGC) is operably ligated after the CMV promoter, the nucleotide sequence shown in SEQIDNO.:2 is the 5' flanking sequence, the nucleotide sequence shown in SEQIDNO.:4 is the nucleotide sequence, the nucleotide sequence shown in SEQIDNO.:3 is the stem-loop sequence, and the bases at positions 9 and / or 10 of the SEQIDNO.RNA fragment are deleted.
[0146] The AAV-5 virus vectors carrying the EGFR siRNA or KRAS-siRNA obtained in this way were named AAV-CMV-EGFR siRNA or AAV-CMV-KRAS siRNA.
[0147] In this specification, unless otherwise specified, the code names AAV-CMV-gene siRNA or AAV-CMVsiR will be used. 遺伝子の略語又は頭文字 A viral vector having the structure of AAV-CMV-EGFR siRNA as described above, characterized in that the RNA sequence of the supported inhibitor gene is different.
[0148] experiment: 100 μL of AAV solution with a potency of 10¹² V.g / ml was injected into the tail vein of mice. We monitored the in vivo expression status of the AAV system in living small animals, and after three weeks, we confirmed that the AAV system was stably expressed in the body, particularly in the liver.
[0149] In the second trial, one test group and two control groups were established. The test group was the AAV-CMV-KRAS-siRNA group, and the control groups were the PBS group and the AAV-CMV-scrR group. An equal number of mice were selected for each group, and mouse lung cancer cells (LLC cells) were injected into the mice's bodies. The progress of mouse model construction was observed using CT scanning technology. After 30 days, mice that had successfully constructed the model were treated with PBS buffer / AAV-CMV-scrR / AAV-CMV-KRAS siRNA injections every two days in the PBS group / AAV-CMV-scrR group / AAV-CMV-KRAS siRNA group. Survival analysis and tumor evaluation were performed on the mice, and treatment was stopped after 7 doses.
[0150] The results of statistically analyzing the survival status of mice in each group within 100 days after treatment are shown in Figure. 25 As shown in A, there was little difference in survival rates between the PBS group and the AAV-CMV-scrR group of mice, while the AAV-CMV-KRAS siRNA group showed the highest survival rate.
[0151] Before and after administration, CT scans were performed on mice in each group. Based on the CT images, a 3D model of the mouse lung tissue was created, and the tumor volume was calculated. The results are shown in the figure. 25 Figure B. 25In B, "PBS pre" indicates the PBS group before administration, "PBS post" indicates the PBS group after administration, "AAV-CMV-scrR pre" indicates the AAV-CMV-scrR group before administration, "AAV-CMV-scrR post" indicates the AAV-CMV-scrR group after administration, "AAV-CMV-KRAS-siRNA pre" indicates the AAV-CMV-KRAS siRNA group before administration, and "AAV-CMV-KRAS-siRNA post" indicates the AAV-CMV-KRAS siRNA group after administration. In mice in the AAV-CMV-KRAS siRNA group, tumor volume decreased significantly after administration, while in mice in the PBS and AAV-CMV-scrR groups, not only did tumor volume not decrease after administration, but it also increased to varying degrees.
[0152] KRAS protein and mRNA expression levels in the lungs of mice from each group were detected by RT-qPCR and Western blotting, respectively, and the results are shown in the figure. 25 C, Figure 25 This is shown in D. From the results, it was found that the KRAS protein and mRNA expression levels in the lungs of mice in the AAV-CMV-KRAS siRNA group were lower than in the control group.
[0153] The above studies suggest that AAV-CMV-KRAS siRNA has a significant therapeutic effect against mouse lung cancer tumors.
[0154] In the third trial, one test group and two control groups were established. The test group consisted of the AAV-CMV-EGFR siRNA group, while the control groups consisted of the PBS group and the AAV-CMV-scrR group.
[0155] An EGFR-DEL19 mouse model was constructed, and tumor production was induced by feeding with doxycycline. After 30 days, mice that successfully constructed the model were administered a treatment every two days. Specifically, mice in the PBS group, AAV-CMV-scrR group, and AAV-CMV-EGFR siRNA group were treated by injecting PBS buffer / AAV-CMV-scrR / AAV-CMV-EGFR siRNA every two days. The survival analysis and tumor evaluation of the mice were performed, and treatment was stopped after 7 administrations.
[0156] The results of statistically analyzing the survival of mice in each group 100 days after treatment are shown in Figure. 26 As shown in A, the survival rates were almost the same in the PBS group and the AAV-CMV-scrR group of mice, but the survival rate was highest in the AAV-CMV-EGFR siRNA group of mice.
[0157] CT scans were performed on each group of mice before and after administration, and the CT images are shown in Figure 1. 26 As shown in E, Figure 26 Based on the CT images of mouse E, a 3D model of the lung tissue was created, the tumor volume was calculated, and the results are shown in the figure. 26 Figure B. 26 In B, "PBS pre" represents the PBS group before administration, "PBS post" represents the PBS group after administration, "AAV-CMV-scrR pre" represents the AAV-CMV-scrR group before administration, "AAV-CMV-scrR post" represents the AAV-CMV-scrR group after administration, "AAV-CMV-EGFR siRNA pre" represents the AAV-CMV-EGFR siRNA group before administration, and "AAV-CMV-EGFR siRNA post" represents the AAV-CMV-EGFR siRNA group after administration. In mice in the AAV-CMV-EGFR siRNA group, tumor volume decreased significantly after administration, but in mice in the PBS group and AAV-CMV-scrR group, not only did tumor volume not decrease after administration, but it also increased to varying degrees.
[0158] EGFR protein and mRNA expression levels were detected in the lungs of each mouse group using RT-qPCR and Western blotting, respectively, and the results are shown in the figure. 26 C, Figure 26 As shown in D, the results showed that in mice with AAV-CMV-EGFR siRNA, the expression levels of EGFR protein and mRNA in the lungs were lower than in the control group.
[0159] The above studies suggest that AAV-CMV-EGFR siRNA has a significant therapeutic effect on lung cancer tumors in EGFR mutant mice.
[0160] In the fourth trial, two test groups and two control groups were established. The test groups were the AAV-CMV-KRAS siRNA group and the AAV-CMV-EGFR siRNA group, while the control groups were the PBS group and the AAV-CMV-scrR group.
[0161] An EGFR-DEL19 mouse model was constructed, and tumor production was induced by feeding with doxycycline. After 30 days, mice that successfully constructed the model were treated by injection every two days with either PBS buffer / AAV-CMV-scrR, AAV-CMV-EGFR siRNA, or AAV-CMV-KRAS siRNA every two days.
[0162] After treatment, the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), serum alkaline phosphatase (ALP), creatinine (CREA), and blood urea nitrogen (BUN) in mice of each group were detected, and these results are shown in the figure. 27 A~Figure 27 As shown in F, it was found that the enzyme content was almost the same in mice of the PBS group, AAV-CMV-scrR group, AAV-CMV-EGFR siRNA group, and AAV-CMV-KRAS siRNA group.
[0163] The above tests suggest that encapsulating the EGFR siRNA system (AAV-CMV-EGFR siRNA) and the KRAS siRNA system (AAV-CMV-KRAS siRNA) with AAV-5 adeno-associated virus, which has high affinity for the liver, results in a system that is highly safe, reliable, has no adverse effects, and is suitable for large-scale dissemination and application.
[0164] The viral vector of the present invention may also include a flanking sequence, a compensation sequence, and a loop sequence that can fold the circuit into the correct structure and express it, and may include any or a combination of some circuits such as 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, or 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence. Here, the 5' flanking sequence is preferably a sequence that has 80% or more homology to ggatcctggaggcttgctgaaggctgaattc, including sequences that have 85%, 90%, 92%, 95%, 98%, and 99% homology to ggatcctggaggctgaattc.
[0165] The loop sequence is preferably a sequence having more than 80% homology, such as gttttggccactgactgac, or sequences with homology of 85%, 90%, 92%, 95%, 98%, or 99% to gttttggccactgactgac.
[0166] The 3' flanking sequence is preferably accggtcaggacaaggacaaggcctgttactcacatggaacaatggcccgcactcgag or a sequence with more than 80% homology to accggtcaggacaaggacaaggcccgcactcgag, including sequences with homology of 85%, 90%, 92%, 95%, 98%, and 99% to accggtcaggacaaggacaaggcccgcactcgag.
[0167] This compensation sequence is the reverse complementary sequence of the RNA fragment, with any bases at positions 1 to 5 deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any bases at positions 1 to 5 deleted.
[0168] Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, in which any 1-3 bases are deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence in which any 1-3 bases are deleted.
[0169] More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, with any 1-3 consecutively sequenced bases deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with any 1-3 consecutively sequenced bases deleted.
[0170] The compensation sequence is the reverse complementary sequence of the RNA fragment, most preferably with deletions at positions 9 and / or 10. If the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence with deletions at positions 9 and / or 10. Deletions at positions 9 and 10 are most effective.
[0171] Furthermore, the flanking sequences, compensatory sequences, and loop sequences mentioned above were not arbitrarily selected, but were determined based on extensive theoretical research and testing. Therefore, with the cooperation of these specific flanking sequences, compensatory sequences, and loop sequences, it is possible to maximize the expression rate of RNA fragments to the greatest extent possible.
[0172] When a viral vector carries two or more circuits, adjacent circuits may be linked via sequence 1-sequence 2-sequence 3. Here, sequence 1 is preferably CAGATC, sequence 2 may be a sequence consisting of 5 to 80 bases, for example, a sequence consisting of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence consisting of 10 to 50 bases, more preferably a sequence consisting of 20 to 40 bases, and sequence 3 is preferably TGGATC.
[0173] The details of Array 2 are shown in the table below. [Table 4]
[0174] More preferably, if the viral vector carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0175] Sequence 4 and sequences 4-1 and 4-2, which have more than 80% homology to sequence 4, were constructed in an AAV vector, and the EGFR siRNA content in lung tissue was measured after 9 hours of intravenous injection.
[0176] The details of the array are shown in the table below. [Table 5] Example 6
[0177] Construction of a plasmid CMV-siR carrying a VEGFR siRNA that inhibits VEGFR expression by the method described in Example 2. V Alternatively, a plasmid CMV-siR carrying mTOR siRNA that inhibits mTOR expression. mTAnd so on. Among them, the siRNA of the VEGFR gene has the following nucleotide sequence: AUUUGAAGAGUUUGUAUUAGCC (SEQ IDNO.: 8). The siRNA of the mTOR gene has the following nucleotide sequence: AGAUAGUUGGCAAAUCUGCCA (SEQ IDNO. 9).
[0178] Different mice were injected with PBS buffer / control plasmid / VEGFR siRNA plasmid / mTOR siRNA plasmid / MIX siRNA plasmid (VEGFR siRNA and mTOR siRNA combined) / sunitinib / Everolimus, and the development of renal cancer tumors in the mice was observed. The results are shown in Figure. 39 ,figure 40 As shown, the development of renal cancer was most significantly inhibited in mice injected with the MIX siRNA plasmid, while the development of renal cancer was relatively rapid in mice injected with PBS buffer / control plasmid.
[0179] Based on the above, the combination of VEGFR siRNA and mTOR siRNA has a remarkable therapeutic effect on renal cancer tumors.
[0180] When a viral vector carries two or more circuits, adjacent circuits may be linked via sequence 1-sequence 2-sequence 3. Here, sequence 1 is preferably CAGATC, sequence 2 may be a sequence consisting of 5 to 80 bases, for example, a sequence consisting of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases, preferably a sequence consisting of 10 to 50 bases, more preferably a sequence consisting of 20 to 40 bases, and sequence 3 is preferably TGGATC.
