Composition for the degradation of trypsin or TMPRSS2

Abstract

A composition for decomposition of trypsin or TMPRSS2 containing, as an active ingredient, bacteria having 00502 protein or a protein having 30% or more sequence identity with the amino acid sequence of 00502 protein and having trypsin binding ability or bacteria having 00509 protein or a protein having 30% or more sequence identity with the amino acid sequence of 00509 protein and having trypsin binding ability.

Description

[Technical Field]

[0001] The present invention relates to compositions for the degradation of trypsin or TMPRSS2. More specifically, the present invention relates to compositions for the degradation of trypsin or TMPRSS2, diagnostic agents for diseases caused by trypsin or TMPRSS2, and quasi-drugs for diseases caused by trypsin or TMPRSS2. This application claims priority under US 63 / 138,798, provisionally filed in the United States on 19 January 2021, and US 63 / 229,077, provisionally filed in the United States on 4 August 2021, the contents of which are incorporated herein by reference. [Background technology]

[0002] The digestive tract is a unique organ constantly exposed to countless molecules derived from food and microorganisms. In addition to external contents, the digestive tract also encounters host-derived molecules such as digestive enzymes. In the upper intestine, digestive enzymes play a crucial role in breaking down the large amount of nutrients ingested through diet into smaller components for absorption into the body. On the other hand, the large intestine primarily absorbs water, and digestive enzymes are not necessary there. In fact, disruptions in their activity are thought to be involved in changes in the composition of the microbiome, breakdown of the mucosal barrier, and the development of inflammation.

[0003] Intestinal tissue possesses various regulatory and protective mechanisms, such as the production of mucins and enzyme-inactivating molecules, to maintain homeostasis and barrier function. Furthermore, the gut microbiota is known to contribute significantly to maintaining a stable environment by reducing or altering the substances in the lumen (see, for example, Non-Patent Literature 1). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] JL Round and SK Mazmanian, The gut microbiota shapes intestinal immune responses during health and disease, Nature reviews immunology, 9, 313-323, 2009. [Overview of the Initiative] [Problems that the invention aims to solve]

[0005] However, the details of microorganism-mediated regulation of intraluminal proteins are not yet fully understood. In particular, the attributes of microorganisms involved in the regulation of digestive enzymes remaining in the large intestine are still largely unknown. The present invention aims to elucidate the functions of microorganisms involved in the regulation of proteases remaining in the large intestine and to provide a technology for controlling protease activity. [Means for solving the problem]

[0006] The present invention includes the following embodiments. [1] A composition for degrading trypsin or TMPRSS2, containing as an active ingredient a bacterium having a protein with 00502 protein or a protein having 30% or more sequence identity to the amino acid sequence of 00502 protein and the ability to bind trypsin, or a bacterium having a protein with 00509 protein or a protein having 30% or more sequence identity to the amino acid sequence of 00509 protein and the ability to bind trypsin. [2] A composition for degrading trypsin or TMPRSS2, containing as active ingredients: a bacterium having a protein 00502 or a protein having 30% or more sequence identity to the amino acid sequence of the 00502 protein and possessing trypsin-binding ability; and a bacterium having a protein 00509 or a protein having 30% or more sequence identity to the amino acid sequence of the 00509 protein and possessing trypsin-binding ability. [3] A composition for degrading trypsin or TMPRSS2, containing as an active ingredient a bacterium having a gene consisting of the nucleotide sequence described in Sequence ID No. 1 or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence described in Sequence ID No. 1 and having trypsin-binding ability, or a bacterium having a gene consisting of the nucleotide sequence described in Sequence ID No. 2 or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence described in Sequence ID No. 2 and having trypsin-binding ability. [4] A composition for degrading trypsin or TMPRSS2, containing as an active ingredient a bacterium having a gene consisting of the nucleotide sequence described in Sequence ID No. 1 or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence described in Sequence ID No. 1 and having trypsin-binding ability, and a bacterium having a gene consisting of the nucleotide sequence described in Sequence ID No. 2 or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence described in Sequence ID No. 2 and having trypsin-binding ability. [5] A composition for degrading trypsin or TMPRSS2 according to any one of [1] to [4], wherein the bacteria have a type IX secretion system (T9SS). [6] The trypsin or TMPRSS2 degradation composition according to claim 5, wherein the T9SS comprises PorV protein, PorU protein, PorN protein, PorM protein, PorL protein, PorK protein, or PorP protein. [7] A composition for degrading trypsin or TMPRSS2 according to any one of [1] to [6], wherein the bacteria belong to the genera Paraprevotella, Prevotella, Prevotellamasilia, or Bacteroidetes. [8] The trypsin or TMPRSS2 degradation composition according to [7], wherein the bacterium belonging to the genus Paraprevotella is Paraprevotella clara, and the bacterium belonging to the genus Prevotella is at least one bacterium selected from the group consisting of Prevotella rara, Prevotella rodentium, and Prevotella muris. [9] A composition for degrading trypsin or TMPRSS2 according to any one of [1] to [8], wherein the bacterium is a bacterium having a 16S rRNA gene consisting of the base sequence of SEQ ID NO: 3 or the base sequence of SEQ ID NO: 4, or a bacterium having a 16S rRNA gene consisting of a base sequence having 97% or more sequence identity with respect to the base sequence of SEQ ID NO: 3 or the base sequence of SEQ ID NO: 4.

[10] A composition for degrading trypsin or TMPRSS2 according to any one of [1] to [6], wherein the bacterium is at least one bacterium selected from the group consisting of Paraprevotella sp.MSP 0303, Paraprevotella sp.MSP 0335, Prevotellamassilia timonensis, Bacteroidetes sp.MSP 0288, Bacteroidetes sp.MSP 0410, Bacteroidetes sp.MSP 0435 and Porphyromonas gingivalis.

[11] A composition for decomposing trypsin or TMPRSS2 according to any one of [1] to

[10] , wherein the bacteria are live bacteria.

[12] A composition for degrading trypsin or TMPRSS2 according to any one of [1] to

[10] , wherein the bacteria are dead bacteria.

[13] A composition for degrading trypsin or TMPRSS2, comprising as an active ingredient:

[13] Protein 00502 or a protein having 30% or more sequence identity with the amino acid sequence of the 00502 protein and possessing trypsin-binding ability, or Protein 00509 or a protein having 30% or more sequence identity with the amino acid sequence of the 00509 protein and possessing trypsin-binding ability.

[14] A composition for degrading trypsin or TMPRSS2, comprising as active ingredients:

[14] Protein 00502 or a protein having 30% or more sequence identity with the amino acid sequence of the 00502 protein and possessing trypsin-binding ability; and Protein 00509 or a protein having 30% or more sequence identity with the amino acid sequence of the 00509 protein and possessing trypsin-binding ability.

[15] A composition for degrading trypsin or TMPRSS2 according to any one of [1] to

[14] , for the treatment of diseases caused by trypsin or TMPRSS2.

[16] A composition for decomposing trypsin or TMPRSS2 according to any one of [1] to

[15] , wherein the disease caused by trypsin or TMPRSS2 is inflammatory bowel disease (ulcerative colitis, Crohn's disease), irritable bowel syndrome, infection, acute pancreatitis, or chronic pancreatitis.

[17] The trypsin or TMPRSS2 decomposition composition according to

[16] , wherein the infectious disease is a viral infection or a bacterial infection.

[18] The trypsin or TMPRSS2 decomposition composition according to

[16] or

[17] , wherein the inflammatory bowel disease, irritable bowel syndrome, or infection is a disease involving TMPRSS2 or IgA.

[19] A diagnostic agent for diseases caused by trypsin or TMPRSS2, comprising a specific binding substance for detecting the 00502 protein or a protein having 30% or more sequence identity to the amino acid sequence of the 00502 protein and possessing trypsin-binding ability, or the 00509 protein or a protein having 30% or more sequence identity to the amino acid sequence of the 00509 protein and possessing trypsin-binding ability. A diagnostic agent for a disease caused by trypsin or TMPRSS2, comprising a primer set or a probe for detecting a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, or a gene encoding a protein having at least 30% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1 and having trypsin-binding ability, or a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 2, or a gene encoding a protein having at least 30% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 2 and having trypsin-binding ability.

[21] A quasi-drug for a disease caused by trypsin or TMPRSS2, comprising, as an active ingredient, a bacterium having a protein having at least 30% sequence identity to the 00502 protein or the amino acid sequence of the 00502 protein and having trypsin-binding ability, or a protein having at least 30% sequence identity to the 00509 protein or the amino acid sequence of the 00509 protein and having trypsin-binding ability.

[22] A quasi-drug for a disease caused by trypsin or TMPRSS2, comprising, as an active ingredient, a 00502 protein or a protein having at least 30% sequence identity to the amino acid sequence of the 00502 protein and having trypsin-binding ability, or a 00509 protein or a protein having at least 30% sequence identity to the amino acid sequence of the 00509 protein and having trypsin-binding ability. [Effect of the Invention]

[0007] According to the present invention, a technique for controlling the activity of a protease can be provided. [Brief Description of the Drawings]

