T cells, methods for preparing them, and their use

Abstract

To provide a useful use of T cells in the preparation of a medicament for treating an infectious disease, inflammation, or tumor.SOLUTION: There is provided use of a reagent for adjusting Ryr2 expression, a reagent for adjusting basal Ca2+ oscillations, a reagent for adjusting m-calpain activity, a reagent for adjusting the binding strength between T cells and DC cells, or a use of T cells in which Ryr2 is overexpressed, in the preparation of a medicament for treating an infectious disease, inflammation, or tumor, preferably, the T cells in which Ryr2 is overexpressed being Treg cells.SELECTED DRAWING: Figure 5

Description

[Technical Field]

[0001] The present invention relates to the biological technology, and more specifically to T cells, methods for preparing them and using them, and reagents for adjusting Ryr2 expression, and adjusted Ca 2+ This relates to the use of reagents for adjusting fundamental vibrations, reagents for adjusting m-calpain activity, and reagents for adjusting the binding strength between T cells and DC cells in the preparation of pharmaceuticals for treating infectious diseases, inflammation, or tumors. [Background technology]

[0002] Regulatory T cells (Tregs) are a functional subgroup of inhibitory T cells. Native Treg cells were first reported by Sakaguchi et al. in 1995, and they account for approximately 5% to 10% of peripheral blood CD4+ T cell counts. FoxP3 is a label for native Tregs. Regulatory T cells are classified into two types: native Tregs (n Tregs) and acquired Tregs (a Tregs).

[0003] The mechanisms of Treg cell suppression are a focus of research. Mechanisms disclosed in *Past, Present, and Future of Regulatory T Cell Therapy in Transplantation and Autoimmunity* (Romano et al., Frontiers in Immunology, 2019) include T cell lysis, surface protein extraction, and local adenosine production, all of which require Treg binding. In recent years, a series of research reports have shifted the focus of research to the direct suppression of dendritic cells. The main reasons are as follows: First, although Treg cells far outnumber dendritic cells in terms of CD4+ T cell count, Treg cells are numerically superior to dendritic cells, with a ratio of approximately 2:1 in the body, suggesting the possibility of a more rational and equitable use of their suppressive capacity. Second, direct DC / Treg binding is common both in vivo and in vitro. While such constraints are thought to suppress DCs, there is still no consensus on how to appropriately utilize them. References: In "Trans-endocytosis of CD80 and CD86: a molecular basis for the cell-extrinsic function of CTLA-4" (Qureshi et al., Science 332, 2011), Sakaguchi's team proposed that this is mainly achieved by the cytotic effect of CTLA-4 expressed on Treg cells. In a recent paper, Shevach proposed that MHC class II extraction plays an important role in the suppression of DCs in antigen presentation.

[0004] However, the inventors of the present application believe that the binding between Treg and DC is mediated via LFA-1 and ICAM-1, and the binding itself is very strong, causing the cytoskeleton of DC cells to be greatly distorted and unable to support antigen presentation to other T cells (Reference: Strong adhesion by regulatory T cells induces dendritic cell cytoskeletal polarization and contact-dependent lethargy (Chen et al., The Journal of experimental medicine, 2017)). Over time, these differences may be resolved, and a more accurate and comprehensive picture of how Treg suppresses DC by contact may be obtained. However, to continue the discussion, it is necessary to answer the basic questions of why Treg binds to DC with such a strong force and how this excessive force affects DC.

[0005] Ryr2 is a calcium release channel in the endoplasmic reticulum / sarcoplasmic reticulum (ER / SR). In the following prior art, it has been disclosed that the Ryr2 gene is related to sudden cardiac death, arrhythmia, and coronary atherosclerosis. For example, Non-patent literature: Family study of sudden cardiac death due to a new mutation in the Ryr2 gene (Shen Tong et al., Journal of Cardiovascular Diseases Integrating Traditional Chinese and Western Medicine, 2019.02) showed that the Ryr2 gene Child Mi has a missense mutation c.G4107C <​​​​​​​​Non - Patent Document: Theoretical study on the relationship between Ryr2 gene expression and the onset of heart qi deficiency syndrome in coronary arteriosclerosis (Ma Yuexiang et al., Chinese Medicine Information, 2012) discloses that Ryr2 dysfunction may lead to reduced cardiac function, that the heart mainly acts on the blood vessels, and heart qi is the basic driving force for promoting blood circulation, and that heart qi deficiency can lead to reduced cardiac function, which is consistent with traditional Chinese medicine. It can further clarify the essence of the symptoms of heart qi deficiency syndrome from the expression of the Ryr2 gene.

[0008] Non - Patent Document: Inhibitory effect of carvedilol on Ryr2 - mediated spontaneous calcium oscillations (Xiao Jianmin et al., Chinese Journal of Pathophysiology, 2013) discloses that carvedilol can inhibit Ryr2 - mediated spontaneous calcium oscillations, and clarifies that carvedilol is superior to other β - receptor blockers in reducing the mortality of heart failure.

[0009] However, in the above - mentioned prior art, the relationship between Ryr2 and T cells, infectious diseases, inflammation, and tumors has not been disclosed.

Summary of the Invention

Problems to be Solved by the Invention

[0010] In order to fill the gap in the prior art, the present invention discovers Ryr2, which is an adjustment switch for Treg cell function, obtains a technology to reduce the expression of Ryr2 by over - expressing FoxP3, and moreover, identifies the target position. Also, by knocking down or knocking out Ryr2 in T cells, the CD4 + T cell pool becomes immunosuppressive cells, and the obtained T cells often have functions similar to those of Treg cells, which is confirmed through many experiment ways. Furthermore, the regulation of Ryr2 can achieve excellent effects in the treatment of any of viral infections, asthma, allergies, colitis, and tumors, and can restore the related systemic autoimmunity of psoriasis - affected mice.

Means for Solving the Problems

[0011] Specifically, the first aspect of the present invention provides T cells in which the Ryr2 gene is deficient or FoxP3 is over - expressed.

[0012] Preferably, in the T cells, at least exon 7 of the Ryr2 gene is deleted.

[0013] Preferably, in the T cells, at least one segment of the Ryr2 gene is deficient in a guanine-rich sequence.

[0014] Preferably, the guanine-rich sequence of the one segment is located in the first 200 bp of the start codon of the Ryr2 gene.

[0015] Preferably, the guanine-rich sequence of the segment is a nucleotide sequence containing at least four guanine (G) molecules. More preferably, it is a nucleotide containing at least 4 to 20 guanine (G) molecules.

[0016] In one particular embodiment of the present invention, the number of elements may include at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and so on.

[0017] Preferably, the guanine-rich sequence of the one segment includes GCAGGGG.

[0018] Preferably, the T cells are selected from cytotoxic T cells, helper T cells, regulatory / inhibitory T cells (Treg), or memory T cells.

[0019] In one particular embodiment of the present invention, the T cells are Tconv cells.

[0020] A second aspect of the present invention provides a method for preparing the T cells of the present invention using shRNA, siRNA, CRISPR / Cas9, zinc finger nuclease technology, transcription activator-like effector nuclease technology, or homing endonuclease.

[0021] Preferably, the shRNA is SEQ ID NO: 5 or 6.

[0022] A third aspect of the present invention is the knockdown of the Ryr2 gene in cells, thereby reducing T cell Ca 2+ This invention provides shRNA that reduces fundamental oscillations, decreases m-calpain activity, improves binding strength with DC cells, and has the function of treating immunosuppressive cells or infectious diseases, inflammation, or tumors.

[0023] Preferably, the shRNA is SEQ ID NO: 5 or 6.

[0024] A fourth aspect of the present invention provides T cells in which Ryr2 is overexpressed.

[0025] Preferably, the T cells are selected from cytotoxic T cells, helper T cells, regulatory / inhibitory T cells (Treg), or memory T cells.

[0026] In one particular embodiment of the present invention, the T cells are Treg cells.

[0027] A fifth aspect of the present invention is a reagent for adjusting FoxP3 expression, a reagent for adjusting Ryr2 expression, Ca 2+ This invention provides reagents for adjusting fundamental vibrations, reagents for adjusting m-calpain activity, or reagents for adjusting the binding strength between T cells and DC cells, for use in the preparation of pharmaceuticals for treating infectious diseases, inflammation, or tumors.

[0028] Preferably, the infectious disease is selected from bacterial infection, viral infection or fungal infection, and more preferably viral infection, pneumonia with infectious shock, peritonitis, bacteremia, pustulosis or sepsis, and the viral infection is selected from acute viral infection or chronic viral infection, and preferably influenza virus, parainfluenza virus, herpesvirus (e.g., HSV-1, EBV), measles virus, varicella-stomatitis virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, lymphocytic choriomeningitis virus or human papillomavirus.

[0029] Preferably, the inflammation may appear in any tissue, and the tissue includes, but is not limited to, the adrenal gland, adrenal malformation, anus, appendix, bladder, blood, bone, bone marrow, brain, mammary gland, cecum, central nervous system (including or excluding the brain), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal gland, larynx, liver, lung, lymph, lymph nodes, lymphocytes, maxilla, mediastinum, mesentery, myometrium, nasopharynx, retina, oral cavity, ovary, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary gland, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testis, thymus, thyroid gland, tongue, tonsillar, trachea, uterus, vulva, and leukocytes. More preferably, the inflammation is selected from systemic lupus erythematosus, rheumatoid arthritis, psoriatic arthritis, scleroderma, asthma, atopic dermatitis, organ-specific inflammatory diseases, allergies (e.g., allergic rhinitis), folliculitis, tonsillitis, pneumonia, hepatitis, nephritis, acne, autoimmune diseases, chronic prostatitis, glomerulonephritis, hypersensitivity, colitis, inflammatory bowel disease, pelvic ulcer, reperfusion injury, transplant rejection, vasculitis, or interstitial cystitis.

[0030] Preferably, the tumor may be any undesirable cell proliferation (or any disease that exhibits undesirable cell proliferation), a neoplasm, or an increased tendency or risk of undesirable cell proliferation, neoplasm or tumor. It may be benign or malignant, and may be primary or secondary (metastatic). The neoplasm may be any abnormal growth or proliferation of cells, and may be located in any tissue. Examples of tissues include the adrenal glands, adrenal malformations, anus, appendix, bladder, blood, bone, bone marrow, brain, mammary glands, cecum, central nervous system (with or without the brain), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal gland, larynx, liver, lungs, lymph, lymph nodes, lymphocytes, maxilla, mediastinum, mesentery, myometrium, nasopharynx, retina, oral cavity, ovaries, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary glands, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testes, thymus, thyroid gland, tongue, amygdala, trachea, uterus, vulva, and leukocytes. More preferably, the tumor is selected from prostate cancer, breast cancer, liver cancer, glioma (e.g., glioma), intestinal cancer, cervical cancer, non-small cell lung cancer, lung cancer, pancreatic cancer, gastric cancer, bladder cancer, skin cancer, rhabdomyocarcinoma, squamous cell carcinoma of the tongue, nasopharyngeal cancer, ovarian cancer, placental choriocarcinoma, lymphoma (e.g., non-Hodgkin lymphoma, Hodgkin lymphoma, cutaneous T-cell lymphoma), leukemia, rectal adenocarcinoma, medulloblastoma, meningioma, neurofibroma (e.g., neurofibrosarcoma), ependymoma, schwannoma, astrocytoma, melanoma, mesothelioma, myeloma, chronic myeloid leukemia, acute myeloid leukemia, myelodysplastic syndrome, chronic lymphocytic leukemia, epidermal carcinoma, colon cancer, thymic carcinoma, hematological cancer, head and neck cancer, or oropharyngeal cancer.

