Compositions and methods for treatment

Specific 14-3-3θ-derived peptides target and eliminate pathological TDP-43, addressing the lack of cure for ALS and FTD by reducing cytoplasmic accumulation and improving symptoms in these neurodegenerative diseases.

JP7850066B2Active Publication Date: 2026-04-22セロシアセラピューティクスプロプライアタリーリミティド
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
セロシアセラピューティクスプロプライアタリーリミティド
Filing Date
2020-08-12
Publication Date
2026-04-22

AI Technical Summary

Technical Problem

There is no cure for neurodegenerative diseases like ALS and FTD, which are characterized by TDP-43 pathology, and the molecular mechanisms regulating TDP-43 localization during mRNA processing and cytoplasmic accumulation in these diseases remain unclear.

Method used

Administering specific peptides derived from 14-3-3θ, such as those with the amino acid sequence of SEQ ID NO: 1 or its conserved variants, or nucleic acid molecules encoding these peptides, to target and eliminate pathological TDP-43, thereby reversing functional deficits associated with ALS and FTD.

Benefits of technology

The peptides effectively reduce cytoplasmic accumulation and fragmentation of TDP-43, improving symptoms such as disinhibition, hyperactivity, motor impairment, and muscle weakness in ALS and FTD models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007850066000001
    Figure 0007850066000001
  • Figure 0007850066000002
    Figure 0007850066000002
  • Figure 0007850066000003
    Figure 0007850066000003
Patent Text Reader

Abstract

Provided herein is a method for treating or preventing a neurodegenerative disease associated with TDP-43 pathology, or ameliorating at least one symptom thereof, comprising administering to a subject an effective amount of a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof, optionally linked to a protein destabilization domain sequence, or a nucleic acid molecule encoding said peptide. Also provided are peptides comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof, chimeric molecules comprising said peptides linked to a protein destabilization domain sequence, and polynucleotides encoding said peptides or chimeric molecules.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This disclosure relates to compositions and methods for the treatment and prevention of neurodegenerative diseases characterized by or associated with TDP-43 pathology. This disclosure also relates to isolated peptides and chimeric molecules, as well as nucleic acids and gene constructs encoding said peptides and chimeric molecules, suitable for treating and preventing said neurodegenerative diseases. [Background technology]

[0002] Amyotrophic lateral sclerosis (ALS) is a motor neuron disease that affects motor neurons in both the brain and spinal cord. ALS is a fatal disease characterized by the loss of pyramidal cells in the cerebral motor cortex, prespinal motor neurons, and brainstem motor neurons, leading to muscle weakness and atrophy. ALS typically progresses rapidly after onset and often results in death within a few years.

[0003] Frontotemporal dementia (FTD) is characterized by progressive damage to the frontal and / or temporal lobes of the brain and is associated with progressive deterioration of decision-making ability, behavior, and language control. FTD is one of the most common forms of presenile dementia, with a median life expectancy of less than 15 years after diagnosis.

[0004] ALS and FTD are both rapidly progressing and fatal neurodegenerative diseases with significant clinical, genetic, and pathological overlap. ALS and FTD are typically classified as either familial (approximately 10% of cases, involving one or more defined gene mutations) or sporadic (approximately 90% of cases, typically with an unknown etiology). The familial and sporadic forms of the disease are clinically indistinguishable. Neuropathologically, ALS and FTD are characterized by the deposition of TDP-43 in neurons. Recent studies suggest that mislocalization of nuclear TDP-43 into the cytoplasm induces toxic adverse events, including abnormal phosphorylation and fragmentation of TDP-43 (Shenouda et al., 2018, Adv Neurobiol 20:239-263), but the molecular mechanisms that regulate the physiological nucleocytoplasmic shuttle of TDP-43 during mRNA processing and drive cytoplasmic accumulation in the disease remain unclear.

[0005] There is no cure for ALS or FTD. The prognosis is poor, and treatment options are limited. The development of new methods to treat these debilitating diseases is clearly needed. [Overview of the Initiative]

[0006] This disclosure is based on our identification of 14-3-3θ as a novel interaction partner of TDP-43 that contributes to the abnormal cytoplasmic localization of TDP-43 and to the pathogenesis of ALS and FTD. We have found that pathological TDP-43 can be targeted and eliminated using specific peptides derived from 14-3-3θ, reversing the functional deficits associated with ALS and FTD.

[0007] The first aspect of this disclosure provides a method for treating, preventing or improving at least one symptom of a neurodegenerative disease associated with TDP-43 pathology, the method comprising administering an effective amount of a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conserved variant thereof, or a nucleic acid molecule encoding the peptide, to a subject in need thereof.

[0008] In certain embodiments, the neurodegenerative disease is selected from amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). ALS includes familial ALS and sporadic ALS. FTD includes familial FTD and sporadic FTD. At least one symptom may include, for example, disinhibition, hyperactivity, motor impairment, or muscle weakness.

[0009] The amino acid sequence of SEQ ID NO: 1 may be provided within a larger, more closely located peptide or polypeptide sequence. In exemplary embodiments, the peptide sequence may include, or consist of, the amino acid sequence of SEQ ID NO: 2, its conserved variants, or sequences that are at least about 75% identical to the sequence of SEQ ID NO: 2.

[0010] Nucleic acid molecules encoding the peptide of SEQ ID NO: 1 or its conserved variants may contain the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least approximately 70% identical to the sequence of SEQ ID NO: 4.

[0011] A peptide of SEQ ID NO: 2, its conserved variant, or a nucleic acid molecule encoding a sequence identical to it by at least approximately 75% may contain the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence identical to that of SEQ ID NO: 5 by at least approximately 70%.

[0012] In certain embodiments, the peptide includes or is ligated to a protein destabilization domain sequence. In exemplary embodiments, the protein destabilization domain sequence includes the rapamycin-binding protein FKBP12.

[0013] Therefore, in one embodiment, the method involves administering to a subject a gene construct encoding a peptide comprising the sequence of SEQ ID NO: 1 or its conserved variants, operably linked to a nucleotide sequence encoding a protein destabilization domain, or a peptide comprising such a sequence.

[0014] A second aspect of the present disclosure provides for the use of a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof, or a nucleic acid molecule encoding said peptide, in the manufacture of a medicament for the treatment or prevention of a neurodegenerative disease associated with TDP-43 pathology, or for the amelioration of at least one symptom thereof.

[0015] A third aspect of the present disclosure provides an isolated peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof.

[0016] The peptide may comprise or consist of the amino acid sequence of SEQ ID NO: 2, a conservative variant thereof, or a sequence that is at least about 75% identical to the sequence of SEQ ID NO: 2.

[0017] A fourth aspect of the present disclosure provides an isolated polynucleotide encoding the peptide of the third aspect.

[0018] The polynucleotide may comprise or consist of the sequence of SEQ ID NO: 4 or SEQ ID NO: 5, or a polynucleotide that is at least about 70% identical to the sequence of SEQ ID NO: 4 or SEQ ID NO: 5.

[0019] In exemplary embodiments of the third and fourth aspects, the peptide or polynucleotide is for use in the treatment or prevention of a neurodegenerative disease associated with TDP-43 pathology, or for the amelioration of at least one symptom thereof.

[0020] A fifth aspect of the present disclosure provides a chimeric molecule comprising a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a conservative variant thereof linked to a protein destabilizing domain sequence.

[0021] A sixth aspect of the present disclosure provides an isolated polynucleotide encoding the chimeric molecule of the fifth aspect.

[0022] In exemplary embodiments of the fifth and sixth aspects, the chimeric molecule or polynucleotide is for use in the treatment or prevention of neurodegenerative diseases associated with TDP-43 pathology, or the amelioration of at least one symptom thereof.

[0023] A seventh aspect of the present disclosure provides a vector comprising the polynucleotide sequence of the fourth or sixth aspect.

[0024] The vector may be a viral vector. The viral vector may be an AAV vector. Typically, the vector is for administration to a subject for the treatment or prevention of a neurodegenerative disease associated with TDP-43 pathology, or the amelioration of at least one symptom thereof.

