Tetracyclic compounds and their uses

Tetracyclic compounds address tumor heterogeneity by targeting specific molecular markers, improving treatment efficacy and reducing toxicity in targeted tumor types.

JP7843542B2Active Publication Date: 2026-04-10SHANGHAI SHIJIANG BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2023-03-16
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Current treatments for tumors are not precise and can lead to inappropriate treatment due to tumor heterogeneity, delaying crucial treatment times and increasing drug toxicity.

Method used

Development of tetracyclic compounds that target specific tumor types with low membrane permeable transition pore activity, low peptidyl prolyl isomerase F expression, high DNA methyltransferase expression, or hypermethylation of NNMT gene sites, providing targeted drug delivery and improved treatment efficacy.

Benefits of technology

The tetracyclic compounds offer superior therapeutic effects on targeted tumors, reducing drug dosage and minimizing side effects by enhancing treatment precision.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007843542000060
    Figure 0007843542000060
  • Figure 0007843542000061
    Figure 0007843542000061
  • Figure 0007843542000062
    Figure 0007843542000062
Patent Text Reader

Abstract

The present invention relates to a tetracyclic compound and its use. The compound of the present invention has a significantly better therapeutic effect on tumors with low expression, no expression, low activation or inactivation of mitochondrial permeability transition pore, low expression, no expression, low activation or inactivation of peptidylprolyl isomerase F, low expression or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of NNMT gene and / or hypermethylation of DNA CpG sites in NNMT gene region. The present invention provides a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof. JPEG2025509621000059.jpg80147
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the art of pharmaceuticals, and more particularly to tetracyclic compounds and their use. [Background technology]

[0002] Tumors are a common disease that seriously endangers human health, and malignant tumor mortality rates have been steadily increasing. Due to the heterogeneity of tumors, simply using the same treatment method or the same drug depending on its origin and pathological characteristics can easily lead to problems caused by inappropriate treatment, delaying the patient's crucial treatment time and timing. Therefore, there seems to be a great need to adopt precise treatment for various tumor situations. With the advancement of biological technology, tumors have a continuous genotype distribution at the molecular level, such as genes and proteins, and changes in the expression and activity of tumor-related genes and proteins are being discovered one after another. Changes in the expression and activity of tumor-related genes and proteins play an important role in the development of malignant tumors. The discovery and application of biomarkers provide precise guidance for the application of related drugs, enabling precise treatment of tumors, thereby achieving targeted drug delivery, significantly improving treatment efficacy, and reducing drug dosage and toxic side effects.

[0003] Therefore, developing drugs that can precisely treat tumors is an urgent task in this field of technology. [Overview of the Initiative] [Problems that the invention aims to solve]

[0004] The present invention aims to provide a compound that exhibits significantly superior therapeutic effects against tumors with low, absent, low activity, or inactivity of membrane permeable transition pores of granules, tumors with low, absent, low activity, or inactivity of peptidyl prolyl isomerase F, tumors with low or absent expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. [Means for solving the problem]

[0005] A first aspect of the present invention provides the use of a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, for the manufacture of a composition or formulation used for the prevention and / or treatment of tumors; [ka] Here, R1 and R2 independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C3-C16 cycloalkyl group, a substituted or unsubstituted 3-12 member heterocycloalkyl group, a substituted or unsubstituted C1-C16 halogenated alkyl group, a substituted or unsubstituted C3-C16 halogenated cycloalkyl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C10 alkyl group-, a substituted or unsubstituted 5-16 member heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-, or a substituted or unsubstituted C2-C10 alkenyl group-substituted or unsubstituted C1-C10 alkyl group-; R3 and R4 are each independently hydrogen atoms, R 16 -O- or R 16 -S- represents; R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 and R 15each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a halogen atom; R9 and R 10 combine to form a substituted or unsubstituted 3- to 12-member heterocycloalkyl ring; R 16 represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group, or a substituted or unsubstituted C3-C16 cycloalkyl group.

[0006] In another preferred example, on the heterocyclic rings of the heterocycloalkyl group, the heteroaryl group, and the heterocycloalkyl ring, there are independently one to four (preferably one, two, three, or four) heteroatoms selected from N, O, and S.

[0007] In another preferred example, on the heterocyclic ring of the heterocycloalkyl group, there are independently one to four (preferably one, two, three, or four) heteroatoms selected from N, O, and S.

[0008] In another preferred example, on the heterocyclic ring of the heteroaryl group, there are independently one to four (preferably one, two, three, or four) heteroatoms selected from N, O, and S.

[0009] In another preferred example, on the heterocyclic ring of the heterocycloalkyl ring, there are independently one to four (preferably one, two, three, or four) heteroatoms selected from N, O, and S.

[0010] In another preferred example, the aforementioned optional "substitution" is such that one or more (preferably one, two, three, four, five, six, seven, or eight) hydrogen atoms on the ring or group are independently a C1-C8 alkyl group, a C3-C12 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, or a nitrate. This refers to substitution with substituents selected from the following: √ group, -CN, hydroxyl group, mercapto group, amino group, C1-C4 carboxyl group, C2-C4 ester group, C2-C4 acylamino group, C1-C8 alkoxyl group, C1-C8 alkylthiol group, C1-C8 halogenated alkoxyl group, C1-C8 halogenated alkylthiol group, C6-C12 aryl group, C6-C12 aryl group-O-, 5-10 member heteroaryl group, 5-10 member heteroaryl group-O-, and 5-10 member heterocycloalkyl group.

[0011] In another preferred example, the aforementioned optional "substitution" is such that one or more (preferably one, two, three, four, five, six, seven, or eight) hydrogen atoms on the ring or group are independently a C1-C6 alkyl group, a C3-C10 cycloalkyl group, a C1-C6 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, or a nitrate. This refers to substitution with substituents selected from the following: √ group, -CN, hydroxyl group, mercapto group, amino group, C1-C4 carboxyl group, C2-C4 ester group, C2-C4 acylamino group, C1-C6 alkoxyl group, C1-C6 alkylthiol group, C1-C6 halogenated alkoxyl group, C1-C6 halogenated alkylthiol group, C6-C12 aryl group, C6-C12 aryl group-O-, 5-10 member heteroaryl group, 5-10 member heteroaryl group-O-, and 5-10 member heterocycloalkyl group.

[0012] In another preferred example, the aforementioned optional "substitution" is such that one or more (preferably one, two, three, four, five, six, seven, or eight) hydrogen atoms on the ring or group are independently a C1-C4 alkyl group, a C3-C10 cycloalkyl group, a C1-C4 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, or a nitrate. This refers to substitution with substituents selected from the following: √ group, -CN, hydroxyl group, mercapto group, amino group, C1-C4 carboxyl group, C2-C4 ester group, C2-C4 acylamino group, C1-C4 alkoxyl group, C1-C4 alkylthiol group, C1-C4 halogenated alkoxyl group, C1-C4 halogenated alkylthiol group, C6-C12 aryl group, C6-C12 aryl group-O-, 5-10 member heteroaryl group, 5-10 member heteroaryl group-O-, and 5-10 member heterocycloalkyl group.

[0013] In another preferred example, the aforementioned "substitution" refers to the independent substitution of one or more (preferably one, two, three, four, five, six, seven, or eight) hydrogen atoms on the ring or group of atoms by a substituent.

[0014] In another preferred example, at least one of R1 and R2 does not represent a hydrogen atom.

[0015] In another preferred example, R1 represents a hydrogen atom, while R2 does not represent a hydrogen atom.

[0016] In another preferred example, R1 does not represent a hydrogen atom, while R2 does.

[0017] In another preferred example, neither R1 nor R2 represents a hydrogen atom.

[0018] In another preferred example, R1 does not represent a hydrogen atom.

[0019] In another preferred example, R2 does not represent a hydrogen atom.

[0020] In another preferred example, R1 and R2 may represent the same atomic group or different atomic groups.

[0021] In another preferred example, R1 and R2 each independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, a substituted or unsubstituted 3-12 member heterocycloalkyl group, a substituted or unsubstituted C1-C12 halogenated alkyl group, a substituted or unsubstituted C3-C12 halogenated cycloalkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted 5-12 member heteroaryl group-substituted or unsubstituted C1-C8 alkyl group-, or a substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-.

[0022] In another preferred example, R1 and R2 each independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, a substituted or unsubstituted 3-10 member heterocycloalkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C3-C10 halogenated cycloalkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted 5-10 member heteroaryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-.

[0023] In another preferred example, R1 and R2 independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-8 member heterocycloalkyl group, a substituted or unsubstituted C1-C6 halogenated alkyl group, a substituted or unsubstituted C3-C8 halogenated cycloalkyl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-10 member heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted C2-C6 alkenyl group-substituted or unsubstituted C1-C6 alkyl group-.

[0024] In another preferred example, R1 and R2 independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-6 member heterocycloalkyl group, a substituted or unsubstituted C1-C6 halogenated alkyl group, a substituted or unsubstituted C3-C6 halogenated cycloalkyl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-8 member heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-.

[0025] In another preferred example, R1 and R2 independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-6 member heterocycloalkyl group, a substituted or unsubstituted C1-C4 halogenated alkyl group, a substituted or unsubstituted C3-C6 halogenated cycloalkyl group, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-8 member heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-.

[0026] In another preferred example, R1 and R2 independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C6 cycloalkyl group, a substituted or unsubstituted 3-8 member heterocycloalkyl group, a substituted or unsubstituted C1-C2 halogenated alkyl group, a substituted or unsubstituted C3-C6 halogenated cycloalkyl group, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted 5-8 member heteroaryl group-substituted or unsubstituted C1-C2 alkyl group-, or a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-.

[0027] In another preferred example, R1 and R2 independently represent a hydrogen atom, a substituted or unsubstituted methyl group, a substituted or unsubstituted ethyl group, a substituted or unsubstituted propyl group, a substituted or unsubstituted butyl group, a substituted or unsubstituted amyl group, a substituted or unsubstituted hexyl group, a substituted or unsubstituted heptyl group, a substituted or unsubstituted octyl group, a substituted or unsubstituted vinyl group-substituted or unsubstituted methyl group-, a substituted or unsubstituted vinyl group-substituted or unsubstituted ethyl group-, a substituted or unsubstituted methyl halide group, a substituted or unsubstituted cycloamyl group, or a substituted or unsubstituted cyclohexyl group.

[0028] In another preferred example, R1 and R2 independently represent a hydrogen atom, a methyl group, an ethyl group, a propyl group, a butyl group, an amyl group, a hexyl group, a vinyl-methyl group, a vinyl-ethyl group, a methyl halide, a cycloamyl group, or a cyclohexyl group.

[0029] In another preferred example, the aryl group refers to a phenyl group.

[0030] In another preferred example, the propyl group is an n-propyl group or an isopropyl group.

[0031] In another preferred example, the propyl group is [ka]

[0032] In another preferred example, the butyl group is an n-butyl group.

[0033] In another preferred example, the butyl group [ka]

[0034] In another preferred example, the hexyl group is an n-hexyl group.

[0035] In another preferred example, the hexyl group is [ka]

[0036] In another preferred example, the chemical structure of the vinyl group-ethyl group is [ka]

[0037] In another preferred example, the cycloamyl group is [ka]

[0038] In another preferred example, the cyclohexyl group is [ka]

[0039] In another preferred example, the halogen atom is a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0040] In another preferred example, the halogenation refers to 1-position halogenation, 2-position halogenation, 3-position halogenation, or total halogenation.

[0041] In another preferred example, the halogenation refers to fluorination, chlorination, bromination, or iodization.

[0042] In another preferred example, the methyl halogenated group is trichloromethyl or trifluoromethyl.

[0043] In another preferred example, the deuteration refers to 1-position deuteration, 2-position deuteration, 3-position deuteration, or total deuteration.

[0044] In another preferred example, R3 and R4 are, independently, hydrogen atoms, R 16 -O- or R 16 Represents -S-

[0045] In another preferred example, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 and R 15 Each of these independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a halogen atom.

[0046] In another preferred example, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 and R 15 Each of these independently represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom.

[0047] In another preferred example, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 and R 15 Each of these independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a halogen atom.

[0048] In another preferred example, R9 and R 10 These atoms bond to form substituted or unsubstituted 3-10 membered heterocycloalkyl rings.

[0049] In another preferred example, R9 and R 10 These atoms bond to form substituted or unsubstituted 3-8 membered heterocycloalkyl rings.

[0050] In another preferred example, R9 and R 10 These atoms bond to form substituted or unsubstituted 5-8 membered heterocycloalkyl rings.

[0051] In another preferred example, R9 and R 10 These atoms bond to form substituted or unsubstituted 5-7 membered heterocycloalkyl rings.

[0052] In another preferred example, R9 and R 10 These combine to form a substituted or unsubstituted 3-membered heterocycloalkyl ring, a substituted or unsubstituted 4-membered heterocycloalkyl ring, a substituted or unsubstituted 5-membered heterocycloalkyl ring, a substituted or unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, a substituted or unsubstituted 8-membered heterocycloalkyl ring, a substituted or unsubstituted 9-membered heterocycloalkyl ring, a substituted or unsubstituted 10-membered heterocycloalkyl ring, a substituted or unsubstituted 11-membered heterocycloalkyl ring, or a substituted or unsubstituted 12-membered heterocycloalkyl ring.

[0053] In another preferred example, R9 and R 10 It combines and substitutes or does not substitute [ka]

[0054] In another preferred example, W1 represents either O or S.

[0055] In another preferred example, W2 represents either O or S.

[0056] In another preferred example, R 16 This represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C12 alkyl group, or a substituted or unsubstituted C3-C12 cycloalkyl group.

[0057] In another preferred example, R 16 This represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group.

[0058] In another preferred example, R 16 This represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group.

[0059] In another preferred example, R 16 This represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0060] In another preferred example, R 16 This represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0061] In another preferred example, R 16 This represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C2 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0062] In another preferred example, R 16 This represents a hydrogen atom, a substituted or unsubstituted methyl group, a substituted or unsubstituted ethyl group, a substituted or unsubstituted propyl group, or a substituted or unsubstituted butyl group.

[0063] In another preferred example, R 16 represents a hydrogen atom or a methyl group.

[0064] In another preferred example, R 17 This represents a hydrogen atom or a substituted or unsubstituted C1-C8 alkyl group.

[0065] In another preferred example, R 17 This represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group.

[0066] In another preferred example, R 17 This represents a hydrogen atom or a substituted or unsubstituted C1-C4 alkyl group.

[0067] In another preferred example, the compound of formula I may or may not have optical activity.

[0068] In another preferred example, the compound of formula I may or may not have a chiral carbon atom.

[0069] In another preferred example, the compound of formula I has one chiral carbon atom.

[0070] In another preferred example, the structure of the compound of formula I is a racemate, an R-type structure, or an S-type structure.

[0071] In another preferred example, the chemical structure of the compound of formula I is as shown in formula I-1. [ka] Here, R1, R2, R3, R4, R5, R6, R7, R8, R9, R 10 , R 11 , R 12 , R 13 , R 14 sum R 15 Each of these is defined independently as described above.

[0072] In another preferred example, "*" represents the structure of a compound.

[0073] In another preferred example, "*" indicates that the compound has a racemic, R-type, or S-type structure.

[0074] In another preferred example, "*" represents a chiral carbon atom.

[0075] In another preferred example, the structure of the chiral carbon atom is a racemic mixture, an R-type structure, or an S-type structure.

[0076] In another preferred example, the structure of the chiral carbon atom is an R-type structure and / or an S-type structure.

[0077] In another preferred example, the R-type and S-type structures of the chiral carbon atoms refer to the structure of a racemic mixture.

[0078] In another preferred example, the chemical structure of the compound of formula I is as shown in formula I-2. [ka] Here, R1, R2, R3, R4, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 , R 15 , R 17 W1 and W2 are defined independently as described above.

[0079] In another preferred example, the chemical structure of the compound of formula I is as shown in formula I-3. [ka] Here, R1, R2, R3, R4, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 , R 15 , R 17 W1, W2, and * are each independently defined as described above.

[0080] In another preferred example, pharmaceutically acceptable salts of the compound of formula I include salts formed by the compound of formula I with an acid.

[0081] In another preferred example, the acid includes one or more of the following: hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodate, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0082] In another preferred example, pharmaceutically acceptable salts of the compound of formula I include salts formed with one or more of the compounds of formula I, including hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodate, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0083] In another preferred example, pharmaceutically acceptable salts of the compound of formula I include salts formed with the compound of formula I using hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodate, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid.

[0084] In another preferred example, the base of a pharmaceutically acceptable salt of the compound of formula I is such that the acid has one H + It contains bases formed by losing a component.

[0085] In another preferred example, the base of a pharmaceutically acceptable salt of the compound of formula I is hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodate, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid with one H + It contains bases formed by losing a component.

[0086] In another preferred example, the base of the pharmaceutically acceptable salt of the compound of formula I is F - Cl - , Br - , I - , HCOO - CH3COO - SO4 2- Or NO3 - Includes.

[0087] In another preferred example, the chemical structural formula of the compound of formula I, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound is as follows: [ka] JPEG0007843542000013.jpg236154JPEG0007843542000014.jpg42154

[0088] In another preferred example, the tumor is a human-derived tumor.

[0089] In another preferred example, the tumor is a human tumor.

[0090] In another preferred example, the tumor includes tumors in which the membrane permeable transition pores of the glomeruli are underexpressed, unexpressed, underactivated, or inactivated.

[0091] In another preferred example, the tumors include tumors in which peptidylprolyl isomerase F is poorly expressed, not expressed, low-activated, or inactivated.

[0092] In another preferred example, peptidyl prolyl isomerase F has the protein number UniProtKB / Swiss-Prot: P30405 and the gene number NCBI Entrez Gene: 10105.

[0093] In another preferred example, the tumor in which the membrane permeable transition pores of the glomeruli are underexpressed or underactivated refers to a tumor in which the expression level or activity of the membrane permeable transition pores of the glomeruli in tumor cells is lower than that of similar cells or normal cells (e.g., malignant bladder tissue cells).

[0094] In another preferred example, the tumor in which the membrane permeable transition pores of the glomeruli are low-expressed or low-activated refers to a tumor in which the ratio (H1 / H0) of the expression level or activity of the membrane permeable transition pores of glomeruli in a certain cell (e.g., tumor cell) to the expression level or activity of the membrane permeable transition pores of glomeruli in a similar cell or normal cell (e.g., malignant bladder tissue cell) is <1.0, preferably ≤0.8, and more preferably ≤0.7, ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0095] In another preferred example, the aforementioned cells include tumor cells.

[0096] In another favorable example, "identical cell" refers to a cell of the same type.

[0097] In another preferred example, the aforementioned like cells include cells of the same type.

[0098] In another preferred example, the like cells include like tumor cells.

[0099] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0100] In another preferred example, the aforementioned like cells refer to cells (like tumor cells) in which the membrane permeability transition pores of the glomeruli are normally expressed or highly expressed, or normally activated or highly activated.

[0101] In another preferred example, the aforementioned like cells refer to cells of the same type, but which have normal or high expression or normal or high activation of the membrane permeability transition pores of the glomeruli (like tumor cells).

[0102] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0103] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the membrane permeable transition pores of the glomeruli are normally expressed or normally activated.

[0104] In another preferred example, H0 represents the expression level or activity of the membrane permeable transition pores of the glomeruli in cells where the glomeruli membrane permeable transition pores are normally expressed, highly expressed, normally activated, or highly activated.

[0105] In another preferred example, cells in which the membrane permeable transition pores of the granules are normally expressed or highly expressed or normally activated or highly activated include cells that are insensitive to the compound of formula I, or its optical isomers or racemates, or its solvates, or its pharmaceutically acceptable salts, or its deuterated compounds.

[0106] In another preferred example, the tumor in which peptidylprolyl isomerase F is low-expression or low-activation refers to a tumor in which the expression level or activity of peptidylprolyl isomerase F in tumor cells is lower than that of similar cells or normal cells (e.g., malignant bladder tissue cells).

[0107] In another preferred example, the tumor in which peptidylprolyl isomerase F is low-expression or low-activation refers to a tumor in which the ratio (P1 / P0) between the expression level or activity P1 of peptidylprolyl isomerase F in a certain cell (e.g., tumor cell) and the expression level or activity P0 of peptidylprolyl isomerase F in a similar cell or normal cell (e.g., malignant bladder tissue cell) is <1.0, preferably ≤0.8, and then more preferably ≤0.7, ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0108] In another favorable example, "identical cell" refers to a cell of the same type.

[0109] In another preferred example, the aforementioned like cells include cells of the same type.

[0110] In another preferred example, the like cells include like tumor cells.

[0111] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0112] In another preferred example, the aforementioned like cells refer to cells (like tumor cells) that normally or highly express peptidyl prolyl isomerase F or that are normally or highly activated.

[0113] In another preferred example, the aforementioned like cells refer to cells of the same type, but which are normally or highly expressed or normally activated or highly activated by peptidyl prolyl isomerase F (like tumor cells).