[0031] A sixth aspect of the present invention is a reagent for adjusting FoxP3 expression, a reagent for adjusting Ryr2 expression, Ca 2+ The present invention provides reagents for adjusting fundamental vibrations, reagents for adjusting m-calpain activity, reagents for adjusting the binding strength between T cells and DC cells, or the use of the T cells of the present invention in the treatment of infectious diseases, inflammation, or tumors.

[0032] A seventh aspect of the present invention is a reagent for adjusting FoxP3 expression, a reagent for adjusting Ryr2 expression, Ca 2+The present invention provides reagents for adjusting fundamental vibrations, reagents for adjusting m-calpain activity, reagents for adjusting the binding strength between T cells and DC cells, or the use of the T cells of the present invention in the preparation of pharmaceuticals for treating infectious diseases, inflammation, or tumors.

[0033] An eighth aspect of the present invention relates to the regulation of FoxP3 expression, the regulation of Ryr2 expression, and Ca 2+ The present invention provides for the adjustment of fundamental vibration, the adjustment of m-calpain activity, the adjustment of the binding strength between T cells and DC cells, or the use of T cells as described in the present invention in the treatment of infectious diseases, inflammation, or tumors, or in the preparation of pharmaceuticals for treating infectious diseases, inflammation, or tumors.

[0034] Preferably, the infectious disease is selected from bacterial infection, viral infection or fungal infection, and more preferably viral infection, pneumonia with infectious shock, peritonitis, bacteremia, pustulosis or sepsis, and the viral infection is selected from acute viral infection or chronic viral infection, and preferably influenza virus, parainfluenza virus, herpesvirus (e.g., HSV-1, EBV), measles virus, varicella-stomatitis virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, lymphocytic choriomeningitis virus or human papillomavirus.

[0035] Preferably, the inflammation may appear in any tissue, and the tissue includes, but is not limited to, the adrenal gland, adrenal malformation, anus, appendix, bladder, blood, bone, bone marrow, brain, mammary gland, cecum, central nervous system (including or excluding the brain), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal gland, larynx, liver, lung, lymph, lymph nodes, lymphocytes, maxilla, mediastinum, mesentery, myometrium, nasopharynx, retina, oral cavity, ovary, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary gland, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testis, thymus, thyroid gland, tongue, tonsillar, trachea, uterus, vulva, and leukocytes. More preferably, the inflammation is selected from systemic lupus erythematosus, rheumatoid arthritis, psoriatic arthritis, scleroderma, asthma, atopic dermatitis, organ-specific inflammatory diseases, allergies (e.g., allergic rhinitis), folliculitis, tonsillitis, pneumonia, hepatitis, nephritis, acne, autoimmune diseases, chronic prostatitis, glomerulonephritis, hypersensitivity, colitis, inflammatory bowel disease, pelvic ulcer, reperfusion injury, transplant rejection, vasculitis, or interstitial cystitis.

[0036] Preferably, the tumor may be any undesirable cell proliferation (or any disease that exhibits undesirable cell proliferation), a neoplasm, or an increased tendency or risk of undesirable cell proliferation, neoplasm or tumor. It may be benign or malignant, and may be primary or secondary (metastatic). The neoplasm may be any abnormal growth or proliferation of cells, and may be located in any tissue. Examples of tissues include the adrenal glands, adrenal miltiorrheic acid, anus, appendix, bladder, blood, bone, bone marrow, brain, mammary glands, cecum, central nervous system (with or without the brain), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal gland, larynx, liver, lung, lymph, lymph nodes, lymphocytes, maxilla, mediastinum, mesentery, myometrium, nasopharynx, retina, oral cavity, ovaries, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary glands, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testes, thymus, thyroid gland, tongue, amygdala, trachea, uterus, vulva, and leukocytes. More preferably, the tumor is selected from prostate cancer, breast cancer, liver cancer, glioma (e.g., glioma), intestinal cancer, cervical cancer, non-small cell lung cancer, lung cancer, pancreatic cancer, gastric cancer, bladder cancer, skin cancer, rhabdomyocarcinoma, squamous cell carcinoma of the tongue, nasopharyngeal cancer, ovarian cancer, placental choriocarcinoma, lymphoma (e.g., non-Hodgkin lymphoma, Hodgkin lymphoma, cutaneous T-cell lymphoma), leukemia, rectal adenocarcinoma, medulloblastoma, meningioma, neurofibroma (e.g., neurofibrosarcoma), ependymoma, schwannoma, astrocytoma, melanoma, mesothelioma, myeloma, chronic myeloid leukemia, acute myeloid leukemia, myelodysplastic syndrome, chronic lymphocytic leukemia, epidermal carcinoma, colon cancer, thymic carcinoma, hematological cancer, head and neck cancer, or oropharyngeal cancer.

[0037] A ninth aspect of the present invention is a reagent that improves FoxP3 expression, a reagent that reduces Ryr2 expression, and Ca 2+ The present invention provides reagents that reduce fundamental vibration, reagents that reduce m-calpain activity, reagents that improve the binding strength between T cells and DC cells, or the use of the above-mentioned Ryr2 gene-deficient T cells in the preparation of pharmaceuticals for treating infectious diseases or inflammation.

[0038] A tenth aspect of the present invention is a reagent that improves FoxP3 expression, a reagent that reduces Ryr2 expression, and Ca 2+Provided are a reagent for reducing basal vibration, a reagent for reducing m-calpain activity, a reagent for improving the binding strength between T cells and DC cells, or the use of the above-mentioned Ryr2 gene-deficient T cells in the treatment of infectious diseases or inflammation.

[0039] The 11th aspect of the present invention is an improvement in FoxP3 expression, a decrease in Ryr2 expression, Ca 2+ Provided is the use of a reduction in basal vibration, a reduction in m-calpain activity, or an improvement in the binding strength between T cells and DC cells in the treatment of infectious diseases, inflammation, or the preparation of a pharmaceutical for treating infectious diseases or inflammation.

[0040] Preferably, the infectious disease is selected from bacterial infection, viral infection, or fungal infection, more preferably viral infection, pneumonia with septic shock, peritonitis, bacteremia, pyosepticemia, or sepsis, and the viral infection is selected from acute viral infection or chronic viral infection, preferably influenza virus, parainfluenza virus, herpes virus (e.g., HSV-1, EBV), measles virus, vesicular stomatitis virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, lymphocytic choriomeningitis virus, or human papillomavirus.

[0041] Preferably, the inflammation may appear in any tissue, and the tissue includes, but is not limited to, the adrenal gland, adrenal malformation, anus, appendix, bladder, blood, bone, bone marrow, brain, mammary gland, cecum, central nervous system (including or excluding the brain), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal gland, larynx, liver, lung, lymph, lymph nodes, lymphocytes, maxilla, mediastinum, mesentery, myometrium, nasopharynx, retina, oral cavity, ovary, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary gland, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testis, thymus, thyroid gland, tongue, tonsillar, trachea, uterus, vulva, and leukocytes. More preferably, the inflammation is selected from systemic lupus erythematosus, rheumatoid arthritis, psoriatic arthritis, scleroderma, asthma, atopic dermatitis, organ-specific inflammatory diseases, allergies (e.g., allergic rhinitis), folliculitis, tonsillitis, pneumonia, hepatitis, nephritis, acne, autoimmune diseases, chronic prostatitis, glomerulonephritis, hypersensitivity, colitis, inflammatory bowel disease, pelvic ulcer, reperfusion injury, transplant rejection, vasculitis, or interstitial cystitis.

[0042] A twelfth aspect of the present invention is a reagent that reduces FoxP3 expression, a reagent that improves Ryr2 expression, Ca 2+ This invention provides reagents for improving fundamental vibration, reagents for improving m-calpain activity, reagents for reducing the binding strength between T cells and DC cells, or T cells overexpressing the above-mentioned Ryr2, for use in the preparation of tumor therapeutics.

[0043] A thirteenth aspect of the present invention is a reagent that reduces FoxP3 expression, a reagent that improves Ryr2 expression, and Ca 2+ This invention provides reagents that improve fundamental vibration, reagents that improve m-calpain activity, reagents that reduce the binding strength between T cells and DC cells, or T cells that overexpress the above-mentioned Ryr2, for use in the treatment of tumors.

[0044] A fourteenth aspect of the present invention involves decreased FoxP3 expression, increased Ryr2 expression, and Ca 2+ This invention provides for use in the preparation of tumor treatment or tumor therapeutic drugs by improving fundamental vibration, enhancing m-calpain activity, and reducing the binding strength between T cells and DC cells.

[0045] Preferably, the tumor may be any undesirable cell proliferation (or any disease that exhibits undesirable cell proliferation in itself), a neoplasm, or an increased tendency or risk of undesirable cell proliferation, neoplasm or tumor. It may be benign or malignant, and may be primary or secondary (metastatic). The neoplasm may be any abnormal growth or proliferation of cells, and may be in any tissue. Examples of tissues include the adrenal glands, adrenal malformations, anus, appendix, bladder, blood, bone, bone marrow, brain, mammary glands, cecum, central nervous system (with or without the brain), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal gland, larynx, liver, lungs, lymph, lymph nodes, lymphocytes, maxilla, mediastinum, mesentery, myometrium, nasopharynx, retina, oral cavity, ovaries, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary glands, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testes, thymus, thyroid gland, tongue, amygdala, trachea, uterus, vulva, and leukocytes. More preferably, the tumor is selected from prostate cancer, breast cancer, liver cancer, glioma (e.g., glioma), intestinal cancer, cervical cancer, non-small cell lung cancer, lung cancer, pancreatic cancer, gastric cancer, bladder cancer, skin cancer, rhabdomyocarcinoma, squamous cell carcinoma of the tongue, nasopharyngeal cancer, ovarian cancer, placental choriocarcinoma, lymphoma (e.g., non-Hodgkin lymphoma, Hodgkin lymphoma, cutaneous T-cell lymphoma), leukemia, rectal adenocarcinoma, medulloblastoma, meningioma, neurofibroma (e.g., neurofibrosarcoma), ependymoma, schwannoma, astrocytoma, melanoma, mesothelioma, myeloma, chronic myeloid leukemia, acute myeloid leukemia, myelodysplastic syndrome, chronic lymphocytic leukemia, epidermal carcinoma, colon cancer, thymic carcinoma, hematological cancer, head and neck cancer, or oropharyngeal cancer.

[0046] A 15th aspect of the present invention is the enhancement of FoxP3 expression, the reduction of Ryr2 expression, and Ca 2+ It provides applications in reducing fundamental vibration, decreasing m-calpain activity, or improving the binding strength between T cells and DC cells.

[0047] A sixteenth aspect of the present invention relates to the regulation of Ryr2 expression, Ca 2+It provides use in adjusting fundamental vibration, regulating m-calpain activity, or improving the binding strength between T cells and DC cells. Preferably, the adjustment is a decrease or an increase.

[0048] A 17th aspect of the present invention is Ca 2+ The invention provides a method for adjusting fundamental vibrations, specifically for regulating m-calpain activity or the binding strength between T cells and DC cells. Preferably, the adjustment is a decrease or an increase.

[0049] An eighteenth aspect of the present invention provides the use of m-calpain activity modifiers in regulating the binding strength between T cells and DC cells. Preferably, the modification is a decrease or an increase.

[0050] A 19th aspect of the present invention provides a Ryr2 antagonist that targets a guanine-rich sequence in exon 7 of the Ryr2 gene or in a segment of the Ryr2 gene. Preferably, the guanine-rich sequence in the segment is located in the first 200 bp of the start codon of the Ryr2 gene. More preferably, the guanine-rich sequence in the segment comprises GCAGGGG.

[0051] A 20th aspect of the present invention provides a method for adjusting the binding strength between T cells and DC cells, which includes adjusting Ryr2 expression.

