Lentiviral vectors in hematopoietic stem cells for the treatment of Wiscott-Aldrich syndrome (WAS)

Abstract

In certain embodiments, a lentiviral vector for treating Wiskott-Aldrich syndrome (WAS) is provided. In certain embodiments, the vector comprises an expression cassette comprising a nucleic acid construct comprising an effective fragment of the endogenous promoter of the WAS gene, the promoter having a length of up to 600 bp, the sequence of HS1pro, and a nucleic acid encoding the Wiskott-Aldrich syndrome protein (WASp) operably linked to the effective fragment of the endogenous promoter of the WAS gene.

Description

[Background technology]

[0001] Cross-reference with related applications This application claims priority and interest to USSN62 / 933,875, filed on November 11, 2019, which is incorporated herein by reference in its entirety for all purposes.

[0002] Description of government support [No results found]

[0003] Inclusion by referencing sequence listings provided as text files The sequence listing was created on November 9, 2020, and is provided with this specification as a text file named "UCLA-P220P_ST25.txt" with a size of 82.1kb. The entire contents of the text file are incorporated herein by reference.

[0004] Wiscott-Aldrich syndrome (WAS) is an X-linked primary immunodeficiency caused by mutations in the Wiscott-Aldrich gene. Patients with WAS have severely impaired acquired and congenital immunity and are highly susceptible to life-threatening viral and bacterial infections. They also suffer from excessively severe eczema, microthrombocytopenia, and are at very high risk of developing autoimmune diseases and cancer.

[0005] WAS is caused by an X-linked recessive pattern in its inheritance and predominantly occurs in males, affecting 1 to 10 males per million. The first signs are typically petechiae and purpura, resulting from a low platelet count (i.e., thrombocytopenia). Spontaneous nosebleeds and bloody diarrhea are also common, and eczema typically progresses during the first month after birth. Recurrent bacterial infections typically progress within three months. In the majority of children with WAS, at least one autoimmune disease progresses, and cancer (often lymphoma and leukemia) progresses in up to one in three patients. Immunoglobulin M (IgM) levels are typically decreased, IgA and IgE are typically increased, and IgG levels can be normal, decreased, or increased. In addition to thrombocytopenia, WAS patients have abnormally small platelets (i.e., microthrombocytopenia), and about 30% also have an increased eosinophil count (i.e., eosinophilia).

[0006] Treatment for WAS typically involves prophylactic antibiotics and antiviral therapy to manage infections. Thrombocytopenia (low platelet count) is treated with platelet infusions and splenectomy. In addition, blood transfusions may be necessary to treat anemia caused by excessive bleeding, and protective helmets can be used to prevent cerebral hemorrhage resulting from head injuries. Immunosuppressive therapy is used to treat autoimmune symptoms.

[0007] Patients with WAS typically do not receive live viral vaccines because they have abnormal T and B lymphocyte function, making viral vaccine stress potentially triggering the disease. Complications of chickentopox infection may occur, which can be prevented with antiviral agents, high-dose immunoglobulin compensatory therapy, or early treatment following exposure to varicella-zoster immunoglobulin (VZIG). Other "non-live" vaccines can be safely administered to patients with WAS, but these do not produce prophylactic levels of antibody production.

[0008] A potential cure is allogeneic hematopoietic stem cell transplantation derived from an HLA-matched donor. However, this treatment is not a viable option for many patients because suitable donors are often unavailable.

[0009] An alternative curative therapy is autologous hematopoietic stem cell (HSC) transplantation via ex vivo gene therapy. In this approach, the patient functions as their own donor, eliminating the risk of immunological complications. The success of implementing this approach depends on developing lentiviral vectors or CRISPR-based therapies to introduce functional copies of the target gene or to correct pathogenic mutations in the patient's HSCs.

[0010] Previous virus-based therapies used the CMMP-WASγ retroviral vector. This therapy restored function and platelet count in all patients. However, in 7 / 9 of patients, acute leukemia developed due to insertional oncogenes (see, e.g., Braun (2014) Sci. Transl. Med. 6(227):227ra33).

[0011] Another treatment involves using a safer SIN lentiviral vector derived from a 1.6kb promoter fragment of the endogenous WAS gene. With this vector, approximately 6 / 7 of patients showed clinical improvement after gene therapy. T, B, and NK cells were functional, and normal immune cell counts were restored. In addition, the severity and frequency of infections decreased, and severe eczema resolved. However, platelet counts and average platelet size remained below normal levels. Patients still had microthrombocytopenia and maintained a risk of developing serious bleeding. [Overview of the project]

[0012] This specification describes the development of novel lentiviral vectors (LVs) for the treatment of Wiscott-Aldrich syndrome (WAS). The vectors described herein are thought to exhibit better (higher) expression in megakaryocytes than current lentiviral vectors and to be able to restore platelet counts to normal levels in WAS patients. In addition, the vectors described herein are thought to maintain similar levels of expression to the pre-WAS gene-expressing SIN LV in all other hematopoietic cell lines, and therefore are thought to be able to restore the number and function of T, B, and NK cells.

[0013] Therefore, the various embodiments described herein may include, but are not limited to, one or more of the following:

[0014] Embodiment 1: Recombinant lentiviral vector (LV) for the treatment of Wiscott-Aldrich syndrome (WAS), wherein the vector is It is an expression cassette, A nucleic acid encoding an effective fragment of the endogenous promoter of the WAS gene, wherein the promoter has a maximum length of 600 bp and contains the HS1pro sequence (SEQ ID NO: 1), and A nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp) operably ligated to the above effective fragment of the endogenous promoter of the WAS gene, The vector, comprising the expression cassette, which includes the expression cassette.

[0015] Embodiment 2: The vector according to Embodiment 1, wherein the sequence of the effective fragment of the endogenous promoter of the WAS gene consists of the sequence of HS1pro (SEQ ID NO: 1).

[0016] Embodiment 3: The vector according to any one of Embodiments 1 to 2, wherein the expression cassette includes a slim enhancer element 2 (SEQ ID NO: 2 = SEQ ID NOs: 3 to 8) or an effective fragment thereof.

[0017] Embodiment 4: The expression cassette contains an effective fragment of enhancer element 2, and the fragment contains the core sub-element 1 (SEQ ID NO: 3 + SEQ ID NO: 4) of enhancer element 2, the core sub-element 4 (SEQ ID NO: 7) of enhancer element 2, and the core sub-element 5 (SEQ ID NO: 8) of enhancer element 2, or consists of these, the vector according to Embodiment 3.

[0018] Embodiment 5: The expression cassette contains an effective fragment of enhancer element 2, and the fragment consists of the core sub-element 1 (SEQ ID NO: 3 + SEQ ID NO: 4) of enhancer element 2, the core sub-element 4 (SEQ ID NO: 7) of enhancer element 2, and the core sub-element 5 (SEQ ID NO: 8) of enhancer element 2, the vector according to Embodiment 4.

[0019] Embodiment 6: The expression cassette contains an effective fragment of enhancer element 2, and the fragment contains the first half (SEQ ID NO: 3) of the core sub-element 1 of enhancer element 2 and the core sub-element 5 (SEQ ID NO: 8) of enhancer element 2, or consists of these, the vector according to Embodiment 3.

[0020] Embodiment 7: The expression cassette contains an effective fragment of enhancer element 2, and the fragment consists of the first half (SEQ ID NO: 3) of the core sub-element 1 of enhancer element 2 and the core sub-element 5 (SEQ ID NO: 8) of enhancer element 2, the vector according to Embodiment 6.

[0021] Embodiment 8: The expression cassette contains an effective fragment of enhancer element 2, and the fragment contains the first half (SEQ ID NO: 3) of the core sub-element 1 of enhancer element 2, or consists of this, the vector according to Embodiment 3.

[0022] Embodiment 9: The expression cassette contains an effective fragment of enhancer element 2, and the fragment contains or consists of the second half (SEQ ID NO: 4) of the core sub-element 1 of enhancer element 2. The vector according to any one of Embodiments 3 and 8.

[0023] Embodiment 10: The expression cassette contains an effective fragment of enhancer element 2, and the fragment contains or consists of the core sub-element 2 (SEQ ID NO: 5) of enhancer element 2. The vector according to any one of Embodiments 3, and 8 to 9.

[0024] Embodiment 11: The expression cassette contains an effective fragment of enhancer element 2, and the fragment contains or consists of the core sub-element 3 (SEQ ID NO: 6) of enhancer element 2. The vector according to any one of Embodiments 3, and 8 to 10.

[0025] Embodiment 12: The expression cassette contains an effective fragment of enhancer element 2, and the fragment contains or consists of the core sub-element 4 (SEQ ID NO: 7) of enhancer element 2. The vector according to any one of Embodiments 3, and 8 to 11.

[0026] Embodiment 13: The expression cassette contains an effective fragment of enhancer element 2, and the fragment contains or consists of the core sub-element 5 (SEQ ID NO: 8) of enhancer element 2. The vector according to any one of Embodiments 3, and 8 to 12.

[0027] Embodiment 14: The expression cassette contains enhancer element HS3 (SEQ ID NO: 9), or an effective fragment thereof. The vector according to any one of Embodiments 1 to 13.

[0028] Embodiment 15: The vector according to Embodiment 14, wherein the expression cassette comprises an effective fragment of enhancer element HS3, and the fragment comprises or comprises an HS3 core sequence (SEQ ID NO: 10).

[0029] Embodiment 16: The vector according to Embodiment 15, wherein the expression cassette comprises an effective fragment of enhancer element HS3, and the fragment consists of an HS3 core sequence (SEQ ID NO: 10).

[0030] Embodiment 17: The vector according to any one of Embodiments 1 to 16, wherein the expression cassette comprises enhancer element H9 (SEQ ID NO: 11) or an effective fragment thereof.

[0031] Embodiment 18: The vector according to Embodiment 17, wherein the expression cassette comprises an effective fragment of enhancer element E9, the fragment comprising or comprising the enhancer element E9 core sequence (SEQ ID NO: 12).

[0032] Embodiment 19: The vector according to Embodiment 18, wherein the expression cassette comprises an effective fragment of enhancer element E9, and the fragment consists of an enhancer element E9 core sequence (SEQ ID NO: 12).

[0033] Embodiment 20: The vector according to any one of Embodiments 1 to 2, wherein the expression cassette comprises a slim enhancer element 2 (SEQ ID NO: 2 = SEQ ID NOs: 3 to 8) and a fragment of the endogenous promoter of the WAS gene consisting of the HS1pro sequence (SEQ ID NO: 1).

[0034] Embodiment 21: The vector according to Embodiment 20, wherein the vector comprises the features shown in Figure 18, and the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0035] Embodiment 22: The vector according to Embodiment 20, wherein the vector comprises the sequence shown in Sequence ID No. 15, and the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0036] Embodiment 23: The above expression cassette is Enhancer element E9 arrays that include or are derived from the E9 core array (sequence number 12); Enhancer element HS3 arrays containing or derived from the HS3 core array (sequence number 10); Slim Enhancer Element 2 (Sequence ID 2 = Sequence IDs 3-8); and A fragment of the endogenous promoter of the WAS gene containing or derived from the HS1pro sequence (SEQ ID NO: 1) A vector according to any one of Embodiments 1 to 2, including the vector described above.

[0037] Embodiment 24: The vector according to Embodiment 23, wherein the vector comprises the features shown in Figure 19, and the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0038] Embodiment 25: The vector according to Embodiment 23, wherein the vector comprises the sequence shown in Sequence ID No. 16, and the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0039] Embodiment 26: The above-mentioned expression cassette is Enhancer element E9 arrays that include or are derived from the E9 core array (sequence number 12); Enhancer element HS3 arrays containing or derived from the HS3 core array (sequence number 10); Enhancer Element 2's core sub-element 1 (sequence number 3 + sequence number 4), Enhancer Element 2's core sub-element 4 (sequence number 7), and Enhancer Element 2's core sub-element 5 (sequence number 8); and A fragment of the endogenous promoter of the WAS gene containing or derived from the HS1pro sequence (SEQ ID NO: 1) A vector according to any one of Embodiments 1 to 2, including the vector described above.