[0025] [[ID=ll]] The vector may be designed for introduction into neurons or brain cells and to direct or promote the expression of the encoded peptide or chimeric molecule in neurons or brain cells.

[0026] As non-limiting examples only, aspects and embodiments of the present disclosure are described herein with reference to the following drawings.

Brief Description of the Drawings

[0027] [Figure 1] 14-3-3θ interacts with TDP-43. Immunoprecipitation (IP) of 14-3-3θ / TDP-43 complexes from N2A cells (A) and mouse brain (B). Control (ctr) IP confirmed the absence of non-specific binding. [Figure 2] Co-expression shows significantly enhanced immunoprecipitation (IP) of 14-3-3θ with TDP-43 having a pathogenic mutation compared to its non-mutant form (n = 3). ***P < 0.001; **P < 0.01; *P < 0.05. Error bars indicate standard error of the mean (SEM). [Figure 3](A) When A315T mutant TDP-43 is expressed alone, it localizes to the nucleus (+MOCK; arrowhead), but when expressed with 14-3-3θ, A315T-TDP-43 co-localizes to the cytoplasm (white arrowhead). (B) Co-expression of (Δ)TDP-43 lacking NLS or NES with 14-3-3θ shows significantly enhanced IP compared to co-expression with the non-mutant (n=3). ****p < 0.0001; *p < 0.05. Error bars indicate SEM. (C) Co-expression with 14-3-3θ localizes ΔNES TDP-43 (black arrowhead), which normally localizes to the nucleus, into the cytoplasm (white arrowhead). For comparison, the cytoplasmic localization of ΔNLS TDP-43 and the nuclear localization of non-mutant TDP-43 were not altered by 14-3-3θ. [Figure 4] Unless α-helix 6 (ΔF) was removed, the N-terminal and C-terminal cleavage mutants of 14-3-3θ immunoprecipitated with TDP-43. Note that in the absence of α-helix 7-9 (ΔG), 14-3-3θ / TDP-43 immunoprecipitation was enhanced. [Figure 5] Co-expression of 14-3-3θα-helix 6 alone (14-3-3θ-Fx-V5) was immunoprecipitated with TDP-43, similar to the 14-3-3θ GΔ mutant. [Figure 6] Alignment of α-helix 6 of the 14-3-3 isoform corresponding to 14-3-3θ-Fx. Red box, 11 amino acid sequence specific to 14-3-3θ. [Figure 7] (A) AAV-mediated expression of 14-3-3θ-V5 in the hippocampus resulted in insolubility and fragmentation (arrowhead) of TDP-43 in control (ctr) and iTDP-43A315T mice, respectively. Quantification of TDP-43 fragmentation levels from independent experiments (n=6). ***P < 0.001; *P < 0.05. Error bars indicate standard error. (B) Quantification of hTDP-43-expressing neurons in the hippocampal CA1 region of AAV-vec (vector) and AAV-14-3-3θ-V5 injected iTDP-43A315T mice. **P < 0.01. Error bars indicate SEM. [Figure 8](A) Amino acids 135-164 of 14-3-3θ, which has a C-terminal degeneration domain (DD) and an N-terminal V5 tag (DD-θFx), spontaneously degrade when expressed in primary neurons unless stabilized by Shield1 treatment. (B) DD-θFx reduced the level of co-expressed A315T mutant human (h) TDP-43 in primary neurons (n=4). Graph: Left column, TDP-43; Right column, TDP-43 + DD-θFx. **, P < 0.01. Error bars indicate SEM. [Figure 9] (A) hTDP-43, primarily in the nuclei of the cortex of vector-injected iTDP-43A315T mice, was significantly reduced in DD-θFx-expressing neurons. (B) Decreased TDP-43 levels in the brains of iTDP-43A315T mice expressing DD-θFx from birth (n=3). mCherry and V5 confirmed AAV-mediated expression. Note that DD-θFx levels were higher in iTDP-43A315T mice than in control mice. Graph: Left column, P0: iTDP-43 + vec; Right column, P0: iTDP-43 + DD-θFx. *, P < 0.05. Error bars indicate SEM. [Figure 10](A) Disinhibition in vector-treated iTDP-43A315T mice (reflected by increased open arm time in elevated cruciform mazes) was significantly reduced with DD-θFx expression (n=8). (B) Increased activity in vector-treated iTDP-43A315T mice (reflected by longer intervals between movement in open fields) was significantly reduced with DD-θFx expression (n=8). (C) Reduced motor performance in vector-treated iTDP-43A315T mice (reflected by shorter time to fall from rotating bars) was comparable to that of ctr mice with DD-θFx expression (n=8). (D) Reduced grip strength in vector-treated iTDP-43A315T mice was significantly higher with DD-θFx expression (n=8). (A)~(D): Column 1, P0:ctr + vec; Column 2, P0:ctr + DD-θFx; Column 3, P0:iTDP-43 + vec; Column 4, P0:iTDP-43 + DD-θFx. vec = vector. ctr = control. ***P < 0.001; **P < 0.01; *P < 0.05; ns, not significant. Error bars indicate SEM. [Figure 11] (A) Reduced levels of transgenic hTDP-43 in iTDP-43A315T mice expressing DD-θFx-V5 compared to mCherry (n=3). Graph: Left column, iv:iTDP-43 + vec, Right column, iv:iTDP-43 + DD-θFx. vec = vector. *P < 0.05. Error bars indicate SEM. (B) Brain staining from vec- and DD-θFx-expressing mice showed a reduction in the number of hTDP-43-positive cells in the hippocampus (n=6). Graph: Left column, iv:iTDP-43 + vec, Right column, iv:iTDP-43 + DD-θFx. vec = vector. **P < 0.01. Error bars indicate SEM. [Figure 12]Disinhibition in vector-treated iTDP-43A315T mice was significantly improved by DD-θFx expression (n=6). First column: iv:ctr + vec; Second column: iv:ctr + DD-θFx; Third column: iv:iTDP-43 + vec; Fourth column: iv:iTDP-43 + DD-θFx. vec = vector. ctr = control. ***P < 0.001; **P < 0.01; *P < 0.05. Error bars indicate standard error (SEM). [Figure 13] The progressive decline in physical strength in vector-treated AAV-hTDP-43 mice is reflected by reduced inversion wire time (A) and corresponding linear regression gradient difference (B), comparable to AAV-hTDP mice injected with AAV-DD-θFx and controls (n=10). B: Column 1, AAV-vec + AAV-vec; Column 2, AAV-vec + AAV-DD-θFx; Column 3, AAV-hTDP-43 + AAV-vec; Column 4, AAV-hTDP-43 + AAV-DD-θFx. * P < 0.05, **** P < 0.0001. Error bars indicate SEM. [Figure 14] Reduced grip strength in AAV-vector-treated AAV-hTDP-43 mice compared to AAV-DD-θFx-injected AAV-hTDP-43 mice (n=7). Column 1: AAV-hTDP-43 + AAV-vec female mice; Column 2: AAV-hTDP-43 + AAV-DD-θFx female mice; Column 3: AAV-hTDP-43 + AAV-vec male mice; Column 4: AAV-hTDP-43 + AAV-DD-θFx male mice. * P < 0.05. Error bars indicate SEM. [Figure 15]Tibialis anterior (TA) muscle atrophy, represented by weight loss, in female and male vector-treated AAV-hTDP-43 mice, comparable to that in AAV-hTDP mice (n=3-7) injected with AAV-DD-θFx. For female and male mice: Column 1, AAV-vec + AAV-vec; Column 2, AAV-vec + AAV-DD-θFx; Column 3, AAV-hTDP-43 + AAV-vec; Column 4, AAV-hTDP-43 + AAV-DD-θFx. * P < 0.05, *** P < 0.001. Error bars indicate SEM. [Modes for carrying out the invention]

[0028] Amino acid and nucleotide sequences are referenced by sequence identification numbers (SEQ ID NO). Sequences are provided in the sequence listing. The amino acid sequence shown in SEQ ID NO. 1 represents an 11-amino acid motif derived from α-helix 6 (αF) of human 14-3-3θ, and the DNA sequence encoding this motif is shown in SEQ ID NO. 4. The amino acid sequence shown in SEQ ID NO. 2 represents a 30-amino acid region derived from αF of human 14-3-3θ, and the DNA sequence encoding this region is shown in SEQ ID NO. 5. The amino acid sequence of human 14-3-3θ is shown in SEQ ID NO. 3. Other nucleotide sequences (including primer sequences) used in the tests described in the Examples are shown in SEQ ID NOs. 6-20.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure belongs. All patents, patent applications, published applications and publications, databases, websites, and other published materials referred to throughout this disclosure are incorporated by reference unless otherwise noted. If there are multiple definitions of a term, the definition in this section shall prevail. When referring to URLs or other such identifiers or addresses, it is understood that such identifiers change and specific information on the internet may appear and disappear quickly, but equivalent information can be found by searching the internet. References to identifiers demonstrate the availability and public dissemination of such information.