[0181] The details of Array 2 are shown in the table below. [Table 6]
[0182] More preferably, if the viral vector carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0183] When the linked sequences are sequence 4 and sequences 4-1 and 4-2, which have 80% or more homology to sequence 4, the delivery system containing these sequences is detected in lung tissue 9 hours after injection and exhibits corresponding enrichment, self-assembly, and cancer therapeutic effects.
[0184] The details of the array are shown in the table below. [Table 7] Example 7
[0185] Plasmid CMV-siR carrying TNF-α siRNA that inhibits TNF-α expression by the method described in Example 2 TNF-α Alternatively, the anti-integrin-α siRNA plasmid CMVsiR inhibits the expression of integrin-α. integrin-α Alternatively, a plasmid CMV-siR carrying B7 siRNA that inhibits B7 expression. B7 The following were supported. Among them, TNF-α siRNA has the following nucleotide sequence: AAAACAUAAUCAAAAGAAGGC (SEQ ID NO. 10). Among them, integrin-α siRNA has the following nucleotide sequence: AUAAUCAUCUCCAUUAAUGUC (SEQ ID NO. 11). B7 siRNA has the following nucleotide sequence: UUUUCUUUGGUAAUCUUCAG (SEQ ID NO. 12).
[0186] Furthermore, an siRNA plasmid CMV-si simultaneously carrying TNF-α siRNA, integrin-α siRNA, and B7 siRNA was constructed according to the method described in Example 2.
[0187] In the first trial, three test groups and three control groups were established. The test groups were the anti-TNF-α(0.5) group, the anti-TNF-α(5) group, and the anti-TNF-α(20) group, while the control groups were the mock group, the scr-RNA group, and the IFX group, respectively.
[0188] In this group, the anti-TNF-α(0.5), anti-TNF-α(5), and anti-TNF-α(20) groups each used plasmids to develop the TNF-α siRNA gene circuit (CMV-siR TNF-α ) encapsulates 0.5 μL, 5 μL, and 20 μL of CMV-siR TNF-α The solution was injected into the tail vein of mice.
[0189] The mock group served as a negative control group, while the scr-RNA group and IFX group received tail vein injections of scr-RNA plasmid and IFX (infliximab), respectively.
[0190] Next, we began constructing a DSS-induced chronic colitis model, during which we weighed and recorded our body weight daily. The results are shown in Figure 54 As shown in A, the scr-RNA group experienced the fastest weight loss, while the anti-TNF-α(0.5), anti-TNF-α(5), and anti-TNF-α(20) groups experienced slower weight loss. This suggests that higher doses of TNF-α siRNA solution resulted in slower weight loss, indicating that the plasmid-encapsulated TNF-α siRNA system can mitigate weight loss in mice with colitis.
[0191] After the model was built, we monitored the in vivo expression of the plasmid system through living small animals, then killed mice and observed their colons. (See Figure) 54As shown in B, the scr-RNA group had the shortest colon length, while the anti-TNF-α(0.5), anti-TNF-α(5), and anti-TNF-α(20) groups had relatively longer colon lengths. It was found that the higher the TNF-α siRNA injection dose, the longer the colon length of the mice. This suggests that the plasmid-encapsulated TNF-α siRNA system shows varying degrees of improvement against colon shortening caused by chronic inflammation.
[0192] The results of evaluating the disease activity index in mice are shown in Figure. 54 As shown in C, the disease activity index of mice was high in the scr-RNA injection group, the anti-TNF-α(0.5) group, and the anti-TNF-α(5) group, while the disease activity index of mice was low in the anti-TNF-α(20) group and the IFX group.
[0193] The results of detecting TNF-α mRNA in the colon of mice are shown in Figure 54 As shown in D, this CMV-siR TNF-α The system was found to be able to reduce the expression and secretion of TNF-α in the colon, and the results of detecting TNF-α in the colon of mice were shown in Figure. 54 As shown in E, this AAV system was found to be able to produce a certain amount of TNF-α, and as a result of detecting the pro-inflammatory factors IL-6, IL-12p70, IL-17A, and IL-23 in the colon, Figure 54 As shown in F, the secretion of inflammatory factors in the high-dose group was generally lower than in the control group.
[0194] Mouse colon sections were stained with HE, and pathological scoring was performed. The results are shown in the figure. 55 A and Figure 55As shown in B, the mice in the anti-TNF-α(0.5), anti-TNF-α(5), and anti-TNF-α(20) groups, particularly the anti-TNF-α(20) group, showed even greater colonic mucosal integrity, shallower immune cell infiltration, and significantly reduced colonic crypt abscesses, as well as colonic congestion and bleeding, compared to the control group.
[0195] The above studies demonstrated that encapsulating the TNF-α siRNA system using plasmids is more effective than IFX in improving the symptoms of colitis.
[0196] In the second trial, four test groups and three control groups were established. The test groups were the anti-TNF-α group, anti-integrin-α group, anti-B7 group, and anti-mix group, while the control groups were the mock group, PBS group, and scr-RNA group.
[0197] In the anti-TNF-α, anti-integrin-α, anti-B7, and anti-mix groups, the TNF-α siRNA gene circuit (CMV-siR) was modified using plasmids. TNF-α ), integrin-α siRNA gene circuit (CMV-siR integrin-α ), B7 siRNA gene circuit (CMV-siR B7 ), mix siRNA gene circuit (CMV-siR mix , in other words, CMV-siR TNF-α+integrin-α+B7 When a substance containing the above was injected into the tail vein of mice at a rate of 20 μL, and the in vivo expression of this system was monitored through living small animals, it was found that the above system was stably expressed in the body, particularly in the liver.
[0198] The mock group served as the negative control group. The scr-RNA group and the PBS group were administered via tail vein injection to mice, respectively, with scr-RNA plasmid and PBS solution (phosphate-buffered salt solution).
[0199] Next, the construction of the DSS-induced chronic colitis model was initiated, and during this period, the body weight was measured and recorded daily. As a result, as shown in Fig. 56 A, in the anti-mix group, the weight gain of the mice was the mildest. That is, the CMV-siR TNF-α+integrin-α+B7 gene circuit encapsulated in the plasmid could significantly reduce the weight loss of chronic colitis mice. In the anti-TNF-α group, anti-integrin-α group, and anti-B7 group, it was found that the weight recovery rate of the mice during the remission period of inflammation was also significantly faster than that of the scr-RNA group and PBS group.
[0200] After the construction of the model was completed, the in vivo expression of the plasmid system was monitored through living small animals, and then the mice were sacrificed and the colon was observed. As a result, as shown in Fig. 56 B, in the four test groups, the erythema of the mice's colon was different in degree but was alleviated, and the shortening of the colon length due to chronic inflammation was also different in degree but was improved.
[0201] As a result of evaluating the Disease Activity Index of the mice, as shown in Fig. 56 C, in the scr-RNA group and PBS group, the disease activity index of the mice was high. In the anti-TNF-α group, anti-integrin-α group, anti-B7 group, and anti-mix group, it was found that the disease activity index of the mice decreased in order.
[0202] As a result of detecting TNF-α mRNA, integrin mRNA, and B7 mRNA in the plasma, liver, and colon of the mice, as shown in Fig. 56 D to Fig. 56 F, it was found that this system generated a certain amount of RNA that was stably expressed in the plasma, liver, and colon, and also significantly reduced the expression of TNF-α, integrin, and B7 mRNA in the colon.
[0203] As a result of HE staining of the mouse colon sections, as shown in Fig. 57As shown in [Figure 0], in the mice of the four test groups, especially the mice in the anti-mix group, the integrity of the colonic mucosa was even higher, and the degree of infiltration of immune cells was even shallower. It was also found that the colonic crypt abscesses and the congestion and bleeding of the colon were significantly reduced compared with the control group. Example 8
[0204] Virus AAV-CMV-siRTNF-α carrying TNF-α siRNA that inhibits the expression of TNF-α or virus AAV-CMVsiR carrying anti-integrin-α siRNA that inhibits the expression of integrin-α by the method described in Example 5 integrin-α or virus AAV-CMV-siR carrying B7 siRNA that inhibits the expression of B7 B7 was constructed. Among them, TNF-α siRNA has the following nucleotide sequence AAAACAUAAUCAAAAGAAGGC (SEQ ID NO.10). Among them, integrin-α siRNA has the following nucleotide sequence AUAAUCAUCUCCAUUAAUGUC (SEQ ID NO.11). B7 siRNA has the following nucleotide sequence UUUUCUUUGGUAAUCUUCAG (SEQ ID NO.12). Also, a virus (AAV-CMV-si mix CMV-siR TNF-α+integrin-α+B7 ) that simultaneously holds TNF-α siRNA, integrin-α siRNA, and B7 siRNA was constructed.
[0205] In the first test, three test groups and two control groups were set up. The three test groups were the AAV-CMV-siR TNF-α (low) group, the AAV-CMV-siR TNF-α (medium) group, and the AAV-CMV-siR TNF-α (high) group, respectively. The control groups were the normal group and the AAV-CMV-scrR group, respectively.
[0206] As for the test process, as shown in Figure 58 A, the AAV-CMV-siR TNF-α (low) group, the AAV-CMV-siR TNF-α (medium) group, the AAV-CMV-siRTNF-α In the (high) group, the TNF-α siRNA system (AAV-CMV-siR) was used with AAV-5 adeno-associated virus, which has high affinity for the liver. TNF-α ) encloses, potency 10 12 AAV solution at a concentration of Vg / ml was injected into mice via tail vein at concentrations of 25 μL, 50 μL, and 100 μL.
[0207] The results of monitoring the in vivo expression of the AAV system in living small animals are shown in Figure 58 As shown in B, after 3 weeks, the AAV system was found to be stably expressed in the body, particularly in the liver, and among them, AAV-CMV-siR TNF-α In the (high) group, the average radiance is 8.42 * 10⁵ (p / sec / cm²). 2 The result reached / sr), and the expression site was the liver, indicating that the expression of the AAV system has a dose-dependent effect.
[0208] Next, we began constructing a DSS-induced chronic colitis model, and during that time, we weighed and recorded the body weight every two days. The results are shown in Figure 58 As shown in C, the CMV-siR TNF-α system encapsulated in AAV was able to reduce weight loss in mice with chronic colitis, and in the three test groups, the rate of weight recovery during the inflammation relief phase was significantly faster than in the AAV-CMV-scrR group.
[0209] After completing model construction in week 10 and monitoring the in vivo expression of the AAV system through living small animals, the mice were killed and their colons were observed, as shown in the figure. 58 As shown in D, AAV-CMV-siR TNF-α (low) group, AAV-CMV-siR TNF-α (middle) group, AAV-CMV-siR TNF-α In the (high) group of mice, colonic redness was reduced to some extent, and the shortening of colon length due to chronic inflammation was also improved to some extent, and among them, AAV-CMV-siR TNF-α In the (high) group, the improvement in inflammation was most pronounced.
[0210] The disease index of each group of mice was scored and statistically analyzed, as shown in Figure. 58 As shown in E, AAV-CMV-siR TNF-α In the (high) group of mice, the disease index of mice was AAV-CMV-siR TNF-α (low) group, AAV-CMV-siR TNF-α The levels were lower than in the (intermediate) group and the AAV-CMV-scrR group.