[0040] Embodiment 27: The vector according to Embodiment 26, wherein the vector comprises the features shown in Figure 20, and the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0041] Embodiment 28: The vector according to Embodiment 26, wherein the vector comprises the sequence shown in Sequence ID No. 17, and the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0042] Embodiment 29: The above-mentioned expression cassette is Enhancer element E9 arrays that include or are derived from the E9 core array (sequence number 12); Enhancer element HS3 includes or consists of the HS3 core array (sequence number 10); the first half of core sub-element 1 of enhancer element 2 (sequence number 3); and core sub-element 5 of enhancer element 2 (sequence number 8); and A fragment of the endogenous promoter of the WAS gene containing or derived from the HS1pro sequence (SEQ ID NO: 1) A vector according to any one of Embodiments 1 to 2, including the vector described above.

[0043] Embodiment 30: The vector according to Embodiment 29, wherein the vector comprises the features shown in Figure 21, and the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0044] Embodiment 31: The vector according to Embodiment 29, wherein the vector comprises the sequence shown in Sequence ID No. 18, and the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0045] Embodiment 32: The vector according to any one of Embodiments 1 to 31, wherein the nucleic acid encoding the WASp protein is a WAS cDNA or a codon-optimized WAS gene.

[0046] Embodiment 33: The vector according to Embodiment 32, wherein the nucleic acid encoding the WASp protein is WAS cDNA (SEQ ID NO: 13).

[0047] Embodiment 34: The vector according to Embodiment 32, wherein the nucleic acid encoding the WASp protein is a codon-optimized WAS.

[0048] Embodiment 35: The vector according to Embodiment 34, wherein the nucleic acid sequence encoding the WASP is a codon-optimized WAS selected from the group consisting of jCAT codon-optimized WAS, GeneArt-optimized WAS, and IDT-optimized WAS.

[0049] Embodiment 36: The vector according to any one of Embodiments 1 to 35, wherein the vector includes a Ψ region vector genome packaging signal.

[0050] Embodiment 37: The vector according to any one of Embodiments 1 to 36, wherein the vector comprises a 5'LTR containing a CMV enhancer / promoter.

[0051] Embodiment 38: The vector according to any one of Embodiments 1 to 37, wherein the vector includes a Rev response element (RRE).

[0052] Embodiment 39: The vector according to any one of Embodiments 1 to 38, wherein the vector includes a central polypurine band.

[0053] Embodiment 40: The vector according to any one of Embodiments 1 to 39, wherein the vector includes a post-translation control element.

[0054] Embodiment 41: The vector according to Embodiment 40, wherein the post-translation control element is a modified woodchuck post-transfer control element (WPRE).

[0055] Embodiment 42: The vector according to any one of Embodiments 1 to 41, wherein the vector cannot be recombined to reconstitute a wild-type lentivirus.

[0056] Embodiment 43: The vector according to any one of Embodiments 1 to 42, wherein the vector exhibits high expression in megakaryocytes.

[0057] Embodiment 44: The vector according to any one of Embodiments 1 to 43, wherein, when administered to a mammal having WAS, the vector restores the number and function of T, B, and NK cells.

[0058] Embodiment 45: A host cell transduced with any one of Embodiments 1 to 44.

[0059] Embodiment 46: The host cell according to Embodiment 45, wherein the cell is a stem cell.

[0060] Embodiment 47: The host cells according to Embodiment 46, wherein the cells are stem cells derived from bone marrow, and / or umbilical cord blood, and / or peripheral blood.

[0061] Embodiment 48: The host cell according to Embodiment 45, wherein the cells are human hematopoietic progenitor cells.

[0062] Embodiment 49: The host cell according to Embodiment 48, wherein the human hematopoietic progenitor cell is a CD34+ cell.

[0063] Embodiment 50: A method for treating Wiscott-Aldrich syndrome (WAS) in a subject, wherein the above method is Transduction of the vector described in any one of Embodiments 1 to 44 into stem cells and / or progenitor cells derived from the above target, The transplantation of the above-mentioned transduced cells (multiple cells) derived from the above-mentioned target into the above-mentioned target, wherein the cells or derivatives derived from the above-mentioned target express the above-mentioned WASp protein, and the transplantation is as follows: The above method, including.

[0064] Embodiment 51: The method according to Embodiment 50, wherein the cells are stem cells.

[0065] Embodiment 52: The host cell according to Embodiment 50, wherein the cells are bone marrow-derived stem cells.

[0066] Embodiment 53: The method according to Embodiment 50, wherein the cells are human hematopoietic stem cells and human hematopoietic progenitor cells.

[0067] Embodiment 54: Human hematopoietic progenitor cells are CD34 + The method according to embodiment 53, wherein the cells are cells.

[0068] Embodiment 55: Recombinant nucleic acids comprising one or more of the following: A nucleic acid sequence comprising or derived from the minimal endogenous promoter of the WAS gene, wherein the minimal endogenous promoter comprises or derived from HS1pro (SEQ ID NO: 1); and / or A nucleic acid sequence containing or derived from Slim Enhancer Element 2 (SEQ ID NO: 2 = SEQ ID NOs: 3-8), or an effective fragment thereof; a nucleic acid sequence containing or derived from the first half of Core Sub-Element 1 of Enhancer Element 2 (SEQ ID NO: 3); and / or A nucleic acid sequence containing or derived from the second half (sequence number 4) of core sub-element 1 of enhancer element 2; and / or A nucleic acid sequence containing or derived from the core sub-element 2 (sequence number 5) of enhancer element 2; and / or A nucleic acid sequence containing or derived from the core sub-element 3 (sequence number 6) of enhancer element 2; and / or A nucleic acid sequence containing or derived from the core sub-element 4 (sequence number 7) of enhancer element 2; and / or A nucleic acid sequence containing or derived from the core sub-element 5 (sequence number 8) of enhancer element 2; and / or Enhancer element HS3 (complete) (SEQ ID NO: 9) or a nucleic acid sequence containing or derived from an effective fragment thereof; and / or Nucleic acid sequences containing or derived from the enhancer element HS3 core (sequence number 10); and / or Enhancer element E9 (complete) (SEQ ID NO: 11) or a nucleic acid sequence containing or derived from an effective fragment thereof; and / or A nucleic acid sequence that contains or is derived from the enhancer element E9 core (sequence number 12).

[0069] Embodiment 56: The nucleic acid according to Embodiment 55, wherein the nucleic acid is a nucleic acid sequence comprising or derived from the minimal endogenous promoter of the WAS gene, and the minimal endogenous promoter comprises or derived from HS1pro (SEQ ID NO: 1).

[0070] Embodiment 57: The nucleic acid according to Embodiment 55, wherein the nucleic acid comprises a slim enhancer element 2 (sequence number 2 = sequence numbers 3-8), or an effective fragment thereof, or a nucleic acid sequence derived therefrom.

[0071] Embodiment 58: The nucleic acid according to Embodiment 55, wherein the nucleic acid comprises the first half (SEQ ID NO: 3) of the core sub-element 1 of the enhancer element 2, or a nucleic acid sequence derived therefrom.

[0072] Embodiment 59: The nucleic acid according to any one of Embodiments 55 and 58, wherein the nucleic acid includes the second half (SEQ ID NO: 4) of the core sub-element 1 of enhancer element 2, or includes a nucleic acid sequence derived therefrom.

[0073] Embodiment 60: The nucleic acid according to any one of Embodiments 55 and 58-59, wherein the nucleic acid includes or comprises a nucleic acid sequence derived from the core sub-element 2 (SEQ ID NO: 5) of the enhancer element 2.

[0074] Embodiment 61: The nucleic acid according to any one of Embodiments 55 and 58-60, wherein the nucleic acid includes or comprises a nucleic acid sequence comprising the core sub-element 3 (sequence number 6) of the enhancer element 2.

[0075] Embodiment 62: The nucleic acid according to any one of Embodiments 55 and 58-61, wherein the nucleic acid includes or comprises a nucleic acid sequence derived from the core sub-element 4 (SEQ ID NO: 7) of the enhancer element 2.

[0076] Embodiment 63: The nucleic acid according to any one of Embodiments 55 and 58-62, wherein the nucleic acid includes or comprises a nucleic acid sequence derived from the core sub-element 5 (sequence number 8) of the enhancer element 2.

[0077] Embodiment 64: The nucleic acid according to any one of Embodiments 55 and 58-63, wherein the nucleic acid comprises enhancer element HS3 (complete) (SEQ ID NO: 9) or an effective fragment thereof, or a nucleic acid sequence comprising thereof.

[0078] Embodiment 65: The nucleic acid according to any one of Embodiments 55 and 58-64, wherein the nucleic acid includes an enhancer element HS3 core (sequence number 10) or a nucleic acid sequence derived therefrom.

[0079] Embodiment 66: The nucleic acid according to any one of Embodiments 55 and 58-65, wherein the nucleic acid comprises enhancer element E9 (complete) (SEQ ID NO: 11) or an effective fragment thereof, or a nucleic acid sequence comprising thereof.

[0080] Embodiment 67: The nucleic acid according to any one of Embodiments 55 and 58-66, wherein the nucleic acid includes an enhancer element E9 core (sequence number 12) or a nucleic acid sequence derived therefrom.

[0081] Embodiment 68: The nucleic acid according to any one of Embodiments 55 to 67, wherein the nucleic acid includes an expression cassette.

[0082] Embodiment 69: The nucleic acid according to Embodiment 68, wherein the expression cassette is effective in expressing WASp when transduced into mammalian cells.

[0083] Embodiment 70: The nucleic acid according to Embodiment 55, wherein the nucleic acid comprises the vector described in any one of Embodiments 1 to 44.

[0084] Definition. A "promoter" refers to a regulatory sequence in nucleic acid that is necessary to initiate the transcription of a gene (for example, a gene that is operably linked to a promoter).

[0085] An "enhancer" refers to a regulatory DNA sequence that, when bound by a specific protein called a transcription factor, improves the transcription of the associated gene.

[0086] When used in relation to promoters, an "effective fragment" (for example, an effective fragment of a WAS promoter) means a full-length promoter fragment sufficient to initiate transcription of a gene operably ligated to that promoter.

[0087] When used in relation to enhancers, "effective fragment" (e.g., effective fragment of a WAS enhancer) means a full-length enhancer fragment that, when bound by a transcription factor, brings about control over the expression of the bound gene. In certain embodiments, the control is equivalent to the expression level and / or lineage brought about by the full-length enhancer.

[0088] The term "operably linked" refers to a nucleic acid sequence that is functionally linked to another nucleic acid sequence. For example, a promoter is operationally linked to a gene when it is positioned at the site where it initiates transcription of that gene. An enhancer is operationally linked to a gene when it can control (e.g., upregulate) the expression of that gene when it is bound to an appropriate transcription factor.

[0089] "Recombinant," as used in accordance with its use in the art, means a nucleic acid sequence that, as part of a single sequence, includes portions that do not naturally exist together or portions that have been rearranged compared to a naturally occurring sequence. Recombinant nucleic acids are produced by processes involving human intervention and / or are generated from nucleic acids produced by human intervention (e.g., through one or more cycles such as replication, amplification, and transcription). A recombinant virus is a virus that contains recombinant nucleic acid. A recombinant cell is a cell that contains recombinant nucleic acid.

[0090] As used herein, the terms “recombinant lentiviral vector” or “recombinant LV” mean an artificially constructed polynucleotide assembled from an LV and several additional segments as a result of human intervention and manipulation.