[0030] The articles "a" and "an" are used herein to refer to one or more (i.e., at least one) grammatical objects of the article. For example, "element" means one or more elements.

[0031] In the context of this specification, the term “about” is understood to mean a range of numbers that a person skilled in the art would consider equivalent to the listed values ​​in the context of achieving the same function or result.

[0032] Unless otherwise required by context, throughout this specification and the subsequent claims, variations such as “equipment / includes” and “equipment / includes” are understood to mean including the described entity (integer) or step or group of entities (integers) or steps, but not to exclude other entities (integer) or step or group of entities (integers) or steps.

[0033] As used herein, the term “operatably coupled” refers to a functional coupling between two elements, regardless of orientation or distance between them, such that the function of one element is controlled or influenced by the other element. For example, an operatable coupling between a promoter and a nucleic acid sequence means that the transcription and expression of the nucleic acid sequence are under the control of or driven by the promoter. In another example in the context of this disclosure, an operatable coupling between two nucleotide sequences may result in a physical coupling or coupling between expressed encoded peptides or polypeptides, thereby forming a chimeric molecule.

[0034] The term "optionally" is used herein to mean that the features described below may or may not be present, or that the events or situations described below may or may not occur. Accordingly, this specification is understood to include and encompass embodiments in which the features are present, embodiments in which the features are absent, embodiments in which the events or situations occur, and embodiments in which they are absent.

[0035] The term "peptide" refers to a polymer composed of amino acids linked together by peptide bonds. The term "polypeptide" is also used to refer to such polymers, and in some examples, polypeptides are longer than peptides (i.e., composed of more amino acid residues). Nevertheless, the terms "peptide" and "polypeptide" may be used interchangeably herein.

[0036] As used herein, the terms “treat / administer,” “prevent,” “prevent,” and their grammatical equivalents mean any and all use of “treat,” “prevent,” “prevent,” or “prevent,” to treat, prevent, delay, or slow the establishment of a neurodegenerative disease described, or to prevent, hinder, delay, or reverse the progression of the disease in any way. Thus, terms such as “treat” and “prevent” should be considered in their broadest context. For example, treatment does not necessarily mean that the patient is treated until they are completely recovered. If a disease presents with or is characterized by multiple symptoms, treatment or prevention does not necessarily have to improve, prevent, hinder, delay, or reverse all of the symptoms, but it can prevent, hinder, delay, or reverse one or more of the symptoms.

[0037] As used herein, the term “effective dose” includes, within its scope, a non-toxic but sufficient amount or dosage of a drug or compound to provide the desired effect. The exact amount or dosage required varies from subject to subject, depending on factors such as the animal species being treated, the age, size, weight and general condition of the subject, the severity of the disease or symptom being treated, the specific drug being administered, and the method of administration. Therefore, it is impossible to determine an exact “effective dose.” However, for any given case, a suitable “effective dose” can be determined by a person skilled in the art using only routine experiments.

[0038] As used herein, the term “subject / subject” refers to mammals and includes humans, primates, domestic animals (e.g., sheep, pigs, cattle, horses, donkeys), laboratory animals (e.g., mice, rabbits, rats, guinea pigs), performance and show animals (e.g., horses, domestic animals, dogs, cats), companion animals (e.g., dogs, cats), and captured wild animals. Preferably, the mammal is human or laboratory animal. More preferably, the mammal is human.

[0039] TDP-43 is a multifunctional RNA / DNA-binding protein encoded by the TARDBP gene. It possesses two RNA recognition motifs and a large C-terminal glycine-rich domain (GRD) that mediates protein-protein interactions. The G-rich domain is found in the majority of pathogenic TARDBP mutations in familial ALS. However, prior to this invention, little was known about the functional role of TDP-43 interactions in physiology and disease.

[0040] As illustrated herein, we have identified the protein 14-3-3θ as a novel interaction partner of TDP-43. Pathogenic mutants of TDP-43 exhibit increased interaction with 14-3-3θ, resulting in cytoplasmic accumulation, insolubility, phosphorylation, and fragmentation of TDP-43, similar to pathological changes in disease. While we do not wish to be bound by theory, we suggest that transient interactions with 14-3-3θ may stabilize TDP-43 while it is present in the cytoplasm during RNA shuttering. We further suggest that 14-3-3θ interacts with abnormal TDP-43 conformations, making them more susceptible to pathological modification.

[0041] Furthermore, as illustrated herein, the inventors demonstrate that the use of a unique peptide sequence derived from 14-3-3θ mediates the removal of pathological TDP-43 from the brains of mice, thereby reversing and preventing ALS and FTD-related symptoms. While illustrated herein in the context of this peptide sequence bound to a protein destabilization domain, this disclosure intends for the use of the peptide in the absence of the protein destabilization domain. Without wishing to be bound by theory, the inventors suggest that the peptide interferes with the physiological and / or pathological interactions between 14-3-3θ and TDP-43, thereby preventing the toxic downstream effects of the 14-3-3θ / TDP-43 complex.

[0042] In one aspect, the present disclosure provides a method for treating, preventing or improving at least one symptom of a neurodegenerative disease associated with TDP-43 pathology, the method comprising administering a peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or its conserved variants, or a nucleic acid molecule encoding the peptide, to a subject in need thereof.

[0043] Embodiments of this disclosure are applicable to the treatment or prevention of any neurodegenerative disease characterized by or otherwise related to TDP-43 pathology. Typically, such diseases are characterized by or related to cytoplasmic accumulation of nuclear TDP-43 and abnormal phosphorylation and fragmentation of TDP-43. In certain embodiments, the disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). ALS includes familial ALS and sporadic ALS. FTD includes familial FTD and sporadic FTD.

[0044] Symptoms of neurodegenerative diseases include behavioral and physical impairments that are characteristic of or associated with these diseases. Accordingly, according to this disclosure, administration of the peptide or nucleic acid molecule encoding the peptide may improve one or more behavioral or physical deficits characteristic of or associated with neurodegenerative diseases. Such behavioral and physical impairments include disinhibition, hyperactivity, motor impairment, and muscle weakness.

[0045] Numerous pathogenic variants of TDP-43 are known to be associated with sporadic or familial ALS and FTD, including, for example, the A315T, N345K, M337V, G294A, A382T, and G287S mutations. However, those skilled in the art will recognize that the scope of this disclosure is not limited to the treatment or prevention of neurodegenerative diseases in individuals having one or more of these mutations.

[0046] The peptide RKQTIDNSQGA (SEQ ID NO: 1), for use in accordance with the aspects and embodiments of this disclosure, is an 11-amino acid motif located within α-helix 6(aF) of human 14-3-3θ (corresponding to amino acid residues 138-148 of wild-type human 14-3-3θ described in SEQ ID NO: 3).

[0047] Conservative variants of the peptide of SEQ ID NO: 1 are also intended herein. A conservative variant comprises one or more conservative amino acid substitutions, which, as will be well understood by those skilled in the art, is the substitution of one amino acid for another amino acid having similar properties. For example, the substitution of the neutral amino acid serine (S) for the similarly neutral amino acid threonine (T) is a conservative amino acid substitution. Those skilled in the art can determine appropriate conservative amino acid substitutions that do not preclude the functional properties of the peptide with respect to TDP-43 interactions.