[0052] Preferably, the adjustment is a decrease or an increase. A method for decreasing the binding strength between T cells and DC cells includes increasing Ryr2 expression, and a method for increasing the binding strength between T cells and DC cells includes decreasing Ryr2 expression.

[0053] Preferably, reducing Ryr2 expression includes overexpressing FoxP3 in T cells or adding a Ryr2 inhibitor. More preferably, the Ryr2 inhibitor is selected from the antagonist of the present invention, ryanodine, dantrolene, or JTV519.

[0054] Preferably, improving Ryr2 expression includes reducing FoxP3 expression in T cells or adding a Ryr2 activator. More preferably, the Ryr2 activator is selected from nicotinamide adenine dinucleotide phosphate, caffeine, 4-chloro-m-cresol, ryanodine, chlorantraniliprole, cyantraniliprole, type B adrenaline, 4-chloro-3-methylphenol, cyantraniliprole, cyclaniliprole, cyclic adenosine diphosphate ribose, suramin sodium, tetraniliprole, or trifluoperazine.

[0055] Preferably, reducing Ryr2 expression includes deleting exon 7 of the Ryr2 gene in the T cells.

[0056] In one particular embodiment of the present invention, shRNA is employed to extract exon 7 of the Ryr2 gene for SEQ ID NO: 5, 6. Knockdown do.

[0057] Preferably, reducing Ryr2 expression involves knocking down or knocking out the Ryr2 gene in T cells. More preferably, knocking down or knocking out a guanine-rich sequence in one segment of the Ryr2 gene in T cells. Even more preferably, the guanine-rich sequence in the one segment is located in the first 200 bp of the start codon of the Ryr2 gene. Most preferably, the guanine-rich sequence in the one segment contains GCAGGGG.

[0058] Preferably, the guanine-rich sequence of the segment is a nucleotide sequence containing at least four guanine (G) molecules. More preferably, it is a nucleotide sequence containing at least four to ten guanine (G) molecules.

[0059] In one particular embodiment of the present invention, the number of elements may include at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and so on.

[0060] A 21st aspect of the present invention is Ca, which reduces Ryr2 expression in T cells. 2+ The present invention provides a method for reducing fundamental oscillations and decreasing m-calpain activity, comprising overexpressing FoxP3 in T cells, knocking down or knocking out the Ryr2 gene in T cells, or adding a Ryr2 inhibitor.

[0061] Preferably, at least exon 7 of the Ryr2 gene Knockdown do.

[0062] In one particular embodiment of the present invention, shRNA is employed to knock out exon 7 of the Ryr2 gene for SEQ ID NO: 5, 6.

[0063] Preferably, the method comprises knocking down or knocking out the Ryr2 gene in T cells. More preferably, knocking down or knocking out a guanine-rich sequence in one segment of the Ryr2 gene in T cells. Even more preferably, the guanine-rich sequence in the one segment is located in the first 200 bp of the start codon of the Ryr2 gene. Most preferably, the guanine-rich sequence in the one segment comprises GCAGGGG.

[0064] Preferably, the guanine-rich sequence of the segment is a nucleotide sequence containing at least four guanine (G) molecules. More preferably, it is a nucleotide sequence containing at least four to ten guanine (G) molecules.

[0065] In one particular embodiment of the present invention, the number of elements may include at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and so on.

[0066] Preferably, the Ryr2 inhibitor is selected from the antagonist of the present invention, ryanodine, dantrolene, or JTV519.

[0067] A 22nd aspect of the present invention is to improve Ryr2 expression in T cells, Ca 2+The present invention provides a method for improving fundamental oscillations and enhancing m-calpain activity, comprising reducing FoxP3 expression in T cells or adding a Ryr2 activator.

[0068] Preferably, the Ryr2 activator is selected from nicotinamide adenine dinucleotide phosphate, caffeine, 4-chloro-m-cresol, ryanodine, chlorantraniliprole, cyantraniliprole, type B adrenaline, 4-chloro-3-methylphenol, cyantraniliprole, cyclaniliprole, cyclic adenosine diphosphate ribose, suramin sodium, tetraniliprole, or trifluoperazine.

[0069] A 23rd aspect of the present invention provides a method for converting Tconv cells to have functions similar to Treg cells, comprising overexpressing FoxP3 in Tconv cells or knocking down or knocking out the Ryr2 gene in Tconv cells.

[0070] Preferably, the method involves knocking down at least exon 7 of the Ryr2 gene or Knockdown This includes doing so.

[0071] In one particular embodiment of the present invention, shRNA is employed to knock out exon 7 of the Ryr2 gene for SEQ ID NO: 5, 6.

[0072] Preferably, the method comprises knocking down or knocking out a guanine-rich sequence in one segment of the Ryr2 gene in Tconv cells. More preferably, the guanine-rich sequence of the one segment is located in the first 200 bp of the start codon of the Ryr2 gene. Even more preferably, the guanine-rich sequence of the one segment comprises GCAGGGG.

[0073] In one particular embodiment of the present invention, a 1.5 kb or 40 kb nucleotide sequence in the promoter region of the Ryr2 gene is knocked down or knocked out.

[0074] Preferably, functions similar to those of Treg cells include binding strength to DC cells, expression levels of related surface markers (e.g., CD25, GITR, CTLA-4, CD39, PD-1, LAG-3, TIM-3), and Ca 2+ Low level, Ca 2+ This includes, but is not limited to, a lower baseline vibration, lower CMAC digestion, reduced talin digestion, and reduced immune hyperactivity.

[0075] A 24th aspect of the present invention provides a method for treating infectious diseases or inflammation, comprising administering an effective amount of the Ryr2 gene-deficient T cells of the present invention to a target.

[0076] A 25th aspect of the present invention involves overexpressing FoxP3 in target T cells, decreasing Ryr2 expression in T cells, and Ca 2+ The present invention provides a method for treating infectious diseases or inflammation, selected from reducing fundamental vibration, reducing m-calpain activity, improving the binding strength between T cells and DC cells, or adding a Ryr2 inhibitor.

[0077] Preferably, the Ryr2 inhibitor is selected from the antagonist of the present invention, ryanodine, dantrolene, or JTV519.

[0078] Preferably, the infectious disease is selected from bacterial infection, viral infection or fungal infection, and more preferably viral infection, pneumonia with infectious shock, peritonitis, bacteremia, pustulosis or sepsis, and the viral infection is selected from acute viral infection or chronic viral infection, and preferably influenza virus, parainfluenza virus, herpesvirus (e.g., HSV-1, EBV), measles virus, varicella-stomatitis virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, lymphocytic choriomeningitis virus or human papillomavirus.

[0079] Preferably, the inflammation may appear in any tissue, and the tissue includes, but is not limited to, the adrenal gland, adrenal malformation, anus, appendix, bladder, blood, bone, bone marrow, brain, mammary gland, cecum, central nervous system (including or excluding the brain), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal gland, larynx, liver, lung, lymph, lymph nodes, lymphocytes, maxilla, mediastinum, mesentery, myometrium, nasopharynx, retina, oral cavity, ovary, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary gland, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testis, thymus, thyroid gland, tongue, tonsillar, trachea, uterus, vulva, and leukocytes. More preferably, the inflammation is selected from systemic lupus erythematosus, rheumatoid arthritis, psoriatic arthritis, scleroderma, asthma, atopic dermatitis, organ-specific inflammatory diseases, allergies (e.g., allergic rhinitis), folliculitis, tonsillitis, pneumonia, hepatitis, nephritis, acne, autoimmune diseases, chronic prostatitis, glomerulonephritis, hypersensitivity, colitis, inflammatory bowel disease, pelvic ulcer, reperfusion injury, transplant rejection, vasculitis, or interstitial cystitis.

[0080] A 26th aspect of the present invention provides a method for treating tumors, which includes administering an effective amount of T cells overexpressing the Ryr2 of the present invention to a target.

[0081] A 27th aspect of the present invention involves reducing the expression of FoxP3 in target T cells, increasing the expression of Ryr2 in T cells, and Ca 2+ The present invention provides a tumor treatment method selected from improving fundamental vibration, improving m-calpain activity, reducing the binding strength between T cells and DC cells, or adding a Ryr2 activator.

[0082] Preferably, the Ryr2 activator is selected from nicotinamide adenine dinucleotide phosphate, caffeine, 4-chloro-m-cresol, ryanodine, chlorantraniliprole, cyantraniliprole, type B adrenaline, 4-chloro-3-methylphenol, cyantraniliprole, cyclaniliprole, cyclic adenosine diphosphate ribose, suramin sodium, tetraniliprole, or trifluoperazine.

[0083] Preferably, the tumor may be any undesirable cell proliferation (or any disease that exhibits undesirable cell proliferation), a neoplasm, or an increased tendency or risk of undesirable cell proliferation, neoplasm or tumor. It may be benign or malignant, and may be primary or secondary (metastatic). The neoplasm may be any abnormal growth or proliferation of cells, and may be located in any tissue. Examples of tissues include the adrenal glands, adrenal malformations, anus, appendix, bladder, blood, bone, bone marrow, brain, mammary glands, cecum, central nervous system (with or without the brain), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidney, lacrimal gland, larynx, liver, lungs, lymph, lymph nodes, lymphocytes, maxilla, mediastinum, mesentery, myometrium, nasopharynx, retina, oral cavity, ovaries, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary glands, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testes, thymus, thyroid gland, tongue, amygdala, trachea, uterus, vulva, and leukocytes. More preferably, the tumor is selected from prostate cancer, breast cancer, liver cancer, glioma (e.g., glioma), intestinal cancer, cervical cancer, non-small cell lung cancer, lung cancer, pancreatic cancer, gastric cancer, bladder cancer, skin cancer, rhabdomyocarcinoma, squamous cell carcinoma of the tongue, nasopharyngeal cancer, ovarian cancer, placental choriocarcinoma, lymphoma (e.g., non-Hodgkin lymphoma, Hodgkin lymphoma, cutaneous T-cell lymphoma), leukemia, rectal adenocarcinoma, medulloblastoma, meningioma, neurofibroma (e.g., neurofibrosarcoma), ependymoma, schwannoma, astrocytoma, melanoma, mesothelioma, myeloma, chronic myeloid leukemia, acute myeloid leukemia, myelodysplastic syndrome, chronic lymphocytic leukemia, epidermal carcinoma, colon cancer, thymic carcinoma, hematological cancer, head and neck cancer, or oropharyngeal cancer.

[0084] The term "adjustment" in this invention includes upregulation or downregulation. For example, the "reagent for adjusting FoxP3 expression" includes a reagent that increases FoxP3 expression or a reagent that decreases FoxP3 expression, and the "reagent for adjusting Ryr2 expression" includes a reagent that increases Ryr2 expression or a reagent that decreases Ryr2 expression.

[0085] The “treatment” of the present invention includes, but is not limited to, delaying, interrupting, preventing, controlling, stopping, reducing, or reversing the progression or severity of one sign, symptom, disorder, condition, or disease. It does not mean completely eliminating all signs, symptoms, conditions, or disorders associated with the disease.