[0091] "Effective dose" means the amount of agent or composition containing such agent necessary to alleviate or eliminate the symptoms of a disease compared to an untreated patient. For therapeutic treatment of a disease, the effective dose of the composition(s) used to carry out the methods described herein will vary depending on the patient's mode of administration, age, weight, and overall health. Ultimately, the attending physician or veterinarian will determine the appropriate dose and dosage regimen. Such a dose is referred to as the "effective" dose. [Brief explanation of the drawing]

[0092] [Figure 1] A shows exemplary LV constructs used to evaluate the control activity of various combinations of elements HS1, HS2, HS3, and HS4. B shows a construct used to evaluate the combination of element E3 and HS1. [Figure 2] This shows the expression levels in MEG-01 cells transduced with the WAS vector. [Figure 3] This shows the expression levels of the WAS vector in Jurkat cells (T cell line). [Figure 4] This shows the expression levels of the WAS vector in RAMOs cells (B cell line). [Figure 5] The constructs used to identify the definitive enhancer element controlling the WAS gene are shown. A represents 10 novel constructs containing putative enhancer elements, each cloned upstream of the endogenous minimal WAS promoter (HS1pro). B represents the gamma retroviral vector (CMMP-mCit) used as a control, capable of restoring platelet count to normal levels. [Figure 6] This shows the expression level of the WAS vector in MEG-01 (megakaryoblast cell line). [Figure 7] This shows the expression levels of the WAS vector in Jurkat cells (T cell line). [Figure 8] This shows the expression levels of the WAS vector in RAMOs cells (B cell line). [Figure 9]This shows the expression levels of the WAS vector in "promegakaryocytes," which are differentiated CB CD34+ megakaryocytes. [Figure 10] This shows the expression level of the WAS vector in megakaryocytes of CB CD34+ differentiated megakaryocytes. [Figure 11] This shows the expression levels of the WAS vector in platelets of CB CD34+ differentiated megakaryocytes. [Figure 12] This shows the WAS vector in "promegakaryocytes," which are differentiated CB CD34+ megakaryocytes. [Figure 13] This shows the expression level of the WAS vector in megakaryocytes of CB CD34+ differentiated megakaryocytes. [Figure 14] This shows the expression levels of the WAS vector in platelets of CB CD34+ differentiated megakaryocytes. [Figure 15] This shows the expression levels of WAS vectors containing each of the five E2 subelements in megakaryocytes of CB CD34+ differentiated megakaryocytes. [Figure 16] This shows the expression levels of WAS vectors containing each of the five E2 fragments in "megakaryocytes" of CB CD34+ differentiated megakaryocytes. [Figure 17] This shows the expression levels of WAS vectors containing each of the five E2 fragments in "platelets" of CB CD34+ differentiated megakaryocytes. [Figure 18] A schematic diagram of the E2 (all slim) vector (E2 (all slim)-HS1pro-mCit-WPRE) is shown. [Figure 19] A schematic diagram of the E9(slim)-HS3(slim)-E2(full slim)-HS1pro-mCit-WPRE vector, which has E9(slim) and HS3(slim) elements added, is shown. [Figure 20] A schematic diagram of E9(slim)-HS3(slim)-E2(1,4,5slim)-HS1pro-mCit-WPRE (with core sub-element 2 of element 2 and core sub-element 3 of element 2 missing) is shown. E9slimHS3slimE2145slimHS1pro. [Figure 21]A schematic diagram of E9(slim)-HS3(slim)-E2(first half of 1 and 5 slim)-HS1pro-mCit-WPRE (with the second half of core sub-element 1 of element 2, core sub-element 2 and core sub-element 3 of element 2, and core sub-element 4 of element 2 missing) is shown. [Figure 22] This shows the expression of candidate vectors in CB CD34+ differentiated megakaryocytes. [Figure 23] This shows the expression of candidate vectors in CB CD34+ differentiated platelets. [Figure 24] This paper demonstrates screening for codon optimization in immortalized B cell lines from WAS patients. [Figure 25] This paper demonstrates screening for codon optimization in immortalized T cell lines from WAS patients. [Figure 26] This shows the titer produced by a codon-optimized version of WASVec. [Modes for carrying out the invention]

[0093] In various embodiments, lentiviral vectors are provided for the treatment (or prevention) of Wiscott-Aldrich syndrome (WAS). In certain embodiments, the vectors are optimized to reduce vector size and increase expression levels and titers. In addition, in various embodiments, for example, vectors for reusing the expression patterns of native WAS genes described herein.

[0094] In particular, bioinformatics analysis (using publicly available databases: Project Encode, Ensemnbl, FANTOM, VISTA Enhancer Browser, and GeneHancer) was used to identify endogenous regulatory elements of native WAS genes. Thirteen putative endogenous enhancer elements were identified within a 1.1 million base pair window.

[0095] To experimentally confirm each of the hypothesized regulatory elements, a lentiviral library was constructed. The enhancer activity of each element was confirmed in MEG-01 cells (megakaryocyte cell line), Jurkat (T cell line), RAMOs (B cell line), and umbilical cord blood CD34+ differentiated megakaryocytes.

[0096] Further experiments identified the necessary core regions of the enhancer and the endogenous WAS promoter, and identified the minimal promoter and slimmed-down enhancer element combinations required to achieve optimal WAS gene expression. Using the identified enhancer elements, we designed our lead candidate lentiviral vectors for the treatment of WAS.

[0097] Accordingly, in certain embodiments, a recombinant lentiviral vector (LV) for the treatment of Wiscott-Aldrich syndrome (WAS) is provided, the vector comprising an expression cassette containing a nucleic acid encoding an effective fragment of the endogenous promoter of the WAS gene, the promoter having a length of up to 600 bp and containing the sequence of HS1pro (SEQ ID NO: 1); and the nucleic acid encoding the Wiscott-Aldrich syndrome protein (WASp) operably ligated to the effective fragment of the endogenous promoter of the WAS gene. In certain embodiments, the effective fragment of the endogenous promoter of the WAS gene consists of the sequence of HS1pro (SEQ ID NO: 1).

[0098] In certain embodiments, the expression cassette includes slim enhancer element 2 (sequence number 2 = sequence numbers 3-8) or an effective fragment thereof. In certain embodiments, the expression cassette includes an effective fragment of enhancer element 2, the fragment including or consisting of core sub-element 1 of enhancer element 2 (sequence number 3 + sequence number 4), core sub-element 4 of enhancer element 2 (sequence number 7), and core sub-element 5 of enhancer element 2 (sequence number 8). In certain embodiments, the expression cassette includes an effective fragment of enhancer element 2, the fragment consisting of core sub-element 1 of enhancer element 2 (sequence number 3 + sequence number 4), core sub-element 4 of enhancer element 2 (sequence number 7), and core sub-element 5 of enhancer element 2 (sequence number 8). In certain embodiments, the expression cassette includes an effective fragment of enhancer element 2, the fragment including or consisting of the first half of core sub-element 1 of enhancer element 2 (sequence number 3) and core sub-element 5 of enhancer element 2 (sequence number 8). In a particular embodiment, the expression cassette includes an effective fragment of enhancer element 2, the fragment consisting of the first half of core sub-element 1 of enhancer element 2 (SEQ ID NO: 3) and core sub-element 5 of enhancer element 2 (SEQ ID NO: 8).

[0099] In certain embodiments, the expression cassette includes an effective fragment of enhancer element 2, the fragment including or consisting of the first half of the core sub-element of enhancer element 2 (SEQ ID NO: 3) and / or the effective fragment of enhancer element 2; the fragment including or consisting of the second half of the core sub-element of enhancer element 2 (SEQ ID NO: 4) and / or the effective fragment of enhancer element 2; the fragment including or consisting of the core sub-element 2 of enhancer element 2 (SEQ ID NO: 5) and / or the effective fragment of enhancer element 2; the fragment including or consisting of the core sub-element 3 of enhancer element 2 (SEQ ID NO: 6) and / or the effective fragment of enhancer element 2; the fragment including or consisting of the core sub-element 4 of enhancer element 2 (SEQ ID NO: 7) and / or the effective fragment of enhancer element 2; and the fragment including or consisting of the core sub-element 5 of enhancer element 2 (SEQ ID NO: 8).

[0100] In certain embodiments, the expression cassette includes the enhancer element HS3 (SEQ ID NO: 9) or an effective fragment thereof. In certain embodiments, the expression cassette includes an effective fragment of the enhancer element HS3, the fragment including or comprising the HS3 core sequence (SEQ ID NO: 10). In certain embodiments, the expression cassette includes an effective fragment of the enhancer element HS3, the fragment comprising the HS3 core sequence (SEQ ID NO: 10).

[0101] In certain embodiments, the expression cassette includes enhancer element E9 (sequence number 11) or an effective fragment thereof. In certain embodiments, the expression cassette includes an effective fragment of enhancer element E9, the fragment including or comprising the enhancer element E9 core sequence (sequence number 12). In certain embodiments, the expression cassette includes an effective fragment of enhancer element E9, the fragment comprising the enhancer element E9 core sequence (sequence number 12).

[0102] In certain embodiments, the expression cassette includes a fragment of the endogenous promoter of the WAS gene consisting of slim enhancer element 2 (sequence number 2 = sequence numbers 3-8); and the sequence of HS1pro (sequence number 1). In certain embodiments, the vector includes the features shown in Figure 18, where the sequence encoding mCitrine is replaced with nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp). In certain embodiments, the vector includes the sequence shown in sequence number 15, where the sequence encoding mCitrine is replaced with nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0103] In certain embodiments, the expression cassette includes an enhancer element E9 sequence containing or derived from the E9 core sequence (SEQ ID NO: 12); an enhancer element HS3 sequence containing or derived from the HS3 core sequence (SEQ ID NO: 10); a slim enhancer element 2 (SEQ ID NO: 2 = SEQ ID NOs. 3-8); and a fragment of the endogenous promoter of the WAS gene consisting of the HS1pro sequence (SEQ ID NO: 1). In certain embodiments, the vector includes the features shown in Figure 19, where the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp). In certain embodiments, the vector includes the sequence shown in SEQ ID NO: 16, where the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0104] In certain embodiments, the expression cassette includes an enhancer element E9 sequence containing or derived from the E9 core sequence (SEQ ID NO: 12); an enhancer element HS3 sequence containing or derived from the HS3 core sequence (SEQ ID NO: 10); core sub-element 1 of enhancer element 2 (SEQ ID NO: 3 + SEQ ID NO: 4); core sub-element 4 of enhancer element 2 (SEQ ID NO: 7); and core sub-element 5 of enhancer element 2 (SEQ ID NO: 8); as well as a fragment of the endogenous promoter of the WAS gene consisting of the HS1pro sequence (SEQ ID NO: 1). In certain embodiments, the vector includes the features shown in Figure 20, where the sequence encoding mCitrine is replaced with nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp). In certain embodiments, the vector includes the sequence shown in SEQ ID NO: 17, where the sequence encoding mCitrine is replaced with nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0105] In certain embodiments, the expression cassette includes an enhancer element E9 sequence containing or derived from the E9 core sequence (SEQ ID NO: 12); an enhancer element HS3 sequence containing or derived from the HS3 core sequence (SEQ ID NO: 10); the first half of core sub-element 1 of enhancer element 2 (SEQ ID NO: 3); and core sub-element 5 of enhancer element 2 (SEQ ID NO: 8); as well as a fragment of the endogenous promoter of the WAS gene consisting of the HS1pro sequence (SEQ ID NO: 1). In certain embodiments, the vector includes the features shown in Figure 21, where the sequence encoding mCitrine is replaced with nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp). In certain embodiments, the vector includes the sequence shown in SEQ ID NO: 18, where the sequence encoding mCitrine is replaced with nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp).

[0106] For clinical applications, it will be understood that the mCitrine reporter can be replaced with a nucleic acid encoding the WASp protein. Such nucleic acids are WAS cDNA or codon-optimized WAS genes (e.g., jCAT-optimized WAS). In certain embodiments, the sequence of the nucleic acid encoding WASP is a codon-optimized WAS selected from the group consisting of jCAT codon-optimized WAS, GeneArt-optimized WAS, and IDT-optimized WAS.

[0107] The expression cassettes described herein for lentiviral vectors are not limited to this use and can also be incorporated into essentially any other construct (e.g., a CRISPR construct) where WASp expression is desired. Therefore, in certain embodiments, nucleic acid constructs containing any of the expression cassette components described herein may be conceived. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6]

[0108] In various embodiments, the lentiviral vectors (LVs) described herein may have a variety of “safety” features, including, for example, the presence of an insulator (e.g., an FB insulator in the 3'LTR). In addition, or alternatively, in certain embodiments, the HIV LTR is replaced with an alternative promoter (e.g., CMV), resulting in a higher titer vector without including the HIV TAT protein during packaging. Other potent promoters (e.g., RSV) may also be used.

[0109] As described above, in various embodiments, the lentiviral vectors described herein contain one or more elements typically found in lentiviral vectors. Such elements include, but are not limited to, the Ψ-region vector genome packaging signal, Rev response element (RRE), polypurine bands (e.g., central polypurine band, 3' polypurine band, etc.), post-translational regulatory elements (e.g., modified woodchuck post-transcriptional regulatory element (WPRE)), and insulators, as described later.