[0211] The TNF-α siRNA levels in the bodies of mice from each group were detected, as shown in Figure. 58 As shown in F, TNF-α siRNA levels were high in all three test groups of mice, while TNF-α siRNA expression was almost nonexistent in the control group (AAV-CMV-scrR group) mice. This suggests that the AAV system described above can produce a certain amount of TNF-α siRNA.
[0212] The TNF-α mRNA levels in the bodies of mice from each group were detected, as shown in Figure. 58 As shown in G, TNF-α mRNA levels were low in the normal group and the three test groups of mice, while TNF-α mRNA levels were high in the AAV-CMV-scrR group of mice. This suggests that the AAV system can reduce TNF-α expression and secretion in the colon.
[0213] The results of detecting pro-inflammatory cytokines IL-6, IL-12, and IL-23 in the mouse colon are shown in Figure. 59 As shown in A, the normal group and AAV-CMV-siR TNF-α In the (high) group of mice, the secretion of pro-inflammatory cytokines was lowest, while in the AAV-CMV-scrR group of mice, the secretion of pro-inflammatory cytokines was highest.
[0214] Mouse colon sections were stained with HE, and pathological scoring was performed. The results are shown in the figure. 59 B, Figure 59 As shown in C, the test group, particularly AAV-CMV-siR TNF-αIn the (high) group of mice, the integrity of the colonic mucosa was even higher, the degree of immune cell infiltration was even shallower, and colonic crypt abscesses, as well as colonic congestion and bleeding, were significantly reduced compared to the AAV-CMV-scrR group.
[0215] From the above tests, CMV-siR encapsulated in liver-affinity AAV TNF-α According to the gene circuit, it enables long-term TNF-α siRNA expression and long-term TNF-α silencing, and can also alleviate colitis to some extent, making it extremely promising in terms of drug discovery potential and clinical research value.
[0216] In the second trial, three test groups and two control groups were established. The test groups were each AAV-CMV-siR T+B+I (low) group, AAV-CMV-siR T+B+I (middle) group, AAV-CMV-siR T+B+I The (high) group consisted of the normal group and the AAV-CMV-scrR group, respectively.
[0217] AAV-CMV-siR T+B+I (low) group, AAV-CMV-siR T+B+I (middle) group, AAV-CMV-siR T+B+I In the (high) group, AAV-5 adeno-associated virus with high affinity to the liver was used to deliver TNF-α siRNA, B7-siRNA, and Integrinα4 siRNA elements in a tandem delivery system (AAV-CMV-siR). T+B+I ) encloses, potency 10 12 AAV solution at a concentration of Vg / ml was injected into the tail vein of mice in volumes of 25 μL, 50 μL, and 100 μL.
[0218] The results of monitoring the in vivo expression of the AAV system in living small animals are shown in Figure 60 As shown in A, the AAV system was stably expressed in the body, particularly in the liver, after 3 weeks, demonstrating that the expression of the AAV system has a dose-dependent effect.
[0219] Next, we began constructing a DSS-induced chronic colitis model, and during that time, we weighed and recorded the body weight every two days. The results are shown in Figure 60 As shown in B, CMV-siR enclosed in AAV T+B+I The system was able to reduce weight loss in mice with chronic colitis, and in the three test groups, the rate of weight recovery during the inflammation relief phase was significantly faster than in the AAV-CMV-scrR group.
[0220] After completing model construction in week 10 and monitoring the in vivo expression of the AAV system through living small animals, the mice were killed and their colons were observed, as shown in the figure. 60 As shown in C, AAV-CMV-siR T+B+I (low) group, AAV-CMV-siR T+B+I (middle) group, AAV-CMV-siR T+B+I In the (high) group of mice, colonic redness was reduced to some extent, and the shortening of colon length due to chronic inflammation was also improved to some extent, and among them, AAV-CMV-siR T+B+I In the (high) group, the improvement in inflammation was found to be the most significant.
[0221] The disease index of mice in each group was scored and statistically analyzed, as shown in Figure. 61 As shown in A, AAV-CMV-siR T+B+I In the (high) group of mice, the disease index was AAV-CMV-siR T+B+I (low) group, AAV-CMV-siR T+B+I It was found to be lower than in the (intermediate) group and the AAV-CMV-scrR group.
[0222] The results of detecting TNF-α siRNA, B7 siRNA, and integrinα4 siRNA in mouse plasma are shown in Figure. 61 B, Figure 61 C, Figure 61 As shown in D, CMV-siR enclosed in AAV T+B+I The system was found to generate a fixed amount of siRNA that is stably expressed in mouse plasma, and to exhibit a dose-dependent effect.
[0223] The results of detecting TNF-α siRNA, B7 siRNA, and integrinα4 siRNA in mouse liver are shown in Figure. 61 E, Figure 61 F, Figure 61 As shown in G, CMV-siR enclosed in AAV T+B+I The system was found to generate a fixed amount of siRNA that is stably expressed in the liver of mice, and to exhibit a dose-dependent effect.
[0224] This system produced a fixed amount of siRNA that is stably expressed in the liver of mice and demonstrated a dose-dependent effect.
[0225] The results of detecting TNF-α siRNA, B7 siRNA, and integrinα4 siRNA in mouse colon are shown in Figure. 62 Large, Figure 62 B, Figure 62 As shown in C, CMV-siR enclosed in AAV T+B+I The system was found to generate a fixed amount of siRNA that is stably expressed in the mouse colon and to exhibit a dose-dependent effect.
[0226] The results of detecting TNF-α mRNA, B7 mRNA, and integrinα4 mRNA in mouse colon are shown in Figure. 62 D, Figure 62 E, Figure 62 As shown in F, CMV-siR enclosed in AAV T+B+I The system was found to significantly reduce the expression of TNF-α, B7, and integrinα4 mRNA in the mouse colon. After HE staining of mouse colon sections and statistical analysis of pathological scoring, the results were as shown in the figure. 63 A, and Figure 63 As shown in B, the test group, particularly AAV-CMV-siR T+B+I In the (high) group of mice, the integrity of the colonic mucosa was even higher, the degree of immune cell infiltration was even shallower, and colonic crypt abscesses, as well as colonic congestion and bleeding, were significantly reduced compared to the AAV-CMV-scrR group.
[0227] From the above tests, CMV-siR encapsulated in liver-affinity AAV T+B+I According to the gene circuit, long-term expression of TNF-α siRNA, B7 siRNA, and integrinα4 siRNA, as well as silencing of multiple target genes, was possible, and the degree of colitis could be significantly alleviated, showing great potential for drug discovery and clinical research value.
[0228] The above arrangement is specifically as shown in the table below. [Table 8-1] [Table 8-2] Example 9
[0229] Plasmid CMV-siR, which carries miR-21 siRNA that inhibits miR-21 expression. miR-21 Plasmid CMVsiR, which carries TGF-β1 siRNA that inhibits TGF-β1 expression. TGF β1 The following is constructed. Here, the miR-21siRNA has the antisense strand of miR-21. Among them, the TGF-β1 siRNA has the following nucleotide sequence: ACGGAAAUAACCUAGAUGGGC (SEQ ID NO. 13).
[0230] Furthermore, plasmid CMV-siR, which simultaneously carries miR-21siRNA and TGF-β1siRNA. miR-21+TGF-β1 This is constructed using the method described in Example 2.
[0231] In this study, eight test groups and three control groups were established. The test groups were, respectively, the Anti-miR-21 (1 mg / kg) group, the Anti-miR-21 (5 mg / kg) group, the Anti-miR-21 (10 mg / kg) group, the TGF-β1 siRNA (1 mg / kg) group, the TGF-β1 siRNA (5 mg / kg) group, the TGF-β1 siRNA (10 mg / kg) group, the Anti-miR-21 + TGF-β1 siRNA (10 mg / kg) group, and the Pirfenidone (300 mg / kg) group. The control groups were, respectively, the normal group, the PBS group, and the scrRNA group.
[0232] In the Anti-miR-21 (1 mg / kg) group, Anti-miR-21 (5 mg / kg) group, and Anti-miR-21 (10 mg / kg) group, plasmids carrying 1 mg / kg, 5 mg / kg, and 10 mg / kg of Anti-miR-21 (antisense strand of miRNA 21) were injected via tail vein into mice with pulmonary fibrosis. In the TGF-β1 siRNA (1 mg / kg) group, TGF-β1 siRNA (5 mg / kg) group, and TGF-β1 siRNA (10 mg / kg) group, TGF-β1 siRNA plasmids carrying 1 mg / kg, 5 mg / kg, and 10 mg / kg of TGF-β1 siRNA (10 mg / kg) were injected via tail vein into mice with pulmonary fibrosis. In the Anti-miR-21 + TGF-β1 siRNA (10 mg / kg) group, 10 mg / kg of Anti-miR-21 and TGF-β1 siRNA plasmids were injected via tail vein into mice with pulmonary fibrosis. In the Pirfenidone (300 mg / kg) group, pirfenidone 300 mg / kg was injected via tail vein into mice with pulmonary fibrosis. The normal group served as the normal control group. In the PBS group and scrRNA group, PBS solution and a control plasmid were injected via tail vein into mice with pulmonary fibrosis, respectively.
[0233] The hydroxyproline content was detected in each group of mice, and the results are shown in the figure. 93 As shown in the figure, hydroxyproline is mainly composed of collagen, and its content reflects the degree of pulmonary fibrosis. 93From this, it was found that the mice in the Anti-miR-21 (5 mg / kg) group, the Anti-miR-21 (10 mg / kg) group, the TGF-β1 siRNA (10 mg / kg) group, and the Anti-miR-21 + TGF-β1 siRNA (10 mg / kg) group had relatively low hydroxyproline content, indicating that pulmonary fibrosis was inhibited.
[0234] The results of fluorescent staining of the lungs of mice from each group are shown in the figure. 94 As shown in the figure, the green area represents type I collagen, the red area represents α-SMA, and the blue area represents DAPI. Mice in the PBS group and the scrRNA group had high levels of type I collagen and α-SMA, but mice in the test group had low levels of both type I collagen and α-SMA. In particular, the Anti-miR-21 (5 mg / kg) group, the Anti-miR-21 (10 mg / kg) group, and the Anti-miR-21 + TGF-β1 siRNA (10 mg / kg) group showed almost no expression of type I collagen and α-SMA.
[0235] The lungs of mice from each group were stained with Masson tricolor, and the results are shown in the figure. 95 As shown, in mice from the PBS group and the scrRNA group, the alveolar spaces were severely destroyed and pulmonary interstitial collagen was formed, but in the test group, these phenomena were significantly reduced.
[0236] The lungs of mice from each group were stained with H&E, and the results are shown in the figure. 96 As shown in the figure, mice in the PBS and scrRNA groups showed enlarged alveolar spaces, infiltration of inflammatory cells, and damage to alveolar structures, while the lung tissue of the experimental groups was found to be normal. Western blot was used to detect TGF-β1 protein levels and TGF-β1 mRNA levels in mice from the normal group, PBS group, scrRNA group, TGF-β1 siRNA (1 mg / kg) group, TGF-β1 siRNA (5 mg / kg) group, TGF-β1 siRNA (10 mg / kg) group, and Pirfenidone (300 mg / kg) group, respectively. The results are shown in the figure. 97 A~Figure 97As shown in C, the mice in the TGF-β1 siRNA (10 mg / kg) group had the lowest levels of both TGF-β1 protein and TGF-β1 mRNA. This suggests that TGF-β1 can be delivered to the lungs and exert its function after the corresponding siRNA expression plasmid is injected via tail vein.