[0086] The "reagents" of the present invention may represent general-purpose reagents, high-purity reagents, analytical reagents, instrumental analysis reagents, clinical diagnostic reagents, biochemical reagents, inorganic ion chromogenic reagents, or instruments and devices used to generate corresponding functions or achieve specific purposes. For example, the "reagents that improve FoxP3 expression" include any reagents that can improve FoxP3 expression in T cells, such as reagents that introduce the FoxP3 gene into T cells, or reagents that improve the transcription or expression of the FoxP3 gene in T cells. The "reagents that reduce FoxP3 expression" include any reagents that can reduce FoxP3 expression in T cells, such as reagents that knock out or knock down the FoxP3 gene in T cells, or reagents that suppress the transcription or expression of the FoxP3 gene. The aforementioned "reagents for reducing Ryr2 expression" include, but are not limited to, reagents necessary for knocking down or knocking out the Ryr2 gene, reagents for improving FoxP3 expression, or reagents for reducing Ryr2 transcription or expression; for example, the antagonist of the present invention, ryanodine, dantrolene, or JTV519. The aforementioned "reagents for improving Ryr2 expression" include, but are not limited to, reagents for introducing the Ryr2 gene into T cells, reagents for improving the transcription or expression of the Ryr2 gene in T cells, or reagents for reducing FoxP3 expression in T cells. The aforementioned "Ca 2+The "reagents that reduce fundamental vibrations" include, but are not limited to, reagents that reduce Ryr2 expression. 2+ The "reagents that improve fundamental oscillations" include, but are not limited to, reagents that improve Ryr2 expression. The "reagents that reduce m-calpain activity" include, but are not limited to, reagents that reduce Ryr2 expression. The "reagents that improve m-calpain activity" include, but are not limited to, reagents that improve Ryr2 expression. The "reagents that improve the binding strength between T cells and DC cells" include, but are not limited to, reagents that reduce Ryr2 expression. The "reagents that reduce the binding strength between T cells and DC cells" include, but are not limited to, reagents that improve Ryr2 expression.

[0087] The "subjects" of the present invention include, but are not limited to, non-human mammals or humans. Preferably, the non-human mammals include, but are not limited to, monkeys, dogs, mice, and rats.

[0088] The "effective amount" in this invention refers to the amount or dose of the reagent or pharmaceutical product of this invention that provides the expected treatment after being administered to a target or organ in one or more doses.

[0089] The "CMAC" in this invention is a blue fluorescent dye with the chemical name 7-amino-4-chloromethylcoumarin. [Brief explanation of the drawing]

[0090] Hereinafter, embodiments of the present invention will be described in detail with reference to the drawings. [Figure 1] This study analyzes the protein expression of m-calpain in Tconv and Treg cells isolated from wild-type mice. Figures A and B show the protein levels of m-calpain, and Figure C shows the mRNA levels of m-calpain. All values ​​are mean values ​​+ SEM values. [Figure 2]The basal oscillations of Ca2+ in single Tconv and Treg cells in a resting state were analyzed. The detection system consisted of 2 mM Ca2+ HBSS with the Ca2+ probe Fluo 4-AM added, where each line represents one cell, and n is the number of biological repetitions at one data point, with n=20. [Figure 3] This is the mean fluorescence intensity (MFI) of the Ca2+ signal in Tconv and Treg cells in a resting state. MFI is analyzed by staining Tconv and Treg cells with Fluo 4-AM. [Figure 4] Figure 2 shows the standard deviation (SD) of the Ca2+ vibration intensity. [Figure 5] The levels of calcium ion regulation-related proteins in Treg and Tconv were analyzed using the GEO database and sorted by differences. [Figure 6] This is a qPCR analysis of Ryr2 mRNA expression in purified Tconv and Treg cells. [Figure 7] Calpain activity was measured in Tconv (left) and Treg (right) cells after digestion with the calpain substrate CMAC and Ryr activation (4-CMC treatment). [Figure 8] These are the calcium ion fundamental oscillations of Tconv cells (center panel) with Ryr2 suppression using a 5 mM JTV519 inhibitor, wild-type Tconv cells (left panel), and Treg cells (right panel). [Figure 9] This is the standard deviation of calcium ion fundamental oscillations in Tconv cells, wild-type Tconv cells, and Treg cells in which Ryr2 was suppressed using a 5 mM JTV519 inhibitor. [Figure 10] The Ryr2 mRNA transcription levels of Tconv cells isolated from WT mice and Tconv cells in which the Ryr2 gene was knocked down from shRNA were analyzed by qPCR. [Figure 11] This study compares the Ca2+ basal oscillations of Tconv cells in which the Ryr2 gene was knocked down using shRNA, with those of wild-type Tconv cells. [Figure 12]This is the standard deviation of Ca2+ basal oscillations between Tconv cells in which the Ryr2 gene was knocked down using shRNA and wild-type Tconv cells. [Figure 13] Calpain activity in JTV519-treated Tconv (left), JTV519-treated Treg (center), and Ryr2 knockdown Tconv (right). [Figure 14] The adhesion strength of T cells to DC2.4 is detected. The left figure shows the average adhesion strength of untreated Tregs, Tconvs, and JTV519-treated Tconvs, while the right figure shows the average adhesion strength of blank interference control (shCtrl) and Ryr2 knockdown Tconvs. [Figure 15] This study measured the adhesion between OT-II T cells and DC2.4 cells presenting OVA. Figure A shows a schematic diagram of the AFM analysis of the three cell types, while Figure B shows the average adhesion of W / O cells (cell-free group), blank interference control (shCtrl), Ryr2 knockdown Tconv, and Treg suppressor cells. [Figure 16] Figure A shows the FACS diagram of suppressive OT-II T cell division in non-Treg, Treg, blank interference control (shCtrl), or Ryr2 knockdown Tconv cells, and Figure B shows the suppression efficiency of blank interference control (shCtrl) or Ryr2 knockdown Tconv cells standardized by Treg (defined as 100% suppression) and non-Treg (defined as 0% suppression), where *, P < 0.05, **, P < 0.01, ***, P < 0.001, and ****, P < 0.0001. [Figure 17] The shRNA knockdown efficiency of the Itpr1, Cacnb1, Trpm1, Trpm4, Trpv2, Orai1, and Orai3 genes in Tconv cells isolated from WT mice will be analyzed by qPCR. [Figure 18]This shows the average adhesion strength of untreated Treg cells, blank interference control Tconv (shCtrl), Ryr2 knockdown Tconv, Itpr1 knockdown Tconv, Cacnb1 knockdown Tconv, Trpm1 knockdown Tconv, Trpm4 knockdown Tconv, Trpv2 knockdown Tconv, Orai1 knockdown Tconv, and Orai3 knockdown Tconv. [Figure 19] We overexpress FoxP3 to silence Ryr2 gene transcription. Specifically, this involves silencing Ryr2 mRNA levels in FoxP3-overexpressing Tconv, A20, 3T3, and Renca cells. [Figure 20] FoxP3 is overexpressed to silence Ryr2 gene transcription. The images show Foxp3 ChIP-seq, transfected Foxp3 (top), or Foxp3 (bottom) untransfected Tconv. Arrows indicate the TSS site of the Ryr2 gene. Triangles represent significant binding peaks recognized by ChIP-seq, primarily overlapping with the promoter region (block) of this gene. [Figure 21] FoxP3 is overexpressed to silence Ryr2 gene transcription. The upper figure shows a schematic diagram of the Ryr2 promoter-luciferase reporter vector construction, TSS, and transcription start site. The lower figure shows the expression levels of dual luciferase driven by the Ryr2 promoter in FoxP3 overexpressing 3T3 or Renca cells. [Figure 22] FoxP3 is overexpressed to silence Ryr2 gene transcription. Figure A shows the result of deleting the sequence segment in the sequence, i.e., a schematic diagram of the cleaved vector of the Ryr2 promoter-luciferase reporter vector, and Figure B shows the expression levels of the dual luciferase driven by the Ryr2 promoter in FoxP3 overexpression 3T3 in Figure A. [Figure 23]FoxP3 is overexpressed to silence Ryr2 gene transcription. Figure A shows schematic diagrams of two cleavage vectors and knockout strategies for the Ryr2 promoter-luciferase reporter vector, and Figure B shows the expression levels of dual luciferase driven by different cleavage vectors or Ryr2 promoters expressing FoxP3 binding sequences in FoxP3 overexpressing 3T3 cells, with NS indicating no statistically significant difference. [Figure 24] FoxP3 is overexpressed to silence Ryr2 gene transcription. In calcium-free HBSS, 4-CmC stimulates FoxP3-overexpressing A20 or 3T3 cells, and represents the mean trajectory (N=3) of changes in calcium ions over time. For each independent experiment, at least 30 cells are collected for analysis in one measurement. [Figure 25] Immunosuppression was induced in a mouse eczema (Scurfy) model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv), restoring immune homeostasis in Scurfy mice. Figure A shows the weight changes of mice in the wild and after PBS injection, and Figure B shows the weight changes of mice injected with Treg, Ryr2+ / +(Foxp3-)Tconv, and Ryr2- / -Tconv, respectively. [Figure 26] In the Ryr2 gene, Cre is constructed by knocking down mice in a condition that knocks down exon 7. [Figure 27] This study involves flow cytometry detection of the distribution of CD4+ and CD8+ T cells in the spleen and thymus of Ryr2+ / + (Ryr2 non-knockout wild-type) mice, CD4-Cre / Ryr2fl / + mice, and CD4-Cre / Ryr2fl- / fl- mice. [Figure 28] This is the percentage of FoxP3+ / CD4+ spleen cells in mice. [Figure 29]The study involved flow cytometry analysis of Treg function-related surface markers (including CD25, GITR, CTLA-4, CD39, PD-1, LAG-3, and TIM-3) in WTTconv (Ryr2+ / +) and Ryr2- / -Tconv, and ELISA detection of IL-10 and TGF-β levels in the supernatant after 24 hours of anti-CD3 / anti-CD28 stimulation. [Figure 30] This figure shows the detection of basal oscillations in Ryr2 knockdown T cells in vitro. Tconv and Treg isolated from WT (Figure A) or CD4-Cre, Ryr2fl / fl (Ryr2- / -) (Figure B) mice were compared (Figure C), and the oscillation levels and standard deviations of calcium ions were detected in HBSS of 2 mM Ca2+ (Figure D). [Figure 31] Calpain activity in Treg, Ryr2+ / +, and Ryr2- / -Tconv cells is detected by CMAC substrate degradation. [Figure 32] Western blotting shows the results of in vivo substrate talin degradation in three cell types: Treg, Ryr2+ / +, and Ryr2- / -Tconv. [Figure 33] Ryr2 knockdown Tconv cells exhibit stronger adhesion in vitro. All data points from four individual DC-T cell pairs (points in Figures A and B) were collected on the same day under each condition and used to generate the bar graph in Figure C. For each T-DC pair, at least 15 adhesion readings were collected, specifically the adhesion between WT Tconv (Figure A) and Ryr2- / -Tconv cells (Figure B) and DC2.4, and the average adhesion (Figure C). [Figure 34] This experiment examined the adhesion between OT-II T cells and DC2.4 cells presenting OVA. The suppressor cells on the DCs were Treg, WT Tconv, or Ryr2- / -Tconv cells. Figure A shows the AFM measurement device for the three cells, and Figure B shows the average OT-II-DC adhesion strength of Treg, WT Tconv, or Ryr2- / -Tconv as suppressor cells. [Figure 35]This represents the relative inhibition efficiency of non-Treg, Treg, Ryr2+ / +, and Ryr2- / -Tconv, where non-Treg is defined as 0% and Treg as 100%. [Figure 36] Immunosuppression was induced in a herpes-infected mouse model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv). The figure shows the analysis of HSV-1 titers in plantar tissue after cell adoptive transfer. HSV-1, Treg, Ryr2- / -Tconv, and Ryr2+ / +Tconv were adopted from PBS, Treg or Ryr2- / -Tconv, and Ryr2+ / +Tconv, respectively. [Figure 37] Immunosuppression was induced in a herpes-infected mouse model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv). The figure shows delayed hypersensitivity (DTH) after HSV-1 antigen re-attack induced by cell adoptive transfer and UV inactivation. The thickness of the sole of the foot where antigen re-attack was not performed was set to 100%. [Figure 38] Immunosuppression was induced in a herpes-infected mouse model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv). The upper figure shows a proposed test for DTH analysis, and the lower figure shows a typical plantar swelling. [Figure 39] Immunosuppression was induced in a mouse asthma model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv). Figure A shows total BALF infiltration, Figure B shows lymphocyte infiltration, and Figure C shows eosinophil infiltration. All numerical values ​​in the measurement results are the average values ​​from three experiments. Blank spaces represent a blank control group. The PBS, Treg, Ryr2- / -Tconv, and Ryr2+ / +Tconv groups were injected with equal amounts of PBS, Treg, Ryr2- / -Tconv, and Ryr2+ / +Tconv, respectively, into the asthma model. [Figure 40]Immunosuppression was induced in a mouse asthma model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv). Figure A shows the susceptibility parameters of the asthma model, and Figure B shows a representative lung H&E tissue section, scaled to 200 μm. The PBS, Treg, Ryr2- / -Tconv, and Ryr2+ / +Tconv groups were each administered by injecting equal amounts of PBS, Treg, Ryr2- / -Tconv, and Ryr2+ / +Tconv into the asthma model, respectively. [Figure 41] Immunosuppression was induced in a mouse colitis (IBD) model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv). Blank spaces represent the control group, and DSS represents the DSS water treatment group. [Figure 42] Immunosuppression was induced in a mouse colitis (IBD) model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv). Figure A shows the induction method for the DSS-induced colitis model, Figure B shows a representative colon image, and Figure C shows a micrograph of a colon section, both scaled to 200 μm. [Figure 43] Immunosuppression was induced in a mouse colon cancer model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv), and the tumor volume growth curves of the mice in each group were measured. Group 1: MC38+PBS, Group 2: MC38+Ryr2+ / +Tconv, Group 3: MC38+Treg, Group 4: MC38+Ryr2- / -Tconv. [Figure 44] Immunosuppression was induced in a mouse dermatitis (Scurfy) model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv), restoring immune homeostasis in Scurfy mice. Figures show the Kaplan-Meier survival curves of the mice; Figure A shows the survival rates of WT and PBS-injected mice, and Figure B shows the survival rates of mice injected with Treg, Ryr2+ / +(Foxp3-)Tconv, and Ryr2- / -Tconv, respectively. [Figure 45]Immunosuppression was induced in a mouse eczema (Scurfy) model using Ryr2 gene knockdown T cells (Ryr2- / -Tconv), restoring immune homeostasis in Scurfy mice. Figure A shows the physical symptoms and treatment of Scurfy mice, and Figure B shows representative H&E staining of various organs (thymus, spleen, lungs, ears, liver, pancreas, small intestine, colon). Samples were collected at 3 weeks for PBS injection model mice and WT mice, and at 8-12 weeks for mice adopted with Treg cells, Foxp3-(Ryr2+ / +) Tconv, and Ryr2- / -Tconv. [Figure 46] Overexpression of Foxp3 and suppression of Ryr2 is an important mechanism of action for the immunosuppressive effect of T cells. The left figure shows the mechanism of action of T cells that overexpress Foxp3 and suppress Ryr2, while the right figure shows the mechanism of action of wild-type T cells. [Modes for carrying out the invention]