[0110] In various embodiments, the vector is a SIN vector that makes it substantially impossible to recombine wild-type lentiviruses.

[0111] In various embodiments, the vectors described herein exhibit high expression in MEG-01 cells (megakaryocyte cell line) and / or Jurkat cells (T cell line) and / or RAMOs cells (B cell line). In specific embodiments, the vectors described herein exhibit high expression in CB CD34+ differentiated megakaryocytes, including "promegakaryocytes," megakaryocytes, and platelets.

[0112] As shown above, in Example 1, the vector described herein is considered effective in transducing cells with high titer and in bringing about high levels of expression of the nucleic acid encoding the WASp protein.

[0113] In light of these results, it is conceivable that Wiscott-Aldrich syndrome (WAS) can be effectively treated in subjects (e.g., humans and non-human mammals) using the LVs described herein, for example, recombinant TAT-independent SIN LVs expressing nucleic acids encoding WASP. These vectors are thought to be usable for stem cell modification, allowing them to be introduced into subjects (e.g., subjects identified as having WAS) that require modification of stem cells (e.g., hematopoietic stem cells and hematopoietic progenitor cells) for therapeutic purposes. Furthermore, the resulting cells are thought to produce sufficient transgenic WASp protein to demonstrate a significant improvement in the subject's health. It is also thought that the vectors can be directly administered to subjects to achieve in vivo transduction of targets (e.g., hematopoietic stem cells or hematopoietic progenitor cells), thereby impacting the treatment of subjects in need of treatment.

[0114] As described above, in various embodiments, the LVs described herein can include various safety features. For example, the HIV LTR is substituted with a CMV promoter, resulting in a higher titer vector without including the HIV TAT protein during packaging. In certain embodiments, an insulator (e.g., an FB insulator) can be introduced into the 3'LTR for safety. The LT can also be constructed to provide efficient transduction and high titer.

[0115] It will be understood that the elements described herein are illustrative and do not need to be limited. Suitable substitutions for these elements will be recognized and considered within the scope of the teachings provided herein, from the perspective of the teachings provided herein.

[0116] WAS codon optimization. As described above, in various embodiments, the lentiviral vector may contain the WAS gene or cDNA. However, in certain embodiments, the nucleic acid encoding WASp is codon-optimized. Various methods of codon optimization are known to those skilled in the art. One exemplary method is JCat (Java Codon Adaptation Tool). The jCAT tool applies the use of gene codons to most sequenced prokaryotes and various eukaryotic cell gene hosts. In contrast to many tools, JCat does not require manual definition of highly expressed genes and is therefore a very rapid and easy method. Further options for JCat for codon adaptation include avoidance of unnecessary cleavage sites for restriction enzymes and Rho independent transcription terminators. The output of JCat is both graphical and given as a Codon Adaptation Index (CAI) value for the input sequence and the newly adapted sequence. JCat optimization is described by Grote et al. (2005) Nucleic Acids Res. 33 (suppl 2): ​​W526-W531), and the JCat tool is available online at www.jcat.de.

[0117] Another codon optimization tool is provided by GeneArt (manufactured by ThermoFisher Scientific®).

[0118] Another codon optimization tool is IDT. The IDT codon optimization tool was developed to optimize a DNA or protein sequence from one organism for expression in another organism by reassigning codon usage based on the frequency of each codon's usage in the new organism. For example, valine is encoded by four different codons (GUG, GUU, GUC, and GUA). However, in human cell lines, the GUG codon is preferentially used (46% usage, compared to 18%, 24%, and 12%, respectively). The codon optimization tool takes this information into account and assigns the valine codon to the same frequency. Furthermore, the tool's algorithm removes codons with a frequency of less than 10% and renormalizes the remaining frequencies to 100%. Additionally, the optimization tool reduces complexity that could interfere with manufacturing and downstream expression, such as repeats, hairpins, and extreme GC content. The IDT optimization tool is available from IDT (Integrated DNA Technologies, Coralville, Iowa) and can be found at www.idtdna.com / CodonOpt.

[0119] Other codon optimization tools include, but are not limited to, CodonW, an open-source software program that can be found at codonw.sourceforge.net, and the OptimumGene™ algorithm by GenScript.

[0120] These codon optimizations are illustrative and non-limiting. Using the teachings provided herein and in Example 1, the use of WAS codons can be quickly optimized for specific applications.

[0121] TAT-independent and self-inactivating lentiviral vector. To further improve safety, in various embodiments, the lentiviral vectors described herein include a TAT-independent self-inactivating (SIN) configuration. Therefore, in various embodiments, it is desirable to use an LTR region within the LV described herein that has reduced promoter activity compared to the wild-type LTR. Such constructs can be provided that are effectively "self-inactivating" (SIN) and provide biosafety features. A SIN vector is a vector in which the production of full-length vector RNA in transduced cells is significantly reduced or completely eliminated. This feature minimizes the risk of the emergence of recombinants (RCRs) that can replicate. Furthermore, this feature reduces the risk of abnormal expression of cell-coding sequences located adjacent to the vector integration site.

[0122] Furthermore, the design of SIN reduces the likelihood of interference between the LTR and the promoter that drives the expression of the transgene. SIN LVs can often enable full activity of the internal promoter.

[0123] Designing SINs increases the biosafety of HIV LTRs. The majority of HIV LTRs contain U3 sequences. The U3 region contains enhancer and promoter elements that regulate the basal and induced expression of the HIV genome within infected cells and in response to cellular activation. Some of these promoter elements are essential for viral replication. Some of the enhancer elements are highly conserved among viral isolates and have been suggested to be decisive pathogenic factors in viral pathogens. Enhancer elements may influence the replication rate at different cellular targets of the virus.

[0124] Since viral transcription begins at the 3' end of the U3 region of the 5'LTR, these sequences are not part of the viral mRNA; rather, this copy from the 3'LTR acts as a template for generating both LTRs of the incorporated provirus. When the 3' copy of the U3 region is modified in the retroviral vector construct, the vector RNA is still produced from the intact 5'LTR in the producer cell, but cannot be regenerated in the target cell. Transduction of such a vector results in the inactivation of both LTRs in the progenitor virus. Thus, the retrovirus is self-inactivating (SIN), and these vectors are known as SIN transcription vectors.

[0125] In certain embodiments, self-inactivation is achieved by introducing a deletion in the U3 region of the 3' LTR of the vector DNA, i.e., the DNA used to construct the vector RNA. During RT, this deletion is transferred to the 5' LTR of the proviral DNA. Typically, it is desirable to remove a sufficient number of U3 sequences to significantly reduce or completely eliminate the transcriptional activity of the LTR, thereby significantly reducing or completely eliminating the production of full-length vector RNA in transduced cells. However, it is generally desirable to retain these elements of the LTR, which are involved in the polyadenylation of viral RNA, a function that typically extends across U3, R, and U5. Therefore, in certain embodiments, it is desirable to remove as many transcriptionally important motifs from the LTR as possible while conserving polyadenylation determinants.

[0126] SIN design is detailed in Zufferey et al. (1998) J Virol. 72(12): 9873-9880 and U.S. Patent No. 5,994,136. However, as described therein, the degree of deletion in the 3'LTR is limited. First, the 5' end of the U3 region plays another essential function in vector transfer and is required for incorporation (terminal dinucleotide + att sequence). Therefore, the terminal dinucleotide and att sequence may indicate the 5' boundary of the deleteable U3 sequence. Furthermore, several loosely defined regions may affect the activity of downstream polyadenylation sites within the R region. Excessive deletion of the U3 sequence from the 3'LTR can reduce the polyadenylation of the vector transcript, leading to adverse consequences in both vector titer in producer cells and transgene expression in target cells.

[0127] An additional SIN design is described in U.S. Patent Publication 2003 / 0039636. As described in that specification, in certain embodiments, a hybrid LTR is formed by replacing the lentiviral sequence removed from the LTR with a corresponding sequence derived from a non-lentiviral retrovirus. Specifically, the lentiviral R region in the LTR can be replaced in whole or in part with an R region derived from a non-lentiviral retrovirus. In certain embodiments, the lentiviral TAR sequence, which is a sequence that interacts with the TAT protein to improve viral replication, is preferably removed in its entirety from the R region. The TAR sequence is then replaced with a corresponding portion of an R region derived from a non-lentiviral retrovirus to form a hybrid R region. The LTR can be further recombined to remove all or part of the lentiviral U3 and U5 regions, and / or replace such portions with non-lentiviral sequences.

[0128] Therefore, in certain embodiments, the SIN configuration provides a retroviral LTR comprising a hybrid lentiviral R region lacking all or part of its TAR sequence, thereby removing any possible activation by TAT, where the TAR sequence or part thereof is replaced by a corresponding portion of a retroviral R region that is non-lentiviral, thereby forming a hybrid R region. In certain embodiments, the retroviral LTR comprises a hybrid R region, which comprises a portion of the HIV R region lacking the TAR sequence (e.g., comprising or comprising the nucleotide sequence shown in SEQ ID NO: 10 in US2003 / 0039636), and a portion of the MoMSV R region corresponding to the TAR sequence lacking the HIV R region (e.g., comprising or comprising the nucleotide sequence shown in SEQ ID NO: 9 in 2003 / 0039636). In another particular embodiment, the entire hybrid R region comprises or comprises the nucleotide sequence shown in SEQ ID NO: 11 in 2003 / 0039636.

[0129] Suitable lentiviruses from which the R region can be derived include, for example, HIV (HIV-1 and HIV-2), EIV, SIV, and FIV. Suitable retroviruses from which the non-lentiviral sequence can be derived include, for example, MoMSV, MoMLV, Frient, MSCV, RSV, and spumavirus. In one exemplary embodiment, the lentivirus is HIV, and the non-lentiviral retrovirus is MoMSV.

[0130] In another embodiment described in US2003 / 0039636, the LTR containing the hybrid R region is a left (5')LTR and further includes a promoter sequence upstream of the hybrid R region. Preferred promoters are of non-lentiviral origin, such as a U3 region of a retrovirus that is non-lentiviral (e.g., the U3 region of MoMSV). In one particular embodiment, the U3 region includes the nucleotide sequence shown in SEQ ID NO: 12 in US2003 / 0039636. In another embodiment, the left (5')LTR further includes a lentiviral U5 region downstream of the hybrid R region. In one embodiment, the U5 region is the U5 region of HIV, which includes the HIVatt site required for genome integration. In another embodiment, the U5 region includes the nucleotide sequence shown in SEQ ID NO: 13 in US2003 / 0039636. In yet another embodiment, the entire left (5') hybrid LTR includes the nucleotide sequence shown in SEQ ID NO: 1 in US2003 / 0039636.

[0131] In another exemplary embodiment, the LTR containing the hybrid R region is a right (3')LTR, further comprising a modified (e.g., truncated) lentiviral U3 region upstream of the hybrid R region. The modified lentiviral U3 region may contain an att sequence, but the absence of any sequence with promoter activity causes the vector to become SIN in that viral transcription cannot proceed beyond the first round of replication after chromosomal integration. In certain embodiments, the modified lentiviral U3 region upstream of the hybrid R region is up to the lentiviral U3att site, consisting of the 3' end of a lentiviral (e.g., HIV) U3 region containing this site. In one embodiment, the U3 region comprises the nucleotide sequence shown in SEQ ID NO: 15 in US2003 / 0039636. In another embodiment, the right (3')LTR further comprises a polyadenylated sequence downstream of the hybrid R region. In another embodiment, the polyadenylated sequence comprises the nucleotide sequence shown in SEQ ID NO: 16 in US2003 / 0039636. In yet another embodiment, the entire right (5')LTR contains the nucleotide sequence shown in SEQ ID NO: 2 or 17 of US2003 / 0039636.

[0132] Therefore, in the case of HIV-based LV, it has been found that such vectors tolerate significant U3 deletions, including removal of the LTR TATA box (e.g., deletion of -418 to -18), without a significant decrease in vector titer. These deletions substantially inactivate the LTR region in such a way that the LTR's transcriptional capacity is reduced to approximately 90% or less.