[0237] The relative miR-21 levels were detected in mice in the normal group, PBS group, scrRNA group, Anti-miR-21 (1 mg / kg) group, Anti-miR-21 (5 mg / kg) group, and Anti-miR-21 (10 mg / kg) group, respectively. (See Figure) 97 As shown in D, the mice in the Anti-miR-21 (10 mg / kg) group showed the highest relative miR-21 levels. This suggests that after tail vein injection of the corresponding antisense strand expression plasmid, the miR-21 antisense strand can be delivered to the lungs and exert its function.
[0238] From the above tests, CMV-siR encapsulated in a liver-affinity plasmid was found to be effective. miR-21 CMV-siR TGF-β1 CMV-siR miR-21+TGF-β1 According to the gene circuit, the severity of pulmonary fibrosis could be significantly alleviated, and its potential for drug discovery and clinical research value were extremely promising.
[0239] Plasmids containing sequence fragments of three different 5' flanking sequences, a loop sequence, and a 3' flanking sequence similarly exhibit therapeutic effects against enrichment, self-assembly, and pulmonary fibrosis in vivo, with the sequences being as follows: 1. Three 5' flanking sequences with over 80% homology. 2. Three loop sequences with over 80% homology 3. Three 3' flanking sequences with over 80% homology. The specific sequences are shown in the following table. [Table 9]
[0240] When an RNA plasmid delivery system carries multiple circuits, sequence 2, which is the linking sequence between adjacent circuits, can consist of multiple bases. In this case, the plasmid also exhibits an enrichment effect after injection, and sequence 2 specifically looks like the table below. [Table 10]
[0241] The specific sequences are shown in the table below, where sequence 4-1 is sequence 4 as described above, and sequences 4-2 / 4-3 / 4-4 are homologous sequences to sequence 4-1 with a homology of more than 80%. [Table 11]
[0242] For in vivo enrichment, self-assembly, and pulmonary fibrosis therapeutic effects when RNA sequence lengths in the plasmid delivery system are 18, 19, and 21, respectively.
[0243] The specific sequences are shown in the table below. [Table 12]
[0244] In plasmid delivery systems, when RNA fragments are supported, they contribute to enrichment of the body, spontaneous complex structure formation, and therapeutic effects against pulmonary fibrosis. The RNA fragments are classified as follows, but are not limited to these: 1) siRNA1 alone, siRNA2 alone, shRNA1 alone, shRNA2 alone, miRNA1 alone, miRNA2 alone, 2) In 1) above, an RNA fragment containing any two types of RNA sequences, 3) The above 1) contains RNA fragments of any three types of RNA sequences.
[0245] The specific sequences are shown in the table below. [Table 13] Example 10
[0246] AAV-CMV-siR virus carrying miR-21 siRNA that inhibits miR-21 expression by the methods described in Examples 5 and 9. miR-21 Alternatively, the AAV-CMVsiR virus possesses a TGF-β1 siRNA that inhibits TGF-β1 expression. TGF β1 The following was constructed. Here, the miR-21 siRNA has the antisense strand of miR-21. Among them, the TGF-β1 siRNA has the following nucleotide sequence ACGGAAAUAACCUAGAUGGGC (SEQ ID NO. 13). Also, the AAV-CMV-siRNA is a virus AAV-CMVMIX that simultaneously possesses both miR-21 siRNA and TGF-β1 siRNA. miR-21+TGF-β1 We constructed it.
[0247] A 100 μL AAV solution with a potency of 10¹² V.g / ml was injected into the tail vein of mice. The in vivo expression of the AAV system was monitored in living small animals, and after 3 weeks, stable expression of the AAV system was observed in the body, particularly in the liver.
[0248] After selecting mice and successfully creating models, each mouse was injected with PBS buffer / AAV-scrR / AAV-anti-miR21 / AAV-TGF-β1 siRNA / AAV-MIX (10 mg / kg) to create PBS, AAV-scrR, AAV-anti-miR21, AAV-TGF-β1 siRNA, and AAV-MIX groups, respectively.
[0249] The detection results for TGF-β1 mRNA levels in normal mice, PBS-group mice, AAV-scrR-group mice, and AAV-TGF-β1siRNA-group mice are shown in the figure. 107 As shown in B, the TGF-β1 mRNA levels in the AAV-TGF-β1 siRNA group mice were relatively low.
[0250] The miR21 mRNA levels were measured in normal mice, PBS-group mice, AAV-scrR-group mice, and AAV-anti-miR21-group mice, respectively, and the results are shown in Figure 1. 107 As shown in C, the miR21 mRNA levels in the AAV-anti-miR21 group mice were found to be relatively low.
[0251] The hydroxyproline content of mice in each group was measured, and the results are shown in Figure. 107 As shown in A, the hydroxyproline content in the bodies of mice in the PBS group and the AAV-scrR group was the highest, while the hydroxyproline content in the bodies of mice in the AAV-anti-miR21 group, the AAV-TGF-β1 siRNA group, and the AAV-MIX group was relatively low in all of them, suggesting that pulmonary fibrosis was inhibited in the mice in the AAV-anti-miR21 group, the AAV-TGF-β1 siRNA group, and the AAV-MIX group.
[0252] Furthermore, the viral vector of the present invention may further include a flanking sequence, a compensation sequence, and a loop sequence that can fold the line into the correct structure for expression, wherein the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence, and the viral vector includes one line or a combination of several lines of any of the following: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, or 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence.
[0253] The 5' flanking sequence is preferably ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence having more than 80% homology thereto, and includes sequences having 85%, 90%, 92%, 95%, 98%, and 99% homology to ggatcctggaggcttgctgaaggctgtatgctgaattc.
[0254] The loop sequence is preferably gttttggccactgactgac or a sequence having more than 80% homology thereto, and includes sequences having 85%, 90%, 92%, 95%, 98%, 99% homology to gttttggccactgactgac, etc.
[0255] The 3' flanking sequence is preferably accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence having more than 80% homology thereto, and includes sequences having 85%, 90%, 92%, 95%, 98%, and 99% homology to accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag.
[0256] The compensation sequence is the reverse complementary sequence of the RNA fragment, with any bases at positions 1 to 5 deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may also be the reverse complementary sequence of this RNA sequence, with any bases at positions 1 to 5 deleted.
[0257] Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, with any 1-3 bases deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of this RNA sequence, with any 1-3 bases deleted.
[0258] More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, in which any consecutive sequence of bases at positions 1 to 3 is deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of this RNA sequence, in which any consecutive sequence of bases at positions 1 to 3 is deleted.
[0259] Most preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, with the bases at positions 9 and / or 10 deleted. If the RNA fragment contains only one RNA sequence, the compensation sequence may also be the reverse complementary sequence of this RNA sequence, with the bases at positions 9 and / or 10 deleted. Deletion of the bases at positions 9 and 10 is most effective.
[0260] Furthermore, the flanking sequences, compensatory sequences, and loop sequences mentioned above were not arbitrarily selected, but were determined based on extensive theoretical research and testing. Therefore, with the cooperation of these specific flanking sequences, compensatory sequences, and loop sequences, the expression rate of RNA fragments can be maximized.
[0261] Adenovirus vectors exhibit enrichment, self-assembly, and pulmonary fibrosis-treating effects in vivo, even when containing three types of co-origin sequences. The sequence combinations are as follows: 1. Three 5' flanking sequences with over 80% homology. 2. Three loop sequences with over 80% homology 3. Three 3' flanking sequences with over 80% homology
[0262] The details of the sequence are shown in Table 2 below. [Table 14]
[0263] When a viral vector carries two or more circuits, adjacent circuits may be linked via sequence 1-sequence 2-sequence 3. Here, sequence 1 is preferably CAGATC, sequence 2 may be a sequence consisting of 5 to 80 bases, for example, a sequence consisting of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 bases, preferably a sequence consisting of 10 to 50 bases, more preferably a sequence consisting of 20 to 40 bases, and sequence 3 is preferably TGGATC.
[0264] When an adenovirus vector carries multiple circuits, adjacent circuits are connected by sequence 1-sequence 2-sequence 3, with sequence 2 containing multiple bases. The constructed delivery system similarly exhibits enrichment, self-assembly, and pulmonary fibrosis therapeutic effects in vivo.
[0265] Details of Array 2 are shown in Table 3 below. [Table 15]
[0266] More preferably, if the viral vector carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0267] If the linked sequence is sequence 4 and a sequence with 80% or more homology to sequence 4, the constructed delivery system also has enrichment, self-assembly, and pulmonary fibrosis therapeutic effects in vivo. Sequence 4-1 is the aforementioned sequence 4, and sequences 4-2 / 4-3 / 4-4 are homologous sequences of sequence 4-1, respectively. The specific sequences are shown in Table 4 below. [Table 16]
[0268] The above RNA fragments contain one or more specific RNA sequences of medical importance that are expressible at the target receptor and have a compensatory sequence that is not expressible at the target receptor. The RNA sequence may be an siRNA sequence, an shRNA sequence, or a miRNA sequence, and is preferably an siRNA sequence.
[0269] The length of a single RNA sequence may be 15–25 nucleotides (nt), preferably 18–22 nt, for example, 18nt, 19nt, 20nt, 21nt, or 22nt. This range of sequence length was not randomly selected but determined by repeated testing. Extensive testing has shown that when the RNA sequence length is shorter than 18nt, especially shorter than 15nt, it is almost ineffective and does not exert any effect. However, when the RNA sequence length is longer than 22nt, especially longer than 25nt, not only does the cost of the circuit increase significantly, but the effect is not superior to that of RNA sequences with a length of 18–22nt, resulting in poor economic performance. Therefore, the most effective balance between cost and effect is achieved when the RNA sequence length is 15–25nt, especially 18–22nt.
[0270] When the RNA sequence lengths were 18, 20, and 21, the constructed delivery system also exhibited therapeutic effects on enrichment, self-assembly, and pulmonary fibrosis in vivo. The specific sequences are shown in Table 5. [Table 17]
[0271] When a viral vector system contains multiple different RNA fragments, it has therapeutic effects on enrichment, self-assembly, and pulmonary fibrosis in the body, as shown in the figure. 110 As shown, the grouping of RNA fragments within it is as follows: 1. Use of six types of RNA alone: siRNA-1 alone, siRNA-2 alone, shRNA-1 alone, shRNA-2 alone, miRNA-1 alone, miRNA-2 alone; 2. Combining any two of the six types of RNA sequences to create RNA fragments: siRNA-1 + siRNA-2, shRNA-1 + shRNA-2, miRNA-1 + miRNA-2; 3. Create RNA fragments by combining any three of the six types of RNA sequences: siRNA-1 + siRNA-2 + shRNA-1, siRNA-1 + siRNA-2 + shRNA-2, siRNA-1 + siRNA-2 + miRNA-1, siRNA-1 + siRNA-2 + miRNA-2. The details of the RNA sequence are shown in Table 1 below. [Table 18] Example 11
[0272] The effect of the plasmid carrying the RVG guide peptide prepared according to Example 2 on glioblastoma is detected.
[0273] The first trial included five test groups and three control groups. Each test group consisted of a CMV-siR group. E group, CMV-siR T group, CMV-RVG-siR E+T group, CMV-siR E+T group, CMV-Flag-siR E+T The groups are represented by "E" for EGFR and "T" for TNC, and the control groups are the PBS group, CMV-scrR group, and CMV-Flag-scrR group, respectively. The specific test process is shown in the figure. 119 Refer to A.
[0274] The CD63 protein expression level and siRNA expression level were detected in each group of mice, as shown in Figure. 119 B~Figure 119 As shown in D, CMV-RVG-siR E+T This suggests that siRNA can be transmitted to the brain by intravenous injection of a gene circuit.