[0008] [Figure 1] FIG. 1 is a diagram showing the results of the proteomics analysis in Experimental Example 1. [Figure 2] FIG. 2 is a graph showing the results of the trypsin activity test of the feces of specific pathogen-free (SPF) mice and germ-free (GF) mice in Experimental Example 1. [Figure 3]Figure 3 is a photograph showing the results of Western blot analysis of feces from SPF mice and GF mice in Experimental Example 1, which detected anionic trypsin protease (PRSS2). [Figure 4] Figure 4 is a fluorescence micrograph showing the results of immunostaining of colon sections of SPF and GF mice in Experimental Example 1, which detected mucus (UEA1) and anionic trypsin protease (PRSS2). [Figure 5] Figure 5 is a graph showing the results of measuring trypsin activity in different locations in the small and large intestines of GF mice and SPF mice in Experimental Example 1. [Figure 6] Figure 6 is a graph showing the results of measuring fecal trypsin activity in GF mice administered with fecal samples collected from healthy donors in Experimental Example 2. [Figure 7] Figure 7 is a graph showing the results of measuring fecal trypsin activity in each group of mice in Experimental Example 2. [Figure 8] Figure 8 is a photograph showing the results of a Western blot measurement of trypsin degradation in Experimental Example 2. [Figure 9] Figure 9 is a photograph showing the results of a Western blot measurement of human trypsin degradation in Experimental Example 2. [Figure 10] Figure 10 is a photograph showing the results of a Western blot measurement of the trypsin degradation capacity of various bacteria in Experimental Example 2. [Figure 11] Figure 11 is a photograph showing the results of Western blotting analysis of rmPRSS2 degradation in Experimental Example 3, where recombinant mouse PRSS2 (rmPRSS2) was pretreated with a protease inhibitor and then incubated with P. clara (1C4). [Figure 12] Figure 12 is a photograph showing the results of observing the binding of rmPRSS2 to the surface of bacteria using a confocal microscope in Experiment Example 3. [Figure 13]Figure 13 is a photograph showing the results of Experimental Example 3, in which P. clara (1C4) pretreated with tunicamycin was incubated with rmPRSS2, and the degradation of rmPRSS2 was analyzed by Western blotting. [Figure 14] Figure 14 is a photograph showing the results of observing the binding of rmPRSS2 to the bacterial surface using a confocal microscope in Experimental Example 3, where P. clara(1C4) treated with tunicamycin and P. clara(1C4) not treated with tunicamycin were incubated with rmPRSS2, respectively. [Figure 15] Figure 15 is a schematic diagram showing the alignment of the gene composition of the type IX secretion mechanism (T9SS) in the genomes of P. clara (JCM14859), P. xylaniphila (JCM14860), and P. gingivalis (ATCC33277) in Experimental Example 3. [Figure 16] Figure 16 is a schematic diagram illustrating homologous recombination that causes deletion of PorU expression in Experimental Example 3. [Figure 17] Figure 17 is a photograph showing the results of Western blotting analysis of rmPRSS2 degradation after incubation of mutant P.clara (JCM14859) with rmPRSS2 in Experimental Example 3. [Figure 18] Figure 18 is a photograph showing the results of Western blot analysis of rmPRSS2 degradation via wild-type P. clara (JCM14859) or a series of mutant P. clara (JCM14859) in Experimental Example 3. [Figure 19] Figure 19 is a photograph showing the results of observing the binding of rmPRSS2 to the bacterial surface using a confocal microscope in Experiment Example 3, where P.clara(Δ00502) and P.clara(Δ00509) were incubated with rmPRSS2, respectively. [Figure 20] Figure 20 is a photograph showing the results of the analysis of rmPRSS2 degradation by Western blotting in Experimental Example 3, where P.clara(Δ00502) and P.clara(Δ00509) were incubated with rmPRSS2. [Figure 21]Figure 21 is a schematic diagram showing the genome sequence of the Paraprevotella strain analyzed in Experimental Example 3. [Figure 22] Figure 22 is a photograph showing the results of the analysis of rmPRSS2 degradation by Western blotting in Experimental Example 3, where P.clara mutant strains in which genes 00502 to 00509 were deleted were incubated with rmPRSS2. [Figure 23] Figure 23 is a graph showing the results of measuring the protease activity of recombinant 00502 or 00509 protein by cleaving FITC-labeled casein in Experimental Example 4. [Figure 24] Figure 24 is a photograph showing the results of Western blotting analysis of rmPRSS2 degradation after incubation with rmPRSS2 using either free recombinant 00502 and 00509 proteins, or recombinant 00502 and 00509 proteins bound to microbeads, in Experimental Example 4. [Figure 25] Figure 25 is a photograph showing the results of observing the binding state between rmPRSS2 and protein-binding beads using a confocal microscope in Experimental Example 4, where recombinant 00502 protein, recombinant 00509 protein, and bovine serum albumin (BSA) were bound to microbeads and incubated with rmPRSS2. [Figure 26] Figure 26 is a photograph showing the results of Western blotting analysis of trypsin degradation in Experimental Example 4, where cecal contents of GF mice were incubated with culture medium control (-) or recombinant 00502 protein conjugated to microbeads. [Figure 27] Figure 27 shows the model proposed by the inventors for trypsin degradation mediated by bacteria of the genus Paraprevotella. [Figure 28] Figure 28 is a graph showing the results of quantifying P. clara strain DNA in the feces of GF mice inoculated with 2-mix using P. clara strain (wild type (WT), Δ00502, or Δ00509) in Experimental Example 5. [Figure 29]Figure 29 is a graph showing the results of measuring fecal trypsin activity in GF mice inoculated with P. clara strain (wild type (WT), Δ00502, or Δ00509) along with 2-mix in Experimental Example 5. [Figure 30] Figure 30 is a graph showing the results of measuring fecal trypsin activity in GF mice inoculated with P. clara strain (wild type (WT), Δ00502) together with 34-mix in Experimental Example 5. [Figure 31] Figure 31 is a photograph showing the results of Western blotting analysis of each protein in the feces of GF mice inoculated with P. clara strain (wild type (WT), Δ00502, or Δ00509) along with 2-mix in Experimental Example 5. [Figure 32] Figure 32 is a photograph showing the results of Western blotting analysis of each protein in the feces of GF mice, the feces of GF mice inoculated with wild-type P. clara strain along with 2-mix, a sample of the above two mixed, and a sample of the above two mixed with the addition of a trypsin inhibitor (TCLK) in Experimental Example 5. [Figure 33] Figure 33 is a graph showing the weight changes of mice in each group after C. rodentium infection in Experimental Example 6. [Figure 34] The upper panel of Figure 34 shows images of the large intestine of each mouse 7 days after C. rodentium infection in Experimental Example 6. The lower panel of Figure 34 shows representative micrographs of hematoxylin-eosin stained cecal tissue from Experimental Example 6. [Figure 35] Figure 35 is a graph showing the histological score of cecal tissue based on hematoxylin-eosin staining in Experimental Example 6. [Figure 36] Figure 36 is a photograph showing the results of Western blotting analysis of each protein in feces in Experimental Example 6. [Figure 37] Figure 37 is a photograph showing the results of evaluating the agglutination effect by fecal IgA in Experimental Example 6, using ex vivo incubation of live C. rodentium and fecal liquid. [Figure 38]Figure 38 is a schematic diagram showing the experimental schedule for Experiment Example 7. [Figure 39] Figure 39 is a graph showing the change in mouse body weight after C. rodentium infection in Experimental Example 7. [Figure 40] Figure 40 is a graph showing the measured CFU levels of C. rodentium in cecal patches in Experimental Example 7. [Figure 41] Figure 41 is a graph showing the measured CFU levels of C. rodentium in the luminal contents in Experimental Example 7. [Figure 42] Figure 42 is a photograph showing the results of Western blotting analysis of each protein in the cecal lumen contents in Experimental Example 7. [Figure 43] Figure 43 is a schematic diagram illustrating the overview of the mouse hepatitis virus (MHV) infection experiment in Experiment Example 8. [Figure 44] Figure 44 is a graph showing the survival curve of mice after MHV infection in Experimental Example 8. [Figure 45] Figure 45 is a graph showing the results of measuring MHV viral titers in the liver, brain, and feces in Experimental Example 8. [Figure 46] Figure 46 is a representative image showing the results of hematoxylin-eosin staining of liver tissue from each group of mice in Experimental Example 8. [Figure 47] Figure 47 shows the homologs of genes related to trypsin degradation (gene 00502 and gene 00509) and the species that encode them, as searched on a computer in Experimental Example 9. [Figure 48] Figure 48 shows the structure of the gene locus related to trypsin degradation in each bacterial species and the sequence identity (%) with the P. clara strain gene in Experimental Example 9. [Figure 49] Figure 49 is a graph showing the results of measuring trypsin activity in the feces of patients in the non-IBD control group (healthy individuals), the ulcerative colitis (UC) group, and the Crohn's disease (CD) group of the Japanese cohort in Experiment Example 9. [Figure 50]Figure 50 is a graph showing the carrier rate of Paraprevotella in the PRISM cohort and HMP2 cohort of patients diagnosed with ulcerative colitis (UC) and Crohn's disease (CD) in Experimental Example 9. [Figure 51] Figure 51 is a photograph showing the results of measuring trypsin degradation by Prevotella rodentium and Prevotella muris strains in Experimental Example 9. [Figure 52] Figure 52 is a photograph showing the results of measuring the trypsin-degrading activity of the Prevotella rara (MSP 0081) strain in Experimental Example 9. [Figure 53] Figure 53 is a schematic diagram showing an example of a fusion protein between the 00502 protein or its homolog, and / or the 00509 protein or its homolog, and the constant region of an antibody. [Modes for carrying out the invention]

[0009] [Composition for the decomposition of trypsin or TMPRSS2] In one embodiment, the present invention provides a composition for degrading trypsin or TMPRSS2, containing as an active ingredient a bacterium having a 00502 protein or a protein having 30% or more sequence identity to the amino acid sequence of the 00502 protein and possessing trypsin-binding ability, or a bacterium having a 00509 protein or a protein having 30% or more sequence identity to the amino acid sequence of the 00509 protein and possessing trypsin-binding ability.

[0010] As described later in the examples, the inventors have revealed that bacteria having the 00502 protein or the 00509 protein adsorb trypsin or TMPRSS2 onto the surface of their cells and degrade the trypsin or TMPRSS2 through autodigestion.

[0011] Therefore, a composition containing a bacterium having the 00502 protein or a bacterium having the 00509 protein as an active ingredient can be used for the degradation of trypsin or TMPRSS2. Thus, the composition of this embodiment can also be described as a degrading agent for trypsin or TMPRSS2.

[0012] The degradation of trypsin or TMPRSS2 can be used for industrial purposes, or, as described later, for pharmaceutical purposes.

[0013] The UniProtKB accession number for the 00502 protein of the Paraprevotella clara (YIT 11840) strain (catalog number "JCM:14859"), as described later, is G5SNC9. Furthermore, the 00502 protein of the Paraprevotella clara (YIT 11840) strain is encoded by the HMPREF9441_00858 gene (UniProtKB). The NCBI accession number for the HMPREF9441_00858 gene is NZ_JH376591 REGION:complement(87340..91131). The amino acid sequence of the 00502 protein of the Paraprevotella clara (YIT 11840) strain is shown in SEQ ID NO: 5, and the cDNA sequence of the HMPREF9441_00858 gene is shown in SEQ ID NO: 1.

[0014] Furthermore, the amino acid sequence of the 00502 protein of the Paraprevotella clara(1C4) strain is shown in SEQ ID NO: 6, and the base sequence of the cDNA of the gene encoding the 00502 protein of the Paraprevotella clara(1C4) strain is shown in SEQ ID NO: 7.

[0015] Furthermore, the amino acid sequence of the 00502 protein of the Paraprevotella xylaniphila (82A6) strain is shown in Sequence ID No. 8, and the base sequence of the cDNA of the gene encoding the 00502 protein of the Paraprevotella xylaniphila (82A6) strain is shown in Sequence ID No. 9.

[0016] Furthermore, the amino acid sequence of the 00502 protein of the Paraprevotella xylaniphila (YIT 11841) strain (catalog number "JCM:14860") is shown in Sequence ID No. 10, and the base sequence of the cDNA of the gene encoding the 00502 protein of the Paraprevotella xylaniphila (YIT 11841) strain is shown in Sequence ID No. 11.

[0017] Furthermore, the amino acid sequence of the 00502 protein of Prevotella rara(109) strain (catalog number "DSM:105141") is shown in Sequence ID No. 12, and the base sequence of the cDNA of the gene encoding the 00502 protein of Prevotella rara(109) strain is shown in Sequence ID No. 13.

[0018] Furthermore, the amino acid sequence of the 00502 protein of Prevotella rodentium (PJ1A) strain (catalog number "DSM:105243") is shown in Sequence ID No. 14, and the base sequence of the cDNA of the gene encoding the 00502 protein of Prevotella rodentium (PJ1A) strain is shown in Sequence ID No. 15.

[0019] Furthermore, the amino acid sequence of the 00502 protein of the Prevotella muris (PMUR) strain (catalog number "DSM:103722") is shown in Sequence ID No. 16, and the base sequence of the cDNA of the gene encoding the 00502 protein of the Prevotella muris (PMUR) strain is shown in Sequence ID No. 17.

[0020] The UniProtKB accession number for the 00509 protein of the Paraprevotella clara (YIT 11840) strain (catalog number "JCM:14859"), as described later, is G5SNC1. Furthermore, the Paraprevotella clara (YIT 11840) strain 00509 protein is encoded by the HMPREF9441_00850 gene (UniProtKB). The NCBI accession number for the HMPREF9441_00850 gene is NZ_JH376591 REGION:73848..76931. The amino acid sequence of the Paraprevotella clara (YIT 11840) strain 00509 protein is shown in SEQ ID NO: 18, and the cDNA sequence of the HMPREF9441_00850 gene is shown in SEQ ID NO: 2.

[0021] Furthermore, the amino acid sequence of the 00509 protein of the Paraprevotella clara(1C4) strain is shown in SEQ ID NO: 19, and the base sequence of the cDNA of the gene encoding the 00509 protein of the Paraprevotella clara(1C4) strain is shown in SEQ ID NO: 20.

[0022] Furthermore, the amino acid sequence of the 00509 protein of the Paraprevotella xylaniphila (82A6) strain is shown in SEQ ID NO: 21, and the base sequence of the cDNA of the gene encoding the 00509 protein of the Paraprevotella xylaniphila (82A6) strain is shown in SEQ ID NO: 22.

[0023] Furthermore, the amino acid sequence of the 00509 protein of the Paraprevotella xylaniphila (YIT 11841) strain (catalog number "JCM:14860") is shown in Sequence ID No. 23, and the base sequence of the cDNA of the gene encoding the 00509 protein of the Paraprevotella xylaniphila (YIT 11841) strain is shown in Sequence ID No. 24.

[0024] Furthermore, the amino acid sequence of the 00509 protein of Prevotella rara(109) strain (catalog number "DSM:105141") is shown in SEQ ID NO: 25, and the base sequence of the cDNA of the gene encoding the 00509 protein of Prevotella rara(109) strain is shown in SEQ ID NO: 26.

[0025] Furthermore, the amino acid sequence of the 00509 protein of Prevotella rodentium (PJ1A) strain (catalog number "DSM:105243") is shown in Sequence ID No. 27, and the base sequence of the cDNA of the gene encoding the 00509 protein of Prevotella rodentium (PJ1A) strain is shown in Sequence ID No. 28.

[0026] As will be described later in the examples, the trypsin or TMPRSS2 degradation composition according to this embodiment may contain a bacterium having a homolog of the 00502 protein or a bacterium having a homolog of the 00509 protein as an active ingredient.

[0027] Homologs of the 00502 protein include proteins that have 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with respect to the amino acid sequence described in SEQ ID NO: 5, and that also possess trypsin-binding ability. Bacteria possessing homologs of the 00502 protein preferably have trypsin or TMPRSS2-binding ability and further possess activity to degrade trypsin or TMPRSS2.

[0028] Homologs of the 00509 protein include proteins that have 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with respect to the amino acid sequence described in SEQ ID NO: 18, and that also possess trypsin-binding ability. Bacteria possessing homologs of the 00509 protein preferably have trypsin or TMPRSS2-binding ability and further possess activity to degrade trypsin or TMPRSS2.

[0029] In the composition for degrading trypsin or TMPRSS2 according to this embodiment, "contained as an active ingredient" means containing an amount of 00502 protein or bacteria having a homolog of 00502 protein, or 00509 protein or bacteria having a homolog of 00509 protein, sufficient to degrade trypsin or TMPRSS2. Alternatively, it means containing 00502 protein or bacteria having a homolog of 00502 protein, or 00509 protein or bacteria having a homolog of 00509 protein as the main active ingredient.

[0030] In the composition for degrading trypsin or TMPRSS2 according to this embodiment, the 00502 protein or bacteria having a homolog of the 00502 protein means bacteria that express the 00502 protein or a homolog of the 00502 protein.

[0031] Bacteria expressing the 00502 protein may also be bacteria possessing the HMPREF9441_00858 gene (SEQ ID NO: 1) encoding the 00502 protein. Furthermore, bacteria having homologs of the 00502 protein may also be bacteria possessing a gene encoding a cDNA that has 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the nucleotide sequence described in SEQ ID NO: 1, and that also encodes a protein capable of binding to trypsin. The 00502 protein may be derived from a gene endemic to the bacterium or from an exogenous gene.

[0032] Similarly, a bacterium having the 00509 protein or a homolog of the 00509 protein means a bacterium that expresses the 00509 protein or a homolog of the 00509 protein.