[0091] The technical solutions of embodiments of the present invention will be clearly and completely described below with reference to the drawings of embodiments of the present invention, but it is clear that the embodiments described are only a part of the embodiments of the present invention, not all of them. All other embodiments that a person skilled in the art can obtain based on embodiments of the present invention without requiring any creative effort fall within the scope of the present invention.

[0092] Used in the example experiment Origin of animals, reagents, and equipment mouse All mouse images are on the C57BL / 6 background. Ryr2fl / fl mouse S Produced by GemPharmatech Co.,Ltd. By PCR, Genotype butIdentified. OT-II transgenic mice are purchased from Jackson Laboratory. Wild-type, Foxp3-IRES-GFP, Ryr2fl / fl, Ryr2 transgenic, OT-II transgenic, CD4-Cre, and Foxp3-Cre-YFP, as well as female Foxp3 + / - mice, are housed at the Tsinghua University Animal Center. All mice are housed under specific pathogen-free (SPF) conditions. All animal experiments comply with animal welfare guidelines and are approved by the Tsinghua University Animal Experiment Ethics Committee (IACUC).

[0093] Culture of cell lines and primary cells DC2.4 cells is U Mass Medical School Professor Ken Rock The cells were donated by: Dr. Tan Xu of the School of Pharmacy, Tsinghua University; Dr. An Guangyu of Beijing Chaoyang Hospital; Dr. Guo Wei of the School of Medicine, Tsinghua University; and Dr. MC38 cells, purchased from the American Center for Typical Cell Cultures (ATCC). MC38, Renca, NIH-3T3, and Vero cells were cultured in DMEM containing 10% FBS, 100 U / mL penicillin, and 100 mg / mL streptomycin. All other cells were grown in the same volume of RPMI-1640 containing 50 μM β-mercaptoethanol. Mycoplasma contamination was tested for all cell lines by PCR analysis. Mouse CD4+CD25+ Treg and CD4+CD25-Tconv cells are isolated from the spleen using a mouse CD4+ T cell isolation kit (StemCell, 19852) and a mouse CD25 Treg cell positive selection kit (Stem cell, 18782). Treg and Tconv cells are, in some cases, sorted from Foxp3-IERS-GFP mouse CD4+ spleen cells by FACS. Mouse DCs are isolated from the spleen using a mouse CD11c selection kit II (Stem cell, 28007). OT-II T cells are isolated from OT-II spleen cells using a mouse CD4+ T cell isolation kit (Stem cell, 19852) and, in some cases, sorted using TCRVα2 antibody by FACS.

[0094] Antibodies and reagents All primary cell isolation kits are from StemCell. Recombinant human IL-2 is from R&D systems. Anti-mouse CD3e monoclonal antibody, anti-mouse CD28 and anti-mouse TCRVα2-PE antibody are from eBioscience. Flow cytometry antibody is from eBioscience. moreover This kit includes anti-CD4, anti-CD8, anti-GITR, anti-CD25, anti-PD-1, anti-CTLA-4, anti-Tim-3, and anti-LAG3 antibodies. The anti-FoxP3 antibody is from Invitrogen. Clones of anti-mouse CD4, anti-mouse CD8, anti-mouse GITR, anti-mouse CD25, anti-mouse PD-1, anti-mouse / rat CTLA-4, anti-mouse / rat FoxP3 (FJK-16s), anti-mouse / human Tim-3, anti-mouse LAG3, anti-mouse PD-1 (J43.1), anti-mouse CTLA4 (UC10-4B9), and anti-mouse GITR (DTA-1) are used. The antibodies used for Western blot analysis are m-calpain large subunit (M-type) antibody and anti-mouse IgG-HRP linked antibody, both from CST. The anti-talin antibody (8D4) was purchased from Sigma-Aldrich.

[0095] The pLKO.1 vector, purchased from the shRNA library platform at the Tsinghua University Biomedical Analysis Center, will be used for all gene knockdown experiments. All pre-designed shRNA sequences will be synthesized by Ruiboxingke Biotech.

[0096] The pLVX-IRES-mcherry vector was donated by Dr. Shen Xiaohua of Tsinghua University School of Medicine.

[0097] Example 1: Ryr2 gene knockdown or FoxP3 overgrowth Current model preparation and experimental verification 1. Ryr2 gene knockdown experiment Steps Lentiviral shRNA was used for Ryr2 gene knockdown; specifically, a pre-synthesized shRNA sequence was inserted into the pLKO.1 vector. Using the EndoFree plasmid Midi kit (CWBIO, CW2105S), plasmids containing shRNA and packaging were obtained from transformed E. coli. plasmid (pMD2.G and psPAX2) were purified. reagent Lentin virus packaging was performed according to the instructions. Simply put, 60-80% of the dish. Coverage 293FT cells were cultured in 10 cm dishes. The culture medium was changed 2 hours before DNA transfection. Using Neofect, 2.5 μg of the packaging vector pMD2.G, 2.5 μg of psPAX2, and 5 μg of the pLKO.1 vector (with inserted shRNA) were transfected into 293FT cells. After 72 hours, lentivirus was obtained and T cells were infected with Polybrene (final concentration 8 μg / mL). 48 hours after viral infection, cells were sorted using an Aria flow cytometer (BD Biosciences). Knockdown efficiency was verified by real-time quantitative PCR. The shRNA sequences are shown below.

[0098] Control - shRNA: 5'-CCGGcaacaagatgaagagcaccaaCTCGAGttggtgctcttcatcttgttgTTTTTG-3' (SEQ ID NO:3) and 5’-AATTCAAAAAcaacaagatgaagagcaccaaCTCGAGttggtgctcttcatcttgttgg-3’ (SEQ ID NO:4); Ryr2 - shRNA: 5'-CCGGccgctaatgaagccatataaaCTCGAGTTTATATGGCTTCATTAGCGGTTTTTG-3' (SEQ ID NO:5) and 5’-AATTCAAAAAccgctaatgaagccatataaaCTCGAGTTTATATGGCTTCATTAGCGG-3’ (SEQ ID NO:6); Itpr1 - shRNA: 5'-CCGGgcagtaggtaagaagttattaCTCGAGtaataacttcttacctactgcTTTTTG-3' (SEQ ID NO:7) and 5'-AATTCAAAAAgcagtaggtaagaagttattaCTCGAGtaataacttcttacctactgc-3' (SEQ ID NO:8); Orai1-shRNA:5'-CCGGcacaaccaccaacctcggtcaaaCTCGAGtttgaccgagtgaggttgtgTTTTTG-3'(SEQ ID NO:9)と'-AATTCAAAAAcacaacctcaactcggtcaaaCTCGAGttgaccgagtgaggttgtg-3'(SEQ ID NO:10);Orai3-shRNA:5'-CCGGgcccttgcttatctgtataatCTCGAGattatacagataagcaagggcTTTTTTGG-3'(SEQ ID NO:11)と-AATTCAAAAAAgcccttgcttatctgtataatCTCGAGattatacagataagcaagc-3'(SEQ ID NO:2:1); Trpm1-shRNA:5'-CCGGcggagtgaacatgcagcatttCTCGAGGaaatgctgcatgttcactccgTTTTTG-3'(SEQ ID NO:13)と5'-AATTCAAAAAcggagtgaacatgcagcatttCTCGAGaaatgcatgcatgttcactccg-3'(SEQ-4-4pm: ID:4); 5'-CCGGgcacatcttcacggtgaacaaCTCGAGttgttcaccgtgaagatgtggTTTTTG-3' (SEQ ID NO:15)と5'-AATTCAAAAAgcacatcttcacggtgaacaaCTCGAGttgttcaccgtgaagatgtgc-3'(SEQ ID NO:16);Trpv2-shRNA:5'-CCGGccaaggaacttgtctctatttCTCGAGaatagaacaagttccTGTTG-IDQ'3' NO:17)と5'-AATTCAAAAAccaaggaacttgtctctatttCTCGAGaatagaaaaaaagagctccttgg-3'(SEQ ID NO:18);Cacnb1-shRNA:5'-CCGGtaggaacgcaatggatattaaCTCGAGttaatatccattgcgttcctaTTTG- ID3'(SEQ ID NO:18); NO:19)と-AATTCAAAAAtaggaacgcaatggatattaaCTCGAGttaatattccattgcgttccta-3'(SEQ ID NO:20)。

[0099] 2. Knockdown efficiency was verified by real-time quantitative PCR. The specific steps are shown below.

[0100] Using TRIzol reagent (Invitrogen), Specified Total RNA was extracted from cells, and first-strand cDNA was synthesized using reverse transcriptase M-MLV (TaKaRa). Real-time quantitative PCR was performed using SYBR Green Master Mix (No Rox) (Yeasen). GAPDH or 18S RNA was used as a standardized control. The primer sequences are shown below.