[0048] Accordingly, isolated peptides containing or consisting of the amino acid sequence of Sequence ID No. 1 or its conserved variants are also provided herein. As used herein, “isolated,” and with reference to a nucleic acid molecule, means that the peptide is substantially free of cellular material or other contaminating proteins from the cell from which it originates (and thus altered from its native state), or, if chemically synthesized, substantially free of chemical precursors or other chemicals, and thus altered from its native state.

[0049] The peptide of SEQ ID NO: 1 or its conserved variants can be provided within larger, more closely spaced peptide or polypeptide sequences. A peptide sequence containing the sequence of SEQ ID NO: 1 typically exists as a continuous sequence and includes, for example, about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 residues. For example, the peptide of SEQ ID NO: 1 for use in accordance with this disclosure can be provided as part of a sequence of a 14-3-3θ αF helix, such as a sequence containing amino acids 135-164 (SEQ ID NO: 2) or a portion thereof of human 14-3-3θ (SEQ ID NO: 3), or a sequence that is at least about 75% identical thereto. For example, a sequence of an αF helix containing the sequence of SEQ ID NO: 1 may have an amino acid length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more.

[0050] In one embodiment, the peptide may contain, or consist of, the amino acid sequence of SEQ ID NO: 2, its conserved variants, or a sequence that is at least about 75% identical to the sequence of SEQ ID NO: 2. The sequence may be about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 2. Accordingly, isolated peptides containing, or consisting of, the amino acid sequence of SEQ ID NO: 2, its conserved variants, or a sequence that is at least about 75% identical to the sequence of SEQ ID NO: 2 are also provided herein.

[0051] Peptides containing or comprising the sequence of Sequence ID No. 1, or their conserved variants thereof, may contain or be linked to one or more other moieties to facilitate other functions, such as transport, cell recognition, targeting, or protein destabilization or degradation. For example, a peptide may be linked to or comprise a cell-targeting moiety that facilitates the targeting of the peptide to one or more specific types of cells, such as neurons of the central nervous system or other cells. Also, as further described below, for example, a peptide may contain or be linked to a protein-destabilizing or degradation signal or domain to disrupt stability and / or induce degradation in vivo. A peptide may be linked to one or more other moieties by any method known in the art (including any chemical or recombination method), resulting in the formation of covalent and / or non-covalent bonds between the molecule and one or more other moieties, where appropriate. Such moieties may be peptides, polypeptides, or protein moieties. Accordingly, the present disclosure further provides chimeric peptides, polypeptides, and proteins containing the sequence RKQTIDNSQGA (Sequence ID No. 1) or its conserved variants linked to heterologous peptides, polypeptides, or proteins. Such chimeric peptides, polypeptides, or proteins may have lengths of, for example, about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1500 or 2000 residues or more.

[0052] The peptide or conserved variant of SEQ ID NO: 1 may be conjugated to the C-terminus or N-terminus of further peptides, polypeptides, or protein moieties. The component molecules can be conjugated using standard chemical coupling techniques such as MBS, glutaraldehyde, EDC, or BDB coupling, or linked by peptide synthesis or recombination methods known to those skilled in the art.

[0053] In certain embodiments of this disclosure, a peptide comprising the sequence of SEQ ID NO: 1 or a conserved variant thereof is conjugated to or includes a portion that provides a protein destabilization or degradation signal. In exemplary embodiments, the protein destabilization or degradation signal is provided by a protein destabilization or degradation domain (for convenience, referred to herein as the “destabilization domain”). The “destabilization domain” refers to a protein, polypeptide, or amino acid sequence that, when functionally conjugated to the peptide, polypeptide, or protein of interest, can disrupt the stability of the peptide, polypeptide, or protein of interest and, if applicable, induce degradation of that peptide, polypeptide, or protein of interest. Examples of destabilization domains well known to those skilled in the art include ubiquitin, PEST sequences (proline-, glutamate-, serine-, and threonine-rich sequences), cyclin disruption boxes, hydrophobic stretches of amino acids, and rapamycin-binding protein FKBP12 (as found in the pTuner plasmid, Clontech). A suitable destabilization domain may be incorporated into the peptide sequences of this disclosure or conjugated to the N-terminus or C-terminus of a linker-having or linker-less peptide. With respect to embodiments in which it is desirable to include a destabilization domain, a person skilled in the art will understand that any suitable destabilization domain may be used, and the scope of this disclosure is not limited by reference to any particular destabilization domain.

[0054] Chimeric peptides, polypeptides, and proteins containing the peptide of SEQ ID NO: 1 or its conserved variants conjugated to a protein destabilization domain sequence are also provided herein. Chimeric peptides, polypeptides, and proteins containing the peptide of SEQ ID NO: 2, its conserved variants, or sequences that are at least about 75% identical to the sequence of SEQ ID NO: 2 conjugated to a protein destabilization domain sequence are also provided herein.

[0055] The peptides and polypeptides disclosed herein may be produced using any method known in the art, including chemical synthesis techniques, nucleic acid synthesis techniques, peptide synthesis techniques, and / or recombinant techniques. For example, peptides such as the peptide of SEQ ID NO: 1 are synthesized using the Fmoc-polyamide method of solid-phase peptide synthesis. Other synthesis methods include solid-phase t-Boc synthesis and liquid-phase synthesis. Purification can be carried out by one or a combination of techniques such as recrystallization, size exclusion chromatography, ion exchange chromatography, hydrophobic interaction chromatography, and reversed-phase high-performance liquid chromatography using, for example, acetonitrile / water gradient separation.

[0056] Alternatively, peptides and polypeptides may be produced using recombinant methods well known in the art. Nucleic acids encoding peptides and polypeptides may be obtained by any suitable method (e.g., RT-PCR or synthesis of oligonucleotides encoding the polypeptides of the present invention). Accordingly, nucleic acid molecules encoding peptides and polypeptides, including the chimeric peptides and polypeptides disclosed herein, are also provided herein. Designing nucleic acid molecules encoding peptides and polypeptides, including the chimeric peptides and polypeptides disclosed herein, is well within the art of the art.

[0057] Peptide mimes of the peptide sequences disclosed herein are also intended and encompassed by this disclosure. As used herein, the term “peptide mime” means a peptide-like molecule that has the ability to interact with the TDP-43 of the peptide on which it is structurally based. Such peptide mimes include chemically modified peptides, peptide-like molecules containing non-natural amino acids, and peptoids (see, for example, Goodman and Ro, Peptidomimetics for Drug Design, “Burger's Medicinal Chemistry and Drug Discovery” Vol. 1 (ed. M.Wolff; John Wiley & Sons 1995), pages 803–861). For example, various peptide mimes are known in the art, including constrained amino acids (e.g., α-methylated amino acids, α,α-dialkylglycines, α-,β- or γ-aminocycloalkanecarboxylic acids, α,β-unsaturated amino acids, β,β-dimethyl or β-methylated amino acids, or other amino acid mimes), non-peptide components that mimic peptide secondary structures (e.g., non-peptide 3-turn mimes, γ-turn mimes, β-sheet structure mimes, or helix structure mimes), or amide bond isosteres (e.g., reducing amide bonds, methylene ether bonds, ethylene bonds, thioamide bonds, or other amide isosteres). Methods for identifying peptide mimes are also well known in the art and include, for example, screening databases containing libraries of potential peptide mimes.

[0058] This disclosure also provides isolated nucleic acid molecules encoding the peptides and chimeric peptides described herein, as well as methods for administering such nucleic acid molecules to subjects requiring them, typically as part of a vector or similar gene construct.

[0059] For example, a nucleic acid molecule encoding the peptide of SEQ ID NO: 1 or a conserved variant thereof may contain the nucleotide sequence shown in SEQ ID NO: 4, or a sequence having at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO: 4. For example, a nucleic acid molecule encoding the peptide of SEQ ID NO: 2, its conserved variant, or a sequence having at least approximately 75% identity with the sequence of SEQ ID NO: 2 may contain the nucleotide sequence shown in SEQ ID NO: 5, or a sequence having at least or approximately 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO: 5. The nucleic acid molecule may further contain a nucleotide sequence of a selected protein destabilization domain operably linked to the above nucleotide sequence so as to express a chimeric peptide or chimeric polypeptide.