[0033] Bacteria expressing the 00509 protein may also be bacteria possessing the HMPREF9441_00850 gene (SEQ ID NO: 2) encoding the 00509 protein. Furthermore, bacteria having homologs of the 00509 protein may also be bacteria possessing a gene encoding a cDNA that has 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the nucleotide sequence described in SEQ ID NO: 2, and that encodes a protein capable of binding to trypsin. The 00509 protein may be derived from a gene endemic to the bacterium or from an exogenous gene.

[0034] The trypsin or TMPRSS2 degradation composition according to this embodiment may contain only bacteria having the 00502 protein or a homolog of the 00502 protein, or only bacteria having the 00509 protein or a homolog of the 00509 protein, or it may contain both bacteria having the 00502 protein or a homolog of the 00502 protein and bacteria having the 00509 protein or a homolog of the 00509 protein. Alternatively, the trypsin or TMPRSS2 degradation composition according to this embodiment may contain the 00502 protein or a homolog of the 00502 protein and bacteria having the 00509 protein or a homolog of the 00509 protein. Such bacteria can be produced by genetic modification or the like.

[0035] In the trypsin or TMPRSS2 degradation composition according to this embodiment, it is preferable that the bacteria having the 00502 protein or a homolog of the 00502 protein, or the 00509 protein or a homolog of the 00509 protein, have a type IX secretion system (T9SS).

[0036] Furthermore, it is preferable that T9SS contains PorV protein, PorU protein, PorN protein, PorM protein, PorL protein, PorK protein, or PorP protein.

[0037] As described later in the examples, the inventors revealed that the 00502 protein or its homolog, or the 00509 protein or its homolog, is transported across the outer membrane to the bacterial surface by T9SS and binds to the bacterial surface.

[0038] For example, in the Paraprevotella clara strain described later, the NCBI accession number for the PorV protein is WP_008622445.1, the NCBI accession number for the PorU protein is WP_008622443.1, the NCBI accession number for the PorN protein is WP_008623210.1, the NCBI accession number for the PorM protein is WP_008623211.1, the NCBI accession number for the PorL protein is WP_008623213.1, the NCBI accession number for the PorK protein is WP_008623215.1, and the NCBI accession number for the PorP protein is WP_008623217.1. In addition, in bacteria other than the Paraprevotella clara strain, homologs of these proteins in those bacteria constitute T9SS.

[0039] In the composition for degrading trypsin or TMPRSS2 according to this embodiment, the bacteria having the 00502 protein or a homolog of the 00502 protein, or the 00509 protein or a homolog of the 00509 protein, may be bacteria belonging to the genera Paraprevotella, Prevotella, Prevotellamasilia, or Bacteroidetes.

[0040] As described later in the examples, the inventors have shown that bacteria belonging to the genera Paraprevotella, Prevotella, Prevotellamasilia, or Bacteroidetes degrade trypsin or TMPRSS2. Examples of bacteria belonging to the genus Paraprevotella include Paraprevotella clara, Paraprevotella xylaniphila, Paraprevotella sp.MSP 0303, and Paraprevotella sp.MSP 0335. Examples of bacteria belonging to the genus Prevotella include Prevotella rara, Prevotella rodentium, and Prevotella muris.

[0041] Bacteria belonging to the genus Paraprevotella are bacteria that possess a 16S rRNA gene consisting of the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4, or a 16S rRNA gene consisting of a nucleotide sequence with 97% or more sequence identity to the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4. If the sequence identity of the 16S rRNA gene is 97% or more, the bacteria are considered to belong to the same species.

[0042] The nucleotide sequence described in Sequence ID No. 3 is the nucleotide sequence of the 16S rRNA gene of the Paraprevotella clara (YIT 11840) strain (catalog number "JCM:14859"), which will be described later. The nucleotide sequence described in Sequence ID No. 29 is the nucleotide sequence of the 16S rRNA gene of the Paraprevotella clara (1C4) strain. The nucleotide sequence described in Sequence ID No. 4 is the nucleotide sequence of the 16S rRNA gene of the Paraprevotella xylaniphila (82A6) strain, which will be described later. The nucleotide sequence described in Sequence ID No. 30 is the nucleotide sequence of the 16S rRNA gene of the Paraprevotella xylaniphila (YIT 11841) strain (catalog number "JCM:14860").

[0043] In the composition for degrading trypsin or TMPRSS2 according to this embodiment, the bacteria having the 00502 protein or a homolog of the 00502 protein, or the 00509 protein or a homolog of the 00509 protein, may be at least one bacterium selected from the group consisting of Paraprebotella sp.MSP 0303, Paraprebotella sp.MSP 0335, Prevotellamassilia timonensis, Bacteroidetes sp.MSP 0288, Bacteroidetes sp.MSP 0410, Bacteroidetes sp.MSP 0435, and Porphyromonas gingivalis.

[0044] Examples of Prevotella rara include Prevotella rara (MSP 0081) and Prevotella rara (109). Examples of Prevotella rodentium include Prevotella rodentium (PJ1A) (catalog number "DSM:105243"). Examples of Prevotella muris include Prevotella muris (PMUR) (catalog number "DSM:103722"). Examples of Prevotellamassilia timonensis include Prevotellamassilia timonensis (MSP 0224). Examples of Porphyromonas gingivalis include Porphyromonas gingivalis (ATCC33277).

[0045] As will be described later in the examples, the inventors have shown that these bacteria degrade trypsin or TMPRSS2.

[0046] The nucleotide sequence described in Sequence ID No. 31 is the nucleotide sequence of the 16S rRNA gene of Prevotella rara (109) strain (catalog number "DSM:105141"). The nucleotide sequence described in Sequence ID No. 32 is the nucleotide sequence of the 16S rRNA gene of Prevotella rodentium (PJ1A) strain (catalog number "DSM:105243"). The nucleotide sequence described in Sequence ID No. 33 is the nucleotide sequence of the 16S rRNA gene of Prevotella muris (PMUR) strain (catalog number "DSM:103722").

[0047] In the composition for degrading trypsin or TMPRSS2 according to this embodiment, the bacteria may be live or dead, as long as they have trypsin or TMPRSS2 degradation activity.

[0048] The trypsin or TMPRSS2 degradation composition according to this embodiment may contain the above-mentioned bacteria in the form of a powder or lyophilized substance, embedded in an aqueous form such as a solution or suspension, or in a semi-solid form. In one embodiment, the composition or bacteria are lyophilized. In one embodiment, a subset of bacteria in the composition is lyophilized. Methods for lyophilizing compositions containing bacteria are well known in the art. For example, see U.S. Patent No. 3,261,761, U.S. Patent No. 4,205,132, and International Publication No. 2012 / 098358. These documents are incorporated herein by reference.

[0049] Bacteria may be freeze-dried as a combination, or freeze-dried separately and then combined. Bacteria may be combined with a pharmaceutically acceptable carrier before being combined with other bacteria. Multiple freeze-dried bacteria may be combined in their freeze-dried form. A mixture of bacteria, once combined, may subsequently be combined with a pharmaceutically acceptable carrier. In one embodiment, the bacteria are freeze-dried solids. In one embodiment, the composition is freeze-dried solids.

[0050] In one embodiment, the present invention provides a composition for degrading trypsin or TMPRSS2, containing as an active ingredient a 00502 protein or a protein having 30% or more sequence identity with the amino acid sequence of the 00502 protein and possessing trypsin-binding ability, or a 00509 protein or a protein having 30% or more sequence identity with the amino acid sequence of the 00509 protein and possessing trypsin-binding ability.

[0051] As described later in the examples, the inventors have shown that the 00502 protein or the 00509 protein degrades trypsin or TMPRSS2. Here, it is preferable that the 00502 protein or the 00509 protein is immobilized on a solid surface.

[0052] The solid phase is not particularly limited and includes particles made of resin, glass, metal, etc., the surface of a container such as a plate or tube, or a film made of resin. The particles may also be magnetic particles.

[0053] The solid phase may be a pharmaceutically acceptable solid phase. Examples of pharmaceutically acceptable solid phases include liposomes, polymer nanoparticles such as protein nanoparticles and lipid nanoparticles, nanoemulsions such as iron nanoparticles and lipid microspheres, micelles, vaccine adjuvants, and nanocrystals. It is preferable that the pharmaceutically acceptable solid phase is approved by the Pharmaceuticals and Medical Devices Agency (PMDA), the U.S. Food and Drug Administration (FDA), and the European Medicines Agency (EMA).

[0054] The method for immobilizing the 00502 protein or the 00509 protein onto a solid phase is not particularly limited and includes methods such as binding by a chemical linker, binding by avidin-biotin, and physical adsorption.

[0055] As will be described later in the examples, the trypsin or TMPRSS2 degradation composition according to this embodiment may contain a homolog of the 00502 protein or a homolog of the 00509 protein as an active ingredient.

[0056] Homologs of the 00502 protein are the same as those described above, and include proteins that have 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with respect to the amino acid sequence described in SEQ ID NO: 5, and that also have trypsin-binding ability. Homologs of the 00502 protein preferably have trypsin or TMPRSS2-binding ability.

[0057] Homologs of the 00509 protein are the same as those described above, and include proteins that have 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with respect to the amino acid sequence described in SEQ ID NO: 18, and that also have trypsin-binding ability. Homologs of the 00509 protein preferably have trypsin or TMPRSS2-binding ability.

[0058] In the composition for degrading trypsin or TMPRSS2 according to this embodiment, "contained as an active ingredient" means containing an amount of 00502 protein or a homolog of 00502 protein, or 00509 protein or a homolog of 00509 protein sufficient to degrade trypsin or TMPRSS2. Alternatively, it means containing 00502 protein or a homolog of 00502 protein, or 00509 protein or a homolog of 00509 protein as the main active ingredient.

[0059] The 00502 protein or its homolog, or the 00509 protein or its homolog, may be tagged with a peptide tag for protein purification, protein detection, or binding to a solid phase. The peptide tag is not particularly limited and examples include histidine tags, FLAG tags, MYC tags, etc.

[0060] The trypsin or TMPRSS2 degradation composition according to this embodiment may contain only the 00502 protein or its homolog, only the 00509 protein or its homolog, or both the 00502 protein or its homolog, as long as it has trypsin or TMPRSS2 degradation activity.

[0061] If the trypsin or TMPRSS2 degradation composition according to this embodiment contains both the 00502 protein or its homolog and the 00509 protein or its homolog, the 00502 protein or its homolog and the 00509 protein or its homolog may be bound together.

[0062] Here, the 00502 protein or its homolog, and the 00509 protein or its homolog, may be linked in a linear chain or in a ring. Furthermore, the 00502 protein or its homolog, and the 00509 protein or its homolog may be linked directly or via a linker. The linker is not particularly limited and includes, for example, a peptide consisting of an amino acid sequence in which GGGGS (SEQ ID NO: 34) is repeated 1 to 4 times.

[0063] The 00502 protein or its homolog, and / or the 00509 protein or its homolog, may be in the form of a fusion protein with an antibody constant region. The antibody constant region may be a constant region derived from a human antibody, or a constant region derived from a human IgG-type antibody.

[0064] Figure 53 is a schematic diagram showing an example of a fusion protein between the 00502 protein or its homolog, and / or the 00509 protein or its homolog, and the antibody constant region. In Figure 53, "Protein" refers to the 00502 protein or its homolog, or the 00509 protein or its homolog, "CH2" refers to the antibody constant region CH2 domain, and "CH3" refers to the antibody constant region CH3 domain.

[0065] As shown in Figure 53, the antibody constant region may be bound to the 00502 protein or its homolog and / or the 00509 protein or its homolog via a linker. The linker is not particularly limited and includes, for example, a peptide consisting of an amino acid sequence in which GGGGS (SEQ ID NO: 34) is repeated 1 to 4 times.

[0066] [Pharmaceutical composition for the treatment of diseases caused by trypsin or TMPRSS2] In one embodiment, the above-described composition for the degradation of trypsin or TMPRSS2 may be used for the treatment of diseases caused by trypsin or TMPRSS2. That is, in one embodiment, the present invention provides a pharmaceutical composition for the treatment of diseases caused by trypsin or TMPRSS2. The pharmaceutical composition of this embodiment contains as an active ingredient a bacterium having protein 00502 or a homolog of protein 00502, a bacterium having protein 00509 or a homolog of protein 00509, protein 00502 or a homolog of protein 00502, or protein 00509 or a homolog of protein 00509.

[0067] In the pharmaceutical composition of this embodiment, the 00502 protein, the homolog of the 00502 protein, the 00509 protein, the homolog of the 00509 protein, and the bacteria having these are the same as described above.

[0068] In the pharmaceutical composition of this embodiment, diseases caused by trypsin or TMPRSS2 include inflammatory bowel disease (ulcerative colitis, Crohn's disease), irritable bowel syndrome, acute pancreatitis, chronic pancreatitis, and the like.

[0069] Alternatively, in the pharmaceutical composition of this embodiment, diseases caused by trypsin or TMPRSS2 include infectious diseases. Examples of infectious diseases include viral infections and bacterial infections. Furthermore, examples of inflammatory bowel disease, irritable bowel syndrome, or infectious diseases include diseases involving TMPRSS2 or IgA. Examples of infectious diseases in which TMPRSS2 is involved include coronavirus infections. Examples of infectious diseases in which IgA is involved include salmonella infections.