[0101] Mouse GAPDH, 5'-CATCACTGCCACCCAGAAGACTG-3' (SEQ ID NO: 21) and 5'-ATGCCAGTGAGCTTCCCGTTCAG-3' (SEQ ID NO: 22); Mouse 18S RNA, 5'-CGGACAGGATTGACAGATTG-3' (SEQ ID NO: 23) and 5'- CAAATCGCTCCACCAACTAA -3'(SEQ ID NO:24); Mouse Ryr2, 5'-ATGGCTTTAAGGCACAGCG-3'(SEQ ID NO:25) and 5'-CAGAGCCCGAATCATCCAGC-3'(SEQ ID NO:26); Mouse FoxP3, 5'-CCCATCCCCAGGAGTCTTG-3'(SEQ ID NO:27) and 5'-ACCATGACTAGGGGCACTGTA-3'(SEQ ID NO:28); Mouse m-Calhain, 5'- GGTCGCATGAGAGAGCCATC -3' (SEQ ID NO:49) and 5' -CCCCGAGTTTTGCTGGAGTA -3' (SEQ ID NO:50);Mouse Itpr1, 5'-CGTTTTGAGTTTGAAGGCGTTT-3' (SEQ ID NO: 29) and 5'-CATCTTGCGCCAATTCCCG-3' (SEQ ID NO: 30);Mouse Orai1, 5'-GATCGGCCAGAGTTACTCCG-3' (SEQ ID NO: 31) and 5'-TGGGTAGTCATGGTCTGTGTC-3' (SEQ ID NO: 32);Mouse Orai3, 5'-GGCTACCTGGACCTTATGGG-3' (SEQ ID NO: 33) and 5'-GCAGGCACTAAATGTGACC-3' (SEQ ID NO: 34);Mouse Trpm15'-ATCCGAGTCTCCTACGACACC-3' (SEQ ID NO: 35) and 5'-CAGTTTGGACTGCATCTCGAA-3' (SEQ ID NO: 36);Mouse Trpm4, 5'-GGACTGCACACAGGCATTG-3' (SEQ (ID NO:37) and 5'-GTACCTTGCGGGGAATGAGC-3' (SEQ ID NO:38); Mouse Trpv2, 5'-TGCTGAGGTGAACAAAGGAAAG-3' (SEQ ID NO:39) and 5'-TCAAACCGATTTGGGTCCTGT-3' (SEQ ID NO:40); Mouse Cacnb1, 5'-GGCAGCAAGTTATCTCCCAG-3' (SEQ ID NO:41) and 5'-CCACAGGATGATTGGCGTCTT-3' (SEQ ID NO:42); HSV-1 gB, 5'-AACGCGACGCACATCAAG-3' (SEQ ID NO:43) and 5'-CTGGTACGCGATCAGAAAGC-3' (SEQ ID NO:44); HSV-1 LAT, 5'-GGGTGGGCTCGTGTTACAG-3' (SEQ ID NO:45) and 5'-GGACGGGTAAGTAACAGAGTCTCTA-3' (SEQ ID NO:46).

[0102] 3. FoxP3 overexpression experiment Steps A vector was constructed, and FoxP3 was PCR amplified using the cDNA of the total RNA of Treg as a template, with forward primer 5'-ATCGCTCGAGATGTGCACACCTAGGCCA-3' (SEQ ID NO: 47) and reverse primer 5'-ATCGGAATTCTCAAGGGCAGGGATTGGA-3' (SEQ ID NO: 48). The amplified fragments were purified on a gel, digested (XhoI and EcoRI), and cloned into the pLVX-IRES-mcherry plasmid to obtain the pLVX-FoxP3-IRES-mcherry construct. The pLVX-FoxP3-IRES-mcherry construct was then obtained according to the knockdown method described above. lentivirus production and FoxP3 overexpressing cell lines The purification process was carried out. FoxP3 expression was verified by RT-PCR.

[0103] 4. Steps for detection using flow cytometry Cells were incubated with an Fc blocker (CD16 / 32 antibody; 2.4G2) for 5 minutes, then left at room temperature in the dark for 15 minutes with surface antibodies (CD4, CD8, GITR, CD25, PD-1, CTLA-4, TIM-3, LAG3). FoxP3 cells were stained, and the surface-stained cells were incubated with FoxP3 / transcription factor fixation / permeabilization buffer (Thermo Fisher) for 30 minutes, and then incubated with antibodies for 2 hours. 。F ACS Diva Software Controlled Using a Fortessa flow cytometer (BD Biosciences) Sample The data was analyzed using Flowjo software.

[0104] 5. ELISA detection step To detect IL-10 and TGF-β, use anti-CD3 / anti-CD28 antibodies. 6 Several purified Treg cells, Ryr2+ / +, and Ryr2- / - Tconv were stimulated. After 72 hours, the supernatant was collected. The supernatant was stored overnight in a highly binding 96-well ELISA plate (Nunc) at 4°C. incubated . After drying 、2Blocked with %BSA at room temperature for 1 hour. After washing... ,cormorant El every Add 100 μL of diluted cell supernatant. , room It was incubated at a warm temperature for 1 hour. again Wash with PBST (0.05% Tween20, Sigma-Aldrich, in PBS), after that, HRP-labeled goat anti-mouse IL-10 and TGF-β detection antibody by Incubated at room temperature for 0.5 hours. TMB (100 mL / well) was added. 、1 0 minutes at room temperature In a dark place The mixture was incubated, and then the reaction was stopped by adding H2SO4 (50 μL, 1 M) per well. Immediately after stopping, the optical density (OD) was read at 450 nm using an ELISA microplate reader (Bio-Rad).

[0105] 6. Calcium imaging Regarding non-adherent cells, Treg, Tconv and A20 cells 2 The samples were stained with mM fluo-4 AM (Thermo Fisher) at 37°C for 1 hour. After washing, the samples were coated with poly-L-lysine (0.1 mg / mL; Sigma-Aldrich) in a homemade sandwich-like chamber at room temperature. Processed Cells were attached to a circular glass plate. After 15 minutes, excess non-adherent cells were washed off with buffer. Regarding the adherent cells, on the glass plate... growth NIH-3T3 and Renca cells 2 The samples were stained with mM fluo-4 AM (Thermo Fisher) at 37°C for 1 hour. The samples were then placed on an Olympus IX-73 microscope equipped with 20x (numerical aperture: 0.8) or 40x (numerical aperture: 1.2) Olympus objective lenses. Unless otherwise specified, Ca samples were taken at 6-second intervals. 2+ The vibrations were recorded for 20 minutes. In the inhibition experiment, Fluo-4 labeled cells were treated at room temperature in the dark with JTV519 (Sigma) for 30 minutes, and then images were acquired. In the stimulation experiment, Ca was used at 1-second intervals. 2+Oscillations were recorded for 5 minutes. After starting to acquire images, 50-80 seconds later, 4-CmC(Sigma) buffer was added to induce intracellular calcium release. Ca 2+ Experiments were conducted using phenol red-free HBSS medium with or without phenol red. Emission signals from 468 to 550 nm, excited by a 488 nm laser, were recorded using a charge-coupled device camera (ORCA-AG, Hamamatsu Corporation). Data acquisition was controlled by NIS-Elements 3.0 software (Nikon). The time-dependent change in the average fluorescence intensity of single cells was recorded using ImageJ and normalized according to the fluorescence intensity of the first frame (Fluo-4 F / F0). Ca in single cells was also recorded. 2+ Display the vibration peak value, Ca 2+ The standard deviation of vibration intensity is Mean± SEM It was calculated as follows.

[0106] 7. Western blot )vinegar Step Cells were collected and lysed with RIPA buffer (Beyotime, P0013B). The cell lysates were centrifuged and the supernatant was collected. Total protein was quantified using a BCA protein assay kit (Beyotime, P0012). After mixing with 3XSDS injection buffer and boiling for 5 minutes, the protein was injected onto a 7.5% PAGE gel (EpiZyme, PG111). and separated Next, the protein was transferred to an NC membrane, and immunoblotting was performed using the primary and secondary antibodies shown. Finally, the immunohistochemical bands were detected using Super ECL detection reagent (Yeasen, 36208ES76).

[0107] 8. experiment result In CD4-cre Tconv, Ryr2 can be knocked down (Figure 26). Also, Tconv cells Ryr2 knockdown Tconv cells showed no impact on their underlying functions, including mouse body weight and growth rate. Furthermore, CD4+ and CD8+ markers in thymocytes and peripheral blood were also affected. cell The distribution was almost the same as in WT mice (see Figure 27 for flow cytometry detection results). In the spleen The proportion of FoxP3+CD4+ T cells was also maintained at a constant level (Figure 28). Surface markers potentially related to Treg function also did not change compared to WT Tconv (see Figure 29 for flow cytometry and ELISA detection results). Ryr2 knockdown Tconv showed basal Ca 2+ The level has decreased, and the vibration intensity has decreased (calcium imaging results are shown in Figure 1). 11 and Figure (See Figure 30). CMAC digestion in Ryr2- / -Tconv is reduced to a level similar to that of Treg compared to untreated Tconv (Figure 31). Similar to Treg, talin digestion is severely deficient in Ryr2- / -Tconv (see Figure 32 for western blot detection results).

[0108] Example 2: Verification of the effect of FoxP3 expression on the Ryr2 gene and determination of the target site. In this example, to determine the specificity of Ryr2 gene regulation, Ryr2 gene regulation was associated with FoxP3 expression, and the target site was determined.

[0109] First, FoxP3 was overexpressed in all four tumor lines: T cells, B cells (A20), 3T3, and Renca (using the method from Example 1). In these four cases, FoxP3 overexpression significantly blocked the transcription of the Ryr2 gene, suggesting that FoxP3 spontaneously targets Ryr2 (Figure 19).

[0110] Next, a whole-genome chip-seq dataset was created for gene expression analysis. ChIP-seq data was downloaded from the GEO dataset, with the GEO ID being Foxp3 in Tconv GSM989036. FoxP3 in Tconv cells was transduced as the expression marker-Foxp3 GSM989034. IGV (v2.4.14) facilitated the visualization of ChIP-seq data using the mouse reference genome mm8, as shown in the screenshots of specific loci. When this dataset was focused on the 40kb region around the Ryr2 gene using the IGV program, a strong signal was detected in the 1.5kb promoter region in the untransfected control group (Figure 20).

[0111] Furthermore, the above region was cloned, including both FoxP3 overexpression and non-FoxP3 overexpression groups, and under the control of this promoter, 3T3 and Renca cells were subjected to the following experiments. to manifest Ru An expression vector for the luciferase reporter gene was constructed. Figure 21 shows that overexpression of FoxP3 reduces luciferase activity. . one Ren Cutting In the experiment, Ryr2 Promoter From the TSS site to a predetermined area of ​​300bp to 500bp Foxp3 The inhibitory activity was gradually reduced.

[0112] Finally, the FoxP3 binding site was determined to be the GCAGGGG sequence, which appears twice. When mutations occur in these two sites, FoxP3 overexpression loses its ability to suppress luciferase, indicating that these two sites are the binding sites for promoter FoxP3 (Figure 23). Furthermore, the suppression of luciferase activity was also found in Ryr2 Ca mediated by 2+ To further confirm the relationship with activity, in this embodiment, 4-CmC induction FoxP3 overexpression group vs. FoxP3 non-overexpression group in 3T3 and A20 cells A calcium signal was detected. Figure 24 shows the Ca2C reaction driven by FoxP3 in FoxP3-transfected cells.2+ The signal is much smaller. This indicates that Ryr2 is indeed a key channel that is directly regulated by FoxP3 and suppresses T cell activity.