[0060] This disclosure also provides vectors comprising one or more nucleotide sequences described herein. Typically, the nucleotide sequences are operably ligated to a promoter to enable the expression of a peptide or polypeptide. The vector may be an episomal vector (i.e., not integrated into the host cell genome) or a vector integrated into the host cell genome. The vector may be replication competent or replication deficient. Exemplary vectors include, but are not limited to, plasmids, cosmids, and viral vectors, such as adeno-associated virus (AAV) vectors, lentiviruses, retroviruses, adenoviruses, herpesviruses, parvoviruses, and hepatitis virus vectors. The selection and design of an appropriate vector is within the scope of the skill and discretion of those skilled in the art.

[0061] Provided herein are polynucleotides comprising expression cassettes or expression constructs that can be used for the expression of peptides, polypeptides, or chimeric peptides or chimeric polypeptides as described herein in a suitable vector for use in gene therapy. Thus, in certain embodiments, the method of the disclosure involves administering to a subject of interest a vector containing nucleotide sequences encoding the peptides and polypeptides disclosed herein, typically operably linked to a heterologous promoter, so that the peptide, polypeptide, or chimeric peptide or chimeric polypeptide of interest is expressed in vivo. In certain exemplary embodiments, the vector is a viral vector. As used herein, the term “viral vector” means a vector derived from any virus and typically comprises at least one element of an origin and has the ability to be packaged into a recombinant virus or virion. A viral vector may have one or more wild-type genes of a virus from which the vector is whole or partially deleted, but retains functional adjacent ITR sequences necessary for the rescue, replication, and packaging of virions. Thus, a viral vector typically contains at least sequences required in cis for viral replication and packaging (e.g., functional ITRs). The ITR does not need to be a wild-type nucleotide sequence; it may be modified, for example, by nucleotide insertion, deletion, or substitution, as long as the sequence provides functional rescue, replication, and packaging. The vector and / or virion can be used for the purpose of introducing heterologous sequences into cells, either in vitro or in vivo.

[0062] In certain embodiments, the vector is an AAV vector, i.e., a vector derived from adeno-associated viruses including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, or a vector using a synthetic or modified AAV capsid protein, such as one optimized for efficient in vivo transduction of the central nervous system. Recombinant AAV vectors describe replication-deficient viruses containing an AAV capsid shell encapsulating the AAV genome. Typically, one or more wild-type AAV genes, preferably all or part of the rep and / or cap genes, are deleted from the genome. Functional ITR sequences are required for the rescue, replication, and packaging of the vector genome into rAAV virions.

[0063] AAV ITRs can be derived from or synthesized from any of several AAV serotypes, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13. Those skilled in the art can make selections without excessive experimentation. AAV ITRs are typically about 145 nucleotides long, but do not need to have a wild-type nucleotide sequence; i.e., they can be modified by nucleotide insertions, deletions, and / or substitutions (provided they are functional). Furthermore, ITRs in polynucleotides do not necessarily need to be identical or derived from the same AAV serotype or isolate, as long as they function as intended, i.e., assist in the rescue, replication, and packaging of the transgene. Nucleotide sequences of AAV ITRs are well known in the art.

[0064] Vectors for use according to this disclosure may also include transcription enhancers, translation signals, and transcription and translation termination signals. Examples of transcription termination signals include, but are not limited to, polyadenylation signal sequences such as bovine growth hormone (BGH) poly(A), SV40 late poly(A), rabbit β-globin (RBG) poly(A), thymidine kinase (TK) poly(A) sequences, and any variants thereof. In some embodiments, the transcription termination region is located downstream of a post-transcriptional regulatory element. In some embodiments, the transcription termination region is a polyadenylation signal sequence.

[0065] Vectors for use according to this disclosure may also include various post-transcriptional regulatory elements. In some embodiments, the post-transcriptional regulatory elements may be viral post-transcriptional regulatory elements. Non-limiting examples of viral post-transcriptional regulatory elements include woodchuck hepatitis virus post-transcriptional regulatory elements (WPRE), hepatitis B virus post-transcriptional regulatory elements (HBVPRE), RNA transport elements, and any variants thereof.

[0066] This disclosure is intended for the delivery of peptides, polypeptides, polynucleotides, and vectors to subjects in need of treatment by any suitable means, typically in the form of pharmaceutical compositions, which may comprise one or more pharmaceutically acceptable carriers, excipients, or diluents. Such compositions may be administered by any convenient or suitable route, such as parenteral (e.g., intraperitoneal, subcutaneous, intra-arterial, intravenous, intramuscular), oral (including sublingual), nasal, or topical routes. Administration may be topical rather than systemic in situations where it is required that a suitable concentration of the molecule be delivered directly to a site in the body to be treated. Topical administration offers the ability to deliver very high local concentrations of the molecule to the required site and is therefore suitable for achieving the desired therapeutic or prophylactic effect while avoiding exposure of other organs of the body to the vector and molecule, thereby potentially reducing side effects.

[0067] It is understood that the specific dose level of the composition of the present invention for any particular subject depends on various factors, including, for example, the activity of the specific drug used, the age, weight, general health and diet of the individual being treated, the timing of administration, the rate of excretion, and any combination with other treatments or therapies. Single or multiple doses may be administered, and the dose level and pattern will be selected by the treating physician. A wide range of doses can be applied. Considering the patient, for example, about 0.1 mg to about 1 mg of the drug may be administered per kg of body weight per day. The dose and method of administration may be adjusted to provide the optimal therapeutic response. For example, several divided doses may be administered daily, weekly, monthly, or at other appropriate time intervals, or the dose may be proportionally reduced as indicated by the urgency of the situation.

[0068] Examples of pharmaceutically acceptable carriers or diluents include: demineralized or distilled water; physiological saline; vegetable oils such as peanut oil, safflower oil, olive oil, cottonseed oil, corn oil, sesame oil, peanut oil, or coconut oil; silicone oils containing polysiloxanes, such as methylpolysiloxane, phenylpolysiloxane, and methylphenylpolysoloxane; volatile silicones; mineral oils such as liquid paraffin, soft paraffin, or squalane; cellulose derivatives such as methylcellulose, ethylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, or hydroxypropylmethylcellulose; lower alkanols, such as ethanol or isopropanol; lower aralkanols; lower polyalkylene glycols or lower alkylene glycols, such as polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1,3-butylene glycol, or glycerin; fatty acid esters such as isopropyl palmitate, isopropyl myristate, or ethyl oleate; polyvinylpyridone; These include agar; carrageenan; tragacanth gum, gum arabic, and petroleum jelly. Typically, one or more carriers form 10 to 99.9% by weight of the composition.

[0069] The present invention is intended for combination therapy in which the peptides, polypeptides, polynucleotides, and vectors described herein are co-administered with other suitable agents that can promote a desired therapeutic or preventive outcome. “Co-administered” means simultaneous administration of the same formulation or two different formulations via the same or different routes, or sequential administration via the same or different routes. “Sequential” administration means a time difference of seconds, minutes, hours, or days between the administrations of the agents. The administrations may be in any order.

[0070] References in this Specified Publication (or information derived therefrom) or known matters shall not be, and should not be, construed as, an endorsement, acknowledgment, or any suggestion in any way that the prior publication (or information derived therefrom) or known matters form part of the common general knowledge in the field of the efforts relating to this Specified Publication.

[0071] Hereinafter, this disclosure is described with reference to the following specific embodiments, but these should not be construed as limiting the scope of this disclosure in any way. [Examples]

[0072] The following examples illustrate the disclosure and should not be construed as limiting in any way the general nature of the disclosures in this description throughout this specification.