[0275] In the second trial, two test groups and two control groups were established. The test groups were CMV-RVG-siR E group, CMV-RVG-siR E+T The control groups were the PBS group and the CMV-scrR group, respectively.
[0276] The specific test includes, 120 As shown in A, mice were selected and injected with glioblastoma cells (U-87 MG-Luc cells) into their bodies. From day 7 to day 21, they were treated with PBS buffer / CMV-scrR / CMV-RVG-siR. E / CMV-RVG-siR E+T Mice were treated by injecting (5 mg / kg) every two days, and survival analysis and tumor evaluation were performed on the mice. BLI in vivo imaging was detected on days 7, 14, 28, and 35.
[0277] figure 120 As shown in B, this figure is a comparative diagram of BLI in vivo image formation detection in mice on day 7, day 14, day 28, and day 35, and CMV-RVG-siR E+T The mice in this group showed the most significant inhibitory effect on glioblastoma.
[0278] figure 120 As shown in C, this figure is a comparison of the survival rates of mice in each group, CMV-RVG-siR E+T The mice in the group were found to have the longest survival time.
[0279] figure 120 As shown in D, this figure is a fluorescence comparison of mice from each group, obtained by luciferase in vivo imaging, with the vertical axis representing the strength of the lucifer fluorescence signal. Since this gene is already artificially incorporated into the implanted tumors, this figure can represent the progression of the tumor. In the control group of mice, tumor progression was rapid in all cases, but in the test group of mice, tumor growth was found to be considerably inhibited.
[0280] figure 120 As shown in E, this figure is a comparative diagram of the relative siRNAs of mice in each group, CMV-RVG-SIR E The mice in the group had high levels of EGFR siRNA and CMV-RVG-SIR E+TThe mice in the group were found to have high levels of both EGFR siRNA and TNC siRNA.
[0281] figure 120 As shown in F, this figure is a comparison of western blots of mice from each group: PBS group, CMV-scrR group, and CMV-RVG-siR group. E The mice in this group were found to have high levels of EGFR and TNC genes.
[0282] Based on the above test data, CMV-RVG-siR E+T This suggests that intravenous injection of plasmids can deliver siRNA to the brain, thereby inhibiting glioblastoma growth.
[0283] Immunohistochemical staining was performed on the brains of mice in each group, and the staining rates of EGFR, TNC, and PCNA were statistically analyzed for each visual field. The results are shown in the figure. 121 As shown. CMV-RVG-siR E+T In the group of mice, the brain content of EGFR, TNC, and PCNA was the lowest, and CMV-RVG-siR E In the group of mice, the levels of EGFR and PCNA in the brain were found to be low. CMV-RVG-siR E Plasmid injection inhibits the expression of EGFR and PCNA in the brain, and CMV-RVG-siR E+T It was found that the expression of EGFR, TNC, and PCNA in the brain can be inhibited by injecting plasmids.
[0284] Plasmids certainly enrich in vivo and spontaneously form complex structures containing RNA fragments. The present invention provides experimental data showing that when a random group of plasmids carries four of the aforementioned circuits, adjacent circuits are connected by sequence 1-sequence 2-sequence 3, with sequence 2 consisting of 5, 10, 20, 30, 40, 50, and 80 bases, respectively, thereby experimentally verifying the plasmid enrichment and self-assembly effects.
[0285] The details of Array 2 are shown in the table below. [Table 19]
[0286] More preferably, if the plasmid carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0287] To demonstrate that plasmids are reliably enriched in vivo and spontaneously form complex structures containing RNA fragments, the present invention randomly provides corresponding experimental data for sets of plasmids containing a linked sequence of sequence 4 and at least two sequences having more than 80% homology to sequence 4, thereby experimentally verifying plasmid enrichment and self-assembly effects.
[0288] The details of the array are shown in the table below. [Table 20] Example 12
[0289] The effect of viruses carrying RVG guide peptides, prepared according to the descriptions in Examples 2 and 5, on glioblastoma is detected.
[0290] Material: AAV-CMV-RVG-siR E and AAV-CMV-RVG-siR E+T 100 μL of AAV solution with a potency of 10¹² V.g / ml was injected into the tail vein of mice. The in vivo expression of the AAV system was monitored in living small animals, and after 3 weeks, stable expression of the AAV system was observed in the body, particularly in the liver.
[0291] Subsequently, mice were selected and injected with glioblastoma cells (U-87MG-Luc cells).
[0292] From day 7 to day 21, mice were administered PBS buffer / AAV-CMV-scrR / AAV-CMV-RVG-siR every two days. E / AAV-CMV-RVG-siR E+T The patients were treated with (5 mg / kg) and divided into PBS group, AAV-scrR group, AAV-CMV-RVG-siRE group, and AAV-CMV-RVG-siRE+T group.
[0293] Survival analysis was performed on each group of mice, and the survival rates at 20, 40, 60, and 80 days after treatment were statistically analyzed. (See Figure) 140 As shown in A, the AAV-CMV-RVG-siRE+T group of mice had the longest survival period, followed by the AAV-CMV-RVG-siRE group.
[0294] To evaluate the tumors in each group of mice, BLI in vivo imaging detection was performed on days 7, 14, 28, and 35, respectively. (See Figure) 140 As shown in B, AAV-CMV-RVG-siR was detected. E+T The inhibitory effect on glioblastoma in the group of mice was the most pronounced.
[0295] To prove that viral vectors reliably exhibit enrichment and self-assembly effects in vivo, the present invention randomly provides experimental data in which, when a set of viral vectors carries the four circuits described above, adjacent circuits are connected by sequence 1-sequence 2-sequence 3, and sequence 2 consists of 5 bases, 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, and 80 bases, respectively, and the enrichment and self-assembly effects of viral vectors are verified through experiments.
[0296] Details of Array 2 are shown in Table 3 below. [Table 21]
[0297] More preferably, if the viral vector carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0298] To demonstrate that viral vectors reliably possess enrichment and self-assembly effects in vivo, the present invention randomly provides corresponding experimental data for a set of viral vectors in which the linked sequence is sequence 4 and which contains at least two sequences having more than 80% homology to sequence 4, thereby verifying the enrichment and self-assembly effects of the viral vectors experimentally.
[0299] The details of the sequence are shown in Table 4 below. [Table 22] Example 13
[0300] Construction of a plasmid CMV-siR carrying PTP1B siRNA that inhibits PTP1B expression by the method described in Example 2. P and plasmid CMV-RVG-siR carrying the targeting peptides RVG and PTP1B siRNA. P Similarly, construct a viral AAV-CMV-siR having a PTP1B siRNA that inhibits PTP1B expression according to the method described in Example 5. P AAV-CMV-RVG-siR virus carrying the targeting peptide RVG P And so, the siRNA of the PTP1B gene has the following nucleotide sequence: UGAUAUAGUCAUUAUCUUCUU (SEQ ID NO. 14).
[0301] In the first trial, two test groups and one control group were established. The test groups were each CMV-siR P group, CMV-RVG-siR PThis is the control group, and the control group is the CMV-scrR group, where "P" represents PTP1B.
[0302] CMV-siR P group, CMV-RVG-siR P In the CMV-scrR group and the CMV-scrR group, the respective doses were 5 mg / kg CMV-scrR. P Plasmid, CMV-RVG-siR P The plasmids CMV-scrR plasmid and other plasmids were injected into mice, and fluorescence microscopy images of the hypothalamus and liver of each group of mice were obtained, as shown in Figure. 160 As shown, we demonstrated that PTP1B siRNA can be transmitted to the hypothalamus.
[0303] In the second trial, two test groups and two control groups were established, with each test group being CMV-siR P group, CMV-RVG-siR P The control groups were the PBS group and the CMV-scrR group, respectively.
[0304] The specific test includes, 161 As shown in A, select C57BL / 6 mice and after 12 weeks, administer PBS buffer / CMV-scrR / CMV-siR P / CMV-RVG-siR P The mice were injected with the drug once every two days for 24 days, and finally, their obesity, energy expenditure, leptin sensitivity, and insulin sensitivity were statistically assessed.
[0305] figure 161 As shown in B, this figure is a comparison of the body weight of mice in each group, CMV-RVG-siR P In this group, the mice's body weight was found to be the most stable.
[0306] figure 161 As shown in C, this figure is a comparison of epididymal fat body weights in mice from each group, CMV-RVG-siR P In the group, it was found that mice had the lightest epididymal fat body weight.
[0307] Using metabolic cages, oxygen consumption, respiratory exchange rate, activity level, and calorie production were continuously detected for 72 hours in mice subjected to various treatments. The mean values were then plotted, statistically analyzed, and the results were plotted. 161 D~Figure 161 This is shown in G. As a result, CMV-RVG-siR P Plasmids can effectively increase oxygen consumption in mice, meaning that mice in this group are in a higher energy metabolic state compared to mice in other groups. Normal mice primarily use glucose as their energy source, and CMV-RVG-siR P The plasmid can reduce the respiratory exchange rate in mice, meaning that mice in this group are more likely to utilize protein as their energy source compared to mice in other groups. CMV-RVG-siR P In mice injected with the plasmid, activity levels significantly increased. Furthermore, CMV-RVG-siR P In the group of mice, calorie production increased significantly.
[0308] figure 161 As shown in H, this figure is a comparison of the initial body weight curves of mice in each group. CMV-RVG-siR P In the group, the mouse with the lightest body weight was found.
[0309] figure 161 As shown in I, this figure is a comparison of the initial food intake curves of mice in each group. CMV-RVG-siR P In the group, the mice were found to have the lowest food intake.
[0310] figure 161 As shown in J, this figure is a comparative chart of serum leptin content in mice from each group. CMV-RVG-siR P The group was found to have the lowest serum leptin content among the mice.
[0311] figure 161 As shown in K, this figure is a comparison of western blots of mice from each group: CMV-RVG-siR. PThe group was found to have the lowest content of PTP1B protein in mice.
[0312] figure 161 As shown in L, this figure is a comparison of the blood glucose change curves of mice in each group. CMV-RVG-siR P In the group, the mice were found to have the lowest blood glucose levels.
[0313] figure 161 As shown in M, this figure is a comparison of the basal glucose change curves of mice in each group. CMV-RVG-siR P The group was found to have the lowest basal glucose content among the mice.
[0314] From the above tests, CMV-RVG-siR P Intravenous injection of plasmids can reduce obesity in obese model mice.
[0315] The results of measuring serum total cholesterol (TC), triglycerides (TG), and low-density lipoprotein (LDL) in mice from each group are shown in the figure. 162 As shown in A, CMV-RVG-siR P In the group, mice were found to have the lowest levels of TC, TG, and LDL.
[0316] The body length of the mice in each group was measured, and the results are shown in Figure. 162 As shown in B, it was found that the body lengths of the four groups of mice were almost identical.
[0317] The results of statistically analyzing the HFD food intake of mice in each group are shown in Figure. 162 As shown in C, the HFD food intake of the four groups of mice was found to be almost identical.
[0318] Liver tissue was collected from each group of mice after treatment and compared with that of a normal control. (See Figure) 162 As shown in D, clear fatty liver pathology features were observed in the liver tissue pathology sections of mice from the PBS group and the CMV-scrR group, and CMV-siR PIn this group, it was found that the mice had a milder case of fatty liver disease.
[0319] From the above tests, CMV-RVG-siR P This suggests that intravenous injection of plasmids can alleviate fatty liver disease in obese mice.