[0113] Here, the steps of the dual luciferase reporter assay according to this embodiment refer to the literature Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3 (Seth et al., Cell 122, 669-682, 2005) and LFA-1-mediated adhesion is regulated by cytoskeletal restraint and by a Ca2+-dependent protease, calpain (Stewart et al., J Cell Biol 140, 699-707, 1998). For convenience, a complete 1500bp promoter sequence and each cleaved promoter sequence are provided. of each Luciferase Current Kutar pGL3 Subcloning And each We constructed a mouse Ryr2 reporter plasmid. . Distribution The plasmid was confirmed to be correct by column determination. Using Neofect (KS2000), 300ng Ryr2 reporter gene and sea kidney luciferase reporter gene plasmid 1.25 × 10⁵ FoxP3 overexpressing 3T3, FoxP3 overexpressing Renca, or FoxP3 overexpressing A20 cells to Co-transfection was performed. 36 hours after transfection, cell lysates were prepared and analyzed using a dual luciferase reporter assay system (Promega).

[0114] Example 3: Ca in T cells 2+ The effect of Ryr2 suppression on the level 1. Differences in m-calpain and DC binding capacity between Tconv and Treg. Since m-calpain activity in Tregs is low, in this example, we consider whether or not its expression level is low. to determine fixed TryAlso, m-calpain is the Ca in cells. 2+ The availability of Tconv and Treg will be adjusted accordingly, so the C in hibernation state will be affected. 2+ A signal was detected.

[0115] As a result, as shown in Figures 1A, B, and C, there was no difference in m-calpain at either the protein or mRNA level between Tconv and Treg. . basis Foundation Ca 2+ Oscillation is a common feature of many immune cells, including Tconv, but this activity is almost absent in Tregs. That is, individual Tregs are Ca 2+ The peak values ​​of the vibration are not shown (Figures 2 and 3). Ca 2+ The standard deviation of vibrational intensity was significantly smaller in Treg than in Tconv (Figure 4). This indicates that m-calpain activity is blocked in Treg, giving Treg a very strong DC binding ability based on LFA-1 / icam-1.

[0116] 2. Ca 2+ Determining the factors that affect the level When T cells are activated, Ca 2+ The signal originates from the IP3R channel, which is a cascade of immunotyrosine-mediated signals leading to secondary Ca 2+ This is a result of expansion to amplification events, and this activation-inducing signal is not present in resting cells. In this example, several Ca2+ cells included in the database GEO DataSets (reference: A mechanism for expansion of regulatory T-cell repertoire and its role in self-tolerance (Feng et al., Nature, 2015)) are used. 2+ Using data on factors that influence signal modulation (specifically shown in Figure 5), we investigated the underlying Ca in Tregs. 2+We investigated the reasons for the low levels and ranked the expression levels of Treg and Tconv based on the degree of difference. As shown in Figure 5, the difference in Ryr2 was the greatest, with Tconv expression levels being more than 5 times log2 higher than Treg (32-fold linear), and the p-value was 2.57 × 10⁻⁶. -14 This conclusion was confirmed by further analysis using qPCR (see Figure 6).

[0117] Here, GEO database analysis Step The following was done: Based on three RNA-Seq studies published in the NCBI GEO database (GSE71162), proteins were classified by expression level. Calcium-related proteins were ranked using GO analysis. The functions of these proteins are annotated based on UniProt (http: / / www.uniprot.org / ). Proteins were ranked according to the degree of difference in Treg and Tconv expression.

[0118] Ryr receptors ER Ryr1, 2, and 3 are located on the membrane, and in human PBMCs, Ryr1 is expressed in the CD19+ population, while Ryr2 is expressed in the CD3+ region. To confirm the low expression level of Ryr2 in Tregs, the digestion rate of CMAC (calpain substrate) was observed using the stimulating factor 4-CMC. As shown in Figure 7, 4-CMC could completely induce calpain activity, while Tregs were not sensitive to this treatment, and it was confirmed that Ryr2 expression was reduced in Tregs.

[0119] 3. Ca by suppression of Ryr2 in Tconv cells 2+ Level and foundation vibration reduction In this example, Ca after Ryr2 suppression 2+ Further examination of the signal changes revealed that, as shown in Figures 8 and 9, the peak value was also Ca 2+ The standard deviation of the signal was also close to that of Treg cells in Ryr2-suppressed Tconv cells, and calcium ion levels were significantly lower compared to Tconv cells that did not suppress Ryr2.

[0120] Based on the above, Ca of T cell subgroups 2+ The decrease in levels is primarily controlled by transcriptional repression of Ryr2.

[0121] Example 4: Enhancement of T cell-DC binding by Ryr2 blocking 1. By Tconv with Ryr2 knocked down, Ca 2+ It is possible to lower the level.

[0122] Ryr2 inhibition is Ca in Tconv 2+ To genetically confirm the cause of the level decrease, Ryr2 knockdown was performed in this example using shRNA interference. The transcription mRNA levels of Ryr2-specific shRNA-knocked Ryr2 were compared with those of unknocked Ryr2 (Figure 10). However, In Ryr2 knockdown Tconv, compared to the control group, basal cellular calcium levels were higher. 2+ The level has dropped significantly. death, Ca 2+ The peak value decreased, Tra 2+ The standard deviation of the change also decreased. (Figures 11 and 12) . Ryr2 suppression by JTV519 treatment Results of low m-calpain substrate digestion treatment And They matched (Figure 13).

[0123] Here, calpain activity of measurement Step To measure calpain activity, 10 μL of medium containing 20 μM calpain substrate CMAC (t-BOC-Leu-Met, Thermo Fisher) was used. 5 The T cells were incubated at room temperature in the dark. After 5 minutes of incubation, the reaction was stopped with 1% PFA (Biosharp), and the cells were immediately placed on ice. Fortessa Calpain activity was defined as the fluorescent signal emitted from the substrate digested via the Hoechst blue channel using a flow cytometer. In all experiments, the inhibitor JTV519 was added 30 minutes prior to the experiment. , life 4-CmC fermentation agent teeth CMAC At the same time Added.

[0124] 2. Effects of Ryr2 deficiency in Tconv cells on T cell-DC binding To investigate the effects of Ryr2 reduction and loss of m-calpain activity on T cell-DC binding, this example involved blocking Ryr2 in Tconv using shRNA and JTV519. The results showed that both treatments induced stronger contact with dendritic cells than Tregs (Figure 14).

[0125] Furthermore, the improved binding of treated Tconv to DCs allows antigen-specific Tconv to stably bind to the same DC. I can't To confirm, 3 Cell adhesion analysis was performed (Reference: Strong adhesion by regulatory T cells induces dendritic cell cytoskeletal polarization and contact-dependent lethargy (Chen et al., The Journal of experimental medicine, 2017)). As a result, Treg and Ryr2 Knockdown The modified Tconv significantly suppressed the binding strength between OTII and OVA-supported DCs (Figure 15). Therefore, at the single-cell level, it was confirmed that Tconv with reduced Ryr2 activity had an ability to inhibit Tconv-DC interaction equivalent to that of Treg. Next, typical DC-mediated antigen presentation... experiment In this context, OTII of shRNA-treated Tconv division The inhibitory capacity was tested. As a result, as shown in Figure 16, these cells showed a decrease in OTII division, similar to Treg cells. ability This showed other potential Ca22 compounds that may act similarly to Ryr2. 2+In investigations of channel activity, shRNAs that reduced these activities were produced in CD4 Tconv cells, and the binding of these shRNAs to DCs was tested using SCFS. As a result, as shown in Figures 17 and 18, knockdown of all but Ryr2 did not improve the binding of treated T cells to DCs, confirming the special involvement of Ryr2.

[0126] Here, in vitro suppression Experimental Steps Purified OTII T cells were stained with CellTrace CFSE (Thermo Fisher Scientific). 。1 0 4 individual Derived from spleen cells Purified DC, 2 x 10 4 Mix 10 OTII T cells, 2 × 10 Tregs or Ryr2- / -Tconvs or Ryr2 knockdown Tconvs, and 2 μM OVA323-339 peptide in a 96-well U-bottom plate. To The cultures were then subjected to CFSE using a Fortessa flow cytometer. of Dilution Detect We evaluated the proliferation of OTII T cells. We calculated the suppression percentage from (1-proliferation%) and normalized the data by setting the non-Treg group as 0% suppression and the Treg group as 100% suppression.

[0127] 3. Confirmation of the binding status with DCs in the case of Ryr2 deficiency using force spectroscopy. Similarly, force spectra also showed that Ryr2 deficiency increased binding to DCs (Figure 33). studies Analysis revealed an enhanced ability to interfere with contact between DCs and T cells (Figure 34). More importantly, Ryr2- / -Tconv cells exhibited similar ability to Treg cells in suppressing OTII amplification induced by antigen-positive dendritic cell stimulation (Figure 35). Therefore, simply restricting Ryr2 in Tconv cells can provide the ability to suppress DC-mediated T cell activation in vitro. Figure 46 shows the immunosuppressive effect of T cells with suppressed Ryr2.

[0128] Here, single-cell force spectra obtained by atomic force microscopy detectionThe steps are as described above. ru. The experiment was conducted using a JPK CellHesion apparatus (references: Alum interaction with dendritic cell membrane lipids is essential for its adjuvanticity (Flach et al., Nat Med 17, 479-487, 2011) and Strong adhesion by regulatory T cells induces dendritic cell cytoskeletal polarization and contact-dependent lethargy (Chen et al., The Journal of experimental medicine, 2017)). In short, to measure the T-DC adhesion strength in a two-cell system, DC2.4 cells were placed on untreated glass. seat The cells were cultured. T cells were treated overnight with 200 U / mL of human IL-2. glass film It was transferred to an AFM-compatible chamber and mounted on the machine table. The clean cantilever was coated with CellTak (BD). A single T cell at the tip of the cantilever It was attached to the AFM cantilever carrying a single T cell. The cantilever was lowered, brought into contact with a single DC, and after a 15-second interaction, it was moved upward until the two cells were completely separated. This allowed for... Force spectrum The curve was obtained. This process was then repeated. In the 3-cell system, glass was used before the experiment. seat The DC2.4 cells cultured above were treated with 100 μg / mL of soluble OVA protein for 4 hours. IL-2 treated Treg / Tconv cells were stained with 10 μM CFSE, and the DC2.4 cells were incubated with these fluorescently labeled Treg or Tconv cells for approximately 20 minutes, after which unlabeled OT-II T cells were added. Next, the cantilever tip containing the OT-II T cells was stained purple. Outer We approached Treg / Tconv cell-DC pairs recognized by a rush lamp. Tconv contactWe analyzed OT-II-DC adhesion inhibition mediated by OT-II. In each cycle, an AFM cantilever carrying a single T cell was lowered by 0.5–2 μm until the first force curve was generated. The T cell on the cantilever was then allowed to interact with a DC for 15 s, and the cantilever was moved upward until the two cells were completely separated. The incubator containing the machine was placed at 37°C and 5% CO2. In all experiments, at least 14 force curves were collected for further analysis. The force curves were processed using JPK image processing software. satiety Select only the appropriate cells and apply AFM detection The following was performed: In each SCFS experiment, one T-DC pair was used to generate force readings for each up and down cycle within a few minutes. At least three pairs of data were used for each condition.

[0129] Example 5: The role of Ryr2- / -T cells in HSV-1 infection 1. Steps for creating and testing a herpes infection model 10 6 The reaction was induced in the hind paw pads of the plantar surface in 20 μL of PBS using pfu HSV-1 (F strain). At 3 dpi, the cells were 2 × 10⁶ 5 Individual cells / 20 μL PBS were used to introduce Treg, Ryr2- / -Tconv, or Ryr2+ / +Tconv into the soles of the feet. At 7 dpi, viral titers were tested using homogenated plantar tissue. Each group consisted of 4-6 mice, and the experiment was repeated three times.

[0130] For DTH, at 6 dpi, UV-inactivated HSV-1 (10 6 After reactivating the right sole of the foot with pfu / 20 μL PBS, plantar swelling was measured at 7 dpi, with the left sole of the foot used as a control. Each group consisted of 16-21 mice.