[0114] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which peptidyl prolyl isomerase F is normally expressed or normally activated.

[0115] In another preferred example, P0 represents the expression level or activity of peptidylprolyl isomerase F in cells that are normally expressed, highly expressed, normally activated, or highly activated.

[0116] In another preferred example, cells in which peptidylprolyl isomerase F is normally expressed or highly expressed or normally activated or highly activated include cells that are insensitive to the compound of formula I, or its optical isomers or racemates, or its solvates, or its pharmaceutically acceptable salts, or its deuterated compounds.

[0117] In another preferred example, the tumors in which the membrane permeable transition pores of the glomeruli are lowly expressed, absent, reduced in nature, or inactivated can be produced by providing an inhibitor of the membrane permeable transition pores of the glomeruli.

[0118] In another preferred example, the tumors in which peptidylprolyl isomerase F is lowly expressed, absent, reduced, or inactivated can be produced by administering a peptidylprolyl isomerase F inhibitor.

[0119] In another preferred example, the inhibitor includes a specific inhibitor.

[0120] In another preferred example, the inhibitor of the membrane permeable transition pores of the glomeruli includes an inhibitor that can cause the membrane permeable transition pores of the glomeruli in the tumor to be less expressed, not expressed, less activated, or inactivated.

[0121] In another preferred example, the inhibitor of peptidylprolyl isomerase F includes inhibitors that cause tumor peptidylprolyl isomerase F to be low-expressed, non-expressed, low-activated, or inactivated.

[0122] In another preferred example, the inhibitor of the membrane permeable transition pore of the granules is selected from Cyclosporin A, CyP-D protein inhibitors, peroxide scavengers, or a combination thereof.

[0123] In another preferred example, the inhibitor of peptidyl prolyl isomerase F includes shRNA.

[0124] In another preferred example, the nucleotide sequence of shRNA is GTTCTTCATCTGCACCATAAA.

[0125] In another preferred example, the tumors include tumors in which the NNMT gene is low-expression or not expressed at all.

[0126] In another preferred example, the tumor includes a tumor in which DNA methyltransferase is highly expressed.

[0127] In another preferred example, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0128] In another preferred example, the tumor includes a tumor in which DNMT1 is highly expressed.

[0129] In another preferred example, the tumor includes a tumor in which DNMT3a is highly expressed.

[0130] In another preferred example, the tumor includes a tumor in which DNMT3b is highly expressed.

[0131] In another preferred example, the tumor includes a tumor in which UHRF1 is highly expressed.

[0132] In another preferred example, the tumor includes a tumor having hypermethylation of nucleotide sites of the NNMT gene and / or hypermethylation of DNA CpG sites in the NNMT gene region.

[0133] In another preferred example, the tumor includes a tumor in which the nucleotide site of the NNMT gene is hypermethylated.

[0134] In another preferred example, the methylation of the nucleotide site of the NNMT gene refers to the methylation of the cytosine nucleotide site of the NNMT gene.

[0135] In another preferred example, the methylation of the nucleotide site of the NNMT gene refers to the methylation of the cytosine nucleotide of the NNMT gene.

[0136] In another preferred example, the methylation of the nucleotide site of the NNMT gene refers to the methylation of the 5th carbon atom on the cytosine of the nucleotide of the NNMT gene.

[0137] In another preferred example, the tumor includes a tumor in which the DNA CpG site in the NNMT gene region is hypermethylated.

[0138] In another preferred example, the methylation of the DNA CpG site in the NNMT gene region refers to the methylation of the cytosine nucleotide site in the DNA CpG site of the NNMT gene region.

[0139] In another preferred example, the methylation of the DNA CpG site in the NNMT gene region refers to the methylation of the cytosine nucleotide in the DNA CpG site of the NNMT gene region.

[0140] In another preferred example, the methylation of the DNA CpG site in the NNMT gene region refers to the methylation of the 5th carbon atom on the cytosine of the nucleotide in the DNA CpG site of the NNMT gene region.

[0141] In another preferred example, the NNMT gene is a human-derived NNMT gene.

[0142] In another preferred example, the NNMT gene is the human NNMT gene.

[0143] In another preferred example, the tumors in which the NNMT gene is low-expression or not expressed refer to tumors in which the NNMT protein cannot be detected by the NNMT antibody in 1 μg of protein extracted from the tumor; more preferably, tumors in which the NNMT protein cannot be detected by the NNMT antibody in 5 μg of protein extracted from the tumor; more preferably, tumors in which the NNMT protein cannot be detected by the NNMT antibody in 10 μg of protein extracted from the tumor; more preferably, tumors in which the NNMT protein cannot be detected by the NNMT antibody in 100 μg of protein extracted from the tumor; and more preferably, tumors in which the NNMT protein cannot be detected by the NNMT antibody in 1000 μg of protein extracted from the tumor.

[0144] In another preferred example, the tumor in which the NNMT gene is low-expression or not expressed refers to a tumor in which the expression level of the NNMT gene in tumor cells is lower than the expression level of the NNMT gene in analogous cells or normal cells.

[0145] In another preferred example, the tumor in which the NNMT gene is low-expressing or not expressed refers to a tumor in which the ratio (E1 / E0) of the NNMT gene expression level E1 in tumor cells to the NNMT gene expression level E0 in like cells or normal cells is <1.0.

[0146] In another preferred example, the tumor in which the NNMT gene is low-expression or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or a normal cell is <1.0, preferably ≤0.7, and more preferably ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0147] In another preferred example, the aforementioned cells include tumor cells.

[0148] In another preferred example, the aforementioned like cells include cells of the same type.

[0149] In another preferred example, the like cells include like tumor cells.

[0150] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0151] In another preferred example, the aforementioned "similar cells" refer to cells in which the NNMT gene is normally or highly expressed (similar tumor cells).

[0152] In another preferred example, the like cells include cells of the same type, yet in which the NNMT gene is normally or highly expressed.

[0153] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0154] In another preferred example, the normal cells refer to normal tissue cells in which the NNMT gene is normally expressed (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0155] In another preferred example, E0 is the expression level of the NNMT gene in cells where the NNMT gene is normally or highly expressed.

[0156] In another preferred example, cells in which the NNMT gene is normally or highly expressed include cells that are insensitive to the compound of formula I, or its optical isomers or racemates, or its solvates, or its pharmaceutically acceptable salts, or its deuterated compounds.

[0157] In another preferred example, the tumor in which DNA methyltransferase is highly expressed refers to a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 20 μg of protein extracted from the tumor; more preferably, a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 5 μg of protein extracted from the tumor; more preferably, a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 1 μg of protein extracted from the tumor; more preferably, a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.2 μg of protein extracted from the tumor; more preferably, a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.05 μg of protein extracted from the tumor; and more preferably, a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.01 μg of protein extracted from the tumor.

[0158] In another preferred example, the tumor in which DNA methyltransferase is highly expressed refers to a tumor in which the expression level of DNA methyltransferase in tumor cells is greater than the expression level of DNA methyltransferase in similar cells or normal cells.

[0159] In another preferred example, the tumors in which DNA methyltransferase is highly expressed refer to tumors in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in like cells or normal cells is >1.0, preferably ≥1.2 or ≥1.5, and then more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, 2-50.

[0160] In another preferred example, the aforementioned like cells include cells of the same type.

[0161] In another preferred example, the like cells include like tumor cells.

[0162] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0163] In another preferred example, the aforementioned like cells refer to cells in which DNA methyltransferases are normally or poorly expressed (e.g., like tumor cells).

[0164] In another preferred example, the like cells include cells of the same type, yet with normal or low expression of DNA methyltransferases.

[0165] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0166] In another preferred example, the normal cells refer to normal tissue cells in which DNA methyltransferases are normally expressed (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0167] In another preferred example, A0 is the expression level of DNA methyltransferase in cells where the DNA methyltransferase is normally or underexpressed.

[0168] In another preferred example, cells in which DNA methyltransferase is normally or poorly expressed include cells that are insensitive to the compound of formula I, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound.

[0169] In another preferred example, the tumors in which DNMT1 is highly expressed refer to tumors in which the DNMT1 protein can be detected with a DNMT1 antibody in 20 μg of protein extracted from the tumor; more preferably, tumors in which the DNMT1 protein can be detected with a DNMT1 antibody in 5 μg of protein extracted from the tumor; more preferably, tumors in which the DNMT1 protein can be detected with a DNMT1 antibody in 1 μg of protein extracted from the tumor; more preferably, tumors in which the DNMT1 protein can be detected with a DNMT1 antibody in 0.2 μg of protein extracted from the tumor; more preferably, tumors in which the DNMT1 protein can be detected with a DNMT1 antibody in 0.05 μg of protein extracted from the tumor; and more preferably, tumors in which the DNMT1 protein can be detected with a DNMT1 antibody in 0.01 μg of protein extracted from the tumor.

[0170] In another preferred example, the tumors in which DNMT1 is highly expressed refer to tumors in which the expression level of DNMT1 in tumor cells is greater than the expression level of DNMT1 in analogous cells or normal cells.

[0171] In another preferred example, the tumors in which DNMT1 is highly expressed refer to tumors in which the ratio (B1 / B0) between the expression level of DNMT1 in tumor cells B1 and the expression level of DNMT1 in like cells or normal cells B0 is >1.0, preferably ≥1.2 or ≥1.5, and then more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, 2-50.

[0172] In another preferred example, the aforementioned like cells include cells of the same type.

[0173] In another preferred example, the like cells include like tumor cells.

[0174] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0175] In another preferred example, the aforementioned like cells refer to cells in which DNMT1 is normally or poorly expressed (e.g., like tumor cells).

[0176] In another preferred example, the like cells include cells of the same type, yet which either express DNMT1 normally or with low expression.

[0177] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0178] In another preferred example, the normal cells refer to normal tissue cells in which DNMT1 is normally expressed (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0179] In another preferred example, B0 is the expression level of DNMT1 in cells where DNMT1 is normally or underexpressed.

[0180] In another preferred example, cells in which DNMT1 is normally or lowly expressed include cells that are insensitive to the compound of formula I, or its optical isomers or racemates, or its solvates, or its pharmaceutically acceptable salts, or its deuterated compounds.

[0181] In another preferred example, a tumor in which DNMT3a is highly expressed refers to a tumor in which the DNMT3a protein can be detected with a DNMT3a antibody in 20 μg of protein extracted from the tumor; more preferably, a tumor in which the DNMT3a protein can be detected with a DNMT3a antibody in 5 μg of protein extracted from the tumor; more preferably, a tumor in which the DNMT3a protein can be detected with a DNMT3a antibody in 1 μg of protein extracted from the tumor; more preferably, a tumor in which the DNMT3a protein can be detected with a DNMT3a antibody in 0.2 μg of protein extracted from the tumor; more preferably, a tumor in which the DNMT3a protein can be detected with a DNMT3a antibody in 0.05 μg of protein extracted from the tumor; and more preferably, a tumor in which the DNMT3a protein can be detected with a DNMT3a antibody in 0.01 μg of protein extracted from the tumor.

[0182] In another preferred example, a tumor in which DNMT3a is highly expressed refers to a tumor in which the expression level of DNMT3a in tumor cells is greater than the expression level of DNMT3a in analogous cells or normal cells.

[0183] In another preferred example, the tumors in which DNMT3a is highly expressed refer to tumors in which the ratio (C1 / C0) between the expression level of DNMT3a in tumor cells C1 and the expression level of DNMT3a in like cells or normal cells C0 is >1.0, preferably ≥1.2 or ≥1.5, and then more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, 2-50.

[0184] In another preferred example, the aforementioned like cells include cells of the same type.

[0185] In another preferred example, the like cells include like tumor cells.

[0186] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0187] In another preferred example, the aforementioned like cells refer to cells in which DNMT3a is normally or poorly expressed (e.g., like tumor cells).

[0188] In another preferred example, the like cells include cells of the same type, yet in which DNMT3a is normally or poorly expressed.

[0189] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0190] In another preferred example, the normal cells refer to normal tissue cells in which DNMT3a is normally expressed (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0191] In another preferred example, C0 is the expression level of DNMT3a in cells where DNMT3a is normally expressed or low.

[0192] In another preferred example, cells in which DNMT3a is normally or lowly expressed include cells that are insensitive to the compound of formula I, or its optical isomers or racemates, or its solvates, or its pharmaceutically acceptable salts, or its deuterated compounds.

[0193] In another preferred example, the tumors in which DNMT3b is highly expressed refer to tumors in which the DNMT3b protein can be detected with a DNMT3b antibody in 20 μg of protein extracted from the tumor; more preferably, tumors in which the DNMT3b protein can be detected with a DNMT3b antibody in 5 μg of protein extracted from the tumor; more preferably, tumors in which the DNMT3b protein can be detected with a DNMT3b antibody in 1 μg of protein extracted from the tumor; more preferably, tumors in which the DNMT3b protein can be detected with a DNMT3b antibody in 0.2 μg of protein extracted from the tumor; more preferably, tumors in which the DNMT3b protein can be detected with a DNMT3b antibody in 0.05 μg of protein extracted from the tumor; and more preferably, tumors in which the DNMT3b protein can be detected with a DNMT3b antibody in 0.01 μg of protein extracted from the tumor.

[0194] In another preferred example, the tumor in which DNMT3b is highly expressed refers to a tumor in which the expression level of DNMT3b in tumor cells is greater than the expression level of DNMT3b in analogous cells or normal cells.

[0195] In another preferred example, the tumors in which DNMT3b is highly expressed refer to tumors in which the ratio (D1 / D0) between the expression level of DNMT3b in tumor cells D1 and the expression level of DNMT3b in like cells or normal cells D0 is >1.0, preferably ≥1.2 or ≥1.5, and then more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, 2-50.

[0196] In another preferred example, the aforementioned like cells include cells of the same type.

[0197] In another preferred example, the like cells include like tumor cells.

[0198] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0199] In another preferred example, the aforementioned like cells refer to cells in which DNMT3b is normally or poorly expressed (like tumor cells).

[0200] In another preferred example, the like cells include cells of the same species, yet which express DNMT3b normally or with low expression.

[0201] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0202] In another preferred example, the normal cells refer to normal tissue cells in which DNMT3b is normally expressed (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0203] In another preferred example, D0 is the expression level of DNMT3b in cells where DNMT3b is normally or poorly expressed.

[0204] In another preferred example, cells in which DNMT3b is normally or lowly expressed include cells that are insensitive to the compound of formula I, or its optical isomers or racemates, or its solvates, or its pharmaceutically acceptable salts, or its deuterated compounds.

[0205] In another preferred example, a tumor that highly expresses UHRF1 refers to a tumor in which the UHRF1 protein can be detected with a UHRF1 antibody in 20 μg of protein extracted from the tumor; more preferably, a tumor in which the UHRF1 protein can be detected with a UHRF1 antibody in 5 μg of protein extracted from the tumor; more preferably, a tumor in which the UHRF1 protein can be detected with a UHRF1 antibody in 1 μg of protein extracted from the tumor; more preferably, a tumor in which the UHRF1 protein can be detected with a UHRF1 antibody in 0.2 μg of protein extracted from the tumor; more preferably, a tumor in which the UHRF1 protein can be detected with a UHRF1 antibody in 0.05 μg of protein extracted from the tumor; and more preferably, a tumor in which the UHRF1 protein can be detected with a UHRF1 antibody in 0.01 μg of protein extracted from the tumor.

[0206] In another preferred example, the tumor in which UHRF1 is highly expressed refers to a tumor in which the expression level of UHRF1 in tumor cells is greater than the expression level of UHRF1 in analogous cells or normal cells.

[0207] In another preferred example, the tumors in which UHRF1 is highly expressed refer to tumors in which the ratio (F1 / F0) between the amount of UHRF1 expressed in tumor cells F1 and the amount of UHRF1 expressed in like cells or normal cells F0 is >1.0, preferably ≥1.2 or ≥1.5, and then more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, 2-50.

[0208] In another preferred example, the aforementioned like cells include cells of the same type.

[0209] In another preferred example, the like cells include like tumor cells.

[0210] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0211] In another preferred example, the aforementioned like cells refer to cells in which UHRF1 is normally or poorly expressed (like tumor cells).

[0212] In another preferred example, the like cells include cells of the same type, yet which express UHRF1 normally or with low expression.

[0213] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0214] In another preferred example, the normal cells refer to normal tissue cells that normally express UHRF1 (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0215] In another preferred example, F0 is the expression level of UHRF1 in cells where UHRF1 is normally or underexpressed.

[0216] In another preferred example, cells in which UHRF1 is normally or lowly expressed include cells that are insensitive to the compound of formula I, or its optical isomers or racemates, or its solvates, or its pharmaceutically acceptable salts, or its deuterated compounds.

[0217] In another preferred example, the tumor in which the nucleotide sites of the NNMT gene are hypermethylated refers to a tumor in which the methylation level of the nucleotide sites of the NNMT gene in certain cells (e.g., tumor cells) is greater than the methylation level of the nucleotide sites of the NNMT gene in similar cells or normal cells.

[0218] In another preferred example, a tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or normal cell (e.g., a malignant bladder tissue cell) is >1.0, preferably ≥1.2 or ≥1.5, and then more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, a tumor between 2 and 50.

[0219] In another preferred example, the tumor in which the nucleotide sites of the NNMT gene are hypermethylated refers to a tumor in which the methylation level of the nucleotide sites of the NNMT gene in a certain cell (e.g., a tumor cell) is ≥1%, preferably ≥3%, ≥5%, ≥10%, ≥15%, or ≥20%, and more preferably ≥25%, ≥30%, ≥40%, or ≥50%.

[0220] In another preferred example, the aforementioned cells include tumor cells.

[0221] In another preferred example, the aforementioned like cells include cells of the same type.

[0222] In another preferred example, the like cells include like tumor cells.

[0223] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0224] In another preferred example, the aforementioned like cells refer to cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated (like tumor cells).

[0225] In another preferred example, the like cells include cells of the same type, yet in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated.

[0226] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0227] In another preferred example, the normal cells refer to normal tissue cells in which the nucleotide sites of the NNMT gene are normally methylated (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0228] In another preferred example, cells in which the nucleotide sites of the NNMT gene are normally methylated or hypomethylated include cells that are insensitive to the compound of formula I, or its optical isomers or racemates, or its solvates, or its pharmaceutically acceptable salts, or its deuterated compounds.

[0229] In another preferred example, the tumor in which the nucleotide sites of the NNMT gene are hypermethylated refers to a tumor in which the methylation level (M%) of the nucleotide sites of the NNMT gene in a certain cell (e.g., a tumor cell) is ≥3% and M1% or less, where M1 is any positive integer between 3 and 100.

[0230] In another preferred example, M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, or 100.

[0231] In another preferred example, the methylation level of the nucleotide region of the NNMT gene refers to the ratio between the number of methylated nucleotides in the NNMT gene region and the total number of nucleotides in the NNMT gene region.

[0232] In another preferred example, the methylation level of the nucleotide sites of the NNMT gene includes the methylation level of the nucleotide sites in the NNMT gene promoter region.

[0233] In another preferred example, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0234] In another preferred example, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within the region from 1050 bp upstream to 499 bp downstream of the transcription start site of the NNMT gene.

[0235] In another preferred example, the region from 1050 bp upstream to 499 bp downstream of the transcription start site of the NNMT gene is positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0236] In another preferred example, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within the region from 1050 bp upstream to 193 bp upstream of the transcription start site of the NNMT gene.

[0237] In another preferred example, the region from 1050 bp upstream to 193 bp upstream of the transcription start site of the NNMT gene is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0238] In another preferred example, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within the region from 840 bp upstream to 469 bp upstream of the transcription start site of the NNMT gene.

[0239] In another preferred example, the region from 840 bp upstream to 469 bp upstream of the transcription start site of the NNMT gene is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0240] In another preferred example, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within the region between any two of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0241] In another preferred example, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide of one or more (e.g., 2, 3, 4, 5, 6, or 7) sites among positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11.

[0242] In another preferred example, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide of a site selected from positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, 114166066 on human chromosome 11 or a combination thereof.

[0243] In another preferred example, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within the region between any two of positions 1161, 1196, 1235, 1270, 1404, 1516, and 1532 of the site of the SEQ ID NO:1 nucleotide sequence (including these two positions themselves).

[0244] In another preferred example, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide of one or more (e.g., 2, 3, 4, 5, 6, or 7) sites among positions 1161, 1196, 1235, 1270, 1404, 1516, and 1532 of the site of the SEQ ID NO:1 nucleotide sequence.

[0245] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of nucleotides at positions 1161, 1196, 1235, 1270, 1404, 1516, 1532, or a combination thereof, of the SEQ ID NO:1 nucleotide sequence.

[0246] In another preferred example, the tumor in which the DNA CpG sites of the NNMT gene region are hypermethylated refers to a tumor in which the methylation level of the DNA CpG sites of the NNMT gene region in certain cells (e.g., tumor cells) is greater than the methylation level of the DNA CpG sites of the NNMT gene region in similar cells or normal cells.