[0133] It has also been shown that the trans-function of Tat becomes unnecessary when a portion of the upstream LTR in the transcription vector construct is replaced by a constitutively active promoter sequence (see, for example, Dull et al. (1998) J Virol. 72(11):8463-8471). Furthermore, we demonstrate that the expression of rev in trans makes it possible to create a high-titer HIV-derived vector stock from a packaging construct containing only gag and pol. This design enables the expression of packaging function subject to complementarity, making it usable only within producer cells. The resulting gene transfer system preserves only three of the nine genes of HIV-1 and relies on four separate transcription units to produce transduction particles.

[0134] In one embodiment shown in Example 1, the cassette expressing the nucleic acid encoding WASp is a SIN vector containing a CMV enhancer / promoter substituted at the 5'LTR.

[0135] The CMV promoter is typically understood to result in high levels of non-tissue specificity in expression. Other promoters with similar constitutive activity include, but are not limited to, the RSV promoter and the SV40 promoter. Mammalian promoters such as the β-actin promoter, ubiquitin C promoter, elongation factor 1α promoter, and tubulin promoter can also be used.

[0136] The SIN configurations described above are illustrative and non-limiting. Numerous SIN configurations are known to those skilled in the art. As described above, in certain embodiments, LTR transcription is reduced by about 95% to about 99%. In certain embodiments, LTR may become transcriptionally inactive by at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0137] Insulator element In certain embodiments, insulators are inserted into the lentiviral vectors described herein to further enhance biosafety. Insulators are DNA sequence elements present throughout the genome. They bind to proteins that modify chromatin and alter local gene expression. Placing insulators in the vectors described herein provides a variety of potential benefits, including, in particular, 1) blocking the positional effect of the vector on expression by adjacency with chromosomes (i.e., barrier activity); and 2) blocking the adjacency of chromosomes with insertive transactivation of gene expression (enhancer blocking). Therefore, insulators can help preserve the independent function of a gene or transcription unit embedded in a genomic or genetic context, whose expression may, in other cases, be affected by regulatory signals in the genomic or genetic context (see, e.g., Burgess-Beusse et al. (2002 Proc. Natl. Acad. Sci. USA, 99:16433; and Zhan et al. (2001) Hum. Genet., 109:471)). In this context, insulators can contribute to protecting the sequence expressed by a lentivirus from the influence of the integration site, which may be mediated by cis-acting elements present in genomic DNA, resulting in relaxed expression of the transferred sequence. In various embodiments, an insulator sequence is provided which is inserted into one or both LTRs, or other locations within the region, of a vector to be integrated into the cellular genome.

[0138] The first and most characterized vertebrate chromatin insulator is located within the chicken β-globin locus regulatory region. This element, containing a DNase-I hypersensitive site (cHS4), appears to constitute the 5' boundary of the chicken β-globin locus (Prioleau et al. (1999) EMBO J.18:4035-4048). A 1.2kb fragment containing the cHS4 element exhibits typical insulator activity, including the ability to block the interaction between the globin gene promoter and enhancer in cell lines (Chung et al. (1993) Cell, 74:505-514), and the ability to protect expression cassettes from positional effects in Drosophila (Id.), transformed cells (Pikaart et al. (1998) Genes Dev. 12:2852-2862), and transgenic mammals (Wang et al. (1997) Nat. Biotechnol., 15:239-243; Taboit-Dameron et al. (1999) Transgenic Res., 8:223-235). The majority of this activity is contained within a 250bp fragment. Within this elongation lies a 49 bp cHS4 core (Chung et al. (1997) Proc. Natl. Acad. Sci., USA, 94:575-580) that interacts with the zinc finger DNA-binding protein CTCF, as suggested by the enhancer blockade assay (Bell et al. (1999) Cell, 98:387-396).

[0139] One exemplary and preferred insulator is FB(FII / BEAD-A), a 77 bp insulator element containing the minimal CTCF binding site enhancer-blocking component of the chicken β-globin 5'HS4 insulator and a homologous region derived from the human T cell receptor α / δ blocking element α / δI(BEAD-I) insulator, as described by Ramezani et al. (2008) Stem Cell 26:3257-3266. The FB "synthetic" insulator has complete enhancer-blocking activity. This insulator is illustrative and not limiting. Other suitable insulators can be used, for example, including full-length chicken β-globin HS4 or its insulator subfragments, ankyrin gene insulators, and other synthetic insulator elements.

[0140] Packaging signal. In various embodiments, the vectors described herein further include a packaging signal. “Packaging signal,” “packaging sequence,” or “PSI sequence” is any nucleic acid sequence sufficient to direct the packaging of the nucleic acid containing the packaging signal into a retroviral particle. This term includes naturally occurring packaging sequences and also includes recombinant variants thereof. Packaging signals for numerous different retroviruses, including lentiviruses, are known in the art. One non-limiting, exemplary PSI is provided by Sequence ID No. 21.

[0141] Rev response element (RRE). In certain embodiments, the lentiviral vectors described herein include a Rev response element (RRE) for enhancing the nuclear export of unspliced ​​RNA. RREs are well known to those skilled in the art. Exemplary RREs include, but are not limited to, those located at positions 7622-8459 of the HIV NL4-3 genome (Genbank accession number AF003887), as well as RREs from other strains of HIV or other retroviruses. Such sequences are readily available from Genbank or the database at the URL hiv-web.lanl.gov / content / index. One non-exclusive exemplary RRE is shown in Sequence ID No. 22.

[0142] Polypurine bands (cPPT, 3'PPT). In various embodiments, the lentiviral vectors described herein further include polypurine bands (e.g., a central polypurine band (cPPT), a 3' polypurine band (3'PPT)). It is known that the efficiency of transduction is improved by inserting a fragment containing a 3'PPT (e.g., see SEQ ID NO: 24) or a central polypurine band (cPPT) into a lentiviral (e.g., HIV-1) vector construct.

[0143] Post-transcriptional regulatory elements (PREs) stimulated by expression In certain embodiments, the lentiviral vectors (LVs) described herein may include any of a variety of post-transcriptional regulatory elements (PREs) whose presence in the transcript increases the expression of a heterologous nucleic acid (e.g., the nucleic acid encoding WASp) at the protein level. PREs may be particularly useful in certain embodiments, especially those involving a lentiviral construct containing a moderate promoter.

[0144] One type of pre-reactive enzyme (PRE) is an intron located within the expression cassette, which can express genes. However, introns can be spliced ​​during lentiviral life cycle events. Therefore, when introns are used as PREs, they are typically positioned opposite to the vector genome transcript.

[0145] Post-transcriptional regulatory elements that are independent of splicing events offer the advantage of not being removed during the viral life cycle. Some examples include post-transcriptional processing elements of herpes simplex virus, and post-transcriptional regulatory elements of hepatitis B virus (HPRE) and woodchuck hepatitis virus (WPRE). Of these, WPRE is usually preferred because it contains an additional cis-acting element not found in HPRE. These regulatory elements are typically located within the vector and included in the RNA transcript of the transgene, but outside the stop codon of the transgene translation unit.

[0146] WPREs have been characterized and are described in U.S. Patent No. 6,136,597. As described in that patent specification, WPREs are RNA export elements that mediate the efficient transport of RNA from the nucleus to the cytoplasm. WPREs enhance transgene expression by inserting cis-acting nucleic acid sequences so that the element and the transgene are contained in a single transcript. The presence of a WPRE in the sense direction has been shown to increase transgene expression by up to 7–10 times. Instead of fully intron-containing genes being spliced ​​between sequences of events that result in the formation of retroviral particles, retroviral vectors transport sequences in the form of cDNA. Introns mediate the interaction of primary transcripts with the splicing mechanism. Because processing of RNA by the splicing mechanism facilitates its cytoplasmic export, the combination of splicing and transport mechanisms often makes cDNA expression inefficient. Therefore, including a WPRE (see, e.g., SEQ ID NO: 23) in the vector results in improved transgene expression.

[0147] Transduced host cells, and a method for transducing cells. Recombinant lentiviral vectors (LVs) and the resulting viruses described herein are capable of delivering heterologous nucleic acid sequences (e.g., nucleic acids encoding WASp) to mammalian cells. In various embodiments, for delivery to cells, the vectors described herein are preferably used in combination with suitable packaging cell lines, or co-transfected in vitro with other vector plasmids containing the necessary retroviral genes (e.g., gag and pol) to form non-replicating virions capable of packaging and infecting the cells of the present invention.

[0148] In certain embodiments, the vector is introduced into a packaging cell line by transfection. The packaging cell line produces viral particles containing the vector genome. Methods of transfection are well known to those skilled in the art. After co-transfection of the packaging vector and transcription vector into the packaging cell line, the recombinant virus is recovered from the culture medium and titrated by standard methods used by those skilled in the art. Thus, packaging constructs can generally be introduced into human cell lines by calcium phosphate transfection, lipofection, or electroporation, with or without excellent selective markers such as neomycin, DHFR, or glutamine synthetase, followed by selection in the presence of appropriate agents and isolation of clones. In certain embodiments, the selective marker can be physically bound to the packaging gene in the construct.

[0149] Stable cell lines are known in which the packaging function is configured to be expressed by suitable packaging cells (see, for example, U.S. Patent No. 5,686,279, which describes packaging cells). In general, any cell compatible with the expression of lentiviral Gag and Pol genes, or any recombinant cell to direct such expression, can be used to produce viral particles. For example, producer cells such as 293T cells and HT1080 cells can be used.

[0150] The packaging cells, together with the lentiviral vector incorporated in this specification, form producer cells. Thus, the producer cells are cells or cell lines capable of producing or releasing packaged infectious viral particles that carry the target therapeutic gene (e.g., the nucleic acid encoding WASp). These cells may further be anchorage-dependent, meaning they optimally proliferate, survive, or maintain function when attached to a surface such as glass or plastic. Some examples of anchorage-dependent cell lines used as lentiviral vector packaging cell lines when the vector is replicable include HeLa or 293 cells and PERC.6 cells.

[0151] Accordingly, in certain embodiments, the present invention provides a method for delivering a gene to a cell and then incorporating it into the genome of said cell, the method comprising contacting said cell with a virion containing the lentiviral vector described herein. Cells (e.g., in the form of a tissue or organ) can be ex vivo contacted (e.g., infected) with the virion and then delivered to a target (e.g., a mammal, animal, or human) on which the gene (e.g., the nucleic acid encoding WASp) will be expressed. In various embodiments, the cells can be self-derived to the target (i.e., originating from the target) or non-self to the target (i.e., allogeneic or heterogeneous). Furthermore, since the vector described herein is deliverable to both dividing and non-dividing cells, the cells can be derived from a variety of types, including, for example, bone marrow cells, mesenchymal stem cells (e.g., obtained from adipose tissue), and other primary cells of human and animal sources. Alternatively, the virion can be administered in vivo directly to the target or a localized area of ​​the target (e.g., bone marrow).

[0152] In certain embodiments, the lenti vector described herein is particularly derived from bone marrow, peripheral blood, or umbilical cord blood, and is used to transduce human hematopoietic progenitor cells or hematopoietic stem cells, in addition to CD4 + It is useful for transduction of T cells, peripheral blood B cells, or T lymphocytes. In certain embodiments, a particularly preferred target is CD34. + These are hematopoietic stem cells and progenitor cells.

[0153] Gene therapy. In yet other embodiments, a method of transducing human hematopoietic stem cells is provided. In certain embodiments, the method involves contacting a population of human cells comprising hematopoietic stem cells with one of the aforementioned lentiviral vectors by a vector under conditions that result in transduction of human hematopoietic progenitor cells in the population. The stem cells can be transduced either in vivo or in vitro depending on the end use. In the context of human gene therapy, such as human hematopoietic stem cell gene therapy, the stem cells can be transduced either in vivo or, alternatively, in vitro and then the transduced stem cells can be injected into a human subject. In one aspect of this embodiment, the human stem cells can be removed from a human, such as a WAS patient, using methods well known to those skilled in the art and transduced as described above. The transduced stem cells are then reintroduced into the same or a different human.