[0320] C57BL / 6 mice were selected and given PBS buffer / AAV-CMV-scrR / AAV-CMV-siR after 12 weeks. P / AAV-CMV-RVG-siR P Each group was injected with either the PBS group, the AAV-CMV-scrR group, or the AAV-CMV-siR group. P group / AAV-CMV-RVG-siR P Groups were created and injected every other day within 24 days. Body weight change, fat body weight, initial food intake, serum leptin content, blood glucose level, basal glucose content, serum total cholesterol (TC), triglycerides (TG), low-density lipoprotein (LDL), body length, and food intake were detected and statistically analyzed in each group of mice. The results are shown below.
[0321] figure 163 As shown in A, this figure is a comparison of the body weight of mice in each group, AAV-CMV-RVG-siR P The mice in the group were found to have the most stable body weight.
[0322] figure 163 As shown in B, this figure is a comparison of epididymal fat body weights in mice from each group, AAAV-CMV-RVG-siR P In the group of mice, the epididymal fat pad was found to be the lightest.
[0323] figure 163 As shown in C, this figure is a comparison of the initial food intake curves of mice in each group. AAV-CMV-RVG-siR P The mice in this group were found to have the lowest food intake.
[0324] figure 163As shown in D, this figure is a comparison of serum leptin content in mice from each group. AAV-CMV-RVG-siR P The mice in this group were found to have the lowest serum leptin levels.
[0325] figure 163 As shown in E, this figure is a comparison of the blood glucose change curves of mice in each group. AAV-CMV-RVG-siR P The mice in this group were found to have the lowest blood glucose levels.
[0326] figure 163 As shown in F, this figure is a comparison of the basal glucose change curves of mice in each group. AAV-CMV-RVG-siR P The mice in this group were found to have the lowest basal glucose content.
[0327] figure 164 A~Figure 164 As shown in C, these three figures are comparative charts of serum total cholesterol (TC), triglycerides (TG), and low-density lipoprotein (LDL) in mice from each group, respectively, and AAV-CMV-RVG-siR P In the group of mice, TC, TG, and LDL levels were found to be the lowest.
[0328] figure 164 As shown in D, this figure compares the body lengths of the mice in each group, and it was found that the body lengths of the mice in the four groups were almost the same.
[0329] figure 164 As shown in E, this figure compares the HFD food intake of mice in each group, and it was found that the HFD food intake of the four groups of mice was almost the same.
[0330] From the above tests, AAV-CMV-siR P AAV-CMV-RVG-siR P This suggests that it has some inhibitory effect on obesity.
[0331] Adenovirus vectors, even when containing three homologous sequences, exhibit therapeutic effects in enriching the body, self-assembly, and obesity, as shown in the figure. 170 As shown, the sequences are grouped as follows: 1. Three 5' flanking sequences with over 80% homology. 2. Three loop sequences with over 80% homology 3. Three 3' flanking sequences with over 80% homology The details of the sequence are shown in Table 2 below. [Table 23]
[0332] If a viral vector carries two or more circuits, adjacent circuits may be linked via sequence 1-sequence 2-sequence 3. Sequence 1 is preferably CAGATC, sequence 2 may be a sequence consisting of 5 to 80 bases, for example, a sequence consisting of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 bases, preferably a sequence consisting of 10 to 50 bases, more preferably a sequence consisting of 20 to 40 bases, and sequence 3 is preferably TGGATC.
[0333] When an adenovirus vector carries multiple circuits, adjacent circuits are linked by sequence 1-sequence 2-sequence 3, and sequence 2 contains multiple bases. The constructed delivery system similarly exhibits enrichment, self-assembly, and obesity-treating effects in vivo.
[0334] Details of Array 2 are shown in Table 3 below. [Table 24]
[0335] More preferably, if the viral vector carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0336] If the linked sequence is sequence 4 and a sequence with 80% or more homology to sequence 4, the constructed delivery system also has enrichment, self-assembly, and obesity treatment effects in vivo. Sequence 4-1 is the aforementioned sequence 4, and sequences 4-2 / 4-3 / 4-4 are homologous sequences of sequence 4-1, respectively. The specific sequences are shown in Table 4 below. [Table 25]
[0337] The above RNA fragments contain one or more specific RNA sequences of medical importance that are expressible at the target receptor and have a compensatory sequence that is not expressible at the target receptor. The RNA sequence may be an siRNA sequence, an shRNA sequence, or a miRNA sequence, and is preferably an siRNA sequence.
[0338] The length of a single RNA sequence may be 15–25 nucleotides (nt), preferably 18–22 nt, for example, 18nt, 19nt, 20nt, 21nt, or 22nt. This range of sequence length was not randomly selected but determined by repeated testing. Extensive testing has shown that when the RNA sequence length is shorter than 18nt, especially shorter than 15nt, it is almost ineffective and does not exert any effect. However, when the RNA sequence length is longer than 22nt, especially longer than 25nt, not only does the cost of the circuit increase significantly, but the effect is not superior to that of RNA sequences with a length of 18–22nt, resulting in poor economic performance. Therefore, the most effective balance between cost and effect is achieved when the RNA sequence length is 15–25nt, especially 18–22nt.
[0339] When the RNA sequence lengths were 18, 20, and 21, the constructed delivery system also exhibited enrichment, self-assembly, and obesity treatment effects in vivo. The specific sequences are shown in Table 5. [Table 26]
[0340] When a viral vector system contains multiple different RNA fragments, it has therapeutic effects on enrichment, self-assembly, and obesity in the body, as shown in the figure. 168 As shown, the grouping of RNA fragments within it is as follows:
[0341] 1. Use of 6 types of RNA alone: siRNA-1 alone, siRNA-2 alone, shRNA-1 alone, shRNA-2 alone, miRNA-1 alone, miRNA-2 alone 2. Create RNA fragments by combining any two of the six types of RNA sequences: siRNA-1 + siRNA-2, shRNA-1 + shRNA-2, miRNA-1 + miRNA-2 3. Create RNA fragments by combining any three of the six types of RNA sequences: siRNA-1 + siRNA-2 + shRNA-1, siRNA-1 + siRNA-2 + shRNA-2, siRNA-1 + siRNA-2 + miRNA-1, siRNA-1 + siRNA-2 + miRNA-2.
[0342] The details of the RNA sequence are shown in Table 1 below. [Table 27] Example 14
[0343] Plasmid CMV-siR carrying mHTT siRNA that inhibits mHTT expression by the method described in Example 2 mHTT and plasmid CMV-RVG-siR carrying the targeting peptides RVG and mHTT siRNA. P We constructed a similar virus, AAV-CMV-siR, which has mHTT siRNA that inhibits mHTT expression.mHTT The targeting peptide RVG-supported virus AAV-CMV-RVG-siR was prepared according to the method described in Example 5. mHTT We constructed the following. Among them, the siRNA of the mHTT gene has the following nucleotide sequence: UAUGUUUUCACAUAUUGUCAG (SEQ ID NO.15).
[0344] In the first trial, two test groups and two control groups were established. The test groups were each CMV-siR mHTT group, CMV-RVG-siR mHTT The control groups were the PBS group and the CMV-scrR group, respectively.
[0345] Diagram showing the experimental procedure 174 As shown in A, CMV-siR mHTT group, CMV-RVG-siR mHTT CMV-siR was administered to Huntington's disease mice in the PBS group and the CMV-scrR group, respectively. mHTT Plasmid, CMV-RVG-siR mHTT After intravenous injection of plasmids, PBS solution, and CMV-scrR plasmid, plasma exosomes were isolated, labeled with PKH26 dye, and then co-cultured with cells to observe the absorption of exosomes by the cells.
[0346] figure 174 As shown in B, this figure compares the levels of siRNA in plasma exosomes of mice from each group, and it was found that the mice in the two test groups had higher levels of siRNA in plasma exosomes.
[0347] After injecting plasmids / solutions into mice from each group, extracted plasma exosomes were labeled with PKH26, co-cultured with cells, and photographed using a confocal microscope. The results are shown in Figure. 174 As shown in C, it has been demonstrated that exosomes encapsulating siRNA enter the cell.
[0348] After extracting plasma exosomes from each group of mice and co-culturing them with cells, changes in HTT protein levels and mRNA levels in each group of mice were detected, as shown in Figure. 174 D~Figure 174 As shown in F, CMV-siR mHTT and CMV-RVG-siR mHTT However, the study demonstrated that HTT protein levels could be reduced, suggesting that siRNA incorporated into the exome can still exert gene silencing functions.
[0349] After co-culturing extracted mouse plasma exosomes with cells, the aggregation of HTT protein in each group of mice was observed and statistically analyzed, as shown in Figure. 174 G~Figure 174 As shown in H, CMV-siR mHTT and CMV-RVG-siR mHTT This demonstrated that the aggregation of pathological HTT proteins in a Huntington's HTT aggregated cell model can be reduced, suggesting that siRNA incorporated into exosomes can still exert gene silencing functions and effectively reduce the aggregation of mutant proteins.
[0350] The absolute siRNA expression levels in the liver, plasma, cortex, and striatum of mice from each group were detected and statistically analyzed. (Figure) 175 As shown in A, this figure is a comparison of the absolute levels of siRNA in the livers of mice from each group, and CMV-SIR mHTT group, CMV-RVG-siR mHTT In this group, the absolute siRNA levels in mice were found to be relatively high. (Figure) 175 As shown in B, this figure is a comparison of absolute siRNA levels in mouse plasma from each group, and CMV-SIR mHTT group, CMV-RVG-siR mHTT In this group, the absolute siRNA levels in mice were found to be relatively high. (Figure) 175 As shown in C, this figure compares the absolute siRNA levels in the cortex and striatum of mice from each group, and it was found that mice injected with CMV-RVG-siRmHTT had higher absolute siRNA levels.
[0351] figure 175 As shown in D, this figure is an in situ hybridization diagram of liver, cortical, and striatal tissue from each group of mice, and CMV-siR mHTT group, CMV-RVG-siR mHTT In the group, significant fluorescence was observed in mouse liver tissue sections, CMV-RVG-siR mHTT In this group, clear fluorescence was observed in the cortical and striatal tissue sections of mice. This suggests that RVG induces exosome siRNA to cross the blood-brain barrier and exert its function.
[0352] In the second trial, two test groups and two control groups were established. The test groups were each CMV-siR GFP group, CMV-RVG-siR GFP The control groups were the PBS group and the CMV-scrR group, respectively. GFP group, CMV-RVG-siR GFP In each of the GFP transgenic mice in the PBS group and the CMV-scrR group, CMV-siR was introduced. GFP Plasmid, CMV-RVG-siR GFP Plasmid, PBS solution, and CMV-scrR plasmid were administered intravenously.
[0353] figure 175 E, Figure 175 As shown in F, this figure is a histological section of the liver, cortex, and striatum of mice from each group, with CMV-siR in the liver. GFP / CMV-RVG-siR GFP In GFP transgenic mice injected with CMV-RVG-siR, GFP fluorescence levels decreased, and CMV-RVG-siR was detected in the corticostriate. GFP In mice injected with RVG, GFP fluorescence levels were found to decrease. This suggests that RVG induces exosome siRNA to cross the blood-brain barrier and exert its function.
[0354] In the third trial, two test groups and one control group were established, with each test group being CMV-siR mHTTgroup, CMV-RVG-siR mHTT This group was the control group, and the control group was the CMV-scrR group.