[0247] In another preferred example, a tumor in which the DNA CpG site of the NNMT gene region is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site of the NNMT gene region in a certain cell (e.g., a tumor cell) and the methylation level W0 of the DNA CpG site of the NNMT gene region in a similar cell or normal cell (e.g., a malignant bladder tissue cell) is >1.0, preferably ≥1.2 or ≥1.5, and then more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, a tumor between 2 and 50.

[0248] In another preferred example, the tumor in which the DNA CpG sites of the NNMT gene region are hypermethylated refers to a tumor in which the methylation level of the DNA CpG sites of the NMT gene region of a certain cell (e.g., a tumor cell) is ≥1%, preferably ≥3%, ≥5%, ≥10%, ≥15%, or ≥20%, and more preferably ≥25%, ≥30%, ≥40%, or ≥50%.

[0249] In another preferred example, the aforementioned cells include tumor cells.

[0250] In another preferred example, the aforementioned like cells include cells of the same type.

[0251] In another preferred example, the like cells include like tumor cells.

[0252] In another preferred example, the aforementioned like cells include tumor cells of the same type.

[0253] In another preferred example, the aforementioned like cells refer to cells in which the DNA CpG site of the NNMT gene region is normally methylated or hypomethylated (e.g., like tumor cells).

[0254] In another preferred example, the like cells include cells of the same type, yet in which the DNA CpG site in the NNMT gene region is normally methylated or hypomethylated.

[0255] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0256] In another preferred example, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the DNA CpG site of the NNMT gene region is normally methylated.

[0257] In another preferred example, cells in which the DNA CpG site of the NNMT gene region is normally methylated or hypomethylated include cells that are insensitive to the compound of formula I, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound.

[0258] In another preferred example, a tumor in which the DNA CpG sites of the NNMT gene region are hypermethylated refers to a tumor in which the methylation level (M%) of the DNA CpG sites of the NNMT gene region of a certain cell (e.g., a tumor cell) is ≥3% and M2% or less, where M2 is any positive integer between 3 and 100.

[0259] In another preferred example, M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, or 100.

[0260] In another preferred example, the methylation level of the CpG site refers to the ratio between the number of methylated CpG nucleotides in a certain gene region and the number of all nucleotides in the gene region.

[0261] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region.

[0262] In another preferred example, the methylation level of the CpG site refers to the ratio between the number of methylated CpG nucleotides in a certain gene region and the number of all CpG nucleotides in the gene region.

[0263] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all CpG nucleotides in the NNMT gene region.

[0264] In another preferred example, the methylation level of the DNA CpG site refers to the ratio between the number of methylated CpG sites in the DNA of a certain region and the number of all CpG sites in the DNA of the region.

[0265] In another preferred example, the methylation level of the DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in the DNA of a certain region and the number of all nucleotides in the DNA of the region.

[0266] In another preferred example, the methylation level of the DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in the DNA of a certain region and the number of all CpG nucleotides in the DNA of the region.

[0267] In another preferred example, the methylation level of the DNA CpG sites in the NNMT gene region refers to the ratio between the number of methylated CpG sites in the DNA of the NNMT gene region and the total number of CpG sites in the DNA of the NNMT gene region.

[0268] In another preferred example, the methylation level of the DNA CpG sites in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the DNA of the NNMT gene region and the total number of CpG nucleotides in the DNA of the NNMT gene region.

[0269] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the DNA CpG site in the NNMT gene promoter region.

[0270] In another preferred example, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0271] In another preferred example, the methylation level of the DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene.

[0272] In another preferred example, the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene corresponds to positions 951-2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0273] In another preferred example, the methylation level of the DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene.

[0274] In another preferred example, the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene corresponds to positions 951-1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0275] In another preferred example, the methylation level of the DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene.

[0276] In another preferred example, the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene corresponds to positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0277] In another preferred example, the methylation levels of DNA CpG sites in the NNMT gene region include the methylation levels of DNA CpG sites within the region between any two of the following positions on human chromosome 11: 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 (including the positions themselves).

[0278] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of one or more sites (e.g., 2, 3, 4, 5, 6, or 7) among positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 of human chromosome 11.

[0279] In another preferred example, the methylation levels of the DNA CpG sites in the NNMT gene region include methylation levels at positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, 114166066, or a selection of combinations thereof on human chromosome 11.

[0280] In another preferred example, the methylation level of the DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites within the region between any two of the following positions of the SEQ ID NO:1 nucleotide sequence (including the positions of these two positions themselves).

[0281] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation levels of one or more (e.g., 2, 3, 4, 5, 6, or 7) sites among positions 1161, 1196, 1235, 1270, 1404, 1516, and 1532 of the SEQ ID NO:1 nucleotide sequence.

[0282] In another preferred example, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation levels of sites selected from positions 1161, 1196, 1235, 1270, 1404, 1516, 1532, or combinations thereof, of the SEQ ID NO:1 sequence.

[0283] In another preferred example, the tumor in which the NNMT gene is low-expressing or not expressed can be produced by administering an NNMT gene inhibitor.

[0284] In another preferred example, the tumor in which DNA methyltransferase is highly expressed can be produced by providing a DNA methyltransferase promoter.

[0285] In another preferred example, the tumor in which DNMT1 is highly expressed can be produced by administering a DNMT1 promoter.

[0286] In another preferred example, the tumor in which DNMT3a is highly expressed can be produced by administering a DNMT3a promoter.

[0287] In another preferred example, the tumor in which DNMT3b is highly expressed can be produced by administering a DNMT3b promoter.

[0288] In another preferred example, the tumor in which UHRF1 is highly expressed can be produced by administering a UHRF1 promoter.

[0289] In another preferred example, the tumor in which the nucleotide site of the NNMT gene is hypermethylated can be produced by providing an agent that promotes methylation of the nucleotide site of the NNMT gene.

[0290] In another preferred example, the tumor in which the DNA CpG sites of the NNMT gene region are hypermethylated can be produced by providing an agent that promotes methylation of the DNA CpG sites of the NNMT gene region.

[0291] In another preferred example, the inhibitor includes a specific inhibitor.

[0292] In another preferred example, the accelerator includes a specific accelerator.

[0293] In another preferred example, the inhibitor of the NNMT gene includes an inhibitor that can cause the NNMT gene in the tumor to be low-expressed or not expressed at all.

[0294] In another preferred example, the DNA methyltransferase promoter includes a promoter that can enable high expression of tumor DNA methyltransferase.

[0295] In another preferred example, the DNMT1 promoter includes a promoter that can increase the expression of DNMT1 in the tumor.

[0296] In another preferred example, the DNMT3a promoter includes a promoter that can increase the expression of DNMT3a in tumors.

[0297] In another preferred example, the DNMT3b promoter includes a promoter that can increase the expression of DNMT3b in the tumor.

[0298] In another preferred example, the UHRF1 promoter includes a promoter that can increase the expression of UHRF1 in the tumor.

[0299] In another preferred example, the methylation promoter of the nucleotide site of the NNMT gene includes a promoter that can hypermethylate the nucleotide site of the tumor's NNMT gene.

[0300] In another preferred example, the methylation promoter of DNA CpG sites in the NNMT gene region includes a promoter that can hypermethylate DNA CpG sites in the NNMT gene region of a tumor.

[0301] In another preferred example, the tumor is selected from lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

[0302] In another preferred example, the lung cancer is selected from non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0303] In another preferred example, the lung cancer cells include NCI-H82 cells.

[0304] In another preferred example, the colon cancer includes colon adenocarcinoma.

[0305] In another preferred example, the colon cancer cells include SW48 cells.

[0306] In another preferred example, the colon cancer cells include MDA-MB-453 cells.

[0307] In another preferred example, the breast cancer includes triple-negative breast cancer.

[0308] In another preferred example, the lymphoma is selected from B-cell lymphoma, T-cell lymphoma, or a combination thereof.

[0309] In another preferred example, the lymphoma includes diffuse large B lymphoma.

[0310] In another preferred example, the brain tumor is selected from glioblastoma, glioma, medulloblastoma, neuroblastoma, or a combination thereof.

[0311] In another preferred example, the brain medulloblastoma includes cerebellar medulloblastoma.

[0312] In another preferred example, the glioblastoma includes glioblastoma pleomorphis.

[0313] In another preferred example, the brain tumor includes medulloblastoma.

[0314] In another preferred example, the brain tumor includes glioblastoma.

[0315] In another preferred example, the brain tumor includes a foveal malignant glioblastoma.

[0316] In another preferred example, the brain tumor includes medulloblastoma.

[0317] In another preferred example, the tumor cells of the brain tumor include Daoy cells.

[0318] In another preferred example, the cells of the brain tumor include one or more of GB-1 cells, SF126 cells, D341 Med cells, Kelly cells, and NB-1 cells.

[0319] In another preferred example, the renal cancer is selected from renal pellucid cell adenocarcinoma, renal cancer Wilms, or a combination thereof.

[0320] In another preferred example, the renal cancer includes renal pellucid cell adenocarcinoma.

[0321] In another preferred example, the aforementioned kidney cancer includes kidney cancer Wilms.

[0322] In another preferred example, the cancer cells of the kidney cancer include kidney cancer Wilms cells.

[0323] In another preferred example, the cancer cells of the kidney cancer include one or more of G-401 cells and 786-O cells.

[0324] In another preferred example, the pancreatic cancer includes pancreatic ductal adenocarcinoma.

[0325] In another preferred example, the cancer cells of the pancreatic cancer include CFPAC-1 cells.

[0326] In another preferred example, the leukemia is selected from T lymphocytic leukemia, myeloid leukemia, or a combination thereof.

[0327] In another preferred example, the T lymphocytic leukemia includes acute T lymphocytic leukemia.

[0328] In another preferred example, the myeloid leukemia includes M4-grade AML acute myeloid leukemia.

[0329] In another preferred example, the myeloid leukemia includes FAB M4 class AML acute myeloid leukemia.

[0330] In another preferred example, the expression includes protein expression and / or mRNA expression.

[0331] In another preferred example, the levels include protein levels and / or mRNA levels.

[0332] In another preferred example, the composition or formulation is a drug composition or a drug formulation.

[0333] In another preferred example, the composition or formulation further comprises a pharmaceutically acceptable carrier.

[0334] In another preferred example, the expression is mRNA expression or protein expression.

[0335] In another preferred example, the composition or formulation may be in the form of a solid, liquid, or semi-solid.

[0336] In another preferred example, the type of composition or formulation is an oral preparation, a topical preparation, or an injectable preparation.

[0337] In another preferred example, the injectable preparation is an intravenous injection preparation.

[0338] In another preferred example, the type of composition or formulation is a tablet, injection, infusion, ointment, gel, solution, pill, or coating.

[0339] A second aspect of the present invention provides a marker for determining whether the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is suitable for the prevention and / or treatment of tumors in tumor patients, the marker comprising a membrane permeable transition pore of a glomeruloblast, peptidyl prolyl isomerase F, the NNMT gene, DNA methyltransferase, UHRF1, methylation of a nucleotide site of the NNMT gene and / or methylation of a DNA CpG site in the NNMT gene region.

[0340] In another preferred example, the marker comprises the expression level or activity of the membrane permeable transition pore of the granule, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region.

[0341] In another preferred example, if, in tumor cells of a tumor patient, there is low expression, absence, low activation or inactivation of the membrane permeable transition pores of the glomeruli, low expression, absence, low activation or inactivation of peptidyl prolyl isomerase F, low expression or absence of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide sites of the NNMT gene, and / or high methylation of the DNA CpG sites in the NNMT gene region, then the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0342] In another preferred example, if tumor cells of a tumor patient exhibit high expression or activation of membrane permeable transition pores in the glomeruli, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of the NNMT gene, and / or low methylation of DNA CpG sites in the NNMT gene region, then the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound becomes unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0343] In another preferred example, the statement that the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound is suitable for the prevention and / or treatment of tumors in tumor patients means that the tumor cells of such tumor patients are sensitive to the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound.

[0344] In another preferred example, the statement that the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound is unsuitable for the prevention and / or treatment of tumors in tumor patients means that the tumor cells of such tumor patients are insensitive to the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound.

[0345] In another preferred example, a tumor in which the membrane permeable transition pores of the granules are low in expression, absent, low in activity, or inactive is the tumor described in the first aspect of the present invention.

[0346] In another preferred example, the tumors in which peptidylprolyl isomerase F is low-expression, absent-expression, low-activation, or inactivated are the tumors described in the first aspect of the present invention.

[0347] In another preferred example, the tumor in which the NNMT gene is low-expressing or not expressed is the tumor described in the first aspect of the present invention.

[0348] In another preferred example, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0349] In another preferred example, the tumor exhibiting high expression of DNA methyltransferase (e.g., DNMT1) is the tumor described in the first aspect of the present invention.

[0350] In another preferred example, the tumor exhibiting high UHRF1 expression is the tumor described in the first aspect of the present invention.

[0351] In another preferred example, the tumor characterized by hypermethylation of nucleotide sites in the NNMT gene is the tumor described in the first aspect of the present invention.

[0352] In another preferred example, the tumor characterized by hypermethylation of the DNA CpG site in the NNMT gene region is the tumor described in the first aspect of the present invention.

[0353] In another preferred example, the tumor having high expression or high activity of the membrane permeable transition pores of the glomeruli refers to a tumor in which the ratio (H1 / H0) between the expression level or activity level H1 of the membrane permeable transition pores of glomeruli in a certain cell (e.g., tumor cell) and the expression level or activity level H0 of the membrane permeable transition pores of glomeruli in a similar cell or normal cell (e.g., malignant bladder tissue cell) is >1.0, preferably ≥1.2 or ≥1.5, and then more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, a tumor in the range of 2-50.

[0354] In another preferred example, the tumors exhibiting high expression or high activity of peptidylprolyl isomerase F refer to tumors where the ratio (P1 / P0) between the expression level or activity P1 of peptidylprolyl isomerase F in certain cells (e.g., tumor cells) and the expression level or activity P0 of peptidylprolyl isomerase F in similar cells or normal cells (e.g., malignant bladder tissue cells) is >1.0, preferably ≥1.2 or ≥1.5, and then more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, tumors between 2 and 50.

[0355] In another preferred example, the tumor exhibiting high expression of the NNMT gene refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or normal cell is >1.0, preferably ≥1.2 or ≥1.5, and more preferably ≥2, ≥3, ≥5, ≥8, ≥10, ≥15, ≥20, ≥30 or ≥50, for example, a tumor between 2 and 50.

[0356] In another preferred example, the tumors with low expression of DNA methyltransferases refer to tumors in which the ratio (A1 / A0) of the expression level of DNA methyltransferase in tumor cells A1 to the expression level of DNA methyltransferase in similar cells or normal cells is <1.0, preferably ≤0.7, and more preferably ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0357] In another preferred example, the tumors with low DNMT1 expression refer to tumors in which the ratio (B1 / B0) of the expression level of DNMT1 in tumor cells B1 to the expression level of DNMT1 in like cells or normal cells B0 is <1.0, preferably ≤0.7, and more preferably ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0358] In another preferred example, the tumors with low DNMT3a expression refer to tumors in which the ratio (C1 / C0) of the expression level of DNMT3a in tumor cells C1 to the expression level of DNA methyltransferase in like cells or normal cells C0 is <1.0, preferably ≤0.7, and more preferably ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0359] In another preferred example, the tumors with low DNMT3b expression refer to tumors in which the ratio (D1 / D0) of the expression level of DNMT3b in tumor cells D1 to the expression level of DNA methyltransferase in like cells or normal cells D0 is <1.0, preferably ≤0.7, and more preferably ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0360] In another preferred example, the tumors with low UHRF1 expression refer to tumors in which the ratio (F1 / F0) of the amount of UHRF1 expressed in tumor cells F1 to the amount of UHRF1 expressed in like cells or normal cells F0 is <1.0, preferably ≤0.7, and more preferably ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0361] In another preferred example, the tumor having hypomethylation of the nucleotide site of the NNMT gene refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or normal cell (e.g., a malignant bladder tissue cell) is <1.0, preferably ≤0.7, and more preferably ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0362] In another preferred example, the tumor having hypomethylation of the DNA CpG site in the NNMT gene region refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site in the NMT gene region of a certain cell (e.g., tumor cell) and the methylation level W0 of the DNA CpG site in the NMT gene region of the same cell or a normal cell (e.g., malignant bladder tissue cell) is <1.0, preferably ≤0.7, and more preferably ≤0.6, ≤0.5, ≤0.4, ≤0.3, ≤0.2, ≤0.1, ≤0.05, ≤0.01, ≤0.005, ≤0.001, ≤0.0001, ≤0.00001, ≤0.000001, or ≤0.0000001.

[0363] A third aspect of the present invention provides a detection reagent kit. The detection reagent kit is (i) The present invention provides a detection reagent used to detect the expression level or activity of membrane permeable transition pores in granules, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of the NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region.

[0364] In another preferred example, the detection sample in the detection reagent kit contains tumor cells.

[0365] In another preferred example, the levels include protein levels and / or mRNA levels.

[0366] In another preferred example, the expression includes mRNA and / or protein expression.

[0367] A fourth aspect of the present invention provides the use of a detection reagent kit described in a third aspect of the present invention for manufacturing an associated diagnostic kit. The associated diagnostic kit is used to determine whether the compound of formula I described in a first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is suitable for the prevention and / or treatment of tumors in tumor patients.

[0368] In another preferred example, the associated detection reagent kit further comprises instructions or a label.

[0369] In another preferred example, the instruction manual or label may include: The present invention describes how, in tumor cells of a tumor patient, if the membrane permeable transition pores of the glomeruli are low in expression, not expressed, low in activity, or inactivated, if peptidyl prolyl isomerase F is low in expression, not expressed, low in activity, or inactivated, if the NNMT gene is low in expression or not expressed, if DNA methyltransferase is high in expression, if UHRF1 is high in expression, if the nucleotide sites of the NNMT gene are high in methylation, and / or if the DNA CpG sites of the NNMT gene region are high in methylation, then the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0370] In another preferred example, the instruction manual or label may include: The present invention describes how, in tumor cells of a tumor patient, if there is high expression or high activation of the membrane permeable transition pores of the glomeruli, high expression or high activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of the nucleotide site of the NNMT gene, and / or low methylation of the DNA CpG site of the NNMT gene region, then the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound becomes unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0371] In another preferred example, the statement that the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is suitable for the prevention and / or treatment of tumors in the patient with the tumor, has the meaning described in the second aspect of the present invention.

[0372] In another preferred example, the statement that the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is unsuitable for the prevention and / or treatment of the tumor in the patient with the tumor, has the meaning described in the second aspect of the present invention.

[0373] A fifth aspect of the present invention provides a medical kit.

[0374] The aforementioned medical kit is (i) A detection reagent used to detect the expression level or activity of membrane permeable transition pores in granules, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of the NNMT gene and / or the methylation level of DNA CpG sites in the NNMT gene region, (ii) The present invention comprises the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0375] In another preferred example, the expression level or activity of membrane permeable transition pores in tumor cells, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of the NNMT gene and / or the methylation level of DNA CpG sites in the NNMT gene region means the expression level or activity of membrane permeable transition pores in tumor cells, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of the NNMT gene and / or the methylation level of DNA CpG sites in the NNMT gene region.

[0376] In another preferred example, the sample for detection includes a tumor.

[0377] In another preferred example, the medical kit further comprises instructions or labels.

[0378] In another preferred example, the instruction manual or label may include: The present invention describes how, in tumor cells of a tumor patient, if the membrane permeable transition pores of the glomeruli are low in expression, not expressed, low in activity, or inactivated, if peptidyl prolyl isomerase F is low in expression, not expressed, low in activity, or inactivated, if the NNMT gene is low in expression or not expressed, if DNA methyltransferase is high in expression, if UHRF1 is high in expression, if the nucleotide sites of the NNMT gene are high in methylation, and / or if the DNA CpG sites of the NNMT gene region are high in methylation, then the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0379] In another preferred example, the instruction manual or label may include: The present invention describes how, in tumor cells of a tumor patient, if there is high expression or high activation of the membrane permeable transition pores of the glomeruli, high expression or high activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of the nucleotide site of the NNMT gene, and / or low methylation of the DNA CpG site of the NNMT gene region, then the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound becomes unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0380] A sixth aspect of the present invention provides a method for preventing and / or treating a tumor by administering the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, to a target for treatment.

[0381] In another preferred example, the tumor is the tumor described in the first aspect of the present invention.

[0382] In another preferred example, the subjects of treatment are humans and non-human mammals (e.g., rodents, rabbits, monkeys, livestock, dogs, cats).

[0383] In another preferred example, the method is: First, the tumor to be treated is subjected to low expression, non-expression, low activation, or inactivation of the membrane permeable transition pores of the glomeruli, low expression, non-expression, low activation, or inactivation of peptidyl prolyl isomerase F, low expression or non-expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide sites of the NNMT gene, and / or high methylation of the DNA CpG sites in the NNMT gene region. The present invention then provides the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, to perform prevention and / or treatment.