[0154] Gene therapy of stem cells / progenitor cells. In various embodiments, the lentiviral vectors described herein are useful for transducing human hematopoietic progenitor cells or hematopoietic stem cells (HSCs) obtained from any of bone marrow, peripheral blood, or umbilical cord blood, in addition to transducing + CD4 + T cells, peripheral blood B or T lymphocyte cells, and the like. In certain embodiments, particularly preferred targets are CD34

[0155] hematopoietic stem cells and progenitor cells. + When cells, such as CD34 5 cells, dendritic cells, peripheral blood cells, or tumor cells are transduced ex vivo, the vector particles are generally used at a dose on the order of a multiplicity of infection (MOI) of 1 - 50, corresponding to 1 - 50 transducing units of the viral vector per 5 10 5 cells and incubated with the cells. This can include amounts of the vector corresponding to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, and 50 MOI. Typically, the amount of the vector can be expressed in terms of HT - 29 transducing units (TU).

[0156] In certain embodiments, the cell-based therapy involves providing stem cells and / or hematopoietic precursors, transducing cells with, for example, a lentivirus encoding the nucleic acid encoding WASp, and then transducing the transformed cells into a subject requiring the therapy (e.g., a subject having a mutation in the WAS gene).

[0157] In certain embodiments, the method involves isolating a population of cells derived from the subject, for example, stem cells, optionally growing the cells in tissue medium, and administering a lentiviral vector that, by being present within the cells, induces normal intracellular WASp production in vitro. The cells are then returned to the subject, where, for example, the cells may result in a population of erythrocytes that produce WASp.

[0158] In some exemplary and non-limiting embodiments, a population of cells that may be derived from a cell line or from an individual other than the subject can be used. Methods for isolating stem cells, immune system cells, etc., from a subject and returning these cells to the subject are well known in the art. Such methods are used, for example, in bone marrow transplantation, peripheral blood stem cell transplantation, etc., in patients undergoing chemotherapy.

[0159] If stem cells are to be used, it will be understood that such cells can be derived from a number of sources, including bone marrow (BM), umbilical cord blood (CB), and mobilized peripheral blood stem cells (mPBSCs). In certain embodiments, the use of induced pluripotent stem cells (IPSCs) is considered. Methods for isolating hematopoietic stem cells (HSCs) and transducing such cells into mammalian subjects are well known to those skilled in the art.

[0160] In certain embodiments, the nucleic acid encoding WASp is introduced into bone marrow stem cells of a patient with WAS, followed by autotransplantation, thereby enabling the use of the lentiviral vector described herein (see, for example, Figures 18-21) containing the nucleic acid encoding WASp instead of mCit in stem cell gene therapy for WAS.

[0161] Direct vector import. In certain embodiments, direct treatment of the target is conceived by direct introduction of the vector(s) described herein. Lentiviral compositions can be formulated for delivery by any available route, including but not limited to parenteral (e.g., intravenous), intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, rectal, and vaginal. Commonly used routes of delivery include inhalation, parenteral, and transmucosal.

[0162] In various embodiments, the pharmaceutical composition may include LV in combination with a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" includes solvents, dispersions, coatings, antimicrobial and antifungal agents, isotonic agents, and absorption retarders that are suitable for pharmaceutically administered substances. Supplementary active ingredients may also be incorporated into the composition.

[0163] In some embodiments, the activator, i.e., the lentivirus described herein and / or other agents that can be administered with the vector, is prepared by a controlled-release formulation including a carrier, e.g., an implant and a microencapsulation delivery system, to prevent the compound from being rapidly removed from the body. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such compositions will be obvious to those skilled in the art. Suitable materials are also commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomes can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811. In some embodiments, the compositions are targeted to specific cell types or cells infected with the virus. For example, the compositions can be targeted using cell surface markers, e.g., monoclonal antibodies against endogenous markers, or viral antigens expressed on the surface of infected cells.

[0164] To facilitate administration and ensure uniformity of dosage, it is advantageous to formulate the composition in unit dosage forms. As used herein, unit dosage forms refer to physically separate units suitable as unitary dosages for treating a subject, each unit containing a predetermined amount of LV calculated to produce a desired therapeutic effect in relation to the drug carrier.

[0165] The unit dose does not need to be administered as a single injection, but may include a series of infusions over a period of time. The unit dose of LV described herein can conveniently be described in terms of the lentivector transduction unit (TU), defined by titrating the vector in cell lines such as HeLa or 293. In certain embodiments, the unit dose is 10 3 , 10 4 , 10 5 , 10 6 , 107 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 It can be TU or a larger range.

[0166] The pharmaceutical composition may be administered once per week at various intervals and, as needed, over different periods, for example, about 1 to 10 weeks; about 2 to 8 weeks; about 3 to 7 weeks; about 4 weeks, about 5 weeks, about 6 weeks, etc. It may be necessary to administer the therapeutic composition indefinitely. Those skilled in the art will understand that certain factors, including but not limited to the severity of the disease or illness, previous treatments, overall health and / or the age of the subject, and other pre-existing illnesses, may influence the dose and timing required to effectively treat the subject. Treatment of a subject with LV may consist of a single treatment or, in many cases, a series of treatments.

[0167] Exemplary and non-limiting doses for administering gene therapy vectors, and methods for determining suitable doses, are known in the art. It is further understood that the appropriate dose of LV may depend on the specific recipient and method of administration. The appropriate dose level for any particular subject may vary depending on various factors, including the subject's age, weight, overall health, sex, and diet, timing of administration, route of administration, excretion rate, and other therapeutic agents being administered.

[0168] In certain embodiments, the lentiviral gene therapy vectors described herein can be delivered to a subject, for example, by intravenous injection, topical administration, or stereotactic injection (see, for example, Chen et al. (1994) Proc. Natl. Acad. Sci. USA, 91:3054). In certain embodiments, the vectors can be delivered orally or by inhalation and may be encapsulated or otherwise manipulated to protect the degradation of the vector and improve its uptake into tissues or cells. The pharmaceutical preparation may contain the LV in an acceptable diluent or may contain a sustained-release matrix into which the LV is embedded. Alternatively, if the vector can be constructed intact from recombinant cells, the pharmaceutical preparation may contain one or more cells that produce the vector, as in the case of retroviral or lentiviral vectors described herein. Pharmaceutical compositions containing the LV described herein may optionally be contained in a container pack or dispenser, along with instructions for administration.

[0169] The compositions, methods, and uses described herein are illustrative and not limiting. Using the teachings provided herein, other variations of compositions, methods, and uses will be readily available to those skilled in the art.

[0170] Example 1 Development of lentiviral vectors for the treatment of Wiscott-Aldrich syndrome (WAS) The objective of the experiments described below was to develop a novel lentiviral vector driven by the endogenous regulatory element of the native WAS gene for the treatment of Wiscott-Aldrich syndrome. Specifically, it was desired to develop a vector that exhibits higher expression in megakaryocytes than the current WAS1.6 lentiviral vector, and consequently restores platelet counts to normal levels in WAS patients. In addition, it was desired to maintain at least similar levels of expression in all other hematopoietic cell lines and restore the number and function of T, B, and NK cells.

[0171] Using bioinformatics analysis (with publicly available databases: Project Encode, Ensemnbl, FANTOM, VISTA Enhancer Browser, GeneHancer), we elucidated the endogenous regulatory elements of native WAS genes.

[0172] The WAS1.6 vector is driven by a 1600 bp promoter fragment located immediately upstream of the transcription start site. Within this fragment, we identified two control elements, "HS1" and "HS2," with sizes of 417 bp and 190 bp, respectively. Therefore, we were able to reduce the promoter size by identifying and removing a 1026 bp inactive sequence in the 1633 bp fragment.

[0173] It should be noted that the 1.6kb promoter was insufficient to drive wild-type level expression in megakaryocytes, resulting in patients maintaining microthrombocytopenia. From this perspective, we hypothesized that an additional endogenous enhancer element is required to drive wild-type level WAS expression in megakaryocytes.

[0174] Proximal analysis of the WAS gene identified novel enhancer elements "HS4" and "HS3" that contain the megakaryocyte DNase I HS region and function as enhancers to accelerate megakaryocyte expression. A series of lentiviral vectors (LVs) containing various combinations of these regions and reporter genes were constructed, and the activity of these regulatory elements was evaluated (see, for example, Figure 1A). Furthermore, the E3 element (Thurman et al. (2012) Nature, 489:75-82), which has been shown to be one of the most potent enhancers in the human genome, exhibits high megakaryocyte sensitivity. Therefore, a vector was also constructed, and the E3 enhancer activity in this context was evaluated (see, for example, Figure 1B).

[0175] To measure whether any of the newly identified enhancer elements increase expression in the megakaryocyte lineage, MEG-01 cells (megakaryocyte cell line) were transduced with a WAS vector. The cells were cultured for 14 days, and flow cytometry was performed for expression (mCitrine) and VCN analysis.

[0176] As shown in Figure 2, the minimal promoter of HS1 (417 bp) appears to be the primary driver of 1.6 kb vector expression in megakaryocytes. In addition, HS2 appears to be inactive within megakaryocyte cell lines, but this element may have enhancer activity in other lineages. HS3 appears to provide a significant acceleration of expression within megakaryocyte cell lines, and HS4 also appears to accelerate expression within megakaryocyte cell lines. The combination of HS3 and HS4 is effective, and E3 is a potent non-lineage-specific enhancer that is also active in megakaryocytes.

[0177] The clinically-grade 1.6kb vector has been shown to express at therapeutic levels in all hematopoietic cell lines except megakaryocytes (patients are no longer immunocompromised but still have thrombocytopenia). As shown, HS2-HS1 contains all the regulatory regions of WAS1.6 (while saving 1.0kb of sequence), so an exemplary slim version of WAS1.6 is HS2-HS1, suggesting that it can be used as a vector backbone. Novel HS3 and HS4 fragments have been shown to accelerate expression in megakaryocytes, and for this reason, HS4-HS3-HS2-HS1 can provide therapeutic levels of expression across the entire hematopoietic cell lineage. One exemplary preferred vector (HS4-HS3-HS2-HS1), which is only 155bp larger than WAS1.6, has been shown to have approximately twice the expression in megakaryocytes.

[0178] However, it has not yet been measured whether HS2-HS1pro functions in other cell lineages (T cells and B cells) in the same way as WAS1.6. In addition, we wanted to measure whether HS3 and HS4 further accelerate expression in other hematopoietic cell lineages, and whether the HS2 enhancer element is necessary. In this regard, we recognized that the HS2 enhancer may have enhancer function in other cell types, or it may be completely inactive. Furthermore, we wanted to measure whether HS1pro functions in the same way as WAS1.6, and whether adding HS4 and HS3 to HS2-HS1 negatively affects expression in other cell types.

[0179] To address these questions, WAS vectors were transduced into Jurkat (T cell line) and RAMOs (B cell line). The cells were cultured for 14 days, and expression was analyzed by flow cytometry and VCN.

[0180] The expression levels of the WAS vector in Jurkat cells are shown in Figure 3, and the expression levels in RAMOs cells are shown in Figure 4. As these figures show, the exposed minimal promoter HS1pro (SEQ ID NO: 1) functions the same as WAS1.6 in all cell lines (MEG-01, CMK, Jurkat, and RAMOs). The HS2 enhancer itself appears to be relatively inactive (190 bp). By removing the inactive 1 kb sequence and the 190 bp HS2 sequence, approximately 1.2 kb of sequence can be saved.

[0181] The HS3 enhancer appears to increase expression in megakaryocyte cell lines but is inactive in B and T cells. The HS4 enhancer appears to increase expression in megakaryocytes and B cells but is inactive in T cells. The E3 enhancer appears to increase expression in megakaryocytes but is inactive in B and T cells (non-endogenous elements).

[0182] From the standpoint of these findings, the preferred WAS vector is one containing HS4-HS3-HS2-HS1pro. This vector is only 200 bp larger than WAS1.6, but it results in higher expression in megakaryocytes and B cells than WAS1.6, and similar expression levels in T cells compared to WAS1.6.

[0183] A thorough reanalysis of the WAS locus identified 13 putative endogenous enhancer elements contained within a 1.1 million base pair window spanning 850 kb upstream and 250 kb downstream of the WAS gene. Three of these elements had been previously identified in our proximal bioinformatics analysis of the WAS locus. To experimentally identify the definitive enhancer element controlling the WAS gene, each putative enhancer element was cloned upstream of the endogenous minimal WAS promoter (HS1pro) and used to drive mCitrine expression (see Figure 5A). Expression of these vectors was compared to a γ retroviral vector (CMMP-mCit, see Figure 5B) that had been used as a previous control and was able to restore platelet counts to normal levels.