[0070] The pharmaceutical composition of this embodiment may be formulated with a pharmaceutically acceptable carrier. Any pharmaceutically acceptable carrier commonly used in the formulation of pharmaceutical compositions can be used without particular limitation. More specifically, examples include binders such as gelatin, corn starch, tragacanth gum, and gum arabic; excipients such as starch and crystalline cellulose; and leavening agents such as alginic acid.

[0071] The pharmaceutical composition of this embodiment may contain additives. Examples of additives include lubricants such as calcium stearate and magnesium stearate, sweeteners such as sucrose, lactose, saccharin, and maltitol, flavoring agents such as peppermint and red ginger oil, stabilizers such as benzyl alcohol and phenol, and buffering agents such as phosphates and sodium acetate.

[0072] The pharmaceutical composition of this embodiment can be formulated by appropriately combining the above-mentioned carriers and additives and mixing them in a unit dose form generally accepted for pharmaceutical production.

[0073] The method of administering the pharmaceutical composition of this embodiment is not particularly limited and may be determined appropriately according to the patient's symptoms, weight, age, sex, etc. Examples include tablets, powders, capsules, liquids, enemas, suppositories, etc. Tablets, powders, capsules, and liquids are administered orally. Enemas and suppositories are administered into the intestines. The pharmaceutical composition is preferably in a dosage form that can deliver the active ingredient (00502 protein or bacteria having a homolog of 00502 protein, 00509 protein or bacteria having a homolog of 00509 protein, 00502 protein or a homolog of 00502 protein, or 00509 protein or a homolog of 00509 protein) to the intestines.

[0074] The dosage of a pharmaceutical composition varies depending on the patient's symptoms, weight, age, sex, etc., and cannot be determined in general terms. However, if the active ingredient is live bacteria, for example, it may be considered to administer 0.1 to 100 mg / kg body weight of the active ingredient per dose unit, once to several times a day. If the active ingredient is dead bacteria or protein, for example, it may be considered to administer 0.1 to 100 mg / kg body weight of the active ingredient per dose unit, once to several times a day.

[0075] The pharmaceutical composition of this embodiment may be a quasi-drug. A quasi-drug is a product that has recognized specific efficacy and effects, and has a mild effect on the human body. The quasi-drug of this embodiment is not particularly limited, but examples include drinks, stomachic medicines, and intestinal regulators.

[0076] [Diagnostic agents for diseases caused by trypsin or TMPRSS2] In one embodiment, the present invention provides a diagnostic agent for diseases caused by trypsin or TMPRSS2, comprising a specific binding substance for detecting the 00502 protein or a protein having 30% or more sequence identity to the amino acid sequence of the 00502 protein and possessing trypsin-binding ability, or the 00509 protein or a protein having 30% or more sequence identity to the amino acid sequence of the 00509 protein and possessing trypsin-binding ability.

[0077] In other words, the diagnostic agent of this embodiment includes a specific binding substance for detecting protein 00502, a homolog of protein 00502, protein 00509, and a homolog of protein 00509 at the protein level.

[0078] Examples of specific binding agents include antibodies, antibody fragments, and aptamers. Examples of antibody fragments include Fab, F(ab')2, Fab', and single-chain antibodies (scFv). The antibody may be a monoclonal antibody or a polyclonal antibody. Commercially available antibodies may also be used.

[0079] In the diagnostic agent of this embodiment, the 00502 protein, the homolog of the 00502 protein, the 00509 protein, the homolog of the 00509 protein, and bacteria having these are the same as described above. Furthermore, diseases caused by trypsin or TMPRSS2 are also the same as described above.

[0080] Using the diagnostic reagent of this embodiment, it is possible to detect the presence or absence of 00502 protein, a homolog of 00502 protein, 00509 protein, a homolog of 00509 protein, or bacteria having these in a biological sample derived from the target.

[0081] The detection principle using the diagnostic agent in this embodiment is not particularly limited and includes, for example, enzyme immunosorbent assay (ELISA), lateral flow immunoassay, Western blotting, flow cytometry (FACS), and the like.

[0082] Examples of biological samples derived from the subject include stool samples. If the presence of protein 00502, a homolog of protein 00502, protein 00509, a homolog of protein 00509, or bacteria containing these is detected in a biological sample derived from the subject using the diagnostic agent of this embodiment, it can be determined that the subject is not suffering from a disease caused by trypsin or TMPRSS2.

[0083] If the presence of protein 00502, a homolog of protein 00502, protein 00509, a homolog of protein 00509, or bacteria containing these is not detected in a biological sample derived from the subject, it can be determined that the subject may be suffering from a disease caused by trypsin or TMPRSS2. In this case, the symptoms of the disease caused by trypsin or TMPRSS2 can be treated or alleviated by administering the above-mentioned pharmaceutical composition or quasi-drug to the subject.

[0084] In one embodiment, the diagnostic agent of this embodiment may detect the 00502 protein, the homolog of the 00502 protein, the 00509 protein, and the homolog of the 00509 protein at the gene level.

[0085] In other words, in one embodiment, the present invention provides a diagnostic agent for diseases caused by trypsin or TMPRSS2, comprising a primer set or probe for detecting the HMPREF9441_00858 gene encoding the 00502 protein or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence of the HMPREF9441_00858 gene and having trypsin-binding ability, or the HMPREF9441_00850 gene encoding the 00509 protein or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence of the HMPREF9441_00850 gene and having trypsin-binding ability. In other words, the diagnostic agent of this embodiment comprises a primer set or probe for detecting the gene consisting of the nucleotide sequence described in SEQ ID NO: 1 or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence described in SEQ ID NO: 1 and having trypsin-binding ability, or the gene consisting of the nucleotide sequence described in SEQ ID NO: 2 or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence described in SEQ ID NO: 2 and having trypsin-binding ability.

[0086] The same applies to the HMPREF9441_00858 and HMPREF9441_00850 genes as described above.

[0087] The gene encoding a protein that has more than 30% sequence identity with the HMPREF9441_00858 gene and possesses trypsin-binding ability is the gene encoding the homolog of the 00502 protein mentioned above.

[0088] Furthermore, the gene encoding a protein that has more than 30% sequence identity with the HMPREF9441_00850 gene and possesses trypsin-binding ability is the gene encoding the homolog of the aforementioned 00509 protein.

[0089] Using the diagnostic reagent of this embodiment, it is possible to detect the presence or absence of bacteria having the 00502 protein, bacteria having a homolog of the 00502 protein, bacteria having the 00509 protein, and bacteria having a homolog of the 00509 protein in a biological sample derived from the target.

[0090] The detection principle using the diagnostic agent in this embodiment is not particularly limited and includes, for example, PCR, RNA sequencing (RNA-Seq), metagenomic analysis, DNA microarray analysis, etc.

[0091] The biological sample derived from the subject is the same as described above, and includes stool samples, etc. If the presence of bacteria having the 00502 protein, bacteria having a homolog of the 00502 protein, bacteria having the 00509 protein, or bacteria having a homolog of the 00509 protein is detected in the biological sample derived from the subject using the diagnostic agent of this embodiment, it can be determined that the subject is not suffering from a disease caused by trypsin or TMPRSS2.

[0092] If no bacteria possessing the 00502 protein, bacteria possessing a homolog of the 00502 protein, bacteria possessing the 00509 protein, or bacteria possessing a homolog of the 00509 protein are detected in the biological sample derived from the subject, it can be concluded that the subject may be suffering from a disease caused by trypsin or TMPRSS2.

[0093] In this case, administering the aforementioned pharmaceutical composition or quasi-drug to the subject can treat or alleviate the symptoms of diseases caused by trypsin or TMPRSS2.

[0094] [Other embodiments] In one embodiment, the present invention provides a method for treating a disease caused by trypsin or TMPRSS2, comprising the step of administering an effective amount of a bacterium having a 00502 protein or a protein having 30% or more sequence identity to the amino acid sequence of the 00502 protein and possessing trypsin-binding ability, or a bacterium having a 00509 protein or a protein having 30% or more sequence identity to the amino acid sequence of the 00509 protein and possessing trypsin-binding ability, to a patient in need of treatment.

[0095] In one embodiment, the present invention provides a method for treating a disease caused by trypsin or TMPRSS2, comprising the step of administering an effective amount of a bacterium having a gene consisting of the nucleotide sequence described in SEQ ID NO: 1 or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence described in SEQ ID NO: 1 and having trypsin-binding ability, or a bacterium having a gene consisting of the nucleotide sequence described in SEQ ID NO: 2 or a gene encoding a protein having 30% or more sequence identity with the nucleotide sequence described in SEQ ID NO: 2 and having trypsin-binding ability, to a patient in need of treatment.

[0096] In one embodiment, the present invention provides a method for treating a disease caused by trypsin or TMPRSS2, comprising the step of administering an effective amount of protein 00502 or a protein having 30% or more sequence identity to the amino acid sequence of protein 00502 and possessing trypsin-binding ability, or protein 00509 or a protein having 30% or more sequence identity to the amino acid sequence of protein 00509 and possessing trypsin-binding ability, to a patient in need of treatment.

[0097] In one embodiment, the present invention provides a step of detecting the presence or absence of protein 00502, a homolog of protein 00502, protein 00509, or a homolog of protein 00509 in a biological sample derived from a subject, wherein the absence of the protein or homolog indicates that the subject is suffering from a disease caused by trypsin or TMPRSS2, and if the presence of the protein or homolog is not detected, the subject is given protein 00502 or a protein having 30% or more sequence identity with the amino acid sequence of protein 00502 and having trypsin-binding ability. The present invention provides a method for diagnosing and treating diseases caused by trypsin or TMPRSS2, comprising the step of administering an effective amount of: a bacterium having a protein, a bacterium having a protein with 00509 protein or a protein having 30% or more sequence identity to the amino acid sequence of 00509 protein and possessing trypsin-binding ability; a protein with 00502 protein or a protein having 30% or more sequence identity to the amino acid sequence of 00502 protein and possessing trypsin-binding ability; or a protein with 00509 protein or a protein having 30% or more sequence identity to the amino acid sequence of 00509 protein and possessing trypsin-binding ability.

[0098] In one embodiment, the present invention provides a step of detecting the presence or absence of bacteria having the 00502 protein, bacteria having a homolog of the 00502 protein, bacteria having a gene consisting of the nucleotide sequence described in Sequence ID No. 1, bacteria having a gene encoding a protein having 30% or more sequence identity to the nucleotide sequence described in Sequence ID No. 1 and having trypsin-binding ability in a biological sample derived from a subject, wherein the absence of detection of the presence of the protein, the homolog, or bacteria having the gene indicates that the subject is suffering from a disease caused by trypsin or TMPRSS2, and if the presence of bacteria having the protein, the homolog, or the gene is not detected, the subject is given a treatment for the 00502 protein or the amino acid sequence of the 00502 protein The present invention provides a method for diagnosing and treating diseases caused by trypsin or TMPRSS2, comprising the step of administering an effective amount of: a bacterium having a protein with 30% or more sequence identity and trypsin-binding ability; a bacterium having a gene consisting of the nucleotide sequence described in Sequence ID No. 1; a bacterium having a gene encoding a protein with 30% or more sequence identity to the nucleotide sequence described in Sequence ID No. 1 and trypsin-binding ability; a bacterium having 00509 protein or a bacterium having a protein with 30% or more sequence identity to the amino acid sequence of 00509 protein and trypsin-binding ability; a bacterium having a gene consisting of the nucleotide sequence described in Sequence ID No. 2; a bacterium having a gene encoding a protein with 30% or more sequence identity to the nucleotide sequence described in Sequence ID No. 2 and trypsin-binding ability; a bacterium having 00502 protein or a protein with 30% or more sequence identity to the amino acid sequence of 00502 protein and trypsin-binding ability; or a bacterium having 00509 protein or a protein with 30% or more sequence identity to the amino acid sequence of 00509 protein and trypsin-binding ability.

[0099] In one embodiment, the present invention provides a composition for the treatment of diseases caused by trypsin or TMPRSS2, comprising as an active ingredient a bacterium having a 00502 protein, a bacterium having a protein having 30% or more sequence identity to the amino acid sequence of the 00502 protein and having trypsin-binding ability, a bacterium having a gene consisting of the nucleotide sequence described in SEQ ID NO: 1, a bacterium having a gene encoding a protein having 30% or more sequence identity to the nucleotide sequence described in SEQ ID NO: 1 and having trypsin-binding ability, a bacterium having a 00509 protein, a bacterium having a protein having 30% or more sequence identity to the amino acid sequence of the 00509 protein and having trypsin-binding ability, a bacterium having a gene consisting of the nucleotide sequence described in SEQ ID NO: 2, or a bacterium having a gene encoding a protein having 30% or more sequence identity to the nucleotide sequence described in SEQ ID NO: 2 and having trypsin-binding ability.

[0100] In one embodiment, the present invention provides a pharmaceutical composition for the treatment of diseases caused by trypsin or TMPRSS2, comprising as an active ingredient a 00502 protein, a protein having 30% or more sequence identity with the amino acid sequence of the 00502 protein and possessing trypsin-binding ability, a 00509 protein, or a protein having 30% or more sequence identity with the amino acid sequence of the 00509 protein and possessing trypsin-binding ability.