[0384] In another preferred example, the method is: First, the target tumor will have low expression, non-expression, low activation, or inactivation of the membrane permeable transition pores of the glomeruli, low expression, non-expression, low activation, or inactivation of peptidyl prolyl isomerase F, low expression or non-expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide sites of the NNMT gene, and / or high methylation of the DNA CpG sites in the NNMT gene region. This will be achieved by using inhibitors of the membrane permeable transition pores of the glomeruli, inhibitors of peptidyl prolyl isomerase F, inhibitors of the NNMT gene, promoters of DNA methyltransferase, promoters of UHRF1, promoters of methylation of the nucleotide sites of the NNMT gene, and / or DNA in the NNMT gene region. The present invention includes administering a CpG site methylation promoter to the target subject, followed by administering the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, to perform prevention and / or treatment.

[0385] In another preferred example, the above description of an inhibitor of membrane permeable transition pores in granules, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of nucleotide methylation of the NNMT gene, and / or an accelerator of methylation of the DNA CpG site in the NNMT gene region has the meaning described in the first aspect of the present invention.

[0386] A seventh aspect of the present invention provides an apparatus or system.

[0387] The aforementioned device or system is (i) A detection module used to detect the expression level or activity of membrane permeable transition pores in granules, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of the NNMT gene and / or the methylation level of DNA CpG sites in the NNMT gene region, (ii) It includes an output module.

[0388] The output module is Information that in tumor cells of a tumor patient, if the membrane permeable transition pores of the glomeruli are low in expression, not expressed, low in activity or inactivated, peptidyl prolyl isomerase F is low in expression, not expressed, low in activity or inactivated, the NNMT gene is low in expression or not expressed, DNA methyltransferase is high in expression, UHRF1 is high in expression, the nucleotide sites of the NNMT gene are hypermethylated, and / or the DNA CpG sites of the NNMT gene region are hypermethylated, then the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes suitable for the prevention and / or treatment of tumors in the tumor patient, and / or The present invention outputs information indicating that in tumor cells of a tumor patient, if there is high expression or high activation of the membrane permeable transition pores of the glomeruli, high expression or high activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of the nucleotide site of the NNMT gene, and / or low methylation of the DNA CpG site of the NNMT gene region, then the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound becomes unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0389] In another preferred example, the apparatus includes a gene detector or a protein detector.

[0390] In another preferred example, the apparatus or system further comprises a sample supply module.

[0391] In another preferred example, the sample supply module is used to supply tumor cell extracts.

[0392] In another preferred example, the apparatus or system further comprises a data processing module.

[0393] In another preferred example, the data processing module processes the expression level or activity of membrane permeable transition pores in granules, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites in the NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region to obtain their numerical ranges.

[0394] An eighth aspect of the present invention provides the use of an inhibitor of granular membrane permeability transition pores, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of nucleotide methylation of the NNMT gene, and / or an accelerator of methylation of the DNA CpG site of the NNMT gene region, for the production of a composition or formulation used to enhance the antitumor effect of an antitumor drug.

[0395] In another preferred example, the inhibitor of the membrane permeable transition pores of the glomeruli includes an inhibitor that can cause the membrane permeable transition pores of the glomeruli in the tumor to be less expressed, not expressed, less activated, or inactivated.

[0396] In another preferred example, the inhibitor of peptidylprolyl isomerase F includes inhibitors that cause tumor peptidylprolyl isomerase F to be low-expressed, non-expressed, low-activated, or inactivated.

[0397] In another preferred example, the inhibitor of the NNMT gene includes an inhibitor that can cause the NNMT gene in the tumor to be low-expressed or not expressed at all.

[0398] In another preferred example, the DNA methyltransferase promoter includes a promoter that can enable high expression of tumor DNA methyltransferase.

[0399] In another preferred example, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0400] In another preferred example, the DNA methyltransferase enhancer includes a DNMT1 enhancer.

[0401] In another preferred example, the DNMT1 promoter includes a promoter that can increase the expression of DNMT1 in the tumor.

[0402] In another preferred example, the DNA methyltransferase enhancer includes a DNMT3a enhancer.

[0403] In another preferred example, the DNMT3a promoter includes a promoter that can increase the expression of DNMT3a in tumors.

[0404] In another preferred example, the DNA methyltransferase enhancer includes a DNMT3b enhancer.

[0405] In another preferred example, the DNMT3b promoter includes a promoter that can increase the expression of DNMT3b in the tumor.

[0406] In another preferred example, the UHRF1 promoter includes a promoter that can increase the expression of UHRF1 in the tumor.

[0407] In another preferred example, the methylation promoter of the nucleotide site of the NNMT gene includes a promoter that can hypermethylate the nucleotide site of the tumor's NNMT gene.

[0408] In another preferred example, the methylation promoter of DNA CpG sites in the NNMT gene region includes a promoter that can hypermethylate DNA CpG sites in the NNMT gene region of a tumor.

[0409] In another preferred example, the inhibitor includes a specific inhibitor.

[0410] In another preferred example, the accelerator includes a specific accelerator.

[0411] In another preferred example, the antitumor drug comprises the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0412] In another preferred example, the tumor is the tumor described in the first aspect of the present invention.

[0413] In another preferred example, the inhibitor of the membrane permeable transition pore of the granules is selected from Cyclosporin A, CyP-D protein inhibitors, peroxide scavengers, or a combination thereof.

[0414] In another preferred example, the inhibitor of peptidyl prolyl isomerase F includes shRNA.

[0415] In another preferred example, the nucleotide sequence of shRNA is GTTCTTCATCTGCACCATAAA.

[0416] In another preferred example, the composition or formulation is a drug composition or a drug formulation.

[0417] In another preferred example, the composition or formulation further comprises a pharmaceutically acceptable carrier.

[0418] In another preferred example, the composition or formulation may be in the form of a solid, liquid, or semi-solid.

[0419] In another preferred example, the type of composition or formulation is an oral preparation, a topical preparation, or an injectable preparation.

[0420] In another preferred example, the injectable preparation is an intravenous injection preparation.

[0421] In another preferred example, the type of composition or formulation is a tablet, injection, infusion, ointment, gel, solution, pill, or coating.

[0422] A ninth aspect of the present invention provides a composition of an active ingredient comprising the following components. (1) The first active ingredient, which includes an antitumor drug, and (2) A second active ingredient comprising an inhibitor of the membrane permeable transition pore of the granules, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of methylation of nucleotide sites of the NNMT gene, and / or an accelerator of methylation of DNA CpG sites in the NNMT gene region.

[0423] In another preferred example, the antitumor drug comprises the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0424] In another preferred example, the above description of an inhibitor of membrane permeable transition pores in granules, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of nucleotide methylation of the NNMT gene, and / or an accelerator of methylation of the DNA CpG site in the NNMT gene region has the meaning described in the eighth aspect of the present invention.

[0425] In another preferred example, the molar ratio between the first active ingredient and the second active ingredient is 0.01-600:1, preferably 0.05-500:1, and then more preferably 0.1-400:1, 0.2-200:1, 0.5-100:1, 0.5-80:1, or 1-50:1.

[0426] In another preferred example, the aforementioned combination of active ingredients contains at least one independent active ingredient.

[0427] In another preferred example, the above combination of active ingredients has a first active ingredient and a second active ingredient that are independent of each other.

[0428] A tenth aspect of the present invention provides a composition comprising the following components. (1) The first active ingredient, which includes an antitumor drug, and (2) A second active ingredient comprising an inhibitor of the membrane permeable transition pore of the granules, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of methylation of nucleotide sites of the NNMT gene, and / or an accelerator of methylation of DNA CpG sites in the NNMT gene region.

[0429] In another preferred example, the antitumor drug comprises the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0430] In another preferred example, the above description of an inhibitor of membrane permeable transition pores in granules, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of nucleotide methylation of the NNMT gene, and / or an accelerator of methylation of the DNA CpG site in the NNMT gene region has the meaning described in the eighth aspect of the present invention.

[0431] In another preferred example, the composition is a drug composition.

[0432] In another preferred example, the drug composition further comprises a pharmaceutically acceptable carrier.

[0433] In another preferred example, the composition or formulation may be in the form of a solid, liquid, or semi-solid.

[0434] In another preferred example, the type of composition or formulation is an oral preparation, a topical preparation, or an injectable preparation.

[0435] In another preferred example, the type of composition or formulation is a tablet, injection, infusion, ointment, gel, solution, pill, or coating.

[0436] In another preferred example, the content of the first active ingredient relative to the total weight of the active ingredients in the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt%, or 20-99 wt%.

[0437] In another preferred example, the content of the second active ingredient relative to the total weight of the active ingredients in the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt%, or 20-99 wt%.

[0438] An eleventh aspect of the present invention provides a medical kit comprising the following formulations. (A) A first formulation having a first active ingredient containing an antitumor drug, and (B) A second formulation having a second active ingredient comprising an inhibitor of the membrane permeable transition pore of the granules, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of methylation of nucleotide sites of the NNMT gene, and / or an accelerator of methylation of DNA CpG sites in the NNMT gene region.

[0439] In another preferred example, the antitumor drug comprises the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0440] In another preferred example, the above description of an inhibitor of membrane permeable transition pores in granules, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of nucleotide methylation of the NNMT gene, and / or an accelerator of methylation of the DNA CpG site in the NNMT gene region has the meaning described in the eighth aspect of the present invention.

[0441] In another preferred example, the medical kit further comprises an instruction manual.

[0442] In another preferred example, the first and second formulations are independent of each other.

[0443] In another preferred example, the first and second formulations are combined.

[0444] In another preferred example, the instruction manual may state that the first formulation and the second formulation are used in combination to enhance the antitumor activity of the antitumor drug.

[0445] In another preferred example, the combination method involves first administering a second formulation containing a second active ingredient, and then administering a first formulation containing a first active ingredient.

[0446] A twelfth aspect of the present invention provides a method for suppressing tumor cells. The method involves suppressing tumor cells by contacting them with the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0447] In another preferred example, the method is performed outside of body or is an in vitro method.

[0448] In another preferred example, the method described above is an in vitro, non-therapeutic, and non-diagnostic method.

[0449] In another preferred example, the contact is performed in vitro.

[0450] In another preferred example, the tumor is the tumor described in the first aspect of the present invention.

[0451] In another preferred example, the method is: First, the tumor cells are subjected to low expression, non-expression, low activation, or inactivation of the membrane permeable transition pores of the glomeruli, low expression, non-expression, low activation, or inactivation of peptidyl prolyl isomerase F, low expression or non-expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide sites of the NNMT gene, and / or high methylation of the DNA CpG sites in the NNMT gene region. The present invention then involves contacting the tumor cells with the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof to suppress the tumor cells.

[0452] In another preferred example, the method is: First, tumor cells will experience low expression, non-expression, low activation, or inactivation of the membrane permeable transition pores of the glomeruli, low expression, non-expression, low activation, or inactivation of peptidyl prolyl isomerase F, low expression or non-expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of the nucleotide sites of the NNMT gene, and / or hypermethylation of the DNA CpG sites in the NNMT gene region. This is achieved by using inhibitors of the membrane permeable transition pores of the glomeruli, inhibitors of peptidyl prolyl isomerase F, inhibitors of the NNMT gene, promoters of DNA methyltransferase, promoters of UHRF1, promoters of methylation of the nucleotide sites of the NNMT gene, and / or DNA in the NNMT gene region. The present invention includes administering a CpG site methylation promoter to tumor cells, and then contacting the tumor cells with the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof to suppress the tumor cells.

[0453] In another preferred example, the above description of an inhibitor of membrane permeable transition pores in granules, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of nucleotide methylation of the NNMT gene, and / or an accelerator of methylation of the DNA CpG site in the NNMT gene region has the meaning described in the eighth aspect of the present invention.

[0454] A thirteenth aspect of the present invention provides the use of the medical kit described in the fifth aspect of the present invention for manufacturing a drug kit used for the prevention and / or treatment of tumors.

[0455] In another preferred example, the drug kit further comprises instructions or a label.

[0456] In another preferred example, the instruction manual or label may include: The present invention describes how, in tumor cells of a tumor patient, if the membrane permeable transition pores of the glomeruli are low in expression, not expressed, low in activity, or inactivated, if peptidyl prolyl isomerase F is low in expression, not expressed, low in activity, or inactivated, if the NNMT gene is low in expression or not expressed, if DNA methyltransferase is high in expression, if UHRF1 is high in expression, if the nucleotide sites of the NNMT gene are high in methylation, and / or if the DNA CpG sites of the NNMT gene region are high in methylation, then the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0457] In another preferred example, the instruction manual or label may include: The present invention describes how, in tumor cells of a tumor patient, if there is high expression or high activation of the membrane permeable transition pores of the glomeruli, high expression or high activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of the nucleotide site of the NNMT gene, and / or low methylation of the DNA CpG site of the NNMT gene region, then the compound of formula I described in the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound becomes unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0458] Within the scope of the present invention, the above technical features of the present invention may be combined with the following specific technical features to constitute a new or preferred technical solution. [Brief explanation of the drawing]

[0459]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

[0460] As a result of long-term and in-depth research, the inventors have unexpectedly discovered for the first time a compound that exhibits remarkably superior therapeutic effects against tumor cells with low, absent, low, or inactivated membrane permeable transition pores of the glomeruli; low, absent, low, or inactivated peptidyl prolyl isomerase F; low or absent NNMT gene expression; high expression of DNA methyltransferase; high expression of UHRF1; hypermethylation of nucleotide sites of the NNMT gene; and / or hypermethylation of DNA CpG sites in the NNMT gene region. The expression level or activity of membrane permeable transition pores of the glomeruli, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of the NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. The inventors of this invention have achieved this invention based on this.

[0461] term Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art.

[0462] As used herein, the terms “include,” “equip,” and “have” may be used interchangeably and have not only closed definitions but also semi-closed and open definitions. In other words, the terms “constitute by…” and “basically constitute by….”

[0463] As used herein, the terms “anticancer drugs” and “antinomatous drugs” may be used interchangeably.

[0464] As used herein, the terms “cancer” and “tumor” may be used interchangeably.

[0465] As used herein, the term “a certain cell” refers to a single cell (e.g., a single tumor cell) or a group of cells containing several similar cells (e.g., a tumor tissue).

[0466] As used herein, "the compound of the present invention is suitable for tumor patients" means that the tumor of the tumor patient is sensitive to the compound of the present invention, etc.

[0467] As used herein, "the compounds of the present invention are unsuitable for cancer patients" means, for example, that the tumors of the cancer patients are insensitive to the compounds of the present invention.

[0468] As used herein, "IC50" and "IC 50 The term "50% inhibiting concentration" can be used interchangeably and refers to the concentration of the inhibitor at which a 50% inhibitory effect is achieved.

[0469] As used herein, the term "P / S" refers to the addition of penicillin and streptomycin to the relevant culture medium.

[0470] As used herein, "expression level or activity of membrane permeable transition pores of granules, expression level or activity of peptidylprolyl isomerase F, expression level of the NNMT gene, expression level of DNA methyltransferase, expression level of UHRF1, methylation level of nucleotide sites of the NNMT gene and / or methylation level of DNA CpG sites in the NNMT gene region" means one or more of the expression level or activity of membrane permeable transition pores of granules, expression level or activity of peptidylprolyl isomerase F, expression level of the NNMT gene, expression level of DNA methyltransferase, expression level of UHRF1, methylation level of nucleotide sites of the NNMT gene and methylation level of DNA CpG sites in the NNMT gene region.

[0471] As used herein, "low expression, non-expression, low activation or inactivation of membrane permeable transition pores of the granules, low expression, non-expression, low activation or inactivation of peptidylprolyl isomerase F, low expression or non-expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region" refers to one or more of the following: low expression, non-expression, low activation or inactivation of membrane permeable transition pores of the granules, low expression, non-expression, low activation or inactivation of peptidylprolyl isomerase F, low expression or non-expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region.

[0472] As used herein, "high expression or activation of membrane permeable transition pores of the granules, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites of the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region" refers to one or more of the following: high expression or activation of membrane permeable transition pores of the granules, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites of the NNMT gene, and hypomethylation of DNA CpG sites in the NNMT gene region.

[0473] As used herein, the term “mitochondria permeability transition pore” is abbreviated as mPTP (mitochondria permeability transition pore).

[0474] As used herein, the term "peptidyl-prolyl isomerase F" is abbreviated as PPIF (Peptidyl-prolyl cis-trans isomerase F).

[0475] As used herein, the phrases "there is hypermethylation of the DNA CpG site," "the DNA CpG site becomes hypermethylated," and "the DNA CpG site is hypermethylated" may be interchangeable.

[0476] As used herein, the phrases "there is hypomethylation of the DNA CpG site," "the DNA CpG site becomes hypomethylated," and "the DNA CpG site is hypomethylated" may be used interchangeably.

[0477] As used herein, the phrases "there is hypermethylation of the nucleotide site," "the nucleotide site becomes hypermethylated," and "the nucleotide site is hypermethylated" may be interchangeable.

[0478] As used herein, the phrases "there is hypomethylation of the nucleotide site," "the nucleotide site becomes hypomethylated," and "the nucleotide site is hypomethylated" may be used interchangeably.

[0479] As used herein, the terms "methylation of DNA CpG sites," "methylation of CpG nucleotides," and "methylation of CpGs" may be used interchangeably.

[0480] As used herein, the term “a certain cell” refers to a single cell (e.g., a single tumor cell) or a group of cells containing several similar cells (e.g., a tumor tissue).

[0481] As used herein, "the compound of the present invention is suitable for tumor patients" means that the tumor of the tumor patient is sensitive to the compound of the present invention, etc.

[0482] As used herein, "the compounds of the present invention are unsuitable for cancer patients" means, for example, that the tumors of the cancer patients are insensitive to the compounds of the present invention.

[0483] As used herein, the English name for the term "NNMT" is Nicotinamide N-Methyltransferase.

[0484] As used herein, the term "bp" refers to a base pair.

[0485] As used herein, the term "SST" refers to a transcription start site.

[0486] As used herein, the term "Chr11" refers to human chromosome 11 as defined according to the human genome version GCF_000001405.25(GRCh37.p13).

[0487] As used herein, the term “human chromosome 11” refers to human chromosome 11 as defined according to the human genome version GCF_000001405.25(GRCh37.p13).

[0488] As used herein, the terms “before the transcription initiation site” and “after the transcription initiation site” do not include the transcription initiation site itself.

[0489] As used herein, “position 114165695 of human chromosome 11” refers to the nucleotide located at position 114165695 of human chromosome 11; “position 114165730 of human chromosome 11” refers to the nucleotide located at position 114165730 of human chromosome 11; “position 114165769 of human chromosome 11” refers to the nucleotide located at position 114165769 of human chromosome 11; “position 114165804 of human chromosome 11” '114165804' refers to the nucleotide at position 114165938 on human chromosome 11; 'position 114165938' refers to the nucleotide at position 114165938 on human chromosome 11; 'position 114166050' refers to the nucleotide at position 114166050 on human chromosome 11; 'position 114166066' refers to the nucleotide at position 114166066 on human chromosome 11.

[0490] As used herein, gene expression includes protein expression and / or mRNA expression of the gene.

[0491] As used herein, the term "DNMT3a" may be used interchangeably with "DNMT3A" to refer to DNA methyltransferase 3a.

[0492] As used herein, the term "DNMT3b" may be used interchangeably with "DNMT3B" to refer to DNA methyltransferase 3b.

[0493] As used herein, the term "DNMT1" refers to DNA methyltransferase 1.

[0494] As used herein, the term "UHRF1" refers to ubiquitin-like tau protein 1, which includes the PHD and ring finger domains.

[0495] As used herein, the term "MS-ESI" refers to electrospray ionization mass spectrometry.

[0496] As used in this specification, 1 The term "H NMR" refers to nuclear magnetic resonance hydrogen spectroscopy.

[0497] Those skilled in the art should understand that chemically stable compounds can be produced by selecting substituents and substitution configurations on the compounds of the present invention, and that such compounds can be synthesized by existing art and the methods described below. It should be understood that substitution by one or more substituents allows these substituents to be located on the same carbon or on different carbons, as long as a stable structure is formed.

[0498] As used herein, the terms “substitution” or “substituted” refer to a process in which a hydrogen atom on an atomic group is replaced by a non-hydrogen group, provided that the bond valences are satisfied and the substitution results in a chemically stable compound, i.e., a compound that does not undergo spontaneous transformations such as cyclization or elimination.

[0499] As used herein, “deuteration” refers to the substitution of one or more hydrogen atoms in a compound or group of atoms by a deuterium atom. Deuteration may be 1-position deuteration, 2-position deuteration, 3-position deuteration, or total deuteration.

[0500] As used herein, the term “solvate” refers to a specific ratio of a complex formed by the coordination of a compound with a solvent molecule.

[0501] As used herein, "R1", "R1", and "R 1 " and " have the same meaning and can be used interchangeably, and also have the same meaning as other similar definitions.

[0502] As used in this specification, [ka] The symbol represents the bonding site of an atomic group.