[0184] The vector was transduced into cells, cultured for 14 days, and expression was re-analyzed by flow cytometry and VCN. Figure 6 shows data for MEG-01 (megakaryoblast cell line), Figure 7 shows data for Jurkat cells (T cell line), and Figure 8 shows results for RAMOs cells (B cell line). As shown in these figures, all 10 newly identified enhancer elements increased expression in MEG-01 cells (megakaryoblast cell line) at higher levels than with the WAS1.6 vector and our previous lentiviral vectors (HS4, 3, 2, 1). Elements 1, 3, 7, 8, and 9 each independently drove expression at higher levels than with our previous clinical γ-retroviral CMMP-mCit vector. All vectors were expressed at higher levels than the γ retroviral vector and at similar levels to WAS1.6 in Jurkat (T cell line), and all vectors were expressed at higher levels than the γ retroviral vector and at similar levels to WAS1.6 in RAMOS (B cell line). In addition, element 2 increased expression to twice the level compared to WAS1.6 and CMMP-mCit.

[0185] The 10 elements were screened again in umbilical cord blood (CB) CD34+ HSPC differentiated into megakaryocytes and platelets, and the results from the cell lines were confirmed. Figures 9-11 show the expression levels of the WAS vector in promegakaryocytes, megakaryocytes, and platelets, respectively. As shown in these figures, the data from CB CD34+ differentiated megakaryocytes differ from the data from MEG-01 cells (megakariblast cell line). Specifically, only enhancer element 2 appears to accelerate expression in CB CD34+ megakaryocytes. This construct is expressed twice as high as WAS1.6, but its expression is lower compared to the γ retrovirus construct.

[0186] One proposed induced vector should contain XXX-HS2-HS1-WASp-WPRE, where XXX represents an additional enhancer element that can be added. The HS2-HS1 component contains two functional elements within the WAS1.6 promoter, where HS1 is the main driving factor and HS2 provides an extra 190 bp. Various constructs containing these elements, as well as enhancer elements 1-10, were constructed and evaluated in promegakaryocytes (Figure 12), megakaryocytes (Figure 13), and platelets (Figure 14).

[0187] It was measured that the optimal vector can contain various components from one or more of the enhancer regions HS3, E2, E9, and E10. HS3 was identified as 531 bp, E2 as 3678 bp, E9 as 555 bp, and E10 as 455 bp. In particular, it was desirable to identify smaller, effective fragments of these regions, especially in terms of the length of enhancer region E2. Analysis of enhancer element 2 (260 kb downstream of WAS) revealed that it contains five fragments of approximately 3.7 kb each. Five E2 fragments, namely E2-1 (the first half of core sub-element 1 + the second half of core sub-element 1, see e.g., Table 1, SEQ ID NOs. 3 and 4, respectively), E2-2 (see e.g., Table 1, SEQ ID NO. 5), E2-3 (see e.g., Table 1, SEQ ID NO. 6), E2-4 (see e.g., Table 1, SEQ ID NO. 7), and E2-5 (see e.g., Table 1, SEQ ID NO. 8), were cloned into five different vectors, making it possible to identify and include the most active E2 fragment in each vector. Expression of these vectors was measured in promegakaryocytes (Figure 15), megakaryocytes (Figure 16), and platelets (Figure 17). As shown in Figures 15-17, none of the E2 elements appeared to be the primary driving factors for expression. E2 sub-elements 2 and 3 did not appear to have any effect on expression when tested individually. E2 is a driving factor for megakaryocyte expression, but it is desirable that it be able to be reduced. This enhancer results in 3-fold higher expression in platelets than WAS1.6 and 1.6-fold higher expression in megakaryocytes than WAS1.6. However, the E2 enhancer is expressed less compared to the γ retroviral vector. On the other hand, the increase compared to WAS1.6 may be sufficient to increase platelet count to a normal level. Elements 1, 2, 3, 7, 8, and 9 each independently drive higher expression in MEG-01 cells than the previous clinical γ retroviral CMMP-mCit vector, while their expression is lower in CB CD34+ megakaryocytes compared to CMMP-mCit. Therefore, there is an expression discrepancy between enhancer elements between CB CD34+ differentiated megakaryocytes and megakaryocyte cell lines (MEG-01 cells).

[0188] Considering these observations, a particular preferred vector would be: 1) E2 (All Slim) - HS1pro - mCit - WPRE (5.6kb); 2) E9 (Slim) - HS3 (Slim) - E2 (All Slim) - HS1pro - mCit - WPRE (6.1kb); 3) E9(slim)-HS3(slim)-E21,4,5(slim)-HS1pro-mCit-WPRE(5.6kb); and 4) E9(slim)-HS3(slim)-E2's 1 (slim) first half and 5(slim)-HS1pro-mCit-WPRE (5.0kb) These include, but are not limited to, the following:

[0189] The above size matches that of the mCit reporter in the open reading frame. The size differs from that of the nucleic acid encoding WASP within the open reading frame.

[0190] Note that vector (3) removes sub-elements 2 and 3 within enhancer element 2, while vector (4) removes the second half of sub-element 1 of enhancer element 2, as well as sub-elements 2, 3, and 4.

[0191] For clinical applications (e.g., to treat WAS), it is also understandable that the mCitrine open reading frame may be replaced with a nucleic acid encoding the WASp protein. Exemplary nucleic acids include, but are not limited to, WAS cDNA and codon-optimized WAS nucleic acids.

[0192] Example 2 Identification of lead candidate vectors Example 1 described the generation of four read candidate vectors: 1) E2(all slim)-HS1pro-mCit-WRPE; 2) E9(slim)-HS3(slim)-E2(all slim)-HS1pro-mCit-WRPE; 3) E9(slim)-HS3(slim)-E21,4,5(slim)-HS1pro-mCit-WRPE; and 4) E9(slim)-HS3(slim)-E211(slim) first half and 5(slim)-HS1pro-mCit-WRPE.

[0193] This example describes screening these vectors and determining lead candidate vectors in CB CD34+ HSPC-differentiated megakaryocytes and platelets. In addition, we evaluated the ability to express actual therapeutic proteins by replacing the open reading frame of mCitrine with WASp through codon optimization. We also demonstrated the modification of WASp expression in WAS patient T and B cell lines.

[0194] To measure lead candidate vectors, four candidate vectors were screened in megakaryocytes and platelets differentiated from healthy donor (HD) umbilical cord blood (CB) CD34+ hematopoietic stem cells and progenitor cells (HPSCs). Single elements containing modified boundaries and fragments of the E2, E9, and HS3 elements were also included, and it was measured whether the modifications (smaller elements) used to generate the lead candidates still preserved expression of the parent elements. WAS1.6 (the current WAS vector undergoing clinical trials) and previously used gamma retroviral vectors were also included for expression comparison.

[0195] As shown in Figure 22, the modified "slim" versions of E9, HS3, and E2 maintain the expression of larger parent elements. In addition, one lead candidate vector, E9(slim)-HS3(slim)-E2 1,4,5(slim)-HS1pro-mCit-WRPE, exhibits similar levels of expression to the γ retroviral vector and 1.8 times higher expression than WAS1.6 in CB CD34+ HSPC-differentiated megakaryocytes (Figure 22).

[0196] Since the E9(slim)-HS3(slim)-E2 1,4,5(slim)-HS1pro-mCit-WRPE is expressed at a similar level to γ ​​retroviral vectors and 1.5 times higher than WAS1.6 (see, for example, Figure 23), similar results were observed in CB CD34+ differentiated platelets.

[0197] Considering this data, one candidate read vector is E9(slim)-HS3(slim)-E21,4,5(slim)-HS1pro-mCit-WPRE(WasVec), which is, 1) In CB CD34+ megakaryocytes, it is expressed at a level equal to / or higher than γ-retroglycerides, 2) It was expressed 1.8 times more than WAS1.6, It is a 5.6kb w / mCitrine file in open reading frame format; It is a 6.4kb w / WASp open reading frame; 3) It is expressed 1.5 times more in platelets than WAS1.6.

[0198] To screen for ideal codon-optimized sequences of WASp and further improve its expression, T and B cell lines derived from WAS patients were immortalized, and different codon-optimized versions of the WASp open reading frame in WASVec-(E9(slim)-HS3(slim)-E21,4,5(slim)-HS1pro-WASp-WPRE) were screened using these cell lines.

[0199] The following are the characteristics of WAS B cell and T cell lines, respectively: cDNA (unmodified, native cDNA sequence as a control); jCAT codon optimization; GeneArt codon optimization; IDT codon optimization; and WASp Open Reading Frame with Benchmarking Codon Optimization We introduced different versions of WASVec, each representing a different codon-optimized version.

[0200] As shown in Figures 24 and 25, jCAT codon optimization of WASP in WASVec resulted in 1.29-fold and 1.48-fold increases in expression in B cells (Figure 24) and T cells (Figure 25), respectively, compared to non-codon-optimized native cDNA. GeneArt codon optimization resulted in 1.13-fold and 1.20-fold increases in expression in B and T cells, respectively, compared to native cDNA, while IDT and venting codon optimization resulted in decreased expression in B and T cells, as also shown in Figures 24 and 25. None of the codon optimizations appeared to have a significant effect on titer. In addition, CATGeneArt may slightly increase titer (Figure 26).

[0201] Considering these observations, one candidate read vector is E9(slim)-HS3(slim)-E2(1,4,5slim)-HS1pro-WASP(jCAT codon optimized)-WPRE, i.e., WASVec. This vector has WASp in the open reading frame and is 6.4kb in size.