[0101] In one embodiment, the present invention provides the use of bacteria having a 00502 protein, bacteria having a protein having 30% or more sequence identity to the amino acid sequence of the 00502 protein and having trypsin-binding ability, bacteria having a gene consisting of the nucleotide sequence described in SEQ ID NO: 1, bacteria having a gene encoding a protein having 30% or more sequence identity to the nucleotide sequence described in SEQ ID NO: 1 and having trypsin-binding ability, bacteria having a 00509 protein, bacteria having a protein having 30% or more sequence identity to the amino acid sequence of the 00509 protein and having trypsin-binding ability, bacteria having a gene consisting of the nucleotide sequence described in SEQ ID NO: 2, or bacteria having a gene encoding a protein having 30% or more sequence identity to the nucleotide sequence described in SEQ ID NO: 2 and having trypsin-binding ability, for the production of a pharmaceutical composition for the treatment of diseases caused by trypsin or TMPRSS2.

[0102] In one embodiment, the present invention provides the use of a 00502 protein, a protein having 30% or more sequence identity to the amino acid sequence of the 00502 protein and having trypsin-binding ability, a 00509 protein, or a protein having 30% or more sequence identity to the amino acid sequence of the 00509 protein and having trypsin-binding ability for the production of a pharmaceutical composition for the treatment of diseases caused by trypsin or TMPRSS2. [Examples]

[0103] The present invention will now be described in more detail with reference to examples, but the present invention is not limited to the following examples.

[0104] [Materials and Methods] (mouse) C57BL / 6 mice, reared under specific pathogen-free (SPF) or germ-free (GF) conditions, were purchased from Sankyo Laboratories Japan, SLC Japan, Charles River Japan, or CLEA Japan. GF mice and gnotobiotic mice were bred and maintained at the gnotobiotic facility of the RIKEN Center for Integrative Medical Sciences. All animal experiments were approved by the Animal Experiment Committee of the RIKEN Yokohama Institute.

[0105] (bacterial strain) Paraprevotella clara (JCM14859), Paraprevotella xylaniphila (JCM14860), Paraprevotella copri (JCM13464), Paraprevotella denticola (JCM13449), Paraprevotella stercorea (JCM13469), and Paraprevotella oulorum (JCM14966) were obtained from the Japan Collection of Microorganisms (JCM). Paraprevotella clara (P237E3b) and (P322B5) were provided by Vedanta Biosciences. Paraprevotella xylaniphila (82A6) was isolated by the inventors.

[0106] (Proteomic analysis of cecal contents) Proteins from cecal contents were extracted by pipetting and mixing with Tris-buffered saline (TBST) containing Tween20 with protease inhibitor. The mixture was then centrifuged at 15,000 × g for 20 minutes at 4°C to remove insoluble matter. The supernatant was transferred to a new tube, 25% trichloroacetic acid (final concentration 12.5% ​​v / v) was added, and the mixture was incubated at 4°C for 1 hour. The supernatant was then removed by centrifuging at 15,000 × g for 15 minutes at 4°C. The precipitate was washed twice with acetone, and the tube was opened and dried. The dried sample was then redissolved in 0.5% sodium dodecanoate and 100 mM Tris-HCl (pH 8.5) using a water bath sonicator (Bioruptor UCD-200, SonicBio Corp). The protein concentration of the redissolved sample was measured by a bicinchoninic acid (BCA) assay, and the protein concentration was adjusted to 1 μg / μL. Preprocessing for shotgun proteome analysis was performed as described in a previous report (Kawashima Y., et al., Optimization of Data-Independent Acquisition Mass Spectrometry for Deep and Highly Sensitive Proteomic Analysis, Int J Mol Sci., 20 (23), 5932, 2019).

[0107] The peptides were directly injected into a 75 μm × 15 cm PicoFrit emitter (New Objective) packed in-house with 2.7 μm core-shell C18 particles (CAPCELL CORE MP 2.7 μm, 160 Å material, Osaka Soda Co., Ltd.), and separated using an Eksigent ekspert nanoLC 400 HPLC system (Sciex) with a gradient of 300 nL / min for 180 minutes.

[0108] The peptides eluted from the column were analyzed using a TripleTOF 5600+ mass spectrometer (Sciex) with shotgun MS and SWATH (Sequential Window Acquisition of All Theoretical Mass Spectra)-MS. In the shotgun MS experiment, the MS1 spectrum was collected for 250 milliseconds in the range of 400–1000 m / z. The top 25 precursor ions with charge states from 2+ to 5+ and exceeding 150 counts / second were selected, fragmentation was performed using rolling collision energy, and the MS2 spectrum was collected for 100 milliseconds in the range of 100–1500 m / z. The dynamic exclusion time was set to 24 seconds.

[0109] In the SWATH-MS experiments, the mass spectrometer was operated in a sequential data-independent acquisition mode, and the precursor separation window was increased by 12 m / z increments. Using a separation width of 13 m / z (window overlap of 1 m / z), a set of 50 windows covering the precursor mass range of 400–1000 m / z was constructed. SWATH MS2 spectra were obtained in the 100–1500 m / z range for 60 milliseconds per MS2 experiment. In each MS2 experiment, precursor ions were fragmented using rolling collision energy.

[0110] All shotgun MS files were identified by comparing them to the mouse UniProt reference proteome (Uniprot id UP000000589, reviewed, canonical) using ProteinPilot software v.4.5 and the Paragon algorithm (Sciex).

[0111] The reliability threshold for proteins was defined as an unused ProteinPilot score of 1.3 and at least one peptide having 95% reliability. In this study, the global false discovery rate for both peptides and proteins was less than 1%. Identified proteins were quantified from SWATH-MS data using PeakView v.2.2 (Sciex).

[0112] (Proteomic analysis of P. clara culture supernatant) The culture supernatant of P. clara was mixed with 25% trichloroacetic acid (final concentration 12.5% ​​v / v) and incubated at 4°C for 1 hour. Subsequently, the supernatant was removed by centrifugation at 15,000 × g for 15 minutes at 4°C, and the precipitate was washed twice with acetone. The lid was then removed and the sample was dried. The dried sample was then redissolved in 0.5% sodium dodecanoate and 100 mM Tris-HCl (pH 8.5) using a water bath sonicator (Bioruptor UCD-200). The protein concentration of the redissolved sample was measured by BCA assay and adjusted to 1 μg / μL. The pretreatment for shotgun proteome analysis was performed as described above.

[0113] The peptides were directly injected at 50°C into a 75 μm × 20 cm PicoFrit emitter packed in-house with 2.7 μm core-shell C18 particles, and then separated using an UltiMate 3000 RSLC nano LC system (Thermo Fisher Scientific) with a gradient at a flow rate of 100 nL / min for 80 minutes. The peptides eluted from the column were analyzed by overlap-window DIA-MS using a Q Exactive HF-X (Thermo Fisher Scientific). MS1 spectra were collected in the range of 495–785 m / z with a resolution of 30,000, and the target value of the automated gain control was 3 × e 6 The maximum injection time was set to 55.

[0114] The MS2 spectrum uses an automatic gain control target value of 3 × e 6The maximum injection time was set to "auto," and the stepped normalized collision energies were set to 22%, 26%, and 30%, with data collected in the range of 200 m / z or higher at a resolution of 30,000. The MS2 isolation width was set to 4 m / z, and an overlapping window pattern of 500-780 m / z was used. The window placement was optimized using Skyline software.

[0115] MS files were compared with a P. clara spectral library using Scaffold DIA (Proteome Software). The spectral library was generated using Prosit software from the protein sequence database of P. clara (UniProt id UP000000589, reviewed, canonical).

[0116] The P. clara protein sequence database was independently created through metagenomic analysis. The search parameters for Scaffold DIA were as follows: Experimental data search enzyme: trypsin, maximum miscleavage site: 1, acceptable precursor mass range: 8 ppm, acceptable fragment mass range: 8 ppm, static modification: cysteine ​​carbamide methylation.

[0117] The protein identification threshold was set so that the false detection rate for peptides and proteins was 1% or less. Peptide quantification was performed using the EncyclopeDIA algorithm of Scaffold DIA. For each peptide, the four highest quality fragment ions were selected and quantified. Protein quantification values ​​were estimated from the sum of peptide quantification values.

[0118] (Peptidemodynamic analysis) Cecal contents were mixed with acetonitrile (ACN) containing 0.1% trifluoroacetic acid (TFA) and dried using a centrifugal evaporator. Acetone was added to the dried sample, and lipid-soluble low molecular weight compounds were extracted using a water bath sonicator. The sample was then centrifuged at 15,000 × g for 15 minutes at 4°C.

[0119] After removing the supernatant, 70% ACN-HCl was added to the precipitate, and the peptide was redissolved in a water bath sonicator. The mixture was then centrifuged at 15,000 × g for 15 minutes at 4°C. The supernatant was then transferred to a new tube and dried using a centrifugal evaporator. The dried sample was then redissolved in 100 mM Tris-HCl containing a protease inhibitor and treated with 10 mM dithiothreitol at 50°C for 30 minutes. Subsequently, it was alkylated with 30 mM iodoacetamide for 30 minutes at room temperature in the dark, and then acidified with 0.5% trifluoroacetic acid (final concentration). The acidified sample was desalted using Monospin C18 (GL Sciences).

[0120] The peptides were directly injected at 50°C into a 75 μm × 25 cm PicoFrit emitter (New Objective) packed in-house with C18 core-shell particles (CAPCELL CORE MP 2.7 μm, 160 Å, Osaka Soda), and then separated using an UltiMate 3000 RSLC nano LC system (Thermo Fisher Scientific) with a gradient at a flow rate of 100 nL / min for 90 minutes.

[0121] The peptides eluted from the column were analyzed by DDA-MS using a Q Exactive HF-X (Thermo Fisher Scientific). The MS1 spectrum was set to the target value of 3 × 10⁻⁶ for automated gain control (AGC). 6 To achieve this, data was collected in the 350-1500 m / z range with a resolution of 120,000.

[0122] 4.4 × 10 3 Thirty of the strongest ions with charge states exceeding 2+ to 5+ were fragmented by collision-induced dissociation with a normalized collision energy of 26% in data-dependent modes, and tandem mass spectra were acquired using an Orbitrap mass spectrometer with a mass resolution of 30,000 at 200 m / z. The AGC target was then processed into 1 × 10⁻¹⁶ AGC targets. 5 I set it to that.

[0123] The MS file was searched using PEAKS Studio for the mouse's UniProt reference proteome (Uniprot id UP000000589, review, canonical).

[0124] The search criteria included a precursor mass tolerance of 8 ppm, a fragment ion mass tolerance of 0.01 Da, the presence or absence of enzymes, carbamide methylation of immobilized modifications, and oxidation (M) of variable modifications. Peptides were identified by filtering to ensure a false detection rate of 1% or less.

[0125] (Western blot) Mouse fecal samples were suspended and diluted 50-fold with phosphate-buffered saline (PBS) supplemented with a protease inhibitor cocktail (Roche). The suspended samples were then centrifuged at 15,000 × g for 10 minutes at 4°C, and the supernatant was subjected to Western blotting. Mouse pancreatic tissue was rapidly frozen in liquid nitrogen, and proteins were extracted using TRIzol Reagent (Thermo Fisher Scientific), with the final protein concentration adjusted to 4 μg / μL. SDS-PAGE and blotting were performed using the Novex(R) NuPAGE(R) SDS-PAGE Gel system (Thermo Fisher Scientific) and iBlot. TM 2. The Dry Blotting System (Thermo Fisher Scientific) was used according to the manufacturer's instructions.

[0126] In some experiments, SDS-PAGE and PVDF film (0.2 μm Transfer Membranes Immobilon-PSQ, Merck Millipore) transfers were performed according to the manufacturer's instructions (XV PANTERA SYSTEM (DRC)).

[0127] For dyeing, use iBind TM We used Western Systems (Thermo Fisher Scientific).

[0128] The antibodies used were as follows: Rabbit anti-mouse PRSS2 antibody (Cosmo Bio), Rabbit anti-mouse HSP90 antibody (#4877, Cell Signaling Technology), Rabbit anti-human PRSS2 antibody (LS-B15726, LSBio), Rabbit anti-human PRSS1 antibody (LS-331381, LSBio), Rabbit anti-mouse TMPRSS2 antibody (LS-C373022, LSBio, against the sequence of the protease domain), Rabbit anti-6-His antibody (A190-214A, Bethyl laboratories), Goat anti-mouse IgAα chain antibody (HRP) (ab97235, Abcam), Rat anti-mouse κ chain antibody (HRP) (ab99632, Abcam), Rabbit anti-mouse CELA3b antibody (OACD03205, Avivasysbio), Anti-rabbit IgG antibody (HRP) (#7074, Cell Signaling Technology), Rabbit anti-mouse Reg3 antibody (51153-R005, Sino Biological).

[0129] Chemi-Lumi One (Nacalai Tesque) was used for the chemiluminescence assay, and Molecular imager(R)ChemiDoc TM XRS+ system (Bio-Rad) or iBright TM FL1500 was used.

[0130] (RT-qPCR) RNA from mouse pancreas was extracted using TRIzol Reagent (Thermo Fisher Scientific). The extracted RNA was converted to cDNA using ReverTra Ace(R)qPCR RT Master Mix with gDNA Remover (Toyobo).