[0355] The test includes a diagram. 176 As shown in A, 8-week-old N17182Q mice were selected and each was given CMV-siR mHTT group, CMV-RVG-siR mHTT In Huntington's disease mice, CMV-scrR group and CMV-siR group mHTT Plasmid, CMV-RVG-siR mHTT The plasmid and the CMV-scrR plasmid were injected into the tail vein, rotation tests were performed on day 0 and day 14, and the mice were killed and analyzed after 14 days.
[0356] figure 176 As shown in B, this figure shows wild-type mice, CMV-scrR group, and CMV-RVG-siR group. mHTT This is a comparative chart of the descent incubation period of the mice in the groups, showing the CMV-scrR group and the CMV-RVG-siR group on day 0. mHTT The mice's descent latency periods were consistent across the groups, and on day 14, the CMV-scrR group showed the shortest descent latency period.
[0357] figure 176 C and Figure 176 As shown in Figure D, 176 C is CMV-scrR group, CMV-RVG-siR mHTT This is a diagram of the western bolt of the striatum of the group of mice. 176 D is CMV-scrR group, CMV-RVG-siR mHTT This is a comparative graph of relative mHTT mRNA levels in the striatum of mice from different groups. It was found that the CMV-scrR group had a high content of N171-mHTT protein in the mouse striatum, and similarly high relative mHTT mRNA levels.
[0358] In the fourth trial, one test group and one control group were established, with the test group receiving CMV-RVG-siR mHTT This group was the control group, and the control group was the CMV-scrR group.
[0359] The test includes a diagram. 176 As shown in E, select 3-month-old BACHD mice and apply CMV-RVG-siR mHTT CMV-RVG-siR was administered to Huntington's disease mice in the CMV-scrR group. mHTT The plasmid and the CMV-scrR plasmid were injected intravenously, and the mice were killed 14 days later for analysis.
[0360] figure 176 As shown in Figure F, 176 F is CMV-scrR group, CMV-RVG-siR group mHTT Western bolt diagrams of the cortex and striatum of mice in the group, CMV-RVG-siR mHTT In this group, the levels of both mutant HTT (HTT) and endogenous HTT (HTT) in the mouse cortex and striatum were found to be low.
[0361] figure 176 As shown in Figure G, 176 G is CMV-scrR group, CMV-RVG-siR mHTT This is a comparative diagram of relative mHTT protein levels in the cortex and striatum of mice in different groups, showing that CMV-RVG-siR levels are present in both the cortex and striatum of mice. mHTT In all groups, the relative mHTT protein levels in the mice were found to be low.
[0362] figure 176 H and Figure 176 As shown in Figure I, 176 H is CMV-scrR group, CMV-RVG-siR mHTT This is an immunofluorescence image of the group of mice, 176 I is the CMV-scrR group, CMV-RVG-siR mHTT This is a comparative diagram of relative mHTT mRNA levels in the mouse cortex and striatum, showing that CMV-RVG-siR levels are present in both the mouse cortex and striatum. mHTT In all groups, the relative mHTT mRNA levels in the mice were found to be low.
[0363] From the above tests, MV-RVG-siR mHTT Intravenous injection of the plasmid suggests that it contributes to the inhibition of mHTT in the striatum and cortex, leading to improved motor function and alleviation of neuropathology in HD mice.
[0364] In the fifth trial, one test group and one control group were established, with the test group receiving CMV-RVG-siR mHTT This group was the control group, and the control group was the CMV-scrR group.
[0365] The test includes a diagram. 177 As shown in A, 6-week-old YAC128 mice were selected and each was subjected to CMV-RVG-siR mHTT CMV-RVG-siR was administered to Huntington's disease mice in the CMV-scrR group. mHTT The plasmid and CMV-scrR plasmid were intravenously injected, and rotation tests were performed on day 0, week 4, and week 8 of the study. After these tests, the mice were killed and analyzed.
[0366] figure 177 As shown in B, this figure shows a wild-type mouse and a CMV-RVG-siR mHTT This is a comparative chart of the depression latency period in mice of the CMV-scrR group and the CMV-RVG-siR group. On day 0, the CMV-RVG-siR group... mHTT In the CMV-scrR group and the CMV-scrR group, the latency period for mouse descent was consistent, and at weeks 4 and 8, the CMV-scrR group showed the shortest latency period for mice descent.
[0367] figure 177 As shown in C, this figure is CMV-RVG-siR mHTT These are western bolt diagrams of the cortex and striatum of mice in the CMV-scrR group and the CMV-RVG-siR group. mHTT In this group, the mouse cortex had low levels of both mutant HTT and endogenous HTT, while the striatum had low levels of mutant HTT and high levels of endogenous HTT.
[0368] figure 177 D, Figure 177As shown in E, both figures are CMV-RVG-siR mHTT This is a comparative graph of relative mHTT mRNA levels and relative mHTT protein levels in the cortex and striatum of mice from the CMV-scrR group and the CMV-scrR group, regardless of whether it is the cortex or striatum. mHTT In this group, both the relative mHTT mRNA level and the relative mHTT protein level in mice were found to be low. figure 177 As shown in F, this figure is CMV-RVG-siR mHTT These are immunofluorescence images of the cortex and striatum of mice in the CMV-scrR group and the CMV-RVG-siR group. mHTT In this group, the expression of NeuN and EM48 in mice was found to be lower than in the CMV-scrR group.
[0369] From the above tests, MV-RVG-siR mHTT Intravenous injection of the plasmid suggested that it contributed to a reduction in mHTT protein and toxic aggregates in the striatum and cortex, improving behavioral defects and neuropathology in the striatum and cortex.
[0370] Similar experiments were also conducted with viral vectors. 100 μL of AAV solution with a titer of 10¹² V.g / ml was intravenously injected into the tail of mice. The in vivo expression status of the AAV system was monitored through living small animals, and after 3 weeks, stable expression of the AAV system was observed in the body, particularly in the liver.
[0371] Next, select a mouse and perform modeling, then apply PBS buffer / AAV-CMV-scrR / AAV-CMV-siR to the modeled mouse. mHTT / AAV-CMV-RVG-siR mHTT PBS group / AAV-CMV-scrR group / AAV-CMV-siR mHTT group / AAV-CMV-RVG-siR mHTT Groups were created. After injecting the above solution into the tail vein, plasma exosomes were separated, labeled with PKH26 dye, and then co-cultured with cells. The absorption status of exosomes by cells was observed, and the results are shown below.
[0372] figure 178 As shown in A, this figure is a comparison of siRNA levels in mouse plasma exosomes from each group, AAV-CMV-siRNA mHTT Group and AAV-CMV-RVG-siR mHTT In the group of mice, high levels of siRNA were found in plasma exosomes.
[0373] figure 178 As shown in B, this figure is a comparison of the relative mHTT mRNA levels of mice in each group after co-culturing mouse plasma exosomes and cells, and AAV-CMV-siR mHTT Group and AAV-CMV-RVG-siR mHTT In the group of mice, the relative mHTT mRNA levels were found to be lower, which is attributed to AAV-CMV-siR mHTT and AAV-CMV-RVG-siR mHTT This was found to be able to lower HTT mRNA levels, meaning that siRNA incorporated into exosomes can still exert its gene silencing function.
[0374] figure 178 As shown in C, this figure is a comparative diagram of the absolute levels of mouse liver siRNA, AAV-CMV-SIR mHTT Group and AAV-CMV-RVG-siR mHTT The mice in the group were found to have high absolute siRNA levels.
[0375] figure 178 As shown in D, this figure is a comparison of the absolute levels of mouse plasma siRNA, AAV-CMV-SIR mHTT Group and AAV-CMV-RVG-siR mHTT The mice in the group were found to have high absolute siRNA levels.
[0376] figure 178 As shown in E, this figure shows wild-type mice (WT), AAV-CMV-scrR group, and AAV-CMV-RVG-siR group. mHTTThis is a comparative chart of the descent latency periods of mice in different groups. At week 0, the descent latency periods of the three mouse groups were the same, while at weeks 4 and 8, the CMV-scrR group mice had the shortest descent latency period.
[0377] figure 178 As shown in F, this figure shows the AAV-CMV-scrR group and the AAV-CMV-RVG-siR group. mHTT This is a comparative diagram of relative mHTT mRNA levels in the cortex and striatum of mice, showing that AAV-CMV-RVG-siR levels are present in both the cortex and striatum. mHTT In the mice in the AAV-CMV-scrR group, mHTT mRNA levels were found to be lower than in the AAV-CMV-scrR group.
[0378] From the above tests, AAV-CMV-RVG-siR mHTT Intravenous injection of this substance was suggested to contribute to the reduction of mHTT protein and toxic aggregates in the striatum and cortex, thereby exerting a therapeutic effect against Huntington's chorea.
[0379] When a viral vector carries two or more circuits, adjacent circuits may be linked via sequence 1-sequence 2-sequence 3. Here, sequence 1 is preferably CAGATC, sequence 2 may be a sequence consisting of 5 to 80 bases, for example, a sequence consisting of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 bases, preferably a sequence consisting of 10 to 50 bases, more preferably a sequence consisting of 20 to 40 bases, and sequence 3 is preferably TGGATC.
[0380] Details of Array 2 are shown in Table 3 below. [Table 28]
[0381] More preferably, if the viral vector carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0382] The details of the sequence are shown in Table 4 below. [Table 29] Example 15
[0383] Plasmid CMV-siR carrying LRRK2siRNA that inhibits LRRK2 expression by the method described in Example 2 LRRK2 and plasmid CMV-RVG-siR carrying the targeting peptides RVG and LRRK2 siRNA. LRRK2 The following was constructed. Of these, the siRNA for the LRRK2 gene is AUUAACAUGAAAAUAUCACUU (SEQ ID NO. 16).
[0384] We will investigate the application of the above carrier system in the treatment of Parkinson's disease.
[0385] In this study, LRRK2R1441G transgenic mice were selected and tested at 3 months of age. The study included an LPS intervention group and a non-LPS intervention group. In the LPS intervention group, CMV-scrR / CMV-RVG-siR was detected 7 days after LPS intervention. LRRK2 Treatment was administered.
[0386] figure 197 A and Figure 197 As shown in Figure B, 197 A is CMV-scrR / CMV-RVG-siR LRRK2 This is a diagram of the western bolt of an LRRK2R1441G transgenic mouse injected with [the substance]. 197 B is CMV-scrR / CMV-RVG-siR LRRK2This is a grayscale protein analysis of LRRK2R1441G transgenic mice injected with CMV-RVG-si. RLRRK2 Mice injected with CMV-RVG-siRLRRK2 showed decreased levels of LRRK2 and S935 proteins, suggesting that CMV-RVG-siRLRRK2 releases siRNA in the liver, and once the siRNA is incorporated into exosomes, it crosses the blood-brain barrier and reduces the expression of deep brain proteins.
[0387] figure 197 As shown in C, this figure represents CMV-scrR / CMV-RVG-siR LRRK2 This is an immunofluorescence image of TH+ neurons in the substantia nigra region of LRRK2R1441G transgenic mice injected with CMV-RVG-siR. LRRK2 In mice injected with CMV-RVG-siR, the loss of TH neurons was prevented, and CMV-RVG-siR was suppressed. LRRK2 The study suggested that when the liver releases siRNA, and the siRNA is incorporated into exosomes, it can cross the blood-brain barrier and enter deep into the brain to exert its function.
[0388] figure 197 As shown in D, this figure represents CMV-scrR / CMV-RVG-siR LRRK2 This is an immunofluorescence image of the microglial activation level in LRRK2R1441G transgenic mice injected with CMV-RVG-siR, and the result is CMV-RVG-siR LRRK2 In mice injected with CMV-RVG-siR, microglial activation could be inhibited. LRRK2 The study suggested that when the liver releases siRNA, and the siRNA is incorporated into exosomes, it can cross the blood-brain barrier and enter deep into the brain to exert its function.