[0073] General method

[0074] Bacterial two-hybrid screening. The BacterioMatch II two-hybrid system was performed according to the manufacturer's instructions (Chem-Agilent). Briefly, the carboxyl terminus of human TDP-43 (corresponding to amino acids 259-415 of the human TDP-43 sequence in UniProt accession number Q13148) was cloned into a pBT (bait) vector and used to identify interaction partners from a human brain cDNA pTRG plasmid library. Detection of protein-protein interaction partners was based on transcriptional activation of the HIS3 reporter gene, and positivity was further validated with a secondary streptomycin resistance reporter. All growth and transformation were performed using chemically competent cells provided in the kit. Colonies were visualized for imaging by incubation on growth plates containing 2% TTC / PBS (Sigma) at 37°C for 10 minutes.

[0075] Cloning. Point mutations and truncated mutants were generated by standard site-directed mutagenesis (Ittner et al, 2005, Biochemistry 44: 5749-5754). Knockdown of 14-3-3θ was performed using a 14-3-3θ MISSION shRNA lentivirus (Sigma-Aldich) with the sequence CCGGCAGTTGCTTAGAGACAACCTACTCGAGTAGTTGTCTAAGCAACTGTTTTTG (SEQ ID NO: 6). Stable overexpression of 14-3-3θ (C-terminal V5-tag) in SH-SY5Y cells was achieved using a lentivirus (cloning vector pLenti6 / Ubc; Life Technologies). All 14-3-3 isoforms were cloned into pcDNA3.1 / myc (Life Technologies) with a C-terminal myc tag, and TDP-43 wild-type / mutant were cloned into pcDNA3.1 / V5 (Life Technologies) with a C-terminal V5 tag, followed by immunoprecipitation.

[0076] Adeno-associated virus. 14-3-3θ (V5-tagged) was cloned into a human synapsin promoter-suppressed rAAV vector using plasmid pAAV-hSyn-EGFP (Addgene, #50465) as a backbone, after removing EGFP. The same vector or a variant was used as a control for mCherry expression. The rAAV9 vector was packaged using the capsid AAV9.PHP.B (Deverman et al., 2016, Nat Biotechnol 34:204~209) as previously described (Bi et al., 2017, Nat Commun 8: 473). 2 μl of rAAV (1 × 10⁶) 13 The viral genome ( / ml) was collected from 3-month-old wild-type or iTDP-43 A315T It was injected into the hippocampus (-1.94 mm AP, 1.6 mm ML, 1.8 mm DV derived from λ) of mice (Ke et al., 2015, Acta Neuropathol 130:661~678). For spinal injection, 1 µl of rAAV (1 × 10⁶) was used. 13 The viral genome ( / ml) was directly injected into the spinal cord of cryosanesthetized neonates (P0-2). All animal experiments were approved by the Macquarie University Animal Ethics Committee.

[0077] Immunoprecipitation. Immunoprecipitation was performed as previously described (Ittner et al., 2009, J Biol Chem 284: 20909-20916). Briefly, 293T HEK cells were co-transfected with TDP-43 variants and / or 14-3-3 isoform / variants in pcDNA3.1 / V5. Cells were lysed in RIPA buffer. Equivalent volumes of protein were incubated overnight with 1 µl of V5 antibody (Life Technologies) and precipitated using magnetic protein G beads (Life Technologies). Co-immunoprecipitation was further confirmed by Western blotting using Myannick bodies.

[0078] Western blotting was performed as previously described (Ke et al., 2012, PLoS One 7: e35678). The primary antibodies used for immunoblotting were human TDP-43, c-terminal TDP-43, pan-TDP-43 (Proteintech), 14-3-3θ (Abcam), V5, myc (Life Technologies), phospho-TDP-43 S409 / 410 (Cosmobio), and GAPDH (Merck-Millipore).

[0079] Cell culture and staining. All immunoprecipitation experiments were performed in 293T HEK cells. Cells were maintained in DMEM containing 10% fetal bovine serum (FBS) according to a standard protocol. SH-SY5Y cells were maintained in DMEM / F-12 containing 10% FBS and used for 14-3-3θ overexpression or knockdown. Stable overexpression and knockdown of 14-3-3θ were achieved by lentiviral transduction. For immunocytochemistry, cells were fixed in 4% PFA and blocked with 3% thermo-inactivated goat serum / 2% BSA. Antibodies used were V5 (Sigma), myc (Life Technologies), and secondary Alexa Fluor 488, 555 (Life Technologies). Cover slips were mounted on Immun-Mount (Southern Biotech).

[0080] Microscopic examination. All cell culture fluorescence images were acquired using either a BX51 epifluorescence microscope or a confocal FV10i microscope (Olympus).

[0081] In vitro conjugate assay. HEK293T cells were transfected with full-length wild-type TDP-43 or TDP-43 with the F147L / F149L double mutant (both c-terminally V5 tagged) or 14-3-3θ (polyhistidine tagged). Cells transfected with the TDP-43 construct were dissolved in immunoprecipitation buffer (IPB) supplemented with EDTA-free complete protease inhibitor cocktail (Roche) (20 mM Tris-HCl (pH 7.8), 150 mM sodium chloride, 0.1% (v / v) NP-40), and V5-tagged TDP-43 was treated with mouse anti-v5 antibody (Life Technologies) (as described above). Next, the lysates were washed twice with IPB and twice with DNase / RNase buffer (DRB) (10 mM TrisHCl (pH 7.6), 2.5 mM MgCl2, and 0.5 mM CaCl2), and reconstituted in DRB. 14-3-3θ-HIS transfected cells were lysed in IPB and purified via TALON resin (Clontech Laboratories). Briefly, the lysates were incubated with TALON resin at 4°C for 2 hours, washed three times with IPB, and eluted with in vitro interaction buffer (IVIB) (20 mM Tris-HCl (pH 7.8), 0.1 M sodium chloride, 20% (v / v) glycerin, 5 mM MgCl2, 5 mM CaCl2, 0.1% (v / v) NP-40, 1 mM EDTA, 0.1 mM DTT, and 0.2 mM PMSF). For RNA and DNA digestion, magnetic bead suspensions containing bound V5-tagged TDP-43 were incubated with DNase, RNase, or buffer (control) at 37°C for 10 minutes. After digestion, all reaction mixtures were washed once with ice-cold IPB and resuspended in IVIB. The purified TDP-43 and 14-3-3θ were then incubated at 4°C for 2 hours for in vitro interaction. The reaction mixtures were washed according to standard IP procedures and eluted in 4× sample buffer for Western blotting.

[0082] Quantitative PCR. RNA purification and quantitative PCR were performed as previously described (Bi et al., 2017, Nat Commun 8: 473). Briefly, RNA was extracted from mouse cortical brain tissue using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. On-column DNA digestion was performed using RNase-free DNase I (Qiagen) to remove contaminating genomic DNA. cDNA was synthesized from 2.5 μg of total RNA using the Second Strand cDNA Synthesis Kit (Invitrogen). mRNA levels were determined by quantitative PCR using Fast SYBR green reaction mix (Invitrogen) and gene-specific primer pairs with an Mx3000 real-time PCR cycler (Stratagene). Levels were expressed as a plutonization change of the housekeeping gene Gapdh and converted to a plutonization difference compared to control tissue. These primers were used (5' to 3'):

[0083] 14-3-3θ (F): GCTAAAACGGCTTTTGATGAGG (Sequence 7); (R): GTGCCCTGGATGCCTTTAGTT (Sequence ID 8) 14-3-3β (F): CTCCAGTCCTCCGCGAAAAT (Sequence ID 9); (R): GAGAGTTCGTGTCCCTGCTC (Sequence ID 10) 14-3-3γ (F): GGCGGTCTTCGGTTTCCTTC (Sequence ID 11); (R): GTTCAGCTCGGTCACGTTCTT (Sequence ID 12) 14-3-3ε (F): CGCACCCCATTCGTTTAGG (Sequence ID 13); (R): ATTCTGCTCTTCACCATCACC (Sequence ID 14) 14-3-3ζ (F): CTACGATCACGTCCAACCCG (Sequence 15); (R): GTCAAACGCTTCTGGCTGC (Sequence ID 16) 14-3-3σ (F): ACAACCTGACACTGTGGACG (Sequence ID 17); (R): CCTTTGGAGCAAGAACAGCG (Sequence ID 18) Gapdh (F): GTGAAGGTCGGTGTGAAC (Sequence ID 19); (R): ATCTCCACTTTGCCACTGCAA (Sequence ID 20)

[0084] Mouse iTDP-43 A315T The mice were previously described (Ke et al., 2015, Acta Neuropathol 130: 661-678). Under the control of the doxycycline controllable (Tet-OFF) promoter in the central nervous system, these mutants constitutively expressed human A315T variant TDP-43. Mice were housed in groups with free access to food and water in a 12-hour light / dark cycle. Time-matted C57Bl / 6 mice were obtained from ARC Perth. All animal experiments were approved by the Macquarie University Animal Ethics Committee.