[0131] RT-qPCR analysis was performed using Thunderbird SYBR qPCR Mix (Toyobo) and Lightcycler480 (Roche), and analyzed by the ΔΔCt method. GAPDH was used as the endogenous control. The nucleotide sequences of the primers used were as follows. GAPDH Forward primer: 5'-GTCGTGGAGTCTACTGGTGTCTTC-3' (SEQ ID NO: 35) GAPDH Reverse primer: 5'-GTCATATTTCTCGTGGTTCACACC-3' (SEQ ID NO: 36) PRSS2 Forward primer: 5'-TGTGACCCTCAATGCCAGAG-3' (SEQ ID NO: 37) PRSS2 Reverse primer: 5'-AGCACTGGGGCATCAACAC-3' (SEQ ID NO: 38)

[0132] (Immunofluorescence staining) Mouse colon tissue (including feces) was collected and fixed overnight at 4°C with Cornoy's solution (60% methanol, 30% chloroform, 10% glacial acetic acid). A Tissue Processor (Leica Microsystems) was used for paraffin embedding. Subsequently, the paraffin blocks were microtome-sectioned into thin sections (5.0 μm), the paraffin was removed, and immunostaining was performed.

[0133] The antibodies used for immunofluorescence were as follows: rabbit anti-PRSS2 antibody (LSBio), Alexa 488-labeled goat anti-rabbit IgG antibody (Thermo Fisher Scientific), 4'-6-diamidino-2-phenylindole (DAPI) (Dojin Chemical Laboratories), and rhodamine-labeled UEA1 (Ulex Europaeus Agglutinin 1, Vector Laboratories). For immunofluorescence imaging, a Leica AF600 and a confocal Leica TCS SP5 were used.

[0134] (Measurement of trypsin activity in mouse and human fecal samples) Mouse intestinal contents or fecal samples were diluted 500-fold (w / v) with 0.9% NaCl solution. Human feces were diluted 200-fold (w / v) with 0.9% NaCl solution. The diluted solutions were vortexed in a mini-shaker at 2,000 rpm for 20 minutes, homogenized by pipetting, and then centrifuged at 10,000 × g for 15 minutes at 4°C. Subsequently, the supernatant was collected, and trypsin activity was measured using the Trypsin Activity Assay Kit (Colorimetric) 100 test (ab102531) according to the manufacturer's protocol. Absorbance at 405 nm was measured in kinetic mode using a PerkinElmer 2030 Multilabel Reader.

[0135] (Establishment of human microbiome in GF mice) Human fecal samples were collected at RIKEN and Keio University in accordance with research protocols approved by the institutional review board. Informed consent was obtained from each subject. Human fecal samples (stored in 20% (v / v) glycerol) were transferred to an anaerobic chamber, thawed, sieved through a 100 μm mesh, transferred to a GF isolator, and administered orally to GF mice at a dose of 200 μL / mouse.

[0136] Antibiotic solutions of 0.5 g / L ampicillin (Nacalai Tesque), 0.5 g / L metronidazole (Nacalai Tesque), and 1.0 g / L tylosin (Sigma) were prepared using autoclaved tap water. Mice that had been orally administered fecal contents from donor C were given the antibiotic solutions for 12 days. The antibiotic solutions were changed once a week.

[0137] (Isolation and identification of colony-forming species from mouse fecal contents) Mouse intestinal contents were mixed with glycerol-containing (20%) PBS and stored in an anaerobic chamber at -80°C. The stock was then mixed with an equal volume of TS broth (BD) in the anaerobic chamber and plated onto the following different agar plates: EG, ES, M10, NBGT, VS, TS (BD), BL (Eiken Chemical), BBE (Kyokuto Pharmaceutical), Oxoid CM0619 (Thermo Fisher Scientific), CM0619-supplemented SR0107 (Thermo Fisher Scientific), CM0619-supplemented SR0108 (Thermo Fisher Scientific), mGAM (Nissui Pharmaceutical), and Schaedler (BD). After 2 days of incubation, colonies with different appearances were transferred to new EG plates. Subsequently, the colonies were cultured overnight in EGEF liquid medium, mixed with glycerol (final concentration 20% (v / v)), and stored at -80°C.

[0138] The EG (Eggerth Gagnon) agar medium was formulated as follows: Protease peptone No. 3 (10.0 g), yeast extract (5.0 g), Na2HPO4 (4.0 g), glucose (1.5 g), soluble starch (0.5 g), L-cysteine ​​HCl (0.5 g), L-cysteine ​​(0.2 g), Tween 80 (0.5 g), agar (4.8 g), horse meat extract (500 mL), water up to 1000 mL + defibrozed horse blood (50 mL). In the EGEF medium, the agar was removed and the defibrozed horse blood (50 mL) was replaced with Fildes solution (40 mL).

[0139] Next, bacterial DNA genomes were extracted from the isolated strains using the same protocol as for DNA isolation from feces. 16S rRNA was amplified by PCR using the KOD plus Neo kit (Toyobo) according to the manufacturer's protocol. Sanger sequencing was outsourced to Eurofins. The nucleotide sequences were compared with the NCBI database. The primer sequences for Sanger sequencing were as follows: F27 primer: 5'-AGRGTTTGATYMTGGCTCAG-3' (SEQ ID NO: 39) R1492 primer: 5'-TACGGYTACCTTGTTACGACTT-3' (SEQ ID NO: 40)

[0140] (Sequencing of 16S rRNA) Frozen mouse fecal samples were thawed, and 100 μL of suspension was mixed with 900 μL of TE10 (10 mM Tris-HCl, 10 mM EDTA) buffer containing RNase A (final concentration 100 μg / mL, Thermo Fisher Scientific) and lysozyme (final concentration 3.0 mg / mL, Sigma). The suspension was incubated at 37°C for 1 hour with gentle agitation. Purified achromopeptidase (Wako) was added to a final concentration of 2,000 units / mL, and the mixture was incubated at 37°C for another 30 minutes. Subsequently, sodium dodecyl sulfate (final concentration 1%) and proteinase K (final concentration 1 mg / mL, Nakarai) were added to the suspension, and the mixture was incubated at 55°C for 1 hour.

[0141] Next, the high molecular weight DNA was extracted with phenol:chloroform:isoamyl alcohol (25:24:1), precipitated with isopropanol, washed with 70% ethanol, and resuspended in 100 μL of TE.

[0142] PCR was performed using Ex taq (Takara). The primer sequences for amplifying the V1-V2 region of the 16S rRNA gene were as follows: 27Fmod primer:5'-AATGATACGGCGACCACCGAGATCTACACxxxxxxxxACACTCTTTCCCTACACGACGCTCTTCCGATCTAGRGTTTGATYMTGGCTCAG-3' (Sequence ID 41, where "xxxxxxxx" represents the Miseq (Illumina) index sequence.) )338R primer:5'-CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGCTGCCTCCCGTAGGAGT-3' (Sequence ID 42, where "xxxxxxxx" represents the Miseq (Illumina) index sequence.)

[0143] PCR products were purified using an Agentcourt AMPure XP (Beckman Coulter) according to the manufacturer's protocol. 16S rRNA libraries were prepared using the Kapa Library Quantification Kit (Kapa Biosystems) according to the manufacturer's protocol. 16S rRNA sequencing was performed using the standard protocol for the MiSeq Reagent kit ver3.

[0144] (Gnathobiotic experiment) Except for Phasolactobacterium faecium (3G4), the isolated strains were cultured in an anaerobic chamber at 37°C for 1-2 days. Phasolactobacterium faecium was cultured on Oxoid CM0619 agar plates with 80 mM sodium succinate for 2-3 days, and the colonies were collected and resuspended in EGEF. OD 600 Based on the values, the bacterial density was adjusted, and a mixture of cultured strains was orally administered to GF mice (150 μL / mouse, total bacterial count approximately 1-2 × 10⁶). 8 CFU).

[0145] To quantify P. clara DNA in feces, mouse fecal DNA was purified, and quantitative real-time PCR was performed using a LightCycler 480 System (Roche) with THUNDERBIRD SYBR qPCR Mix (Toyobo) to amplify sequences specific to the 16s rRNA gene of the P. clara strain. A standard curve was created from serial dilutions of the genomic DNA of the P. clara (JCM14859) strain. The base sequences of the primers used were as follows. 5'-CGTAGGAGTTTGGACCGTGT-3'(Sequence ID 43) 5'-GCATGGGAGCGACAAATAAA-3'(Sequence ID 44)

[0146] (Citrobacter rodentium (C. rodentium) infection) GF mice were orally inoculated with either 200 μL of 2-mix (B. uniformis and P. merdae) + P. clara (WT), 2-mix + P. clara (Δ00502), or 2-mix alone. After 14 days, the mice were infected by orally administering C. rodentium (150 μL / mouse) that had been cultured overnight, and were euthanized on day 7.

[0147] For histological analysis, the necks of mice were fixed with 4% paraformaldehyde and embedded in paraffin. The paraffin blocks were incised and stained with hematoxylin and eosin.

[0148] The severity of colitis was assessed by a gastroenterologist according to the following criteria: infiltration of inflammatory cells (score, 0-4), mucosal thickening (score, 0-4), goblet cell depletion (score, 0-4), crypt abscess (score, 0-4), and destruction of tissue structure (score, 0-4). The final histological score was defined as the sum of the scores for these parameters.

[0149] For the colony-forming unit (CFU) assay, cecal patches or cecal luminal contents were collected, homogenized in PBS, and then serially diluted homogenates were plated onto LB agar plates. After incubation overnight at 37°C under aerobic conditions, CFUs were counted.

[0150] For ex vivo evaluation of C. rodentium-specific IgA, cecal contents were resuspended in 5x (w / v) LB medium, centrifuged, and the supernatant was filtered through a sterile filter unit with a 0.22 μm pore size PVDF membrane. This supernatant was then mixed with an equal volume of C. rodentium culture medium cultured overnight in vitro. The mixture was incubated at room temperature for 1 hour with gentle shaking, and the agglutination effect was examined using a confocal microscope (Leica TCS SP8). Alternatively, after incubation, the mixture was centrifuged, washed once with PBS, and the bacterial pellet was lysed with 1% SDS solution (diluted with 50 mM Tris-HCl buffer supplemented with 5 mM EDTA). The lysates were stained by Western blotting with goat anti-mouse IgA α-chain antibody (HRP) (ab97235) to evaluate the relative amount of C. rodentium-binding (C. rodentium-specific) IgA in the fecal contents.

[0151] For the vaccine administration experiment, GF mice were pre-administered 200 μL of 2-mix (B. uniformis and P. merdae) + P. clara (WT) or 2-mix + P. clara (Δ00502). Four days later, the mice were given C. rodentium (10) inactivated with peracetic acid. 10 The mice were orally administered (150 μL / mouse) once a week for three weeks. After three weeks of immunization, the mice were infected with C. rodentium (150 μL / mouse) cultured overnight by oral administration and euthanized on day 14.

[0152] C. rodentium inactivated with peracetic acid was prepared as follows: C. rodentium cultured overnight was centrifuged (16,000 × g, 10 mins) and collected, then added to sterile PBS in a 100% per mL solution. 10 The pellet was resuspended at a density of 1.4%. Peracetic acid (240990, Sigma) was added to a final concentration of 0.4%, and incubated at room temperature for 1 hour. After washing three times with sterile PBS, the final pellet was added to PBS in 10 ml. 11The vaccine was resuspended at the final particle / mL concentration and stored at 4°C. Before use, 100 μL of inactivated vaccine was inoculated into 200 mL of LB medium and incubated overnight at 37°C to confirm complete inactivation.

[0153] (Infection with mouse hepatitis virus (MHV)) MHV-2 was provided by Makoto Ujiie (Nippon Veterinary and Life Science University). Five-week-old GF C57BL / 6N male mice were obtained from CLEA Japan or Sankyo Lab Service and housed in separate stainless steel isolators. GF ​​mice were orally administered 200 μL of 2-mix (B. uniformis and P. merdae) + P. clara (WT) or 2-mix + P. clara (Δ00502). Two weeks after inoculation, the mice were given 4.5 x 10⁶ doses. 6 Students were orally infected with PFU's MHV-2, and their survival rates were observed daily for 10 days.

[0154] To measure viral titer, liver and brain samples were collected on day 4 or 5 post-infection and homogenized using a DNA / RNA shield (Zymo Research). Viral RNA was extracted using the Quick-RNA Viral Kit (Zymo Research) according to the manufacturer's instructions, and cDNA was synthesized using ReverTra Ace (Toyobo) and random primers (Toyobo).

[0155] Quantitative real-time PCR was performed using a LightCycler 480 System (Roche) with THUNDERBIRD SYBR qPCR Mix (Toyobo) to amplify the orf1a gene. The relative amount of MHV was determined from a standard curve created from serial dilutions of MHV genome cDNA. The base sequences of the primers used were as follows. 5'-AAGAGTGATTGGCGTCCGTAC-3'(Sequence ID 45) 5'-ATGGACACGTCACTGGCAGAG-3'(Sequence No. 46)

[0156] (Trypsin degradation in vitro) Bacteria cultured overnight were incubated with recombinant mouse trypsin (final concentration 1 μg / mL) for 1 hour or with human trypsin (final concentration 20 μg / mL) for 4 hours. The recombinant trypsin isoforms used were recombinant mouse PRSS2 (50383-M08H, Sino Biological), recombinant human PRSS1 (LS-G135640), recombinant human PRSS2 (LS-G20167), and recombinant human PRSS3 (His-tag) (NBP2-52220).

[0157] In some experiments, recombinant PRSS2 mice were treated for 30 minutes with one of the following trypsin inhibitors before incubation with P. clara culture medium: AEBSF (Sigma, final concentration 2 mM), leupeptin (Sigma, final concentration 100 μM), or TLCK (Abcam, final concentration 100 μM).