[0389] From the above tests, CMV-RVG-siR LRRK2 Intravenous injection of the plasmid suggested that it contributes to the inhibition of LRRK2 in dopaminergic neurons, thereby mitigating neuropathological development in Parkinson's disease (PD) mice.
[0390] When a plasmid carries two or more circuits, adjacent circuits may be linked via sequence 1-sequence 2-sequence 3. Here, sequence 1 is preferably CAGATC, sequence 2 may be a sequence of 5 to 80 bases, for example, a sequence of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 bases, preferably a sequence of 10 to 50 bases, more preferably a sequence of 20 to 40 bases, and sequence 3 is preferably TGGATC.
[0391] Details of Array 2 are shown in Table 3 below. [Table 30]
[0392] More preferably, if the plasmid carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0393] The details of the sequence are shown in Table 4 below. [Table 31]
[0394] When a viral vector carries two or more circuits, adjacent circuits may be linked via sequence 1-sequence 2-sequence 3. Here, sequence 1 is preferably CAGATC, sequence 2 may be a sequence consisting of 5 to 80 bases, for example, a sequence consisting of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 bases, preferably a sequence consisting of 10 to 50 bases, more preferably a sequence consisting of 20 to 40 bases, and sequence 3 is preferably TGGATC.
[0395] Details of Array 2 are shown in Table 3 below. [Table 32]
[0396] More preferably, if the viral vector carries two or more circuits, adjacent circuits are linked via sequence 4 or a sequence having more than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGGAGTCGACCAGTGGATC.
[0397] The details of the sequence are shown in Table 4 below. [Table 33] Example 16: Safety Detection
[0398] The RNA delivery vector system according to the present invention was studied in more detail in cynomolgus monkeys (Macaca fascicularis). Cynomolgus monkeys are a well-known non-human primate model used in safety assessment studies.
[0399] Four ethically recognized adult rhesus monkeys were given 5 mg / kg of CMV-siR. E Plasmids were injected intravenously, and blood samples were taken at different time points before or after injection. One month later, these rhesus monkeys received 5 mg / kg of CMV-siR daily. E Plasmids were injected intravenously a total of five times, and blood samples were taken at different time points before or after each injection.
[0400] figure 230 As shown in Figure 230 Figure A shows the change in whole blood siRNA concentration in cynomolgus monkeys after a single injection. 230Figure B shows the change in whole blood siRNA concentration in cynomolgus monkeys after multiple injections. In the case of a single injection, the siRNA concentration in cynomolgus monkeys peaked 6 hours after intravenous injection and then decreased thereafter. In the case of multiple injections, the siRNA concentration in cynomolgus monkeys peaked 3 hours after intravenous injection and then decreased thereafter. It was found that the rate of decrease in siRNA concentration in cynomolgus monkeys after multiple injections was more gradual.
[0401] The foregoing describes the present invention and should not be considered limiting. Unless otherwise noted, the implementation of the present invention will involve the use of prior art such as organic chemistry, polymer chemistry, and biotechnology, and it is clear that the present invention can be implemented in ways other than those specifically described in the above description and examples. Other aspects and improvements within the scope of the present invention will be obvious to those skilled in the art. Many modifications and changes are possible according to the teachings of the present invention, and these are therefore within the scope of the present invention.
Claims
1. An isolated nucleic acid that encodes one or more RNAs that inhibit gene expression, The aforementioned gene is selected from the group consisting of the EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, mHTT gene, Lrrk2 gene, and α-synuclidein gene. The RNA is miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, or any combination thereof. The nucleic acid is (a) A nucleotide sequence having in this order a 5' flanking sequence, a sequence encoding one or more RNAs, a stem-loop sequence, a compensation sequence, and a 3' flanking sequence, The length of the sequence encoding one or more RNAs is 15 to 29 nucleotides. The 5' flanking sequence is ggatcctggagggcttgctgaaaggctgtgctgaattc, ctggagggcttgctgaaaggcttgctgaattcg, ctggagggcttgctgaaaggcttgcttgttaacg, , ctggagggcttgctgaaaggcttgctgctgcaacg, The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatg gcccagatctggccgcactcgag, caccggtcaggacacaaggcctgttactagcactcacat ggaacaaatggcc, caggcctcaggacacaaggcctgttactagcactcacatggaacaaatg gcc, or cagcgctcaggacacaaggcctgttactagcactcacatggaacaaatggcc, The stem loop array is gttttggccacctgac, gttaagggccacctgac, or gaattggccacctgac. The compensation sequence is the reverse complementary sequence of the sequence encoding one or more RNAs, wherein the bases at positions 9 and / or 10 are deleted, and the (a) nucleotide sequence, (b) A nucleotide sequence encoding a target tissue-specific targeting protein, The target tissue-specific targeting protein is selected from the group consisting of RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, MSP targeting peptide, RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein, and the (b) nucleotide sequence, Nucleic acids containing these substances.
2. The nucleic acid according to claim 1, wherein the (a) nucleotide sequence encodes 2 to 4 RNA molecules.
3. The nucleic acid according to claim 1 or 2, wherein the RNA is selected from the group consisting of siRNA of the EGFR gene, siRNA of the KRAS gene, siRNA of the VEGFR gene, siRNA of the mTOR gene, siRNA of the TNF-α gene, siRNA of the integrin-α gene, siRNA of the B7 gene, siRNA of the TGF-β1 gene, siRNA of the H2-K gene, siRNA of the H2-D gene, siRNA of the H2-L gene, siRNA of the HLA gene, siRNA of the GDF15 gene, antisense strand of miRNA-21, antisense strand of miRNA-214, siRNA of the TNC gene, siRNA of the PTP1B gene, siRNA of the mHTT gene, siRNA of the Lrrk2 gene, and siRNA of the α-synuclidein gene.
4. The siRNA of the EGFR gene is uguugcuucuuaauuccu, aaaugaucuucaaaaguguccc, ucuuuaagaaggaaagaucau, aauauucguagcaauuuaugga, or uaaaaauuccucacaauauacu, The siRNA of the KRAS gene is ugauuuaguaguauaugugc, aauuugucucuuauaaagugug, uaauuugucucucuuauaaagugu, uuauuguuuucgaaauuucucga, or uguauuacauaaacac. The siRNA of the VECFR gene is auuugaagaguuguuaugucc, uaauagacugguaacuuucau, acaacuauguacauaauagac, uuuaagacaagcuuuucucca, or aacaaagguuguuuucacaugac. The siRNA of the mTOR gene is agauaguuggcaaaaucugccca, acuauuucacacauauaaggu, aaaauguugucaaaagaagggu, aaaaauguugucaaaagaaggg, or ugauuucuccaauuucucuc. The SiORNA of the TNF-α gene is aaaacauacaaagaaggc, uaaaaacauacaaagaa, aauaaaaauacaaagaagug, uuuucacgggaaaaacaugucug, or aaaacauacaaagaaggca. The siRNA of the integrin-α gene is auaacauucuccauuaauguc, aaacaauuccuuuuuuaucucuu, auuaaaacaggaaaacuugag, auaaagaaggauaacaacag, or uucuuuaauucauaaagucuc. The siRNA of the B7 gene is uuuucuugggguaaaucuucag, agaaaaauuccacuuuuucuu, auuucaaagucagauauacua, acaaaaauuccauuucugag, or auuauugaguuaaaguccu. The siRNA of the Tf-β1 gene is acgggaaaauaaccuagaugggc, ugaacuugucauagauuucgu, uugaagaacauauauauagcug, ucuaacuaguaguuguuccc, or ucucagacucuuggggccucucucac. The si-RNA of the HP-K gene is aaaaacaaucaacaaacaa, ucaaaaaacaaucaacaaucaa, uaugagaagacaauugucugucuc, aacaacaagguuaacauucaa, or acaaaaccucuaagcauucuc. The SiORNA of the H2-D gene is aaucucggagagacauucag, aauguuguguaaagagaacug, aacaucagacaauguugugua, uguuaacaaucaaggucacuu, or aacaaaaaccucuaagcau. The siRNA of the H2-L gene is gauccgcucccaaauacuccgg, aucugcgugaucccucccaaa, ucggagagacauuucagagcu, ucuggagagacacauuucagag, or aauucuggagagacacauuucagag. The siRNA of the HLA gene is aucuggaugugugagaacccg, ugucacugcuugcagccugag, ucacaaaggggaagggcaggaa, uugcagaaaacaagugugu, or acacgaacacacacacaugca. The siRNA of the GDF15 gene is uauaaaaaacagcuguuuggggc, agacuuauaaaaaacagcu, aauuaaaaaaaaaacagac, aucugagacccauucaccgu, or ugcaacuccagcuggggggcgu. The SiORNA of the TNC gene is uaugaaauguaaaaaaaggga, aaucauauccuuaaaaaggaa, uaaucauauccuuaaaaagga, ugaaaaaauccuuaguaguauuccau, or agaaguaaaaaacuaugucga. The siRNA of the PTP1B gene is ugauauagucauuaucuucuu, uccauuuuuauaucaaaaaaaaagcg, auuguuuaaaauauaaaaaaggag, aauuuuaaaaaaacauuguguu, or uuuuauauguacuuuuugau. The SiORNA of the MHRT gene is uauguuuucacauauguucag, auuuaguaguccacaacuaagaa, auuguuuuucacauaaaauuguccc, uaugaauaagcauucuaucug, or uauguuuguuccucuuaaaaaa. The SiORNA of the LrrkP gene is auuaacaagaaaauacacuu, uuaacaauacaauacuu, aucuuuaaaaauuguuaacgc, uugauuuaagaaaauagucuc, or uugauaacaguauguugu. The nucleic acid according to claim 3, wherein the siRNA of the α-synchrenein gene is auauauaacaaauuucacaa, aaguauauauauauauauauaacaa, auaacuuauauauauuuguccu, uaacuaaaaaauauauucgag, or ucgaauauauauauauauugucag.
5. The nucleic acid according to any one of claims 1 to 4, wherein the length of the sequence encoding one or more RNAs is 21 to 23 nucleotides.
6. The nucleic acid according to any one of claims 1 to 5, wherein the (a) nucleotide sequence codes for a plurality of RNAs, and the sequences encoding each RNA are linked via a linker whose sequence is cagattctggccgcacctcgaggtaggagtcgaccagtggattc.
7. The nucleic acid according to any one of claims 1 to 6, wherein the nucleic acid further comprises a promoter, and the (b) nucleotide sequence is located between the promoter and the (a) nucleotide sequence.
8. A vector comprising the nucleic acid according to any one of claims 1 to 7.
9. The vector according to claim 8, which is a plasmid.
10. The vector according to claim 8, which is a baculovirus vector, an adenovirus vector, a retrovirus vector, a herpesvirus vector, or a lentivirus vector.
11. The vector according to claim 10, which is an adenovirus vector.
12. A pharmaceutical composition containing a nucleic acid according to any one of claims 1 to 7 or a vector according to any one of claims 8 to 11.
Citation Information
Patent Citations
siRNA inhibiting EGFR expression as well as precursors and application of siRNA
CN109971756A
siRNA for inhibiting MOR gene expression and application thereof
CN112280780A
A system for stable expression of sirnas in mammalian cells
JP2005512596A
Multitargeted rnai for cancer treatment
JP2017518764A