[0131] 2 , conclusion Fruit In herpes infection models, Treg or Ryr2- / -Tcon v When injected, HSV-1 Promote amplification, Infusion of Ryr2+ / +Tconv compared to inoculation with virus (PBS) alone HSV-1's pfuIt did not increase (see Figure 36). Next, the same model was used to detect the DTH response. HSV-1 The After two doses, the sensitized soles swelled, but the increase in sole thickness decreased in both the Treg and Ryr2- / -Tconv injections. In the control group, neither Ryr2+ / +Tconv nor virus monotherapy (PBS) reduced thickness (Figures 37 and 38).

[0132] Example 6: The role of Ryr2- / -T cells in a mouse asthma model 1. Creation of an asthma model and experiment Step Airway inflammation was induced with ovalbumin (OVA). Mice were sensitized by two intracellular injections of OVA and alum adjuvant (100 μg + 4 mg) on ​​days 0 and 14. Intratracheal OVA shock was repeatedly administered to the posterior lingual region on days 21, 23, and 25. 10 6 Individual Treg, Ryr2- / -Tconv, Ryr2+ / +Tconv, or PBS were IV adopted. On day 32, We analyzed immune cell infiltration in bronchoalveolar lavage fluid from euthanized mice and performed pathological analysis of lung tissue. .

[0133] 2. H&E staining Step lung All tissues at 4°C 4% no ho The sample was immobilized in tourmaline. Then, the sample was embedded in paraffin. Thickness: 5-6 μm. flake cut . The samples were stained with matoxylin and eosin.

[0134] 3. experiment result In the OVA-sensitized asthma model prepared according to the sensitization schedule in Figure 40A, infusion of Treg and Ryr2- / -Tconv showed comparable effects in limiting BALF cell count, as did the degree of reduction in lymphocytes and eosinophils (Figure 39). Histological examination is shown in Figure 40B.

[0135] Example 7: The effects of Ryr2- / -T cells in a mouse model of colitis 1. Creation of a DSS-induced colitis (IBD) model and experimentStep For a DSS-inducing mouse model of experimental colitis, refer to the literature "Inhibition of Dectin-1 Signaling Ameliorates Colitis by Inducing Lactobacillus-Mediated Regulatory T Cell Expansion in the Intestine" (Tang et al., Cell Host Microbe 18, 183-197, 2015) and "Myeloid-Derived Suppressor Cells Are Controlled by Regulatory T Cells via TGF-beta during Murine Colitis" (Lee et al., Cell Rep 17, 3219-3232, 2016). In short, 3 × 10⁶ male C57BL / 6 mice are given 3 × 10⁶ cells. 6 Individual Ryr2- / -Tconv, wild-type Tconv, or Treg cells were introduced as IV adoptive cells. The following day, 4% DSS (w / v) water 7 days Interjection After inducing colitis (Yeason, MW = 36,000-50,000 Da), then normal drinking water They changed it and continued raising the animals. Normal control mice were administered PBS and given normal drinking water. On day 10, the mice were killed, and the colon was dissected to measure its length. The colon was then fixed with 4% PFA at 4°C for 48 hours and used for subsequent H&E staining. Colon sections were observed using 3DHISTECH Pannoramic Scan (3DHISTECH). Each group consisted of 11-18 mice.

[0136] 2. H&E Histological Steps colon organization to 4 4% at ℃ no ho It was then fixed in tourmaline. sample It was embedded. A thickness of 5-6 μm. flake cut . The samples were stained with matoxylin and eosin.

[0137] 3. experiment result In the colitis model prepared according to the induction schedule shown in Figure 42A, the colon length was shortened in the group injected with Treg and Ryr2- / -Tconv. v is Both are Ryr2- / -Tcon v and Compared to other methods, we were able to reduce colon damage (Figures 41 and 42).

[0138] Example 8: Effects of Ryr2- / -T cells in a mouse colon cancer model 1. Creation of a colon cancer tumor model and experiment Step A tumor mouse model was created by transplanting cells based on the literature "Oxidative stress controls regulatory T cell apoptosis and suppressor activity and PD-L1-blockade resistance in tumor" (Maj et al., Nat Immunol 18, 1332-1341, 2017). In short, MC38 colon cancer cells were washed twice with PBS, and then... 、5 ×10 5 10 MC38 cells and 10 6 individual T cells After mixing, The drug was injected subcutaneously into the abdomen of a 6-week-old male C57BL / 6 mouse. inoculation From the 7th day onward, the tumor was examined using calipers every 4-5 days. size of Weighing The volume was calculated as (length × width × width) / 2. Group 1: MC38 + PBS, Group 2: MC38 + Ryr2 + / + Tconv, Group 3: MC38 + Treg, Group 4: MC38 + Ryr2- / - Tconv. Each group consisted of 10 mice.

[0139] 2. experiment result In the MC38 tumor model, injection of Treg and Ryr2- / -Tconv promoted tumor growth, but no significant effect was observed in the PBS and Ryr2+ / +Tconv groups (Figure 43).

[0140] Example 9: Restoration of immune homeostasis by Ryr2- / -T cells in a mouse dermatitis model In this example, since the role of Ryr2- / -Tconv cells in general inflammation caused by multi-organ autoimmunity was the most significant, a Foxp3-deficient mouse model was constructed, and the restoration of immune homeostasis in Foxp3-deficient immune-deficient mice under the regulation of Ryr2- / -Tconv cells was investigated.

[0141] 1. Scurfy mouse model Based on the literature "A requisite role for induced regulatory T cells in tolerance based on expanding antigen receptor diversity" (Haribhai et al., Immunity 35, 109-122, 2011) and "TGF-beta-induced Foxp3+ regulatory T cells rescue scurfy mice" (Huter et al., Eur J Immunol 38, 1814-1821, 2008), a dermatitis model using Foxp3-deficient mice was created. 5×10 6 One purified T cell was washed twice with PBS, deuterated in 50 μL of PBS, and intraperitoneally injected. Injection was performed on postnatal day 2 or 3 of newly diagnosed homologous dermatitis mice. For the first two weeks, T cell adoptive transfer was performed every 3-4 days, and thereafter, once every two weeks. At the time of adoptive transfer, the body weight of the dermatitis model and male WT symbiotic pups was recorded and survival rates were monitored. All mice were sampled on the day of birth, and genotyping for the sf mutation gene was performed by PCR, and genotype was verified by sequencing. The primers for FoxP3 PCR were 5'-CATCCCACTGTGACGAGATG-3' (SEQ ID NO: 1) and 5'-ACTTGGAGCACAGGGGTCT-3' (SEQ ID NO: 2). Histologically, mice injected with PBS were analyzed at 3 weeks, and mice adopted with Treg and Ryr2- / -Tconv were analyzed at 8-12 weeks.

[0142] 2. H&E Histological Steps Skin, ears, liver, and other tissues all at 4°C for 4% no hoThe sample was immobilized in tourmaline. Then, the sample was embedded in paraffin. Thickness: 5-6 μm. flake I cut it. He The samples were stained with matoxylin and eosin.

[0143] 3. experiment result Mice with dermatitis (FoxP3- / -, C57BL / 6) were injected with PBS, Treg, Ryr2+ / +Tconv, or Ryr2- / -Tconv at 2-3 days postnatal. As expected, all mice injected with PBS or Ryr2+ / +Tconv died at 2-4 weeks postnatally. On the other hand, all mice injected with Treg or Ryr2- / -Tconv survived for at least 20 weeks (Figures 44 and 25). Furthermore, no deaths or obvious abnormalities were observed in the dermatitis-affected mice injected with Ryr2- / -Tconv after 6 months of follow-up.

[0144] Histological results are shown in Figure 45. As expected, mice injected with PBS or Ryr2+ / +Tconv exhibited severe thyroiditis, spleenitis, pneumonia, dermatitis, hepatitis, pancreatitis, gastritis, and colitis. On the other hand, all mice injected with Treg or Ryr2- / -Tconv were cured of these diseases, meaning that the overall functional deficiency in FoxP3-deficient mice was restored, suggesting that Ryr2 modulates the immune function of T cells.

[0145] Based on the above, Ryr2- / -T and Treg cells exhibit functionally identical effects in mouse herpes infection models, asthma models, colitis models, and colon cancer models, and furthermore, Dermatitis We were also able to restore immune function in mice. In other words, in some diseases in which Tregs are known to have immunomodulatory effects, Ryr2- / -T has been shown to perform equivalent actions.

[0146] Although preferred embodiments of the present invention have been described in detail above, the present invention is not limited to the details of the above embodiments, and various modifications can be made to the technical solution means of the present invention without departing from the technical concept of the present invention, and all of these simple modifications fall within the scope of the patent of the present invention.

[0147] Furthermore, the specific technical features described in the above-mentioned embodiments may be combined in any suitable manner, as long as they do not contradict each other, and in order to avoid unnecessary duplication, the present invention will not describe various possible combinations again.

Claims

1. A pharmaceutical product for treating infectious diseases or inflammation, comprising a reagent that reduces Ryr2 expression, The reagent for reducing Ryr2 expression comprises shRNA, ryanodine, dantrolene, or JTV519. The aforementioned shRNAs are SEQ ID NO: 5 and SEQ ID NO:

6. Pharmaceuticals.

2. The pharmaceutical product according to claim 1, characterized in that the infectious disease is selected from bacterial infection, viral infection, or fungal infection.

3. The pharmaceutical product according to claim 2, characterized in that the infectious disease is selected from pneumonia with infectious shock, peritonitis, bacteremia, pustulosis, or sepsis, and the viral infection is selected from acute viral infection or chronic viral infection.

4. The pharmaceutical product according to claim 2, characterized in that the virus is selected from influenza virus, parainfluenza virus, herpes virus, measles virus, varicella-stomatitis virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, lymphocytic choriomeningitis virus, or human papillomavirus.

5. The pharmaceutical product according to claim 1, characterized in that the inflammation is selected from systemic lupus erythematosus, rheumatoid arthritis, psoriatic arthritis, scleroderma, asthma, atopic dermatitis, organ-specific inflammatory diseases, allergies, folliculitis, tonsillitis, pneumonia, hepatitis, nephritis, acne, autoimmune diseases, chronic prostatitis, glomerulonephritis, hypersensitivity, colitis, inflammatory bowel disease, pelvic ulcer, reperfusion injury, transplant rejection, vasculitis, or interstitial cystitis.

6. Ca ２＋ A composition for reducing fundamental vibration, reducing m-calpain activity, or improving the binding strength between T cells and DC cells, comprising a reagent that reduces Ryr2 expression in T cells, A reagent for reducing Ryr2 expression in T cells comprises a vector, plasmid, or lentivirus containing DNA encoding FoxP3, or a Ryr2 inhibitor, wherein the Ryr2 inhibitor is selected from shRNA, ryanodine, dantrolene, or JTV519. The shRNA is the composition shown in SEQ ID NO: 5 and SEQ ID NO:

6.

7. Ca ２＋ A composition for improving fundamental vibration, improving m-calpain activity, or reducing the binding strength between T cells and DC cells, comprising a reagent that improves Ryr2 expression in T cells, A reagent for improving Ryr2 expression in T cells comprises a Ryr2 activator, characterized in that the Ryr2 activator is selected from nicotinamide adenine dinucleotide phosphate, caffeine, 4-chloro-m-cresol, ryanodine, chlorantraniliprole, cyantraniliprole, type B adrenaline, 4-chloro-3-methylphenol, cyantraniliprole, cyclaniliprole, cyclic adenosine diphosphate ribose, suramin sodium, tetraniliprole, or trifluoperazine.

8. T cells characterized by overexpression of Ryr2.

9. The T cell according to claim 8, characterized in that the T cell is a Treg cell.

Images