[0202] The examples and embodiments described herein are for illustrative purposes only, and it is understood that various modifications or changes in light thereof will be suggested to those skilled in the art and should be included within the spirit and scope of this application and the appended claims. All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety for all purposes. Sequence List Sequence ID 1: HS1pro (minimally endogenous promoter of the WAS gene) TCAGCCTCAGGCTACCTAGGTGCTTTAGAAAGGAGGCCACCCAGGCCCATGACTACTCCTTGCCACAGGGAGCCCTGCACACAGATGTGCTAAGCTCTCGCTGCCAGCCAGAGGGAGGAGGGTCTGAGCCAGTCAGAAGGAGATGGGCCCCAGAGAGTAAGAAAGGGGGAGGAGGACCCAAGCTGATCCAAAAGGTGGGTCTAAGCAGTCAAGTGGAGGAGGGTTCCAATCTGATGGCGGAGGGCCCAAGCTCAGCCTAACGAGGAGGCCAGGCCCACCAAGGGGCCCCTGGAGGACTTGTTTCCCTTGTCCCTTGTGGTTTTTTGCATTTCCTGTTCCCTTGCTGCTCATTGCGGAAGTTCCTCTTCTTACCCTGCACCCAGAGCCTCGCCAGAGAAGACAAGGGCAGAAAGCACC Sequence number 2 Enhancer element 2 (slim) Sequence ID 3: The first half of Core Sub-Element 1 of Enhancer Element 2 GACCTGAAGGGTAAGGGGGTGTGGAGGTTGTGAAGGCGGGAAGGGGGGTAGCCCCTTCACCAATGTAAACAAGGATGTGGGTTCTGCGGCCACACTCTCCCCCGCCCTCCCCAGCGGCATTTCCAGCAAGTCACA TGTCCTGCGCACAGGCTGGGGGCCCCCTGCTGCTGCCTTTCTTAGAAGCCAGGACCACAGAGCCCGCACAGTGAGCTACTTGGGGAGCTATTTCTGTAGACTGAGCTTGGGGTACTGGGAGGCAGTGCTGTTGGC Sequence ID 4 Enhancer Element 2, second half of Core Sub-Element 1 GATCTGGGGGAAAACCCCCTGAGGGTCCCATTTCTCTGCCACTGACCCCTTTGCCTGGCAGAAAGGCTCTGCTGCCTCCTAGCTGTGTAGCAATGGATAAGGCCTTTAACCTCTCTAAGCTGAAATGTCCTCATGCATAAGGTGGAGACAGTAACTCCTCTTCCATCTGCTGGGTGTTGTCAAAACTACACAGGAGGTTTGCCAAGCACCTAAGGCACAGTAGGTGGTCAAGAAACAGGAACACAATTTGTCATGACGACAATGATTCCTTCATATGCTAGTTACCCACGAGTCAGCCAGAATGTTGCCATAACCACTTATGAAGCCCTTCCTCATTTCTGTTGCAATTCCTCAGCCAGAGGAAAGCCCCA Sequence ID 5: Core sub-element 2 of enhancer element 2 CCACCTCTGTCCTCCAGAAAGCCCTCCTCTTCCCAGAAGGCTGGCACACAGGGCTGGGGGCCAGGCTTGACTTCCCTGTGGAGGGGTCTGAGGTTGGGGGGATGACCTGCAGAGGTAGGGGAATTCAGAGAACTTGTTTTG ATAGAAACTGAAACTCCTCCTCTTGCTGACGCTGCACTTGTGGGCAATCTGCACCTGTTCTCCCCTCCCAGAGGCCAGCTGGAAGGGGGTCCCCCACCATTCTACCTCTGTTCCCATCTCAAACAGGGCTCAGAAATCCTCA Sequence ID 6: Core sub-element 3 of enhancer element 2 GAGAGCCTGGATTATCTTCCTATAGGGTCCTACCATTTGCTTTAGAGACATCTGAGAGAACTGCCTACTCCCCAGGTAGCTGCCTGCCTCCCAGAAGAGCCACAGCAAGTTCCGCTAAGGGCAAAAAAGGAAGCTAGGTGTCTACAGGGAACCTAAAAACAAACCACACTAACGTGTGTACACACAGCTGCAGAGGGAGACAGGGACCTGGTCTGCT Sequence ID 7: Core sub-element 4 of enhancer element 2 CACAGCCCTTGCCACTCCCCCATGGCCCATGTAGAAACAACCATGTGGCCTTCACTCTGCCCACAGAAGCTAGCACCAGGACCCTGGTCAGGGTTAGAGGTTTCTGCTGAGTCAAAGCCACATGGAGGGAGGGAGCAAGGGAGAGATGCAGAGTCATGTTTCCAGGAGGAGGTTATCTGAGCATAACAGGGACAGGGTGGCCACAGGATACCTCTGAGGCTCAGGTTCCCACCTCCACTCCACC Sequence ID 8: Core sub-element 5 of enhancer element 2 CTCCAACTCTCTGCTCCACGTTCCTTCCACTATTCAACACATGGCAGGAAGTCAGCCTGTAGGGCTTCACACTACAGTCTAAGCTGACTGCCATCTGTCCCCATCCAGGCGAGGCTGGAAACGGGGGCAGCAAAAAGCCCAGGGACAAAGTCCCCTTCCCAGGCACATGTATTATGCACTCTGCACCAAGGAAACCTCCAGATAA GGTCTAGAGACCAAGGGCCATGTACTTCGGGGGAGAGGCCAGAGGACTTCTGAGGTTTTACAGAGAAAAGCCAAAGGCAGCCCAGTCAGGGGAAATGTGTAGCCATAGTGCCGATAAGGAAAGGCCTTCAACCTGCCCTGGTCAGCTCTTCCTGTAAGTAGAGGCCCCTTACCGAAGGCCCCAGTGGGAGGAAGGGTCGGGAGTA Sequence ID 9: Enhancer Element HS3 (Complete) [ka] Sequence ID 10 Enhancer Element HS3 Core CTAAAAGCCACCAAAACCAAGACAGCAATGAAAGTAACCTCTGGTCTTCTAACTGCTCATTATACACTAATTATGATGCACTAGCATGCTAAGAGACACTTCCACCAGCGCCATGACAGTGCCATGGCAACATCAAGAAGTCACCCCACATGGTCTAAAAAAGGGGAAGAACCTTCAGTTCCCGGAATTGCCCCCCCTTTCCTGGAAAACTCATGAATAATCCACCCCTTGTTTAGCATATAAT Sequence ID 11: Enhancer Element E9 (Complete) GGGATCTGTGTGCAGATTTACCTCTACCTACACCTGGCTGGGGATCATAAAGAAAATCAAGGGATGCGCTACCTCCATGAATCCAGGTTTCAGCAGAGCTAAGGGAGTGAAATTTGGGGCCATTTTACTTGTCTCAAACCTTGTTATCTGAGAGAAAGCTAGAGCTTCCTTCTTTCAGCCCCCAGAGACAATGTGGCCAGGCTCCGGAGGGCTGGGAAGATGAGCAATGCTTGTGAGTCACCATGATAGGAAGCAGAAGGGTCAGGAAGTCCCTGGGAGCAAGGCTTAGGGTTAGGGTTAGGGAGAAAACACTTGGGCCTGGAGGCTCGGGGCAGGCTTCCTAGAGGGGAGGGGTAGGAAGAGGCAGTGACAGGGCCCACAGCAATGGAGAGGAGTTGGACTGCAGGGATGGGGTAGGGGGACAGACGACAAGGGACACTCAGAAGACTAATGTCTGGGAGTGGGAAAACAGTGTTTGCTCAGCCAGGAAGCTGCATCCAGCTCTTTTATCATTTGTAGAAGACCAAGTACCCAGGCCTGGGAGGAGCCCAGAGA SEQ ID NO: 12 Enhancer element E9 core CAAACCTTGTTATCTGAGAGAAAGCTAGAGCTTCCTTCTTTCAGCCCCCAGAGACAATGTGGCCAGGCTCCGGAGGGCTGGGAAGATGAGCAATGCTTGTGAGTCACCATGATAGGAAGCAGAAGGGTCAGGAAGTCCCTGGGAGCAAGGCTTAGGGTTAGGGTTAGGGAGAAAACACTTGGGCCTGGAGGCTCGGGGCAGGCTTCCTAGAGGGGAGGGGTA SEQ ID NO: 13 WAS cDNA Sequence ID 14: Codon-Optimized WAS Sequence ID 15 E2 (All Slim) - HS1pro - mCit - WPRE The sequence derived from CMV, arranged clockwise (red arrow in Figure 18): Sequence ID 16: E9(Slim)-HS3(Slim)-E2(All Slim)-HS1pro-mCit-WPRE (E9(Slim) and HS3(Slim) elements added) In Figure 19, the sequence derived from CMV (red arrows) is arranged clockwise: Sequence ID 17 E9(slim)-HS3(slim)-E2(1,4,5slim)-HS1pro-mCit-WPRE (Element 2's core sub-element 2 and Element 2's core sub-element 3 are missing) In Figure 20, the sequence derived from CMV (red arrows) is arranged clockwise: Sequence ID 18: E9(slim)-HS3(slim)-E2(first half of 1 and 5 slim)-HS1pro-mCit-WPRE(second half of core sub-element 1 of element 2 and core sub-element 4 of element 2 missing) In Figure 21, the sequence derived from CMV (red arrows) is arranged clockwise: SEQ ID NO:19 CMV: AGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCG SEQ ID NO:20 5’R / U5: GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGC SEQ ID NO:21 PSI: Tcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggag SEQ ID NO:22 RRE: Tccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacct SEQ ID NO: 23 WPRE: Cccatatttgttctgtttttcttgatttgggtatacatttaaatgttaataaaacaaaatggtggggcaatcatttacatttttagggatatgtaattactagttcaggtgtattgccacaagacaaacatgttaagaaactttcccgttatttacgctctgttcctgttaatcaacctctggattacaaaatttgtgaaagattgactgatattcttaactatgttgctccttttacgctgtgtggatatgctgctttaatgcctctgtatcatgctattgcttcccgtacggctttcgttttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtccgtcaacgtggcgtggtgtgctctgtgtttgctgacgcaacccccactggctggggcattgccaccacctgtcaactcctttctgggactttcgctttccccctcccgatcgccacggcagaactcatcgccgcctgccttgcccgctgctggacaggggctaggttgctgggcactgataattccgtggtgttgtcggggaagggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctgga SEQ ID NO: 24 3' PPT: tttttaaaagaaaaggggggac SEQ ID NO: 25 3' data U3 / R / U5 tggaagggctaattcactcccaacgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacctactgcttaagcctcaataaagcttgccttgagtgcttCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGC SEQ ID NO: 26 SV40 ori: Atcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagg[[ID=*6]] SEQ ID NO: 27 KANr: It should be noted that the content seems to be some genetic sequence-related information. If you have any specific questions about this translation or the original content, feel free to let me know. Also, please double-check the accuracy of the translation according to your specific needs, especially considering the专业性 of patent texts.Attgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctctctgatgccgccgtgttccggctgtcagcgcaggggcgccccggtctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggcta tcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctctctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattc gaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaa aatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgctttatcgcttctttgacgagttcttcttga அக்க்கு நுர்க்கு28 COLE1: agatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatacca aatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttacc ggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcg gcagggtcggaacaggaggcgcacgaggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcg Sequence ID 29: Complete sequence of WASVec lentiviral vector transfer transcription including codon-optimized WASp open reading frame (sequence starts with CMV) tttatattggctcatgtccaacattaccgccatgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatgg

Claims

1. A composition for the treatment of Wiscott-Aldrich syndrome (WAS), comprising a recombinant lentiviral vector (LV), wherein the vector is It is an expression cassette, A nucleic acid sequence comprising an effective fragment of the endogenous promoter of the WAS gene, wherein the effective fragment comprises the sequence of HS1pro (SEQ ID NO: 1), has a maximum length of 600 bp, and is operably linked to a recombinant nucleic acid of SEQ ID NO: 2, or an effective fragment thereof (any of SEQ ID NOs: 3-8), and a nucleic acid encoding the Wiscott-Aldrich syndrome protein (WASp), A composition comprising an expression cassette containing the following.

2. The composition according to claim 1, wherein the expression cassette further comprises enhancer element HS3 (SEQ ID NO: 9) or an effective fragment thereof (SEQ ID NO: 10).

3. The composition according to claim 1 or 2, wherein the expression cassette further comprises enhancer element E9 (SEQ ID NO: 11) or an effective fragment thereof (SEQ ID NO: 12).

4. The vector includes a sequence in sequence number 15 in which the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp). The composition according to any one of claims 1 and 3.

5. The vector includes a sequence in which the sequence encoding mCitrine in Sequence ID No. 16 is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp); or The vector includes a sequence in which the sequence encoding mCitrine in Sequence ID No. 17 is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp); or The vector includes a sequence in sequence number 18 in which the sequence encoding mCitrine is replaced with a nucleic acid encoding Wiscott-Aldrich syndrome protein (WASp). The composition according to claim 1.

6. The nucleic acid encoding the WASp is a WAS cDNA or a codon-optimized WAS gene; or The nucleic acid encoding the WASp is WAS cDNA (SEQ ID NO: 13); or The nucleic acid encoding the WASp is a codon-optimized WAS gene; or The nucleic acid encoding the WASp is a codon-optimized WAS selected from the group consisting of a jCAT codon-optimized WAS gene, a GeneArt-optimized WAS gene, and an IDT-optimized WAS gene. The composition according to any one of claims 1 to 5.

7. The vector includes a Ψ region vector genome packaging signal; and / or The vector includes a 5'LTR containing a CMV enhancer / promoter; and / or The vector includes a Rev response element (RRE); and / or The vector includes a central polypurine band; and / or The vector includes a post-transcriptional control element; and / or The vector includes a post-transfer control element, and the post-transfer control element is a modified woodchuck post-transfer control element (WPRE). The composition according to any one of claims 1 to 6.

8. A host cell transduced with the vector specified in any one of claims 1 to 7.

9. The aforementioned cells are stem cells; or The cells are stem cells derived from bone marrow, and / or umbilical cord blood, and / or peripheral blood; or The aforementioned cells are human hematopoietic progenitor cells; or The aforementioned cells are human hematopoietic progenitor cells, and the aforementioned human hematopoietic progenitor cells are CD34+ cells. The host cell according to claim 8.

10. A recombinant nucleic acid sequence comprising an effective fragment of the promoter of the WAS gene, wherein the effective fragment comprises the sequence of HS1pro (SEQ ID NO: 1), having a maximum length of 600 bp, and comprising a recombinant nucleic acid sequence operably linked to the recombinant nucleic acid sequence of SEQ ID NO: 2, or any of its effective fragments (SEQ ID NOs: 3 to 8).

Images