[0503] As used herein, the term “alkyl group” refers to a linear (i.e., unbranched) or branched saturated hydrocarbon group containing only carbon and hydrogen atoms, or a group of atoms formed by combining a linear group with a branched chain. A group specified by the number of carbon atoms before the alkyl group (e.g., C1-C6 alkyl group) refers to an alkyl group having that number of carbon atoms (e.g., 1 to 6), for example, a C1-C4 alkyl group refers to an alkyl group containing 1 to 4 carbon atoms. Representative examples of these alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, s-butyl, t-butyl, or similar groups of atoms.

[0504] As used herein, the term “alkenyl group” refers to a hydrocarbyl group formed by removing one hydrogen atom connected to a double bond from a linear or branched molecule having one or more double bonds. Alkenyl groups specified by the number of carbon atoms (e.g., C2-C6 alkenyl group) refer to alkenyl groups having that number of carbon atoms (e.g., 1 to 6), for example, a C2-C4 alkenyl group refers to an alkenyl group containing 2 to 4 carbon atoms. Representative examples of these alkenyl groups include, but are not limited to, vinyl groups (CH2=CH-), butenyl groups (C(CH3)2=CH-), or similar atomic groups.

[0505] As used herein, the term “halogen atom” refers to a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0506] As used herein, the term "halogenation" refers to substitution with a halogen atom.

[0507] As used herein, the term “alkyl halide” refers to an atomic group formed by substituting one or more (preferably one, two, three, or four) hydrogen atoms of an alkyl group with a halogen atom. The alkyl group and halogen atom are as defined above. A halogen alkyl group specified by the number of carbon atoms (e.g., C1-C8 alkyl halide) refers to a halogen alkyl group having that number of carbon atoms (e.g., one to eight), for example, a C1-C6 alkyl halide refers to an alkyl halide containing one to six carbon atoms. Representative examples of these alkyl halides include, but are not limited to, -CF3, -CHF2, isopropyl monofluoride, butyl difluoride, or similar atomic groups.

[0508] As used herein, the term “cycloalkyl group” refers to a saturated or partially saturated monocyclic, dicyclic, or polycyclic (fused, bridging, or spirocyclic) cyclic group. When “cycloalkyl group” is preceded by a carbon number (e.g., C3-C12), the cycloalkyl group refers to one having that number of carbon atoms (e.g., 3 to 12). For example, the term “C3-C8 cycloalkyl group” refers to a saturated or partially saturated monocycloalkyl group or dicycloalkyl group having 3 to 8 carbon atoms, including cyclopropyl, cyclobutyl, cycloamyl, cycloheptyl, or similar groups. “Spirocycloalkyl group” refers to a dicyclic or polycyclic group sharing one carbon atom (called a spiro atom) between monocyclic rings, such a group may contain one or more double bonds, but neither ring has a complete conjugated π-electron system. A "condensed cycloalkyl group" refers to a bicyclic or polycyclic group of all carbon atoms in which each ring in the system shares a pair of adjacent carbon atoms with other rings in the system, where one or more rings may contain one or more double bonds, but none of the rings have a complete conjugated π-electron system. A "bridged cycloalkyl group" refers to a polycyclic group of all carbon atoms in which any two rings share two carbon atoms that are not directly linked, where such a group may contain one or more double bonds, but none of the rings have a complete conjugated π-electron system. Representative examples of these cycloalkyl groups are as follows: [ka]

[0509] As used herein, the term “cyclohalogenated alkyl group” refers to an atomic group formed by substituting one or more (preferably one, two, three, or four) hydrogen atoms of a cycloalkyl group with a halogen atom. The cycloalkyl group and halogen atom are as defined above. A cycloalkyl group specified by the number of carbon atoms (e.g., C3-C8 cyclohalogenated alkyl group) refers to a cycloalkyl group having that number (e.g., three to eight) of carbon atoms on the ring, for example, C3-C8 cyclohalogenated alkyl group refers to a cyclohalogenated alkyl group containing three to eight carbon atoms on the ring. Representative examples of these cyclohalogenated alkyl groups include, but are not limited to, monofluorocyclopropyl group, monochlorinated cyclobutyl group, monofluorocycloamyl group, difluorocycloheptyl group, or similar atomic groups.

[0510] As used herein, the term “alkoxyl group” refers to the RO- group, where R is an alkyl group. Alkyl groups are defined above. Alkoxyl groups specified by the number of carbon atoms (e.g., C1-C8 alkoxyl group) refer to groups in which the alkyl group has that number of carbon atoms (e.g., 1 to 8). Representative examples of these alkoxyl groups include, but are not limited to, methoxy, ethoxyl, N-propoxy, isopropoxy, t-butoxy, or similar groups.

[0511] As used herein, the term “alkylthiol group” refers to the RS- group, where R is an alkyl group, as defined above. Alkyl groups specified by the number of carbon atoms (e.g., C1-C8 alkoxyl group) refer to alkyl groups in which the alkyl group has that number of carbon atoms (e.g., 1 to 8). Representative examples of these alkylthiol groups include, but are not limited to, methylthio, ethylthio, N-propylthio, isopropylthio, t-butylthio, or similar groups.

[0512] As used herein, the term “halogenated alkoxyl group” refers to a halogenated alkyl group-O-. The halogenated alkyl group is as defined above. For example, a C1-C6 halogenated alkoxyl group refers to a halogenated alkoxyl group having one to six carbon atoms. Representative examples of these halogenated alkoxyl groups include, but are not limited to, monofluorinated methoxy groups, monofluorinated ethoxyl groups, difluorinated butoxy groups, or similar atomic groups.

[0513] As used herein, the term “alkyl thiol halogenated group” refers to an alkyl halogenated group-S-. The alkyl halogenated group is as defined above. For example, a C1-C6 alkyl thiol halogenated group refers to an alkyl thiol halogenated group having one to six carbon atoms. Representative examples of these alkyl thiol halogenated groups include, but are not limited to, methyl thio monofluoride, ethyl thio monofluoride, butyl thio difluoride, or similar groups.

[0514] As used herein, the term “cycloalkoxyl group” refers to the RO- group, where R is a cycloalkyl group. A cycloalkyl group is defined above. A cycloalkoxyl group specified by the number of carbon atoms (e.g., C3-C8 cycloalkoxyl group) refers to a cycloalkoxyl group in which the cycloalkyl group has that number of carbon atoms (e.g., 3 to 8). Representative examples of these cycloalkoxyl groups include, but are not limited to, cyclopropoxy groups, cyclobutoxy groups, or similar groups.

[0515] As used herein, the term “cycloalkylthiol group” refers to the RS- group, where R is a cycloalkyl group. A cycloalkyl group is defined above. A cycloalkylthiol group specified by the number of carbon atoms (e.g., C3-C8 cycloalkoxyl group) refers to a cycloalkylthiol group in which the cycloalkyl group has that number of carbon atoms (e.g., 3 to 8). Representative examples of these cycloalkylthiol groups include, but are not limited to, cyclopropylthio, cyclobutylthiol, or similar groups.

[0516] As used herein, the term “halogenated cycloalkoxyl group” refers to an atomic group formed by the substitution of one or more (preferably one, two, three, or four) hydrogen atoms of a cycloalkoxyl group with a halogen atom. The cycloalkoxyl group and halogen atom are as defined above. A term preceded by the number of carbon atoms in the haliden cycloalkoxyl group (e.g., C3-C8 haliden cycloalkoxyl group) refers to a haliden cycloalkoxyl group having that number (e.g., three to eight) of carbon atoms on the ring, for example, a C3-C8 haliden cycloalkoxyl group refers to a haliden cycloalkoxyl group containing three to eight carbon atoms on the ring. Representative examples of these haliden cycloalkoxyl groups include, but are not limited to, monofluorocyclopropyl-O-, monochlorinated cyclobutyl-O-, monofluorocycloamyl-O-, difluorocycloheptyl-O-, or similar atomic groups.

[0517] As used herein, the term “halogenated cycloalkylthiol group” refers to an atomic group formed by the substitution of one or more (preferably one, two, three, or four) hydrogen atoms of a cycloalkylthiol group with a halogen atom. The cycloalkylthiol group and halogen atom are as defined above. A carbon number preceding the haliden cycloalkylthiol group (e.g., C3-C8 haliden cycloalkoxyl group) refers to a haliden cycloalkylthiol group having that number (e.g., three to eight) of carbon atoms on the ring, for example, a C3-C8 haliden cycloalkylthiol group refers to a haliden cycloalkylthiol group containing three to eight carbon atoms on the ring. Representative examples of these haliden cycloalkylthiol groups include, but are not limited to, monofluorocyclopropyl-S, monochlorinated cyclobutyl-S, monofluorocycloamyl-S, difluorocycloheptyl-S, or similar atomic groups.

[0518] As used herein, the term “heterocycloalkyl ring” refers to a fully saturated or partially unsaturated ring (including, but not limited to, 3- to 7-membered monocyclic rings, 7- to 11-membered dicyclic rings, or 8- to 16-membered tricyclic rings) where at least one heteroatom is present in a ring having at least one carbon atom. The number preceding the heterocyclic ring refers to the number of ring atoms in the heterocycloalkyl ring. For example, a 3- to 16-membered heterocyclic ring refers to a heterocyclic ring having 3 to 16 ring atoms. Each heterocyclic ring having heteroatoms may contain one or more (e.g., one, two, three, or four) heteroatoms, each independently selected from a nitrogen atom, an oxygen atom, or a sulfur atom, where the nitrogen atom or sulfur atom may be oxidized, and the nitrogen atom may also be quaternized. Representative examples of these monocyclic heterocycloalkyl rings include, but are not limited to, azetidinyl rings, oxetane rings, tetrahydrofuranyl rings, piperidine rings, and piperazine rings. Polycyclic heterocycloalkyl rings include piperazine rings having spiro rings, fused rings, and bridging rings. Here, the heterocycles of the relevant spiro ring, fused ring, and bridging ring are optionally linked to other rings by single bonds or further fused to other cycloalkyl rings and heterocycles via any two or more atoms on the ring.

[0519] As used herein, the term “heterocycloalkyl group” refers to a fully saturated or partially unsaturated cyclic group of atoms (including, but not limited to, series such as 3- to 7-membered monocyclics, 7- to 11-membered dicyclics, and 8- to 16-membered tricyclics), where at least one heteroatom is present in a ring having at least one carbon atom. The number preceding a heterocycloalkyl group refers to the number of ring atoms in the heterocycloalkyl group. For example, a 3- to 16-membered heterocycloalkyl group refers to a heterocycloalkyl group having 3 to 16 ring atoms. Each heterocyclic ring having heteroatoms may contain one or more (e.g., one, two, three, or four) heteroatoms, each independently selected from nitrogen, oxygen, or sulfur atoms, where the nitrogen or sulfur atom may be oxidized, and the nitrogen atom may also be quaternized. Representative examples of these monocyclic heterocycloalkyl groups include, but are not limited to, azetidinyl, oxetane, tetrahydrofuranyl, piperidine, and piperazine groups. Polycyclic heterocycloalkyl groups include heterocyclic groups of spiro rings, fused rings, and bridging rings. The relevant spiro rings, fused rings, and bridging ring heterocycloalkyl groups can optionally be linked to other atomic groups by single bonds, or further fused with other cycloalkyl rings and heterocycles via any two or more atoms on the ring.

[0520] As used herein, the term "aryl group" refers to a monocyclic or fused polycyclic (a ring sharing a pair of adjacent carbon atoms) group of all carbon atoms having a conjugated π-electron system, and is an atomic group of aromatic cyclic hydrocarbon compounds. When an aryl group is specified by the number of carbon atoms (e.g., C6-C12 aryl group), it refers to an aryl group having that number of carbon atoms (e.g., 6 to 12) on the ring. Representative examples of these aryl groups include phenyl groups and naphthoyl groups.

[0521] As used herein, the term “heteroaryl group” refers to an aromatic heterocyclic group having one or more (preferably one, two, three, or four) heteroatoms. The group may be monocyclic (monocyclic formula) or fused or covalently polycyclic (bicyclic, tricyclic, or polycyclic), and each heterocyclic ring containing heteroatoms may have one or more (e.g., one, two, three, or four) heteroatoms independently selected from oxygen, sulfur, and nitrogen atoms. The number preceding a heteroaryl group refers to the number of ring atoms in the heteroaryl group. For example, a 5-12 membered heteroaryl group refers to a heteroaryl group having 5 to 12 ring atoms. Representative examples of these heteroaryl groups include, but are not limited to, pyrrolyl, pyrazole, imidazole, thiazole, furan, pyridine, and pyrimidine groups.

[0522] As used herein, the term “carboxyl group” refers to an atomic group of -COOH or an atomic group of -alkyl-COOH, where alkyl is as defined above. For example, “C2-C4 carboxyl group” refers to an atomic group of -C1-C3 alkyl-COOH. Representative examples of these carboxyl groups include, but are not limited to, -COOH, -CH2COOH, or similar atomic groups.

[0523] As used herein, the term “ester group” refers to an RC(O)-O- or -C(O)-OR group, where the alkyl group (R) is as defined above. For example, “C2-C4 ester group” refers to a -C1-C3 alkyl-C(O)-O- or -C(O)-O-C1-C3 alkyl group. Representative examples of these ester groups include, but are not limited to, CH3C(O)O-, C2H5C(O)O-, (CH3)2CHC(O)O-, -C(O)OCH3, -C(O)OC2H5, or similar groups.

[0524] As used herein, the term “acylamino group” refers to an RC(O)-N- or -C(O)-NR group, where the alkyl group (R) is as defined above. For example, “C2-C4 acylamino group” refers to a -C1-C3 alkyl-C(O)-N- or -C(O)-N-C1-C3 alkyl group. Representative examples of these acylamino groups include, but are not limited to, CH3C(O)-N-, C2H5C(O)-N-, (CH3)2CHC(O)-N-, -C(O)-N-CH3, -C(O)-N-C2H5, or similar groups.

[0525] As used herein, the term "acyl group" means [ka] Here, R represents an alkyl group, and the alkyl group is as defined above. An acyl group limited by the number of carbon atoms before it (for example, a C2-C6 acyl group) refers to an acyl group having that number (for example, 2 to 6) carbon atoms on the ring, for example, a C2-C4 acyl group refers to an atomic group having the structure C1-C3 alkyl-C(O)-. Representative examples of these acyl groups include, but are not limited to, CH3C(O)-, C2H5C(O)-, or similar atomic groups.

[0526] As used herein, "-C(O)-" and [ka]

[0527] As used herein, "amino group" represents -NH2 either alone or as part of another substituent.

[0528] As used herein, “nitro group” represents --NO2, either alone or as part of another substituent.

[0529] As used herein, "cyanide group" represents -CN either alone or as part of another substituent.

[0530] As used herein, the term "hydroxyl group" represents -OH either alone or as part of another substituent.

[0531] As used herein, the "mercapto group" represents -SH either alone or as part of another substituent.

[0532] In this specification, all substituents mean unsubstituted unless explicitly stated as “substituted.” The term “substituted” means that a substituent substitutes one or more hydrogen atoms on a group of atoms. The substituents are those described above or the substituents appearing in each example. Preferably, the “substituted” means that one or more (preferably one, two, three, four, five, six, seven or eight) hydrogen atoms on a ring or group of atoms are replaced by a C1-C8 alkyl group, a C3-C12 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro group, -CN, hi This refers to substitution with substituents selected from droxyl groups, mercapto groups, amino groups, C1-C4 carboxyl groups, C2-C4 ester groups, C2-C4 acylamino groups, C1-C8 alkoxyl groups, C1-C8 alkylthiol groups, C1-C8 halogenated alkoxyl groups, C1-C8 halogenated alkylthiol groups, C6-C12 aryl groups, C6-C12 aryl group-O-, 5-10 member heteroaryl groups, 5-10 member heteroaryl group-O-, and 5-10 member heterocycloalkyl groups.

[0533] In the present invention, “prevention” refers to a method of preventing the onset of a disease and / or its associated symptoms, or protecting a subject from becoming ill. As used herein, “prevention” also refers to delaying the onset of a disease and / or its associated symptoms, and reducing the risk of becoming ill in a subject.

[0534] The “treatment” described in this invention means delaying the progression of a disease, bringing it to an end, or eliminating the disease, but does not require 100% suppression, elimination, or reversal. In some embodiments, the associated disease (e.g., tumor) and its complications are reduced, suppressed, and / or reversed by at least about 10%, 30%, 50%, 80%, 90%, or 100%, compared to the level observed in the absence of the compound of the invention.

[0535] compound As used herein, “compound of the present invention,” “the aforementioned compound of the present invention,” “compound of formula I of the present invention,” or “compound of formula I” may be used interchangeably and refer to a compound having the chemical structure of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof. This term should be understood to also include mixtures of the above components. [ka]

[0536] Specifically, the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, are described in the first aspect of the present invention.

[0537] In the present invention, the compound of formula I may be a racemate, an R-type structure, or an S-type structure. Knowledge of the racemate, R-type structure, or S-type structure of the compound of the present invention, and methods for determining them, is widely known to those skilled in the art. For example, the racemate, R-type structure, or S-type structure is as follows: [ka]

[0538] There are countless other examples of racemic, R-type, or S-type structures of other compounds.

[0539] Typically, the compound of formula I of the present invention is a specific compound prepared in the examples of the present invention.

[0540] The compound of formula I of the present invention may be prepared by organic synthesis methods known in the art.

[0541] In this invention, the term "pharmaceutically acceptable salt" refers to a salt that is suitable for use as a drug when formed with the compound of the present invention and an acid or base. Pharmacochemically acceptable salts include inorganic salts and organic salts. A preferred type of salt is a salt formed with the compound of the present invention and an acid, and suitable acids for the formation of such salts include, but are not limited to, inorganic acids such as hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, trifluoroacetic acid, trifluoroformic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, and benzenesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. A preferred type of salt is a metal salt formed by the compound of the present invention and a base. Suitable bases for forming such salts include, but are not limited to, inorganic bases such as sodium hydroxide, potassium hydroxide, sodium carbonate, sodium bicarbonate, and sodium phosphate, and organic bases such as ammonia, triethylamine, and diethylamine.

[0542] The present invention may allow for the conventional conversion of the compounds of formula I to their pharmaceutically acceptable salts. For example, by adding a solution of a suitable acid to a solution of the compound and removing the solvent after all salting, a suitable salt of the compound of the present invention can be obtained.

[0543] Preferably, the compounds of the present invention are those prepared in the embodiments of the present invention.

[0544] Membrane-permeable transition pores of nodules In this invention, the English term for "membrane permeability transition pore of granules" is "mitochondria permeability transition pore," which is abbreviated as mPTP.

[0545] The remarkably superior therapeutic effect of the compound of the present invention against tumors exhibiting low expression, absence, low activity, or inactivity of the membrane permeable transition pores of glomeruli means that tumors exhibiting low expression, absence, low activity, or inactivity of the membrane permeable transition pores of glomeruli are sensitive to the compound of the present invention.

[0546] Preferably, tumors having low expression, absence, low activity, or inactivity of the membrane permeable transition pores of the glomeruli are as described in the first aspect of the present invention.

[0547] In this invention, the expression level or activity of the membrane permeable transition pores of the granules is measured using conventional methods. For example, the activity of mPTP is measured, or the expression level of mPTP is measured at the protein level or mRNA level.

[0548] Peptidylprolyl isomerase F In this invention, the English name for the term "peptidyl-prolyl isomerase F" is Peptidyl-prolyl cis-trans isomerase F, and is abbreviated as PPIF.

[0549] The remarkably superior therapeutic effect of the compound of the present invention against tumors with low expression, absence, low activity, or inactivity of peptidylprolyl isomerase F means that tumors with low expression, absence, low activity, or inactivity of peptidylprolyl isomerase F are sensitive to the compound of the present invention.

[0550] Preferably, tumors having low expression, no expression, low activity, or inactivity of peptidyl prolyl isomerase F are as described in the first aspect of the present invention.

[0551] In this invention, the expression level or activity of peptidyl prolyl isomerase F is measured using conventional methods. For example, the activity of PPIF is measured, or the expression level of PPIF is measured at the protein level or mRNA level.

[0552] NNMT gene In this invention, the English name for NNMT is Nicotinamide N-Methyltransferase. Different databases have different identification numbers for the NNMT gene. For example, HGNC:7861; Entrez Gene:4837; Ensembl:ENSG00000166741; OMIM:600008; UniProtKB:P40261.

[0553] According to the human genome version GCF_000001405.25 (GRCh37.p13), the NNMT gene region is a DNA sequence located on human chromosome 11 from position 114,128,528 bp to position 114,184,258 bp, with a total length of 55,731 bp. This region includes the NNMT gene promoter region, the NNMT gene exon region, and the NNMT gene intron region, and the NNMT gene transcription start site is at position 114,166,535 bp.

[0554] The NNMT gene promoter region is the nucleotide sequence from position 114,164,535 to position 114,167,034 on human chromosome 11, that is, the sequence from 2000 bp before the transcription start site of the NNMT gene (bold portion) to the transcription start site itself and 499 bp after it (underlined portion). The NNMT gene promoter region has a total length of 2500 bp, and its nucleotide sequence is shown in SEQ ID NO:1 below.