[0158] In some experiments, P. clara was cultured overnight in the presence of tunicamycin (Sigma, final concentration 10 μg / mL), 2-fluoro-L-fucose (Cayman Chemical, final concentration 250 μM), or the corresponding DMSO control before incubation with recombinant mouse PRSS2.

[0159] Ca 2+ In experiments to evaluate the effects, 1 mM Ca was added before incubation with recombinant mouse PRSS2. 2+ Low calcium levels with or without supplementation 2+ P. clara was cultured in mGAM medium. In experiments using the P. clara supernatant, P. clara cultured overnight was filtered using a sterile filter unit with a PVDF membrane having a pore size of 0.22 μm.

[0160] (Confocal microscope) Recombinant mouse PRSS2 on Alexa Fluor TM Using the 488 Antibody Labeling Kit (A20181, ThermoFisher) to label Alexa Fluor TMThe samples were labeled with 488 and pretreated with an AEBSF inhibitor (150 μg / mL rmPRSS2 with 20 mM AEBSF).

[0161] Alexa Fluor TM Mouse PRSS2 labeled with 488 was incubated with bacteria cultured at a final concentration of 5 μg / mL in an anaerobic chamber for 20 minutes. The mixture was centrifuged, washed once with PBS, and then resuspended in PBS. Confocal imaging was performed using a Leica TCS SP8 confocal microscope.

[0162] (Disucine imimidyl sulfoxide (DSSO) crosslinking) DSSO (A33545) was purchased from Thermo Fisher Scientific. P. clara (1C4) strains cultured overnight were incubated with recombinant PRSS2 mice treated with AEBSF for 20 minutes, washed once with PBS, and then resuspended in 10 mM DSSO. After incubation at room temperature for 10 minutes, the reaction was stopped by adding Tris-HCl buffer (final concentration 20 mM).

[0163] After washing with PBS, the pellet was dissolved in 1% SDS solution (diluted with 50 mM Tris-HCl buffer with 5 mM EDTA). Only the P. clara (1C4) strain (without incubation with PRSS2) was treated similarly and used as a negative control. The supernatant was stained with rabbit anti-6-His antibody (A190-214A, Bethyl Laboratories) and anti-rabbit IgG antibody (HRP) (#7074, Cell Signaling Technology) and analyzed by Western blotting.

[0164] (Whole cell lysate, supernatant, protein staining of glycosylated proteins) P. clara (1C4) strains were cultured overnight in the presence of tunicamycin (Sigma, final 10 μg / mL), 2-fluro-L-fucose (Cayman Chemical, final 250 μM), or the corresponding DMSO control. The cultured bacteria were then pelletized, washed once with PBS, and dissolved in 1% SDS solution (diluted in 50 mM Tris-HCl buffer with 5 mM EDTA). SDS-PAGE was performed using the Novex(R) NuPAGE(R) SDS-PAGE Gel system (Thermo Fisher Scientific). Proteins containing glycans were analyzed using Pro-Q. TM Staining was performed using the Emerald 300 Glycoprotein Gel and Blot Stain Kit (ThermoFisher) according to the manufacturer's protocol. Proteins from whole cell lysates were stained with the Colloidal Blue Staining Kit (Thermo Fisher Scientific). Proteins from the supernatant were concentrated using Amicon Ultra Centrifugal Filters (10kD NMWL) and then stained with the Colloidal Blue Staining Kit (Thermo Fisher Scientific).

[0165] (Mutant generation) Deletion mutants of the P. clara (JCM14859) strain (Δ03049~03053, Δ000502, and Δ000509) were prepared as follows: First, a 1kb sequence flanking the coding region was amplified by PCR and incorporated into the suicide vector pLGB30 using HiFi DNA Assembly (NEB) according to the manufacturer's protocol. Subsequently, 1 μL of each reaction solution was transformed into electro-competent Escherichia coli S17-1 λpir.

[0166] Next, the transformants were conjugated with P. clara (JCM14859) strain as follows. The donor and recipient strains were then subjected to OD in LB medium and EGEF medium, respectively. 600The cultures were adjusted to a ratio of 0.5 and mixed in a 1:1 ratio. This mixture was dropped onto an EGEF agar plate and incubated aerobically at 37°C for 16 hours. Subsequently, conjugated organisms were selected on an EGEF agar plate containing tetracycline (10 μg / mL). The conjugated organisms were partially sensitive to rhamnose-induced ss-bfe1 toxin expression and their growth was inhibited in the presence of 10 mM rhamnose (overnight OD). 600 (~0.3). Subsequently, to select the disappearance of plasmids from the genome by a second crossover, the complete conjugated organisms were cultured for at least three generations in EGEF broth supplemented with 10 mM rhamnose until the complete conjugated organisms lost out to the regenerated organisms (overnight OD). 600 (The value reached ~1.0). Subsequently, bacterial cultures were performed, single colonies were collected, and normal deletions were confirmed by PCR.

[0167] A homologous sequence of approximately 0.5–1 kb in the coding region was incorporated into the suicide vector pLGB30, and electrocompetent Escherichia coli S17-1 strain was transformed. Insertion mutants were then created using the same procedure.

[0168] Transformants were conjugated with P. clara (JCM14859) strain using the same protocol. Completely conjugated individuals were selected on EGEF agar plates containing tetracycline (10 μg / mL), confirmed by PCR, and maintained in EGEF broth supplemented with tetracycline (10 μg / mL). The nucleotide sequences of all primers used to create mutants are shown in Tables 1-5 below.

[0169] [Table 1]

[0170] [Table 2]

[0171] [Table 3]

[0172] [Table 4]

[0173] [Table 5]

[0174] (Transmission electron microscope (TEM)) Wild-type (WT) or Δ00502 P.clara (JCM14589) strains were incubated with recombinant mouse PRSS2 (50383-M08H, Sino Biological, final concentration 5 μg / mL) for 20 minutes, washed with PBS, and fixed at room temperature for 2 hours using a 4% paraformaldehyde-1% glutaraldehyde solution. After washing with 0.05 M PBS, the pellets were dehydrated in stages with ethanol (50%, 70%, 80%, 90%, 95%, 100%). The dehydrated pellets were impregnated with LRW resin (1:1 ethanol and LRW for 1 hour, then 1:2 ethanol and LRW overnight, and finally 100% LRW for 5 hours). After impregnation, the samples were cured in gelatin capsules (53°C, 24 hours). Polymerized LRW blocks were dissected with a Leica Ultracut UCT to obtain 80 nm sections.

[0175] For immunogold staining, sections were first blocked with 0.05 M PBS supplemented with 1% BSA, and then stained with rabbit anti-6-His antibody (A190-214A, Bethyl Laboratories) for 60 minutes. After washing with 0.05 M PBS, sections were stained with 12 nm colloidal gold-labeled goat anti-rabbit IgG antibody for 60 minutes. After washing again with 0.05 M PBS, sections were fixed with 1% glutaraldehyde dissolved in 0.05 M PBS, washed with water, and then stained with uranyl acetate for 5 minutes. All images were taken with a JEOL JEM-1400 transmission electron microscope.

[0176] (Recombinant protein expression and binding to magnetic microbeads) To produce recombinant 00502 and recombinant 00509 proteins, the coding regions of the genes for both proteins (excluding the N-terminal sequence encoding the signal peptide) were cloned into the expression vector pET-28b(+)(#69865, Novagen), and a His tag was introduced at the C-terminus according to the supplier's protocol.

[0177] Next, the expression vector was transformed into Rosetta-gami B(DE3) competent cells (#71136, Novagen). Subsequently, the transformants were grown exponentially, and protein expression was induced by adding 0.4 mM IPTG (I6758, Sigma). After culturing overnight at 25°C, B-PER was performed. TM Cells were lysed using Bacterial Protein Extraction Reagent (#78243, Thermo Fisher Scientific), and Pierce TM Ni-NTA Magnetic Agarose Beads (#78605, Thermo Fisher Scientific) and Pierce TM Recombinant proteins 00502 and 00509 were prepared using Polyacrylamide Spin Desalting Columns (#89849, Thermo Fisher Scientific).

[0178] Next, purified recombinant 00502 protein, recombinant 00509 protein, or bovine serum albumin (#23209, Thermo Fisher Scientific) is processed using Dynabeads. TM Using the Antibody Coupling Kit (14311D, Thermo Fisher Scientific), following the manufacturer's protocol, micromagnetic beads (Dynabeads) TM It was bound to ). 15 μg of protein was added per 1 mg of beads.

[0179] Next, 1 mg of protein-bound Dynabeads TMThe Alexa Fluoride was resuspended in 200 μL of EGEF medium and pretreated with recombinant mouse PRSS2 (final concentration 3 μg / mL) and AEBSF. TM The recombinants were mixed with 488-labeled mouse PRSS2 (final concentration 5 μg / mL) or 50 μL of GF cecal contents (50-fold dilution in PBS). The nucleotide sequences of all primers used to prepare the recombinants are shown in Table 6 below.

[0180] [Table 6]

[0181] (Protease activity assay) Pierce TM Using the Fluorescent Protease Assay Kit (#23266, Thermo Fisher Scientific), the protease activity of P. clara culture medium, P. clara culture supernatant, recombinant 00502 protein, and recombinant 005009 protein was measured according to the manufacturer's protocol.

[0182] Using a PerkinElmer 2030 Multilabel Reader equipped with fluorescein excitation and emission filters (485 / 538 nm), we detected the increase in total fluorescence due to the digestion of the FITC-casein substrate into smaller fluorescein-labeled fragments. Protease activity was measured as a change in relative fluorescence units (RFU).

[0183] (Metagenomic analysis of human stool samples from a publicly released cohort) Metagenomes obtained from human stool samples of the PRISM, HMP2, FHS, 500FG, CVON, and Jie cohorts were de novo assembled into a non-redundant gene catalog, and their relative abundances were quantified by grouping them into metagenomic species using MSPminer.

[0184] To search the gene catalog for homologs of the P. clara and P. xylanphila strain genes at the trypsin-related locus containing the genes encoding the 00502 protein and the 00509 protein, as well as six other neighboring genes, we used USEARCH ublast (at protein level), retaining hits with a minimum e-value of 0.1. As a result, we confirmed in the gene catalog that all eight genes are present in each strain.

[0185] To identify additional putative homologs and species encoding this locus, we first evaluated the similarity between the corresponding homologs of the P. clara and P. xylanphila strains, and set the minimum identity (Id) and coverage (Cov) thresholds for ublast hits for each gene at the locus as follows: 00502: Id=25%, Cov=90%. 00503: Id=70%, Cov=90%. 00504: Id=60%, Cov=90%. 00505: Id=60%, Cov=90%. 00506: Id=50%, Cov=90%. 00507: Id=25%, Cov=90%. 00508: Id=45%, Cov=80%. 00509: Id=20%, Cov=30%.

[0186] Next, we evaluated which other metagenomic species (MPS) encode homologs of the 00502-00509 genes in the P. clara and P. xylanphila strains, identifying MSP 0355 and MSP 0305, which have 8 and 7 homologs, respectively. While MSP 0355 and MSP 0305 were previously annotated only in the Bacteroidetes phylum, we now used ublast to compare their proteomes with the Integrated Human Gastrointestinal Genome (UHGG) collection. As a result, MSP 0355 and MSP 0305 were annotated as GUT_GENOME 140082 and GUT_GENOME 016875, respectively, and the majority of the genes (>90%) were found to have high reliability (median amino acid identity >99% and e value <1×e). -184In UHGG, both were mapped to a single species representative of the UHGG. In UHGG, both were phylogenetically classified as the species Paraprevotella.

[0187] (statistics) All statistical analyses were performed using GraphPad Prism software (GraphPad Software, Inc.). One-way ANOVA with Tukey's test was used for multiple comparisons. For comparisons between two groups, the Mann-Whitney U test (non-parametric) or paired t-test (parametric) with Welch's correction was used. Spearman's rank correlation was used to examine the correlation between two variables. The log-rank (Mantel-Cox) test was used for survival analysis.

[0188] [Experimental Example 1] (Regulation of colonic trypsin by the microbiome) To investigate the influence of gut microbiota on protein distribution in the large intestine, cecal contents were collected from germ-free (GF) mice and specific pathogen-free (SPF) mice, and proteomic analysis was performed using mass spectrometry. Of the 713 host-derived proteins detected, 324 were found to be present in higher levels in SPF mice than in GF mice (>2-fold, p<0.05). These included immune-related molecules such as α-defensin 21 (Defa21) and peptidoglycan-recognizing protein 1 (Pglyrp1). On the other hand, GF mice had 45 more proteins than SPF mice (>2-fold, p<0.05).

[0189] Figure 1 shows the results of proteomics analysis. Figure 1 shows proteins whose expression levels were increased in the cecum of GF mice compared to SPF mice. Among these, we focused on anionic trypsin protease (encoded by the Prss2 gene). The level of anionic trypsin protease (PRSS2) was significantly elevated in the cecal contents of GF mice.

[0190] Figure 2 is a graph showing the results of trypsin activity testing of feces from SPF and GF mice. Figure 3 is a photograph showing the results of Western blot analysis of feces from SPF and GF mice to detect anionic trypsin protease (PRSS2). Figure 4 is a fluorescence micrograph showing the results of immunostaining of colon sections of SPF and GF mice to detect mucus (UEA1) and anionic trypsin protease (PRSS2). Cell nuclei were also stained with DAPI.