[0085] Exercise testing - Wire testing was performed as previously described (van Hummel et al., 2018, Am J Pathol 188: 1447-1456). Briefly, mice were placed on a wire mesh, inverted, and the latency until they fell off was recorded. Grip strength was measured using a grip strength meter to determine maximum forearm strength (Chatillon, AMETEK), as previously described (Am J Pathol 188, 1447-1456).

[0086] Immunohistochemistry. Staining of paraffin tissue sections, including antigen recovery, has been previously described (van Eersel et al, 2015, Neuropathology and Applied Neurobiology 41: 906-925). The primary antibodies used for staining were against human TDP-43, pan-TDP-43 (ProteinTech), NeuN, mCherry, EGFP (Abcam), and V5 (Sigma). The secondary antibodies used were conjugated to Alexa-Fluor 488, 555, and 647 (Life Technologies).

[0087] Statistical analysis. Statistical analysis was performed using GraphPad Prism 6.0. Student's t-test was used for comparing two groups, and ANOVA was used for comparing multiple groups.

[0088] Example 1 - Identification of a novel interaction partner of TDP-43

[0089] To identify novel interaction partners for the C-terminal glycine-rich domain (GRD) of TDP-43, we performed the bacterial two-hybrid screening described above. The best candidate identified (11 out of 65 hits) was 14-3-3θ (encoded by the YWHAQ gene), a member of the 14-3-3 scaffold protein family. Co-immunoprecipitation from mouse N2a cells and mouse brain confirmed the interaction between endogenous 14-3-3θ and TDP-43 (Figure 1).

[0090] To test whether the 14-3-3θ / TDP-43 interaction is disease-related, we expressed 14-3-3θ together with TDP-43 mutants in 293T HEK cells. Surprisingly, 14-3-3θ significantly interacted with TDP-43 mutants associated with pathogenic mutations, including the A315T mutation, a pathogenic mutant associated with familial ALS and FTD (see Figure 2). Co-expression of 14-3-3θ with TDP-43-A315T resulted in significant cytoplasmic co-localization (Figure 3A). Nuclear localization (NLS) and nuclear export (NES) sequences mediate the dominant nuclear localization of TDP-43. Interestingly, 14-3-3θ showed potent interactions with both NES deletion (ΔNES) and NLS deletion (ΔNLS) mutants of TDP-43 (Figure 3B). The cytoplasmic localization of TDP-43-ΔNLS and the nuclear localization of non-mutant TDP-43 were not altered by 14-3-3θ, but TDP-43-ΔNES, when expressed in cells, strictly localized to the nucleus and formed nuclear aggregates (Winton et al, 2008, J Biol Chem 283:13302-13309), and when co-transfected with 14-3-3θ, was found almost exclusively in the cytoplasm (Figure 3C).

[0091] The above findings demonstrate that the inventors have identified a novel interaction between 14-3-3θ and TDP-43, which leads to enhanced complex formation that drives cytoplasmic localization of TDP-43 variants, including pathogenic mutants.

[0092] Next, the inventors tested all 14-3-3 isoforms for potential interactions with TDP-43 by co-immunoprecipitation. TDP-43 was shown to interact more strongly with the 14-3-3η, 14-3-3γ, and 14-3-3σ isoforms than with 14-3-3θ, but showed no clear interaction with 14-3-3ε, 14-3-3ζ, and 14-3-3β (data not shown). The 14-3-3σ and 14-3-3ζ isoforms are not abundant in neurons. More importantly, compared to wild-type TDP-43, only 14-3-3θ showed a significantly stronger interaction with TDP-43-A315T and especially with the TDP-43-ΔNES mutant, while other interacting isoforms did not show enhanced interaction (in fact, 14-3-3σ interacted less with TDP-43-ΔNES) (data not shown). Therefore, in the pathogenic mutant of TDP-43, only the interaction with 14-3-3θ was altered.

[0093] Example 2 - Interaction motif at 14-3-3θ mediating binding with TDP-43

[0094] 14-3-3 dimers typically interact with phosphorylated interaction partners. However, in contrast, in the case of TDP-43, we found that phosphorylated mimic mutants of TDP-43 interact less with 14-3-3θ, supporting non-canonical interactions (data not shown).

[0095] Structurally, 14-3-3θ has nine α-helices (see Figure 4), with helices αC, αE, αG, and αI contributing to the standard partner bond of the 14-3-3θ dimer. To identify the interaction motif of 14-3-3θ that mediates the TDP-43 bond, we stepped down 14-3-3θ and revealed that this interaction is mediated by the sixth α-helix (αF) of 14-3-3θ (Figure 4).

[0096] The inventors created a construct containing only α-helix 6 (αF) of 14-3-3θ (the 30-amino acid sequence shown in SEQ ID NO: 2; corresponding to amino acids 135-164 of the wild-type human TDP-43 sequence), and named this construct "Fx". When Fx is expressed, TDP-43 co-precipitates (Figure 5), but the known 14-3-3θ interaction partners YES-associated protein (YAP) and FOXO1 cannot be pulled down (no data available), further supporting a non-canonical interaction between 14-3-3θ and TDP-43. α-helix 6 (αF) of 14-3-3θ is located on the opposite surface of the 14-3-3θ dimer and possesses a 10-amino acid motif that is different from the canonical interaction site in the center of the molecule and not found in other 14-3-3 isoforms (Figure 6), which can explain a different interaction with TDP-43 than previously thought.

[0097] Example 3 - Effect of increasing 14-3-3θ expression in vivo

[0098] To study the effect of increased 14-3-3θ levels in vivo, the inventors used adeno-associated virus (AAV) in 3-month-old non-transgenic mice and iTDP-43 A315T 14-3-3θ was expressed in the hippocampus of mice. Increased neuronal 14-3-3θ levels resulted in the accumulation of insoluble TDP-43 fragments in non-transgenic mice, leading to iTDP-43 A315T It accumulated more in mice (Figure 7A). Furthermore, AAV-14-3-3θ injection iTDP-43 A315T Mice showed a substantial reduction in hTDP-43-expressing hippocampal neurons compared to controls (Figure 7B). Therefore, increased 14-3-3θ levels in vivo lead to disease-like insolubility and fragmentation of endogenous and transgenic TDP-43, and iTDP-43 A315T This further exacerbated the neuropathological phenotype in mice.

[0099] The inventors also tested whether long-term AAV-mediated overexpression of 14-3-3θ in the spinal cord of naive C57Bl / 6 mice would result in altered endogenous TDP-43 and functional deficits. Histopathological analysis of the spinal cord 10 months after 14-3-3θ overexpression revealed cytoplasmic accumulation of TDP-43 in 14-3-3θ overexpressing anterior horn motor neurons, whereas non-expressing or GFP control cells exhibited only nuclear TDP-43 (data not shown). Thus, chronically increased 14-3-3θ levels impaired the localization of TDP-43 in motor neurons and resulted in functional motor deficits.