[0555] SEQ ID NO: 1: GAGGAGGTGCTTGCCAGACACTGGGTCATGGCAGTGGTCGGTGAAGCTGCAGTTGCCTAGGGCAGGGATGGAGAGAGAGTCTGGGCATGAGGAGAGGGTCTCGGGATGTTTGGCTGGACTAGATTTTACAGAAAGCCTTATCCAGGCTTTTAAAATTACTCTTTCCAGACTTCATCTGAGACTCCTTCTTCAGCCAACATTCCTTAGCCCTGAATACATTTCCTATCCTCATCTTTCCCTTCTTTTTTTTCCTTTCTTTTACATGTTTAAATTTAAACCATTCTTCGTGACCCCTTTTCTTGGGAGATTCATGGCAAGAACGAGAAGAATGATGGTGCTTGTTAGGGGATGTCCTGTCTCTCTGAACTTTGGGGTCCTATGCATTAAATAATTTTCCTGACGAGCTCAAGTGCTCCCTCTGGTCTACAATCCCTGGCGGCTGGCCTTCATCCCTTGGGCAAGCATTGCATACAGCTCATGGCCCTCCCTCTACCATACCC .

[0556] In this invention, the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene corresponds to positions 951-2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0557] In this invention, the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene corresponds to positions 951-1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0558] In this invention, the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene corresponds to positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0559] In the present invention, the nucleotide sequence locations of SEQ ID NO:1 corresponding to positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 of human chromosome 11 are shown in Table 1. [Table 1]

[0560] DNA methylation DNA methylation is a form of chemical modification of DNA that alters gene expression without changing the DNA sequence. Numerous studies suggest that DNA methylation can regulate gene expression by altering chromatin structure, DNA morphology, DNA stability, and the way DNA interacts with proteins.

[0561] DNA methylation is one of the first and most deeply studied regulatory mechanisms of epigenetic inheritance. Broadly speaking, DNA methylation refers to a chemical modification process in which a specific base on a DNA sequence acquires a methyl group via covalent bonding with S-adenosylmethionine as the methyl donor, catalyzed by DNA methyltransferase 1. This DNA methylation modification can occur at sites such as the C-5 position of cytosine, the N-6 position of adenine, and the N-7 position of guanine. In general research, DNA methylation primarily refers to the process of methylation of the carbon atom at position 5 of cytosine in CpG dinucleotides. The product is called 5-methylcytosine (5-mC) and is the main form of DNA methylation in eukaryotes such as plants and animals. DNA methylation, as a relatively stable modification state, can be inherited by the DNA replication process under the action of DNA methyltransferases, thus playing an important role in regulating epigenetic inheritance.

[0562] DNA methylation reactions can be divided into two types. Type 1 involves the methylation of DNA that has two unmethylated strands and is called de novo methylation. Type 2 involves the methylation of one unmethylated strand of a double-stranded DNA that has one methylated strand and is called maintenance methylation.

[0563] Typically, DNA methylation is the methylation of DNA CpG sites. CpG dinucleotides are distributed very unevenly throughout the human genome, and some segments of the genome retain CpGs at a higher-than-normal rate. These are mainly CpG-enriched regions (also called CpG islands) located in gene promoters and exon regions, and some regions that enrich CpG dinucleotides, with more than 60% of gene promoters containing CpG islands. Here, CpG is an abbreviation for cytosine (C)-phosphate (p)-guanine (G).

[0564] Intracellular gene expression is regulated in various ways by signaling pathways, transcription factors, and epigenetic modifications. DNA methylation is an important method by which epigenetic modifications regulate gene expression. The level of DNA methylation in a specific gene region always affects the expression level of that gene. Compared to regulation of gene expression by signaling pathways and transcription factors, DNA methylation by epigenetic modifications has a more stable effect on gene expression and is less susceptible to the extracellular environment. Because DNA methylation can be easily detected with existing technologies, it is an ideal biomarker.

[0565] tumor According to research on the present invention, the compounds of the present invention can be used for the prevention and / or treatment of tumors.

[0566] In this invention, the terms "tumor," "cancer," "cancer," and "tumor" may be used interchangeably.

[0567] In a preferred example of the present invention, the term "tumor" as described in the present invention includes tumors having low expression, absence, low activity, or inactivity of the membrane permeable transition pores of the granules. A typical example of a tumor having low expression, absence, low activity, or inactivity of the membrane permeable transition pores of the granules as described in the present invention is as described in the first aspect of the present invention.

[0568] In a preferred example of the present invention, the term "tumor" as used in the present invention includes tumors with low expression, absence, low activity, or inactivity of peptidylprolyl isomerase F. A typical example of a tumor with low expression, absence, low activity, or inactivity of peptidylprolyl isomerase F as used in the present invention is as described in the first aspect of the present invention.

[0569] In a preferred example of the present invention, the term "tumor" as used in the present invention includes tumors with low or no expression of the NNMT gene. A typical example of a tumor with low or no expression of the NNMT gene as used in the present invention is as described in the first aspect of the present invention.

[0570] In a preferred example of the present invention, the term "tumor" as used in the present invention includes tumors exhibiting high expression of DNA methyltransferases. A typical example of a tumor exhibiting high expression of DNA methyltransferases as used in the present invention is as described in the first aspect of the present invention.

[0571] The DNA methyltransferase described in the present invention includes, but is not limited to, DNMT1, DNMT3a, DNMT3b, or a combination thereof. Preferably, the DNA methyltransferase described in the present invention includes DNMT1.

[0572] In a preferred example of the present invention, the term "tumor" as used in the present invention includes tumors exhibiting high expression of DNMT1. A typical example of a tumor exhibiting high expression of DNMT1 as used in the present invention is as described in the first aspect of the present invention.

[0573] In a preferred example of the present invention, the term "tumor" as used in the present invention includes tumors exhibiting high expression of DNMT3a. A typical example of a tumor exhibiting high expression of DNMT3a as used in the present invention is as described in the first aspect of the present invention.

[0574] In a preferred example of the present invention, the term "tumor" as used in the present invention includes tumors exhibiting high expression of DNMT3b. A typical example of a tumor exhibiting high expression of DNMT3b as used in the present invention is as described in the first aspect of the present invention.

[0575] In a preferred example of the present invention, the “tumor” described in the present invention includes tumors that exhibit high expression of UHRF1 (a ubiquitin-like tau protein 1 containing the PHD and ring finger domains). As a representative example, a tumor exhibiting high expression of UHRF1 described in the present invention is as described in the first aspect of the present invention.

[0576] In a preferred example of the present invention, the term "tumor" as described in the present invention includes tumors with hypermethylation of nucleotide sites of the NNMT gene. As a representative example, a tumor with hypermethylation of nucleotide sites of the NNMT gene as described in the present invention is as described in the first aspect of the present invention.

[0577] In a preferred example of the present invention, the term "tumor" as described in the present invention includes tumors with hypermethylation of DNA CpG sites in the NNMT gene region. As a representative example, a tumor with hypermethylation of DNA CpG sites in the NNMT gene region as described in the present invention is as described in the first aspect of the present invention.

[0578] Typically, the tumor described in the present invention is as described in the first aspect of the present invention.

[0579] In this invention, Table 2 shows representative tumor types corresponding to various tumor cell lines. [Table 2]

[0580] Antitumor drugs In the present invention, the antitumor drug may be the compound of formula I of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0581] use The present invention provides the use of the compounds of the present invention in the prevention and / or treatment of tumors.

[0582] In particular, the compounds of the present invention exhibit remarkably excellent therapeutic effects against tumors with low expression, absence, low activity, or inactivity of the membrane permeable transition pores of granules, tumors with low expression, absence, low activity, or inactivity of peptidyl prolyl isomerase F, tumors with low expression or absence of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. Specifically, tumors with low expression, absence, low activity, or inactivity of the membrane permeable transition pores of granules, tumors with low expression, absence, low activity, or inactivity of peptidyl prolyl isomerase F, tumors with low expression or absence of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region are sensitive to the compounds of the present invention. The expression level or activity of membrane-permeable transition pores in granules, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites in the NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region serve as markers for determining whether the compounds of the present invention are suitable for the treatment of tumor cell refinement. These markers can effectively identify tumor patients who are sensitive to the compounds of the present invention, improve the therapeutic effect, and potentially avoid administering the compounds to tumor patients who are not sensitive to them, thereby enabling the treatment of tumor refinement.

[0583] The present invention provides a method for preventing and / or treating tumors, which involves administering the compound of the present invention to a target for treatment.

[0584] The compounds of the present invention exhibit remarkably excellent therapeutic effects against tumors with low, absent, low activity, or inactivity of membrane permeable transition pores of granules, tumors with low, absent, low activity, or inactivity of peptidyl prolyl isomerase F, tumors with low or absent expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. In the process of tumor prevention and / or treatment, first, an inhibitor of the membrane permeable transition pores of the glomeruli, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of methylation of nucleotide sites of the NNMT gene, and / or an accelerator of methylation of DNA CpG sites of the NNMT gene region are administered to the target tumor so that the target tumor exhibits low expression, non-expression, low activation, or inactivation of the membrane permeable transition pores of the glomeruli, low expression, non-expression, low activation, or inactivation of peptidyl prolyl isomerase F, low expression or non-expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of the NNMT gene, and / or high methylation of DNA CpG sites of the NNMT gene region. Then, the compound of the present invention is administered to the target tumor to prevent and / or treat the tumor. Therefore, we have developed a compound that can significantly enhance the antitumor effect when used in combination with an inhibitor of the membrane permeable transition pore of the glomeruli, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of methylation of nucleotide sites of the NNMT gene, and / or an accelerator of methylation of DNA CpG sites in the NNMT gene region. The compound of the present invention can be used in combination with an inhibitor of the membrane permeable transition pore of the glomeruli, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of methylation of nucleotide sites of the NNMT gene, and / or an accelerator of methylation of DNA CpG sites in the NNMT gene region, thereby significantly enhancing the therapeutic effect of the compound of the present invention on tumors.

[0585] In another preferred example, the subjects of treatment are humans and non-human mammals (e.g., rodents, rabbits, monkeys, livestock, dogs, cats).

[0586] In the present invention, the method for reducing the expression, activity, etc., of the membrane permeable transition pores of the glomeruli in a tumor, such as low expression, non-expression, low activation, or inactivation; low expression, non-expression, low activation, or inactivation of peptidyl prolyl isomerase F; low expression or non-expression of the NNMT gene; high expression of DNA methyltransferase; high expression of UHRF1; high methylation of nucleotide sites of the NNMT gene; and / or high methylation of DNA CpG sites in the NNMT gene region is not particularly limited. For example, the expression or activity of the membrane permeable transition pores of the glomeruli and / or peptidyl prolyl isomerase F in a tumor can be specifically suppressed by means such as gene insertion, gene knockout, or gene repression (e.g., introducing shRNA).

[0587] In another preferred example, the inhibitor of peptidyl prolyl isomerase F includes shRNA.

[0588] In another preferred example, the nucleotide sequence of shRNA is GTTCTTCATCTGCACCATAAA.

[0589] marker The present invention provides a marker for determining whether the compound of the present invention is suitable for the prevention and / or treatment of tumors in tumor patients, the marker comprising the expression level or activity of the membrane permeable transition pore of the glomeruli, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region.

[0590] In one implementation state, the expression level or activity of the membrane permeable transition pores of the granules, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. The method is as follows: In tumor cells of a tumor patient, if the membrane permeable transition pores of the glomeruli are low in expression, not expressed, low in activity or inactivated, peptidyl prolyl isomerase F is low in expression, not expressed, low in activity or inactivated, the NNMT gene is low in expression or not expressed, DNA methyltransferase is high in expression, UHRF1 is high in expression, the nucleotide sites of the NNMT gene are hypermethylated, and / or the DNA CpG sites of the NNMT gene region are hypermethylated, then the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for the prevention and / or treatment of tumors in the tumor patient, and / or In tumor cells of a tumor patient, if there is high expression or high activation of the membrane permeable transition pores of the glomeruli, high expression or high activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of the nucleotide site of the NNMT gene, and / or low methylation of the DNA CpG site of the NNMT gene region, the compound of formula I described in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for the prevention and / or treatment of tumor in the tumor patient, including, but not limited to, this.

[0591] Specifically, tumors in which the membrane permeable transition pores of the granules are low in expression, not expressed, low in activity, or inactive, and / or in which peptidyl prolyl isomerase F is low in expression, not expressed, low in activity, or inactive, are as described in the first aspect of the present invention.

[0592] Specifically, tumors exhibiting low or no expression of the NNMT gene, high expression of DNA methyltransferase (e.g., DNMT1), high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region are as described in the first aspect of the present invention.

[0593] Specifically, the tumors exhibiting high expression or high activation of membrane permeable transition pores of granules, and / or high expression or high activation of peptidyl prolyl isomerase F, are as described in the second aspect of the present invention.

[0594] In one preferred embodiment of the present invention, the tumor exhibiting high expression of the NNMT gene, low expression of DNA methyltransferase (e.g., DNMT1), low expression of UHRF1, hypomethylation of nucleotide sites of the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region are as described in a second aspect of the present invention.

[0595] The present invention further provides the use of the marker (or its expression level) or detection reagent, which are used to manufacture a detection reagent kit. The detection reagent kit is used to determine whether the compound of the present invention is suitable for the prevention and / or treatment of tumors in tumor patients.

[0596] Composition or formulation, combination of active ingredients and medical kit, and method of administration. Preferably, the composition described in the present invention is a drug composition, and the composition described in the present invention may contain a pharmaceutically acceptable carrier.

[0597] As used herein, “pharmaceutically acceptable carrier” means one or more compatible solids, semi-solids, liquids, and gel fillers that are suitable for human or animal use, are of sufficient purity, and have sufficiently low toxicity. “Compatibility” means that each component in the drug composition can be mixed with the active ingredient of the drug, and that when they are combined, the efficacy of the drug is not significantly reduced.

[0598] In the present invention, pharmaceutically acceptable carriers are not particularly limited and should be understood to be selected from materials commonly used in the art, prepared by conventional methods, or purchased from the market. Some representative examples of pharmaceutically acceptable carriers include cellulose and its derivatives (e.g., methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, carboxymethylcellulose sodium, etc.), gelatin, talc, solid lubricants (e.g., stearic acid and magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyhydric alcohols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., tween), wetting agents (e.g., sodium lauryl sulfate), buffers, chelating agents, thickeners, pH adjusters, penetration enhancers, colorants, fragrances, stabilizers, antioxidants, preservatives, bacteriostatic agents, and heat-free raw water.

[0599] In a preferred example of the present invention, the composition or formulation may be in the form of a solid, liquid, or semi-solid.

[0600] In a preferred example of the present invention, the type of composition or formulation is an oral preparation, a topical preparation, or an injectable preparation.

[0601] Typical examples of such compositions or formulations include tablets, injections, intravenous solutions, ointments, gels, solutions, pills, or coatings.

[0602] The drug formulation should be consistent with the method of administration. The drug of the present invention is also used in conjunction with other synergistic therapeutic agents (before, during, or after use). When using a drug composition or formulation, a safe and effective amount of the drug is administered to the target of treatment (e.g., human or non-human mammal). The aforementioned safe and effective amount is usually at least 10 μg / kg of body weight, most often less than 8 mg / kg of body weight, preferably 10 μg / kg to 1 mg / kg of body weight. Of course, the specific dosage needs to be determined considering conditions such as the route of administration and the patient's health condition, but these conditions should be taken into consideration by a skilled physician.

[0603] The present invention has the following excellent technical effects, primarily.

[0604] The present invention has developed a compound that exhibits significantly superior refining therapeutic effects against tumors with low, absent, low activity, or inactivity of membrane permeable transition pores of granules, tumors with low, absent, low activity, or inactivity of peptidyl prolyl isomerase F, tumors with low or absent expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. Tumors exhibiting low, absent, low activity, or inactivity of the membrane permeable transition pores of granulosia, tumors exhibiting low, absent, low activity, or inactivity of peptidylprolyl isomerase F, tumors exhibiting low or absent expression of the NNMT gene, tumors exhibiting high expression of DNA methyltransferase, tumors exhibiting high expression of UHRF1, tumors exhibiting hypermethylation of nucleotide sites of the NNMT gene, and / or tumors exhibiting hypermethylation of DNA CpG sites in the NNMT gene region are highly sensitive to the compounds of the present invention. In other words, the compounds of the present invention exhibit significantly superior therapeutic effects against tumors exhibiting low, absent, low activity, or inactivity of the membrane permeable transition pores of granulosia, tumors exhibiting low, absent, low activity, or inactivity of peptidylprolyl isomerase F, tumors exhibiting low or absent expression of the NNMT gene, tumors exhibiting high expression of DNA methyltransferase, tumors exhibiting high expression of UHRF1, tumors exhibiting hypermethylation of nucleotide sites of the NNMT gene, and / or tumors exhibiting hypermethylation of DNA CpG sites in the NNMT gene region. Therefore, the compounds of the present invention may be used to refine tumors exhibiting low, absent, low activity, or inactivity of granular membrane permeable transition pores, low, absent, low activity, or inactivity of peptidyl prolyl isomerase F, low or absent expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, thereby improving the therapeutic effect and potentially avoiding the administration of the compounds of the present invention to tumor patients who are not sensitive to them.Therefore, the compounds of the present invention, which exhibit significantly superior refinement therapeutic effects against tumors with low, absent, low activity, or inactivity of the membrane permeable transition pores of the granules, low, absent, low activity, or inactivity of peptidyl prolyl isomerase F, low or absent expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, have advantages such as better preventive and therapeutic effects against tumors, lower drug dosages, and fewer side effects. In addition to improving the preventive and therapeutic effects of the compounds of the present invention against tumors, they reduce side effects and improve patient adherence to medication.

[0605] We will now further describe the present invention in combination with specific embodiments. The following specific embodiments provide detailed embodiments and specific operating procedures based on the present technical solution, but it should be understood that the scope of protection of the present invention is not limited to these embodiments. [Examples]

[0606] The English term for "membrane permeability transition pore of a nodule" is mitochondria permeability transition pore, abbreviated as mPTP.

[0607] The English name for the term "peptidyl-prolyl isomerase F" is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF.

[0608] DNMT3a refers to DNA methyltransferase 3a, whose English name is DNA methyltransferase 3a, and whose NCBI entrez gene:1788; Uniprotkb / Swiss-port: Q9Y6K1.

[0609] DNMT3b refers to DNA methyltransferase 3b, whose English name is NDNA methyltransferase 3b, and whose CBI entrez gene:1789; Uniprotkb / Swiss-port: Q9UBC3.

[0610] DNMT1 refers to DNA methyltransferase 1, whose English name is DNA methyltransferase 1, and whose NCBI entrez gene:1786; Uniprotkb / Swiss-port: P26358.

[0611] UHRF1 refers to ubiquitin-like tau protein 1, which includes PHD and ring finger domains, and its English name is NCBI entrez gene:29128; Uniprotkb / Swiss-port:Q96T88.

[0612] The English name for the NNMT gene is Nicotinamide N-Methyltransferase.

[0613] Example 1 Synthesis of compound AB31882 The chemical structure of compound AB31882 is as follows: [ka]

[0614] The synthesis method for compound AB31882 is as follows: [ka]

[0615] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and magnesium butenyl bromide (2.7 mL, 2.7 mmol, 5 eq, 1 M) was added dropwise at 0 °C under the protection of nitrogen gas. The reaction was carried out for 0.5 hours, and the thorough reaction was confirmed by LC-MS analysis. The mixture was then rapidly cooled with saturated ammonium chloride aqueous solution, the organic phase was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31882 from the crude product via thin-layer chromatography (DCM / MeOH = 30 / 1).

[0616] Compound AB31882: MS-ESI: Theoretical value [M+H] + :392.18, measured value:392.20. 1 H NMR(400 MHz, CDCl3)δ 7.14(s, 1H), 6.75-6.72(m, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.81(s, 1H), 5.76-5.67(m, 1H), 4.95-4.84(m, 2H), 4.76-4.73(m, 1H), 3.88(s, 3H), 3.85(s, 3H), 3.49-3.29(m, 2H), 2.93-2.80(m, 2H), 2.06-1.71(m, 4H).

[0617] Example 2 Synthesis of compound AB31883 The chemical structure of compound AB31883 is as follows: [ka]

[0618] The synthesis method for compound AB31883 is as follows: [ka]

[0619] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and magnesium ethyl bromide (2.7 mL, 2.7 mmol, 5 eq, 1 M) was added dropwise at 0 °C under the protection of nitrogen gas. The reaction was carried out for 0.5 hours, and the thorough reaction was confirmed by LC-MS analysis. The mixture was then rapidly cooled with saturated ammonium chloride aqueous solution, the organic phase was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31883 from the crude product via thin-layer chromatography (DCM / MeOH = 30 / 1).