[0100] Example 4 - 14-3-3θ-Fx Targeted Pathological TDP-43 Degradation

[0101] From the unique interaction pattern between 14-3-3θ and TDP-43 and the preference of 14-3-3θ for abnormal forms of TDP-43, the inventors sought to determine whether 14-3-3θ could be used to therapeutically target pathological TDP-43. The inventors designed constructs containing 14-3-3θ-Fx (Example 2) fused to the C-terminal degradation domain (DD) from the PTuner plasmid (Clonetech) and an N-terminal V5 tag for detection (referred to herein as "DD-θFx"). DD-θFx was shown to accumulate in primary neurons only in the presence of the stabilizing compound Shield1, confirming efficient DD-induced degradation in neurons (Figure 8A). Co-expression of DD-θFx and A315T mutant human TDP-43 (hTDP-43) in neurons resulted in a significant decrease in hTDP-43 levels, consistent with induction of degradation (Figure 8B). Furthermore, iTDP-43 A315T AAV-mediated expression of DD-θFx in the mouse brain resulted in mutually exclusive expression of recombinant hTDP-43 with DD-θFx (Figure 9A) and a decrease in TDP-43 levels (Figure 9B). This suggests clearance of transgenic hTDP-43 via DD-θFx degradation. The turnover of DD-θFx was higher in iTDP-43 A315T mice than in control mice, presumably due to iTDP-43 A315TThis was thought to be due to the presence of TDP-43 aggregates in mice. DD-θFx-expressing iTDP-43 A315T Functional evaluation in mice was performed using a control vector injection of iTDP-43. A315T Compared to mice, the mice showed less disinhibition, less hyperactivity, reduced motor impairment, and increased muscle strength (Figure 10). Therefore, DD-θFx induces targeted degradation of pathogenic TDP-43 in neurons, and iTDP-43 A315T This prevented the defect in mice.

[0102] Next, the inventors used the neurotrophic AAV serotype AAV.PHP.B (Deverman et al., 2016, Nat Biotechnol 34:204-209) and studied iTDP-43, a 3-month-old animal with an established deficiency. A315T This enabled systemic delivery of DD-θFx (or control) to central nervous system neurons in mice. Western blotting revealed DD-θFx expression in iTDP-43. A315T A decrease in hTDP-43 was observed in mice compared to controls (Figure 11A). This resulted in comparable and reproducible DD-θFx and control vector expression patterns throughout the central nervous system within two weeks (Figure 11B). Importantly, a 32.6 ± 6.6% decrease was observed in hTDP-43 expressing neurons without apparent cell loss. Furthermore, DD-θFx co-localized with hTDP-43 in the remaining neurons, many of which showed only weak transgenic TDP-43 staining. Next, iTDP-43 in 3.5-month-old mice... A315T Mice (i.e., 2 weeks after DD-θFx AAV delivery) were functionally evaluated. At this age, untreated iTDP-43 mice were evaluated. A315T Mice exhibit significant impairment (Ke et al., 2015 Acta Neuropathol 130:661-678). In particular, DD-θFx expression is associated with iTDP-43 A315T Disinhibition in mice was improved (Figure 12). Expression of the control vector improved iTDP-43 in these tasks. A315TIt did not affect the mouse deficiency. DD-θFx did not affect the performance of control mice. Overall, neuronal DD-θFx expression was associated with iTDP-43 A315T We reduced TDP-43 levels in mice and improved established functional deficiencies. This data suggests that pathological TDP-43 can be targeted and eliminated using specific interacting peptides, indicating the potential for new methods of treating ALS and FTD.

[0103] Example 5 - DD-θFx prevented the deficiency induced by human wild-type TDP-43 expression in mice.

[0104] Next, the inventors investigated the effect of DD-θFx expression in a mouse model of sporadic ALS based on AAV-mediated expression of non-mutant hTDP-43 in CNS neurons. The inventors used the neurotropic AAV9 serotype AAV.PHP.B and enabled systemic delivery and homogeneous expression in CNS neurons via temporal vein injection in naive neonatal C57B1 / 6 mice (Deverman et al., 2016, Nat Biotechnol 34:204-209). The effect of DD-θFx was investigated by co-injection at birth (AAV-DD-θFx) in mice injected with either natural hTDP-43 (AAV-hTDP-43) or AAV vector alone (AAV-ctr).

[0105] Up to 10 weeks of age, AAV-hTDP-43 and AAV-ctr showed comparable performance in the inverted wire test every other week (Figure 13), suggesting comparable strength. Subsequently, performance in the inverted wire test progressively declined in mice treated with AAV-hTDP-43, which was completely prevented when mice were co-treated with AAV-DD-θFx at birth (Figure 13). This result was supported by direct assessment of grip strength, where male AAV-hTDP-43 mice showed significantly reduced grip strength compared to AAV-ctr mice, which was prevented by co-treatment with DD-θFx (Figure 14). A similar trend was observed in female mice. Furthermore, at 19 weeks of age, the tibialis anterior muscle weight of female and male AAV-hTDP-43 mice was significantly reduced compared to their respective controls (Figure 15). These results demonstrate that DD-θFx prevents the deficiency induced by non-mutant TDP-43 expression in mice. [Explanation of Symbols]

[0106] [Figure 1] Input: Input N2a cells: N2a cells mouse brain: mouse brain [Figure 2] Input: Input Fold of IP: Multiples of IP [Figure 3] Fold of IP: Multiples of IP MOCK: Mock [Figures 4 and 5] Input: Input [Figure 7] control: contrast Extraction: Extraction TDP-43 fragments relative to full length: Neuron: Neuron [Figures 8, 9, 11] rel hTDP-43 levels: Relative hTDP-43 levels [Figure 10] Time in Arm (s): Time within the arm (s) closed: Closed open: open Distance Traveled (m): Traveled distance (m) Time till fall (s): Peak Force (N): Maximum force (N) [Figure 12] Neuron: Neuron Time in Area (s): Time within the area (s) closed: Closed open: open [Figure 13] Time on Wire (s): Time on the wire (s) Days pi: days after injection Linear Regression Slope (>= Day 10 pi): Linear regression slope (≥ 10 days after injection) [Figure 14] Grip Strength: Grip strength [Figure 15] TA Muscle Weight (mg): TA muscle weight

Claims

1. Use of a peptide consisting of the amino acid sequence of SEQ ID NO: 2, or a nucleic acid molecule encoding the peptide, in the manufacture of a pharmaceutical product for treating or preventing neurodegenerative diseases associated with TDP-43 pathology, or for improving at least one symptom thereof.

2. The use according to claim 1, wherein the neurodegenerative disease is selected from amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

3. The use according to claim 1 or 2, wherein the at least one symptom includes disinhibition, hyperactivity, motor impairment, or muscle weakness.

4. The use according to any one of claims 1 to 3, wherein the nucleic acid molecule encoding the peptide of SEQ ID NO: 2 comprises the nucleotide sequence of SEQ ID NO:

5.

5. The use according to any one of claims 1 to 4, wherein the peptide comprises or is linked to a protein destabilization domain sequence.

6. The use according to claim 5, wherein the protein destabilization domain sequence includes the rapamycin-binding protein FKBP12.

7. The use according to any one of claims 1 to 6, wherein a nucleic acid molecule is operably linked to a nucleotide sequence encoding a protein destabilization domain, and comprises a gene construct encoding a peptide consisting of the sequence of SEQ ID NO:

2.

8. An isolated peptide consisting of the amino acid sequence of SEQ ID NO:

2.

9. An isolated polynucleotide encoding the peptide described in claim 8.

10. The polynucleotide according to claim 9, comprising or derived from the sequence of sequence number 5.

11. A chimeric molecule containing a peptide consisting of the amino acid sequence of Sequence ID No. 2 linked to a protein destabilization domain sequence.

12. An isolated polynucleotide encoding the chimeric molecule described in claim 11.

13. Use of the chimeric molecule of claim 11 or the polynucleotide of claim 12 in the manufacture of a medicament for treating or preventing neurodegenerative diseases associated with TDP-43 pathology, or for improving at least one symptom thereof.

14. A vector comprising the polynucleotide sequence according to claim 9, 10, or 12.

15. The vector according to claim 14, wherein the vector is an AAV vector.

Citation Information

Patent Citations

  • Use of 14-3-3-Proteins in Treatment and Prevention of Neurodegeneration

    US20110183341A1

  • Combinations of aggregating proteins and molecular chaperone proteins for the treatment of proteinopathies or conformational diseases

    US20160220649A1

  • Genetic switches for the detection of fusion proteins

    WO2004050870A2

  • A method of modulating protein 14-3-3 functionality by facilitating or inhibiting phosphorylation

    WO2011120082A1