[0620] Compound AB31883: MS-ESI: Theoretical value [M+H] + :366.17, measured value:366.10. 1 H NMR(400 MHz, CDCl3)δ 7.14(s, 1H), 6.76-6.71(m, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.78(s, 1H), 4.70-4.67(m, 1H), 3.88(s, 3H), 3.84(s, 3H), 3.46-3.44(m, 1H), 3.32-3.27(m, 1H), 2.93-2.79(m, 2H), 1.78-1.64(m, 2H), 0.82-0.78(m, 3H).

[0621] Example 3 Synthesis of compound AB31884 The chemical structure of compound AB31884 is as follows: [ka]

[0622] The synthesis method for compound AB31884 is as follows: [ka]

[0623] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and magnesium propylbromide (2.7 mL, 2.7 mmol, 5 eq, 1 M) was added dropwise at 0 °C under the protection of nitrogen gas. The reaction was carried out for 0.5 hours, and the thorough reaction was confirmed by LC-MS analysis. The mixture was then rapidly cooled with saturated ammonium chloride aqueous solution, the organic phase was extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31884 from the crude product via thin-layer chromatography (DCM / MeOH = 30 / 1).

[0624] Compound AB31884: MS-ESI: Theoretical value [M+H] + :380.18, measured value:380.10. 1 H NMR(400 MHz, CDCl3)δ 7.14(s, 1H), 6.76-6.73(m, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.80(s, 1H), 4.73-4.70(m, 1H), 3.88(s, 3H), 3.84(s, 3H), 3.47-3.20(m, 2H), 2.87-2.79(m, 2H), 1.73-1.59(m, 2H), 1.29-1.20(m, 2H), 0.81-0.78(m, 3H).

[0625] Example 4 Synthesis of compound AB31885 The chemical structure of compound AB31885 is as follows: [ka]

[0626] The synthesis method for compound AB31885 is as follows: [ka]

[0627] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and magnesium isopropylbromide (2.7 mL, 2.7 mmol, 5 eq, 1 M) was added dropwise at 0 °C under the protection of nitrogen gas. The reaction was carried out for 0.5 hours, and the thorough reaction was confirmed by LC-MS analysis. The mixture was then rapidly cooled with saturated ammonium chloride aqueous solution, the organic phase was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31885 from the crude product via thin-layer chromatography (DCM / MeOH = 30 / 1).

[0628] Compound AB31885: MS-ESI: Theoretical value [M+H]+: 380.18, Measured value: 380.20. 1 H NMR(400 MHz, CDCl3)δ 7.13(s, 1H), 6.78-6.71(m, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.77(s, 1H), 5.43-5.42(m, 1H), 3.87(s, 3H), 3.84(s, 3H), 3.51-3.45(m, 2H), 2.97-2.92(m, 1H), 2.81-2.74(m, 1H), 2.07-2.02(m, 1H), 0.90-0.86(m, 6H).

[0629] Example 5 Synthesis of compound AB31886 The chemical structure of compound AB31886 is as follows: [ka]

[0630] The synthesis method for compound AB31886 is as follows: [ka]

[0631] Compound 1 (1.0 g, 2.69 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (30 mL), and magnesium methylbromide (4.5 mL, 13.45 mmol, 5 eq, 3M) was added dropwise at 0 °C under the protection of nitrogen gas. The reaction was carried out for 0.5 hours, and the thorough reaction was completed by LC-MS analysis. The mixture was rapidly cooled with saturated ammonium chloride aqueous solution, the organic phase was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31886 from the crude product via flash chromatography (silica gel with 100-200 mesh size, DCM / MeOH = 100 / 1).

[0632] Compound AB31886: MS-ESI: Theoretical value [M+H] + :352.15, measured value:352.10. 1 H NMR(400 MHz, CDCl3)δ 7.15(s, 1H), 6.74(s, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.85(s, 1H), 4.87-4.83(m, 1H), 3.90(s, 3H), 3.84(s, 3H), 3.41-3.32(m, 2H), 2.94-2.77(m, 2H), 1.18(d, J= 8.0 Hz, 3H).

[0633] Example 6 Synthesis of compound AB31891 The chemical structure of compound AB31891 is as follows: [ka]

[0634] The synthesis method for compound AB31891 is as follows: [ka]

[0635] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and magnesium propenylbromide (2.7 mL, 2.7 mmol, 5 eq, 1 M) was added at 0 °C under the protection of nitrogen gas. The reaction was carried out for 0.5 hours, and the thorough reaction was confirmed by LC-MS analysis. The mixture was then rapidly cooled with saturated ammonium chloride aqueous solution, the organic phase was extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31891 from the crude product via thin-layer chromatography (DCM / MeOH = 50 / 1).

[0636] Compound AB31891: MS-ESI: Theoretical value [M+H] + : 378.17, measured value: 378.35. 1 H NMR(400 MHz, CDCl3)δ 7.11(s, 1H), 6.72-6.69(m, 2H), 6.56(s, 1H), 5.92(d, J= 8.0 Hz, 2H), 5.83-5.74(m, 2H), 4.88-4.80(m, 3H), 3.87(s, 3H), 3.82(s, 3H), 3.48-3.26(m, 2H), 2.84-2.77(m, 2H), 2.44-2.40(m, 3H).

[0637] Example 7 Synthesis of compound AB31893 The chemical structure of compound AB31893 is as follows: [ka]

[0638] The synthesis method for compound AB31893 is as follows: [ka]

[0639] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and magnesium cyclohexyl bromide (2.7 mL, 2.7 mmol, 5 eq, 1 M) was added at 0 °C under the protection of nitrogen gas. The reaction was carried out for 0.5 hours, and the thorough reaction was confirmed by LC-MS analysis. The mixture was rapidly cooled with saturated ammonium chloride aqueous solution, the organic phase was extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31893 from the crude product via thin-layer chromatography (DCM / MeOH = 50 / 1).

[0640] Compound AB31893: MS-ESI: Theoretical value [M+H] + : 420.21, Measured value: 420.20. 1 H NMR(400 MHz, DMSO-d6)δ 7.23(s, 1H), 6.82(d, J= 8.0 Hz, 1H), 6.76(s, 1H), 6.66(d, J= 8.0 Hz, 1H), 5.99(s, 2H), 5.85(s, 1H), 4.46-4.45(m, 1H), 3.75(d, J= 8.0 Hz, 6H), 3.41-3.38(m, 2H), 2.96-2.89(m, 1H), 2.68-2.64(m, 1H), 1.65-1.50(m, 7H), 1.11-1.03(m, 4H).

[0641] Example 8 Synthesis of compound AB31900 The chemical structure of compound AB31900 is as follows: [ka]

[0642] The synthesis method for compound AB31900 is as follows: [ka]

[0643] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and under the protection of nitrogen gas, magnesium cycloamyl bromide (2.7 mL, 2.7 mmol, 5 eq, 1 M) was added dropwise at 0 °C. The reaction was carried out for 0.5 hours, and the thorough reaction was confirmed by LC-MS analysis. The mixture was then rapidly cooled with saturated ammonium chloride aqueous solution, the organic phase was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31900 from the crude product via thin-layer chromatography (DCM / MeOH = 30 / 1).

[0644] Compound AB31900: MS-ESI: Theoretical value [M+H] + :406.20, Measured value:406.20. 1 H NMR(400 MHz, DMSO-d6)δ 7.20(s, 1H), 6.79(d, J= 8.0 Hz, 1H), 6.73(s, 1H), 6.64(d, J= 8.0 Hz, 1H), 5.96(s, 2H), 5.87(s, 1H), 4.51(d, J= 8.0 Hz, 1H), 3.72(s, 6H), 3.41-3.35(m, 2H), 2.86-2.63(m, 2H), 2.17-2.15(m, 1H), 1.55-1.15(m, 8H).

[0645] Example 9 Synthesis of compound AB35403 The chemical structure of compound AB35403 is as follows: [ka]

[0646] The synthesis method for compound AB35403 is as follows: [ka]

[0647] Compound 1 (500 mg, 1.34 mmol, 1 eq) was dissolved in dichloromethane (50 mL), cesium fluoride (204 mg, 1.34 mmol, 1 eq) and (trifluoromethoxy group) trimethylsilane (96 mg, 0.67 mmol, 2 eq) were added, and the reaction was carried out at 40 °C overnight under the protection of nitrogen gas. The complete reaction was achieved by LCMS inspection. The reaction product was diluted with water, the organic phase was extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and then centrifuged to remove the liquid. Compound AB35403 was obtained from the crude product via flash chromatography (dichloromethane).

[0648] Compound AB35403: MS-ESI: Theoretical value [M+H] + : 406.12, Measured value: 406.10. 1 H NMR (400 MHz, DMSO-d6) δ 7.26 (s, 1H), 7.03 (d, J = 8.0 Hz, 1H), 6.82 (s, 1H), 6.79 (s, 1H), 6.03 (s, 1H), 6.01 (s, 2H), 5.52 - 5.46 (m, 1H), 3.82 (d, J = 8.0 Hz, 6H), 3.58 - 3.55 (m, 2H), 2.89 - 2.71 (m, 2H).

[0649] Example 10 Synthesis of Compound AB31875 The chemical structural formula of Compound AB31875 is as follows.

Chemical formula

[0650] The synthesis method of Compound AB31875 is as follows.

Chemical formula

[0651] Compound 1 (336 mg, 1 mmol) is dissolved in n-butyl magnesium bromide (10 mL), stirred at 0°C for 10 minutes, and the reaction is thoroughly analyzed by LC-MS. The reaction product is rapidly cooled with water, dissolved in tetrahydrofuran, and filtered to obtain the mother liquor. The organic solvent is removed by vacuum distillation, and the compound AB31875 is obtained through the purification process.

[0652] Compound AB31875: MS-ESI: Theoretical value [M+H] + :394.48, measured value:394.20. 1 H NMR(400 MHz, dmso)δ 7.20(s, 1H), 6.78(s, 1H), 6.74(s, 1H), 6.64(s, 1H), 5.97(s, 2H), 5.82(s, 1H), 4.66 - 4.56(m, 1H), 3.73(s, 6H), 3.20 - 3.17(m, 2H), 2.92 - 2.64(m, 2H), 1.60 - 1.46(m, 1H), 1.13(s, 3H), 0.72(s, 3H).

[0653] Example 11 Synthesis of compound AB35435 The chemical structure of compound AB35435 is as follows: [ka]

[0654] The synthesis method for compound AB35435 is as follows: [ka]

[0655] Compound 1 (150 mg, 0.40 mmol, 1.0 eq) is dissolved in tetrahydrofuran (10 mL), and magnesium hexyl bromide (2 mL, 2.0 mmol, 5.0 eq, 1 M) is added at 0 °C. The reaction is carried out at room temperature for 0.5 hours. TLC analysis is performed, and thorough reaction is confirmed by LC-MS analysis. The mixture is rapidly cooled with saturated ammonium chloride aqueous solution, the organic phase is extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged. Compound AB35435 is obtained from the crude product by flash chromatography (DCM / MeOH = 50 / 1).

[0656] Compound AB35435: MS-ESI: Theoretical value [M+H]+: 422.23, Measured value: 422.40. 1 H NMR(400 MHz, DMSO-d6)δ 7.23(s, 1H), 6.82(d, J= 8.0 Hz, 1H), 6.77(s, 1H), 6.66(d, J= 8.0 Hz, 1H), 6.00(d, J= 4.0 Hz, 2H), 5.85(s, 1H), 4.66-4.63(m, 1H), 3.76(s, 6H), 3.31-3.26(m, 2H), 2.85-2.67(m, 2H), 1.62-1.49(m, 2H), 1.20-1.13(m, 8H), 0.80-0.77(m, 3H).

[0657] Example 12 Synthesis of compound AB31714 The chemical structure of compound AB31714 is as follows: [ka]

[0658] The synthesis method for compound AB31714 is as follows: [ka]

[0659] Compound 1 (2 g, 5.95 mmol) is dissolved in chloroform (60 mL), aqueous ammonia (24 mL) is added, and the mixture is stirred overnight at room temperature. When a new compound is detected by thin-layer chromatography, the product is extracted and dehydrated by centrifugation, the solution is concentrated under reduced pressure, and the organic solvent is removed to obtain the solid compound AB31714.

[0660] Compound AB31714: MS-ESI: Theoretical value [M+H]+: 454.03, Measured value: 454.10. 1 H NMR(400 MHz, DMSO-d6)δ 7.29(s, 1H), 7.06(d, J = 8.5 Hz, 1H), 6.86(d, J = 8.5 Hz, 1H), 6.76(s, 1H), 6.27(s, 1H), 5.97(d, J = 5.9 Hz, 2H), 5.61(s, 1H), 3.78(t, J = 6.8 Hz, 7H), 3.61(t, J = 9.0 Hz, 1H), 3.26 - 3.13(m, 2H), 2.68(d, J = 16.0 Hz, 1H).

[0661] Example 13 Synthesis of compound AB31713 The chemical structure of compound AB31713 is as follows: [ka]

[0662] Compound AB31713 is available for purchase on the market.

[0663] Example 14 We will investigate the activity of membrane-permeable transition pores in the related cells of the glomeruli. Experimental background: The mitochondrial permeability transition pore (abbreviated as mPTP) is a non-specific pathway on the inner mitochondrial membrane that allows small molecules with a molecular weight of less than 1.5 KD to pass freely. Its activity is affected by peroxides (such as H2O2), pH, and calcium ions inside the mitochondria. Some mitochondrial permeability transition pores are activated, while some are inactivated. For cells in which the mitochondrial permeability transition pore is activated, when peroxides (such as H2O2) are added, the activity of the mitochondrial permeability transition pore increases and the mitochondrial membrane potential decreases. In contrast, for cells in which the mitochondrial permeability transition pore is inactivated, when peroxides (such as H2O2) are added, it has no obvious effect on the activity of the mitochondrial permeability transition pore and does not cause an obvious change in the mitochondrial membrane potential. Based on this principle, we can determine whether mPTP is activated in specific cells by measuring the change in the mitochondrial membrane potential difference under the stimulation of peroxides.

[0664] Experimental methods and results: Daoy cells (human medulloblastoma, ATCC number HTB-186) were cultured in DMEM medium + P / S with 10% fetal bovine serum. The medium was supplemented with 1.5 μM of Cyclosporin A (abbreviated as CsA. CsA effectively suppresses the activity of the mPTP mitochondrial permeability transition pore), and at the same time, cells cultured without CsA were selected as the control group. When detecting the mitochondrial membrane potential difference with Tetramethylrhodamine (TMRM), the higher the TMRM fluorescence intensity, the greater the membrane potential difference. The results are shown in Table 3. S A (abbreviated as CsA. CsA S effectively suppresses the activity of the mPTP mitochondrial permeability transition pore) was added, and at the same time, cells cultured without CsA were selected as the control group. When detecting the mitochondrial membrane potential difference with Tetramethylrhodamine (TMRM), the higher the TMRM fluorescence intensity, the greater the membrane potential difference. The results are shown in Table 3. S effectively suppresses the activity of the mPTP mitochondrial permeability transition pore) was added, and at the same time, cells cultured without CsA were selected as the control group. When detecting the mitochondrial membrane potential difference with Tetramethylrhodamine (TMRM), the higher the TMRM fluorescence intensity, the greater the membrane potential difference. The results are shown in Table 3.

Table 3

[0665] As seen from Table 3, CsA SFor normal Daoy cells without A added to the culture medium, the membrane potential drops significantly under the action of H2O2, indicating that mPTPs in Daoy cells are activated. However, when activated C was added to the culture medium, the membrane permeable transition pores of the mPTP granules were also activated. S For Daoy cells A, adding H2O2 prevents their membrane potential from decreasing, and this is because activated mPTPs are C S This indicates that it is suppressed and inactive by A. In this case, the membrane potential does not decrease due to H2O2.

[0666] Therefore, as can be seen from Table 3, the membrane-permeable transition pores of the glomeruli in Daoy cells are activated.

[0667] Example 15 This study investigates the inhibitory effect of the compound of the present invention on the vitality of Daoy cells in which mPTP is normally activated, and on the vitality of Daoy cells in which mPTP formed by introducing PPIF mRNA shRNA is inactivated.

[0668] The English name for the term "peptidyl-prolyl isomerase F" is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF. Its protein number is UniProtKB / Swiss-Prot: P30405, and its gene number is NCBI Entrez Gene: 10105.

[0669] 1. Forms Daoy cells with reduced activation of the membrane permeable transition pore (mPTP) of the glomeruli. 1.1 Experimental Background: The activity of the membrane permeable transition pore (mPTP) of the glomeruli is regulated by the PPIF protein; therefore, suppressing the PPIF protein significantly reduces mPTP activity. Since the activity of the PPIF protein is controlled by the amount of PPIF protein expressed within the cell, introducing shRNA of specific induced degradation PPIF mRNA into Daoy cells specifically reduces the expression level of PPIF protein in Daoy cells, thereby forming Daoy cells in which the membrane permeable transition pore (mPTP) of the glomeruli is inactivated (abbreviated as Daoy cells with inactivated mPTP).

[0670] 1.2 Experimental Method and Results: A viral vector containing the shRNA of specifically induced degradation PPIF mRNA was obtained using cloning technology. The shRNA sequence (nucleotide sequence GTTCTTCATCTGCACCATAAA (SEQ ID NO: 2)) contained in this viral vector was subjected to specific induced degradation of PPIF mRNA. Daoy cells into which the gene was introduced into the viral vector containing the shRNA of specifically induced degradation PPIF mRNA were designated as the experimental group, and Daoy cells into which the gene was introduced into an empty viral vector without the shRNA of specifically induced degradation PPIF mRNA were designated as the control group. The expression level of PPIF protein in Daoy cells was detected by Western blotting, and the results are shown in Figure 1. As can be seen from Figure 1, Daoy cells into which the shRNA of specifically induced degradation PPIF mRNA was introduced hardly expressed PPIF (PPIF shRNA in Figure 1), while Daoy cells into which the shRNA of specifically induced degradation PPIF mRNA was not introduced expressed PPIF (Con shRNA in Figure 1, control group) normally. When the glomerular membrane potential difference was detected in Daoy cells into which a gene was introduced using an empty viral vector lacking the shRNA of specifically induced degradation PPIF mRNA, and in Daoy cells into which a gene was introduced using a viral vector containing the shRNA of specifically induced degradation PPIF mRNA, according to the method of Example 14, the TMRM fluorescence intensity increased and the membrane potential difference became larger. The results are shown in Table 4-5. [Table 4] [Table 5]

[0671] Table 4-5 shows that in Daoy cells into which the gene is introduced into an empty viral vector lacking the shRNA of specifically induced degradation PPIF mRNA, the membrane permeable transition pore (mPTP) of the glomeruli is activated. In Daoy cells into which the gene is introduced into a viral vector containing the shRNA of specifically induced degradation PPIF mRNA, the membrane permeable transition pore (mPTP) of the glomeruli is inactivated. By introducing the shRNA of specifically induced degradation PPIF mRNA into Daoy cells, we successfully create Daoy cells in which the membrane permeable transition pore (mPTP) of the glomeruli is inactivated.

[0672] Using the Promega CellTiter-Glo kit (which reflects cell vitality by examining intracellular ATP content), we detected the vitality of Daoy cells inactivated by mPTPs that had been introduced with shRNA for specific induced degradation of PPIF mRNA, and the vitality of Daoy cells activated by mPTPs that had not been introduced with shRNA for isomorphosis-induced degradation of PPIF mRNA. The results are shown in Figure 2. As can be seen from Figure 2, the vitality of Daoy cells inactivated by mPTPs that had been introduced with shRNA for specific induced degradation of PPIF mRNA and the vitality of Daoy cells activated by mPTPs that had not been introduced with shRNA for isomorphosis-induced degradation of PPIF mRNA are almost the same. There is no statistical significance in the difference in cell vitality.

[0673] 2. Investigate the relationship between the inhibitory effect of the compound of the present invention on cancer cells and mPTP activity. 2.1 Experimental Background: The Promega CellTiter-Glo kit reflects cell activity by directly measuring intracellular ATP content to detect cell vitality. This experiment investigated the inhibition of Daoy cell vitality by inactivating mPTPs that had been introduced with shRNA for specific induced degradation of PPIF mRNA, and by activating Daoy cell vitality by mPTPs that had not been introduced with shRNA for isomorphically induced degradation of PPIF mRNA. 50 Detect the value.

[0674] 2.2 Experimental Methods and Results: Daoy cells that inactivate mPTPs by introducing shRNA of specificity-induced degradation PPIF mRNA and Daoy cells that activate mPTPs by not introducing shRNA of isomorph-induced degradation PPIF mRNA were cultured in EMEM medium + P / S containing 10% fetal bovine serum. The semi-inhibitory concentration IC of the compound of the present invention for both types of cells was measured. 50 The following was measured. The results are shown in Table 6. [Table 6] Note: IC 50 This is the 50% inhibiting concentration, i.e., the concentration of the inhibitor that achieves a 50% inhibitory effect. Daoy cells that activate mPTP are Daoy cells into which the gene is introduced into an empty viral vector that does not have the shRNA of specifically induced degradation PPIF mRNA, and Daoy cells that inactivate mPTP are Daoy cells into which the gene is introduced into a viral vector that has the shRNA of specifically induced degradation PPIF mRNA.

[0675] As can be seen from Table 6, the compounds of the present invention achieve a significant inhibitory effect on Daoy cells that inactivate mPTP, but an insufficient inhibitory effect on Daoy cells that activate mPTP. In order to significantly enhance the inhibitory effect of the compounds of the present invention by lowering the mPTP activity of Daoy cells, the compounds of the present invention have a more significant inhibitory effect on Daoy cells that inactivate mPTP, and Daoy cells that inactivate mPTP are highly sensitive to the compounds of the present invention. As a result, the compounds of the present invention have an excellent refining therapeutic effect on Daoy cells that inactivate mPTP. As described above, when PPIF protein is suppressed, mPTP activity is significantly reduced. Suppressing the expression level of PPIF protein reduces the mPTP activity of Daoy cells. Therefore, the compounds of the present invention achieve a significant inhibitory effect on Daoy cells that lowly express PPIF protein, but an insufficient inhibitory effect on Daoy cells that normally express PPIF protein. As a result, lowering the expression level of PPIF protein may significantly enhance the inhibitory effect of the compounds of the present invention. Therefore, the compounds of the present invention exhibit a more significant inhibitory effect on Daoy cells that lowly express PPIF protein. In other words, Daoy cells that lowly express PPIF protein are more sensitive to the compounds of the present invention than Daoy cells that normally express PPIF protein. As a result, the compounds of the present invention exhibit an excellent refining therapeutic effect on Daoy cells that lowly express PPIF protein.

[0676] Example 16 In this example, we investigate the sensitivity of various compounds prepared in the example to the expression levels of NNMT and DNMT1 in NCI-H82 cells.

[0677] Experimental Methods and Results: NCI-H82 cells with high NNMT protein expression (ov-NNMT NCI-H82 cells) were obtained by introducing the NMT gene into NCI-H82 cells via a viral vector to overexpress the NNMT protein. NCI-H82 cells with low NMT protein expression (sh-DNMT1 NCI-H82 cells) were obtained by knocking down the expression of DNMT1 in NCI-H82 cells by introducing the gene into shRNA (the nucleotide sequence of the shRNA is GATCCGGGATGAGTCCATCAAGGAAGATTCAAGAGATCTTCCTTGATGGACTCATCCTTTTTTG) (SEQ ID No: 3)) via a viral vector. NCI-H82 cells with low NMT protein expression (sh-DNMT1 NCI-H82 cells) were obtained by introducing the gene into an empty viral vector that does not contain the NNMT gene or shRNA (Con-NCI-H82 cells). The results regarding the DNMT1 protein content in Con-NCI-H82 cells and ov-NNMT NCI-H82 cells detected by Western Blot experiments, and the DNMT1 protein content in Con-NCI-H82 cells and sh-DNMT1 NCI-H82 cells detected by Western Blot experiments, are shown in Figures 3 and 4. As can be seen from Figures 3 and 4, NNMT protein is highly expressed in ov-NNMT NCI-H82 cells and knocked down, i.e., low-expressed, DNMT1 protein in sh-DNMT1 NCI-H82 cells compared to Con-NCI-H82 cells.

[0678] The cell vitality of Con-NCI-H82 cells, ov-NNMT NCI-H82 cells, and sh-DNMT1 NCI-H82 cells was detected using the Promega CellTiter-Glo kit (which reflects cell vitality by examining the intracellular ATP content). The results are shown in Figures 5 and 6. As can be seen from Figures 5 and 6, the cell vitality of on-NCI-H82 cells, ov-NNMT NCI-H82 cells, and sh-DNMT1 NCI-H82 cells is almost the same. There is no statistical significance in the differences in cell vitality.

[0679] By using the Promega CellTiter-Glo kit, that is, by examining the ATP content within cells via the kit, cell vitality was detected, and the inhibitory effects of the various compounds prepared in this example on Con-NCI-H82 cells, ov-NNMT NCI-H82 cells, and sh-DNMT1 NCI-H82 cells (IC) were determined. 50 The system detects the following, and the results are shown in Table 7. [Table 7] JPEG0007843542000053.jpg42161Note:IC 50 The '-' represents the 50% inhibiting concentration, i.e., the concentration of the inhibitor at which a 50% inhibitory effect is achieved. Con-NCI-H82 represents the control group of NCI-H82 cells into which the NNMT gene and shRNA are introduced into an empty viral vector. ov-NNMT NCI-H82 represents the experimental group of NCI-H82 cells into which the NNMT gene is introduced into a viral vector containing the NNMT gene, resulting in high expression of the NNMT protein in ov-NNMT NCI-H82 cells. sh-DNMT1 NCI-H82 represents the experimental group of NCI-H82 cells into which the shRNA is introduced into a viral vector containing the NNMT protein, resulting in knockdown (i.e., low expression) of the NNMT protein in ov-NNMT NCI-H82 cells.

[0680] As can be seen from Table 7, in this embodiment, by overexpressing the NNMT protein in NCI-H82 cells and knocking down the expression of DNMT1 in NCI-H82 cells, the compound of the present invention has a remarkable inhibitory effect on tumor cells that have low or no NNMT gene expression and high DNMT1 expression, but has an inferior inhibitory effect on tumor cells that have high NNMT gene expression and low DNMT1 expression. Furthermore, the inhibitory effect of the compound of the present invention is enhanced by lowering the expression of the NNMT gene in tumors or increasing the expression of DNMT1 in tumors, and the amount of NNMT expression in tumor cells is significantly inversely correlated with the sensitivity to the compound of the present invention, while the amount of DNMT1 expression in tumor cells is significantly positively correlated with the sensitivity to the compound of the present invention.Therefore, the compound of the present invention has a remarkable inhibitory effect on tumor cells that have low or no NNMT gene expression and high DNMT1 expression, and tumor cells that have low or no NNMT gene expression and high DNMT1 expression are highly sensitive to the compound of the present invention, thus providing a remarkably superior therapeutic effect on tumor cells that have low or no NNMT gene expression and high DNMT1 expression.

[0681] Example 17 The methylation level of cellular DNA is maintained by DNA methyltransferases DNMT3a, DNMT3b, and DNMT1. DNMT3a and DNMT3b perform de novomethylation of DNA, while DNMT1 replicates and maintains methylated DNA with the help of the protein UHRF1 (a ubiquitin-like tau protein 1 containing PHD and ring finger domains). This example detects the correlation between NNMT expression in tumors and the expression of DNMT1, UHRF1, DNMT3a, and DNMT3b.

[0682] Experimental Methods and Results: Expression data for NNMT genes, DNMT1, UHRF1, DNMT3a, and DNMT3b were obtained from a publicly available database (Cancer Cell Line Encyclopedia, CCLE, total of 1019 cell lines) in various cells. Next, the correlation between NNMT expression and DNMT1, UHRF1, DNMT3a, and DNMT3b expression in these cells, as well as the correlation between the expression levels of NNMT genes in each cell and the expression levels of DNMT1, UHRF1, DNMT3a, and DNMT3b, were analyzed using bioinformatics methods. The experimental results are shown in Figure 7.

[0683] As can be seen from Figure 7, the expression of NNMT in each cell is inversely correlated with the expression of DNA methyltransferase and UHRF1. Therefore, tumor cells that highly express DNA methyltransferase and UHRF1 are highly sensitive to the compounds of the present invention, and the compounds of the present invention have remarkably excellent therapeutic effects against tumors that highly express DNA methyltransferase and UHRF1.

[0684] It should be noted that the above description, as an embodiment designed to address a certain aspect, has been improved by those skilled in the art without departing from the principles of the present invention, and these improvements should also be considered within the scope of protection of the present invention.

Claims

1. Used in the manufacture of compositions or formulations used for the prevention and / or treatment of tumors; The aforementioned tumor, Tumors in which the NNMT gene is low-expression or not expressed, and / or Tumors in which the nucleotide sites of the NNMT gene are hypermethylated, and / or This includes tumors in which the DNA CpG site in the NNMT gene region is hypermethylated. Here, a tumor in which the NNMT gene is low-expressing or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level of the NNMT gene in tumor cells E1 and the expression level of the NNMT gene in similar cells E0 is < 1.0; The tumor in which the nucleotide region of the NNMT gene is hypermethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide region of the NNMT gene in tumor cells and the methylation level L0 of the nucleotide region of the NNMT gene in similar cells is > 1.0; The tumor in which the NNMT gene region DNA CpG site is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the NNMT gene region DNA CpG site in tumor cells and the methylation level W0 of the NNMT gene region DNA CpG site in similar cells is > 1.

0. Use of the compound of formula I, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, or its deuterated compound. 【Chemistry 1】 (R 1 and R 2 Each of these independently represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C3-C16 cycloalkyl group, a substituted or unsubstituted 3-12 member heterocycloalkyl group, a substituted or unsubstituted C1-C16 halogenated alkyl group, a substituted or unsubstituted C3-C16 halogenated cycloalkyl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C10 alkyl group-, a substituted or unsubstituted 5-16 member heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-, or a substituted or unsubstituted C2-C10 alkenyl group-substituted or unsubstituted C1-C10 alkyl group-; R 3 and R 4 Each of them is independently a hydrogen atom, R 16 -O- or R 16 Represents -S-; R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a halogen atom; R 9 and R 10 They bond to form substituted or unsubstituted 3-12 membered heterocycloalkyl rings; R 16 represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group, or a substituted or unsubstituted C3-C16 cycloalkyl group; The aforementioned "substitutions" include one, two, or three hydrogen atoms on the ring or group being independently C1-C8 alkyl, C3-C12 cycloalkyl, C1-C8 halogenated alkyl, C3-C8 halogenated cycloalkyl, C3-C8 cycloalkoxyl group, C3-C8 cycloalkylthiol group, C3-C8 halogenated cycloalkoxyl group, C3-C8 halogenated cycloalkylthiol group, halogen atom, nitro group, -CN, hydroxyl group, mercury This refers to substitution with substituents selected from pt groups, amino groups, C1-C4 carboxyl groups, C2-C4 ester groups, C2-C4 acylamino groups, C1-C8 alkoxyl groups, C1-C8 alkylthiol groups, C1-C8 halogenated alkoxyl groups, C1-C8 halogenated alkylthiol groups, C6-C12 aryl groups, C6-C12 aryl-O- groups, 5-10 membered heteroaryl groups, 5-10 membered heteroaryl-O- groups, and 5-10 membered heterocycloalkyl groups; Each of the heterocycloalkyl group, the heteroaryl group, and the heterocyclic ring of the heterocycloalkyl ring independently contains one, two, or three heteroatoms selected from N, O, and S.

2. R 1 and R 2 Each independently represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, a substituted or unsubstituted 3-10 membered heterocycloalkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C3-C10 halogenated cycloalkyl group, a substituted or unsubstituted C6-C12 aryl group - substituted or unsubstituted C1-C6 alkyl group -, a substituted or unsubstituted 5-10 membered heteroaryl group - substituted or unsubstituted C1-C6 alkyl group -, or a substituted or unsubstituted C2-C8 alkenyl group - substituted or unsubstituted C1-C8 alkyl group -; R 9 and R 10 However, they bond to form substituted or unsubstituted 3-10 membered heterocycloalkyl rings; and / or R 16 However, it represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group. The use described in feature 1.

3. R 1 and R 2 Each independently represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-8 member heterocycloalkyl group, a substituted or unsubstituted C1-C6 halogenated alkyl group, a substituted or unsubstituted C3-C8 halogenated cycloalkyl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-10 member heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted C2-C6 alkenyl group-substituted or unsubstituted C1-C6 alkyl group-; R 9 and R 10 However, they bond to form substituted or unsubstituted 3-8 membered heterocycloalkyl rings; and / or R 16 However, it represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group. The use described in feature 1.

4. R 1 and R 2 Each independently represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C6 cycloalkyl group, a substituted or unsubstituted 3-8 member heterocycloalkyl group, a substituted or unsubstituted C1-C2 halogenated alkyl group, a substituted or unsubstituted C3-C6 halogenated cycloalkyl group, a substituted or unsubstituted C6-C8 aryl group - substituted or unsubstituted C1-C2 alkyl group -, a substituted or unsubstituted 5-8 member heteroaryl group - substituted or unsubstituted C1-C2 alkyl group -, or a substituted or unsubstituted C2-C4 alkenyl group - substituted or unsubstituted C1-C2 alkyl group -; R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 and R 15 However, each independently represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom; R 9 and R 10 However, when combined, substitution or non-substitution 【Chemistry 2】 and / or R 16 However, this represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group. Here, R 17 However, it represents a hydrogen atom or a substituted or unsubstituted C1-C8 alkyl group; W 1 and W 2 However, each independently represents either O or S. The use described in feature 1.

5. R 1 and R 2 Each of these independently represents a hydrogen atom, a methyl group, an ethyl group, a propyl group, a butyl group, an amyl group, a hexyl group, a vinyl group-methyl group-, a vinyl group-ethyl group-, a methyl halide group, a cycloamyl group, or a cyclohexyl group; R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 and R 15 However, each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a halogen atom; R 9 and R 10 However, when combined, substitution or non-substitution 【Transformation 3】 and / or R 16 However, it represents a hydrogen atom, a methyl group, an ethyl group, a propyl group, or a butyl group. Here, R 17 However, it represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; W 1 and W 2 However, each independently represents either O or S. The use described in feature 1.

6. A pharmaceutically acceptable salt of the compound of formula I is The compound of formula I includes salts formed with one or more of the following: hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodate, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid. The use described in feature 1.

7. The use according to claim 1, characterized in that the compound has the following chemical structural formula. 【Chemistry 4】 【change】 【change】

8. The expression includes protein expression and / or mRNA expression; The tumor in which the NNMT gene is low-expressing or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level of the NNMT gene in tumor cells E1 and the expression level of the NNMT gene in similar cells E0 is ≤ 0.7; The tumor in which the nucleotide region of the NNMT gene is hypermethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide region of the NNMT gene in tumor cells and the methylation level L0 of the nucleotide region of the NNMT gene in similar cells is ≥ 1.5; The tumor in which the NNMT gene region DNA CpG site is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the NNMT gene region DNA CpG site in tumor cells and the methylation level W0 of the NNMT gene region DNA CpG site in similar cells is ≥ 1.

5. The use described in feature 1.

9. The tumor in which the NNMT gene is low-expressing or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level of the NNMT gene in tumor cells E1 and the expression level of the NNMT gene in similar cells E0 is ≤ 0.5; The tumor in which the nucleotide sites of the NNMT gene are hypermethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in tumor cells and the methylation level L0 of the nucleotide site of the NNMT gene in similar cells is ≥ 2; and / or The tumor in which the NNMT gene region DNA CpG site is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the NNMT gene region DNA CpG site in tumor cells and the methylation level W0 of the NNMT gene region DNA CpG site in similar cells is ≥ 2. The use described in feature 1.

10. The aforementioned similar cells, Similar tumor cells in which the NNMT gene is normally expressed or highly expressed, Similar tumor cells in which the nucleotide sites of the NNMT gene are normally methylated or hypomethylated, and / or This includes similar tumor cells in which the DNA CpG site in the NNMT gene region is normally methylated or hypomethylated. The use described in feature 1.

11. The tumor in which the nucleotide sites of the NNMT gene are hypermethylated refers to a tumor in which the methylation level of the nucleotide sites of the NNMT gene in tumor cells is ≥1%, preferably ≥3%, ≥5%, ≥10%, ≥15%, or ≥20%, and more preferably ≥25%, ≥30%, ≥40%, or ≥50%; The tumor in which the nucleotide sites of the NNMT gene are hypermethylated refers to a tumor in which the methylation level (M%) of the nucleotide sites of the NNMT gene in tumor cells is ≥3% and M1% or less, where M1 is any positive integer between 3 and 100; The methylation level of the nucleotide region of the NNMT gene refers to the ratio between the number of methylated nucleotides in the NNMT gene region and the total number of nucleotides in the NNMT gene region; The methylation level of the nucleotide sites of the NNMT gene includes the methylation level of the nucleotide sites in the NNMT gene promoter region; The methylation level of the nucleotide sites of the NNMT gene includes the methylation level of nucleotide sites in the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene; The methylation level of the nucleotide sites of the NNMT gene includes the methylation level of nucleotide sites in the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene; The methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site in the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene; The methylation levels of the nucleotide sites of the NNMT gene include the methylation levels of nucleotide sites within the region between any two of the following positions on human chromosome 11: 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 (including the positions themselves); The methylation levels of the nucleotide sites of the NNMT gene include the methylation levels of nucleotides at positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, 114166066, or a combination thereof selected from positions 114166066 of human chromosome 11; The methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within the region between any two of the positions 1161, 1196, 1235, 1270, 1404, 1516, and 1532 of the SEQ ID NO:1 nucleotide sequence (including the two positions themselves); The methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide at one or more of the sites (e.g., 2, 3, 4, 5, 6, or 7) of positions 1161, 1196, 1235, 1270, 1404, 1516, and 1532 of the SEQ ID NO:1 nucleotide sequence; The tumor in which the NNMT gene region DNA CpG site is hypermethylated refers to a tumor in which the methylation level of the NNMT gene region DNA CpG site in tumor cells is ≥1%, preferably ≥3%, ≥5%, ≥10%, ≥15%, or ≥20%, and more preferably ≥25%, ≥30%, ≥40%, or ≥50%; The tumor in which the NNMT gene region DNA CpG site is hypermethylated refers to a tumor in which the methylation level (M%) of the NNMT gene region DNA CpG site of the tumor cells is ≥3% and M2% or less, where M2 is any positive integer between 3 and 100; The methylation level of the NNMT gene region DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the total number of nucleotides in the NNMT gene region; The methylation level of the NNMT gene region DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the total number of CpG nucleotides in the NNMT gene region; The methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the DNA CpG site in the NNMT gene promoter region; The methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the DNA CpG site in the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene; The methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the DNA CpG site in the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene; The methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the DNA CpG site in the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene; The methylation level of the NNMT gene region DNA CpG site includes the methylation level of the DNA CpG site within the region between any two of the following positions on human chromosome 11: 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 (including the positions themselves); The methylation level of the NNMT gene region DNA CpG site includes the methylation level of a site selected from position 114165695, position 114165730, position 114165769, position 114165804, position 114165938, position 114166050, position 114166066 of human chromosome 11, or a combination thereof; The methylation level of the NNMT gene region DNA CpG site includes the methylation level of the DNA CpG site within the region between any two of the following positions of the SEQ ID NO:1 nucleotide sequence (including the two positions themselves); and / or The methylation level of the NNMT gene region DNA CpG site includes the methylation levels of the site selected from positions 1161, 1196, 1235, 1270, 1404, 1516, 1532, or combinations thereof, of the site in the SEQ ID NO:1 sequence. The use described in feature 1.

12. M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100; M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100; The nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO: 1; The region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene corresponds to positions 951-2500 of the nucleotide sequence shown in SEQ ID NO: 1; The region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene corresponds to positions 951-1808 of the nucleotide sequence shown in SEQ ID NO: 1; and / or The region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene corresponds to positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO:

1. The use described in feature 11.

13. The tumor is a human tumor, and / or Lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof, The use described in feature 1.

14. The lung cancer is selected from non-small cell lung cancer, small cell lung cancer, or a combination thereof; The aforementioned colon cancer includes colon adenocarcinoma; The aforementioned breast cancer includes triple-negative breast cancer; The lymphoma is selected from B-cell lymphoma, T-cell lymphoma, or a combination thereof; The brain tumor is selected from glioma, glioblastoma, gliocytoma, medulloblastoma, neuroblastoma, or a combination thereof; The aforementioned kidney cancer is selected from renal pellucida adenocarcinoma, renal cancer Wilms, or a combination thereof; The aforementioned pancreatic cancer includes pancreatic ductal adenocarcinoma; and / or The aforementioned leukemia is selected from T lymphocytic leukemia, myeloid leukemia, or a combination thereof. The use described in feature 13.

15. The aforementioned lymphoma includes diffuse large B lymphoma; The aforementioned brain medulloblastoma includes cerebellar medulloblastoma; The aforementioned glioblastoma includes glioblastoma multiforme; The aforementioned T lymphocytic leukemia includes acute T lymphocytic leukemia; The myeloid leukemia includes M4-grade AML acute myeloid leukemia; and / or The aforementioned myeloid leukemia includes FAB M4 class AML acute myeloid leukemia. The use described in feature 14.

16. The composition or preparation is a drug composition or drug preparation; The composition or formulation further comprises a pharmaceutically acceptable carrier; The composition or formulation is in the form of a solid, liquid or semi-solid; and / or The composition or formulation is an oral preparation, a topical preparation, or an injectable preparation. The use described in feature 1.

Citation Information

Patent Citations

  • Application of vanillin in preparation of nicotinamide-N-methyltransferase inhibitor

    CN112494467A

  • Compounds and methods for modulating rho gtpases

    WO2009007457A2