[0191] As a result, the trypsin activity tests of feces from SPF and GF mice, Western blot analysis of feces from SPF and GF mice, and immunohistochemical staining of colon sections were similar to the results of the proteomics analysis. It was revealed that GF mice had a higher amount of anionic trypsin protease in their cecal contents and feces compared to SPF mice. Hereafter, anionic trypsin protease may simply be referred to as trypsin.

[0192] Trypsin is produced in the pancreas as an inactive precursor (trypsinogen), which is then secreted into the duodenum and activated by enteropeptidase. Therefore, we investigated trypsinogen expression in the pancreas of GF mice and SPF mice. The results showed that the mRNA and protein levels of PRSS2 in the pancreas were equivalent between GF and SPF mice. This result ruled out the possibility that the difference in trypsin levels observed in the colon was due to differences in pancreatic production.

[0193] Next, we examined intraluminal trypsin activity in different locations in the small and large intestines of GF mice and SPF mice. Figure 5 is a graph showing the results of measuring trypsin activity in the jejunum, ileum, cecum, large intestine, and feces. In Figure 5, "ns" indicates no significant difference, and "*" indicates a significant difference at p<0.05.

[0194] The results revealed that SPF mice and GF mice had similar levels of trypsin up to the distal end of the small intestine. On the other hand, in the large intestine, SPF mice had significantly lower trypsin activity compared to GF mice, revealing that the microbiome plays an important role in regulating trypsin in the large intestine.

[0195] [Experimental Example 2] (Identification of Paraprevotella strains that can promote trypsin degradation) While it had been previously reported that the intestinal microbiome inactivates pancreatic proteases, the bacteria involved in this process remained unidentified. Therefore, we attempted to isolate and identify bacteria that reduce trypsin from the human microbiome.

[0196] First, fecal samples collected from six healthy Japanese donors (Donors A-F) were administered to GF mice. Subsequently, trypsin activity in the feces of the GF mice was measured. Figure 6 is a graph showing the results of fecal trypsin activity measurements in GF mice administered with fecal samples collected from each healthy donor (A-F). In Figure 6, "ns" indicates no significant difference, and "***" indicates a significant difference at p<0.001.

[0197] The results revealed that the human fecal samples examined varied in their ability to reduce fecal trypsin activity in mice. Specifically, mice administered with the microbiome of donor B did not experience a decrease in fecal trypsin activity, while mice administered with the microbiomes of donors C, D, E, and F showed a significant decrease in fecal trypsin activity.

[0198] Next, mice administered the microbiome of donor C (mouse C#5) were selected, and their cecal contents were collected. Furthermore, these cecal contents were orally administered to new GF mice (GF+C#5 mice). To narrow down the microbiome, the GF+C#5 mice were divided into four groups, and each group was administered ampicillin (Amp), metronidazole (MNZ), tylosin (Tyl), or a control (no antibiotics, No Abx) via drinking water. Trypsin activity in the feces of each group was measured over time.

[0199] Figure 7 is a graph showing the results of fecal trypsin activity measurements for mice in each group. In Figure 7, "ns" indicates no significant difference, and "***" indicates a significant difference at p<0.001. As a result, fecal trypsin activity decreased within a few days in GF+C#5 mice that were not treated with antibiotics. Notably, fecal trypsin activity decreased more significantly in the Amp-treated group, while the decrease in fecal trypsin activity was absent in the MNZ-treated or Tyl-treated groups. These results indicate that the C#5 microbiome contains bacteria that reduce trypsin activity, which are concentrated in the Amp-treated group and reduced in the MNZ or Tyl-treated groups.

[0200] One Amp-treated mouse (mouse C5-Amp#5) was tracked, its cecal contents were collected, and cultured in vitro under anaerobic conditions using various media. Subsequently, 432 distinct colonies were isolated, and the nucleotide sequence of the 16S rRNA gene was analyzed, resulting in 35 unique strains. These 35 strains broadly covered the bacterial species colonized in C5-Amp#5 mice. When a mixture of the 35 isolated strains (35-mix) was administered to GF mice (GF+35-mix), fecal trypsin activity was significantly reduced, a reduction comparable to that observed in mice colonized with the original donor C's microbiome.

[0201] Next, to narrow down the effector bacteria, the 16S rRNA gene sequences of fecal samples obtained from the antibiotic administration test described above were analyzed, and Spearman's rank correlation test was performed to evaluate the relationship between the relative abundance of each of the 35 strains and the decrease in trypsin activity. As a result, 14 of the 35 strains showed a negative correlation with trypsin activity (ρ≦-0.3).

[0202] Next, we created gnotobiotic mice and compared the effects of these 14 bacteria with the remaining 21 bacteria. As a result, GF+14-mix mice showed a strong reduction in fecal trypsin activity, similar to that of GF+35-mix mice, while GF+21-mix mice did not show a reduction in activity. Subsequently, we further selected 9 strains from this 14-mix that were significantly associated with a reduction in trypsin activity (ρ≦-0.5, p<0.05).

[0203] Colonization of GF mice with 9-mix showed a potent reduction in fecal trypsin activity, similar to that observed in mice colonized with 14-mix. Ultimately, 9-mix was divided into 3-mix, consisting of Bacteroidales species, and 6-mix, consisting of non-Bacteroidales species.

[0204] A 3-mix consisting of Paraprevotella clara (P.clara, strain ID:1C4), Bacteroides uniformis (B.uniformis, strain ID:3H3), and Parabacteroides merdae (P.merdae, strain ID:1D4) was found to be necessary and sufficient for reducing fecal trypsin activity in vivo, while six non-Bacteroidales mixes had no effect whatsoever on reducing fecal trypsin activity.

[0205] To identify bacteria that degrade trypsin, each strain of the 9-mix was incubated with recombinant mouse trypsin (rmPRSS2, with added C-terminal His-tag), and trypsin degradation was measured by Western blotting.

[0206] Figure 8 is a photograph showing the results of a Western blot. The results showed that only P. clara (strain ID: 1C4) reduced trypsin. Consistent with this, the mixture of B. uniformis 3H3 and P. merdae 1D4 (3-mix with P. clara (1C4) removed) or the 34-mix did not show any ability to reduce fecal trypsin activity in vivo.

[0207] Based on the above, contrary to our initial hypothesis that a community of microbiota is necessary for the reduction of trypsin activity, we concluded that a single P. clara(1C4) is necessary for the reduction of trypsin activity.

[0208] Next, recombinant human trypsin isoforms PRSS1, PRSS2, and PRSS3 (rhPRSS1-3) were mixed with P. clara (1C4) and incubated, and the degradation of human trypsin was analyzed by Western blotting.

[0209] Figure 9 is a photograph showing the results of a Western blot. In Figure 9, "-" indicates that P. clara was not added, and "+" indicates that P. clara was added. The results revealed that P. clara can promote the reduction of three known human trypsins (PRSS1 and PRSS2, and to a lesser extent, PRSS3) in addition to mouse trypsin.

[0210] Next, we investigated whether the effect of P. clara on reducing trypsin activity was strain-specific. Specifically, recombinant mouse PRSS2 (rmPRSS2) was incubated in vitro with Paraprevotella or Prevotella strains, and the degradation of rmPRSS2 was analyzed by Western blotting. Paraprevotella strains used were P. clara (JCM14859, P237E3b, P322B5) and P. xylaniphila (JCM14860, 82A6). Prevotella strains used were Prevotella copri, Prevotella denticola, Prevotella stercorea, and Prevotella oulorum. Figure 10 shows a photograph of the Western blotting results. In Figure 10, "*" indicates the location of the cleaved PRSS2 fragments detected by the anti-PRSS2 antibody.

[0211] Paraprevotella is a recently identified genus of Prevotellaceae that includes only two species: P. clara and Paraprevotella xylaniphila. Therefore, we examined the P. xylaniphila (JCM14860) and P. xylaniphila (82A6) strains isolated from fecal samples of healthy humans.

[0212] As a result, it was revealed that three other P. clara strains (JCM14859, P237E3b, P322B5) isolated from fecal samples taken from healthy individuals, including non-Japanese donors, all shared the effect of reducing trypsin levels. Furthermore, it was found that both the P. xylaniphila (JCM14860) and P. xylaniphila (82A6) strains exhibited potent trypsin-reducing abilities similar to those of the P. clara strains.

[0213] On the other hand, bacteria of the genus Prevotella (Prevotella copri, Prevotella denticola, Prevotella stercorea, and Prevotella oulorum), which are phylogenetically close to Paraprevotella, all did not reduce trypsin activity.

[0214] These results indicate that bacteria of the genus Paraprevotella are representative components of the human microbiota with trypsinolytic ability.

[0215] [Experimental Example 3] (Autolysis of Trypsin by Type IX Secretion Machinery-Dependent Polysaccharide (Polysaccharide) Binding Molecule) The substrate specificity of P. clara was investigated. Specifically, GF mouse cecal contents containing a large amount of trypsin together with various proteins were incubated ex vivo with P. clara (1C4). Subsequently, the abundance of peptides derived from each protein was examined by peptidome analysis using LC-MS. As a result, among 7614 peptides derived from 276 proteins, trypsin was the only protein that showed a pattern in which the peptide concentration clearly increased with time in the presence of P. clara.

[0216] These results indicate that P. clara has a narrow substrate specificity and high activity against trypsin. Also, when examining the reaction rate of trypsin degradation by P. clara, it became clear that the reaction occurs gradually stoichiometrically.

[0217] Also, trypsin degradation mediated by P. clara requires a sufficient amount of divalent cations (e.g., Ca 2+This degradation occurred only in the presence of [the substance]. Therefore, it became clear that this degradation was mediated by an enzyme (protease). However, this degradation was not observed when trypsin was incubated with the culture supernatant of P. clara. Furthermore, when live P. clara or filtered P. clara supernatant was incubated with a protease substrate (flurocein-labeled casein), no proteolytic activity was detected.

[0218] Figure 11 shows a photograph of the results of Western blotting analysis of rmPRSS2 degradation in recombinant mouse PRSS2 (rmPRSS2) after pretreatment with a protease inhibitor and incubation with P. clara (1C4). The results revealed that pretreatment with the serine protease inhibitors AEBSF or leupeptin, and further with the specific trypsin inhibitor TLCK, eliminated the trypsin-degrading ability of P. clara. This result indicates that trypsin degradation by P. clara is mediated by trypsin-dependent autodigestion.

[0219] Next, to elucidate the mechanism by which P. clara promotes trypsin autodigestion, trypsin was labeled with Alexa Fluor 488, and the interaction between trypsin and P. clara was visualized. Figure 12 shows photographs of the results of observing the binding of rmPRSS2 to the bacterial surface using a confocal microscope after incubation of P. clara (1C4) and two Prevotella species, P. denticola and P. oulorum, respectively, with Alexa Fluor 488-labeled rmPRSS2. In Figure 12, the black squares show magnified images of P. clara (1C4).

[0220] As a result, it was observed that fluorescently labeled trypsin accumulated on the surface of P. clara within a few minutes. On the other hand, no trypsin accumulation was observed in P. denticola and P. oulorum. From this, it was thought that trypsin degradation occurs on the surface of P. clara via trypsin-binding surface molecules, and that these trypsin-binding surface molecules promote trypsin accumulation and autodigestion.

[0221] Next, to identify the trypsin-binding surface molecule of P. clara, the molecules were treated with disucine-imidyl sulfoxide (DSSO) as a chemical crosslinking agent to capture the complex between trypsin (His-tag rmPRSS2) and P. clara-derived molecules. Subsequently, the crosslinked complex between rmPRSS2 and P. clara-derived molecules was analyzed by Western blotting.

[0222] As a result, DSSO treatment revealed a new high-molecular-weight (~250 kDa) band that was blotted with anti-His-tag antibody. This band indicates the presence of a high-molecular-weight complex containing trypsin.

[0223] Although our available mass spectrometry equipment lacked sufficient sensitivity to detect the crosslinked peptides originating from this complex, a smear-like band around 250 kDa indicated that trypsin was interacting with heterogeneous molecules.

[0224] Bacteroidetes, including Paraprevotella, are known to have glycan complexes modified on their cell surface. Therefore, it was hypothesized that glycan-containing molecules present on the surface of P. clara are involved in trypsin binding and degradation.

[0225] To investigate this hypothesis, we used inhibitors that target glycosylation in P. clara. First, we treated P. clara with tunicamycin, an inhibitor that targets WecA-like transferase, which mediates the first step in O-glycan formation of bacterial lipopolysaccharides (LPS).

[0226] Figure 13 shows the results of Western blotting analysis of rmPRSS2 degradation after incubation of P. clara (1C4) pretreated with tunicamycin (Tuni.) or vehicle control with rmPRSS2. The results revealed that no trypsin degradation was observed in P. clara treated with tunicamycin.

[0227] Figure 14 shows photographs of confocal microscopy observations of rmPRSS2 binding to the bacterial surface after incubation with Alexa Fluor 488-labeled rmPRSS2 in P. clara (1C4) treated with tunicamycin and P. clara (1C4) that was not treated with tunicamycin. In Figure 14, "Tunicamycin(+)" indicates the result after tunicamycin treatment, and "Tunicamycin(-)" indicates the result after no tunicamycin treatment. As a result, it was revealed that trypsin did not accumulate on the surface of P. clara treated with tunicamycin. Similarly, when P. clara was treated with 2-fluoro-L-fucose (2F-Fuc), a fucose transferase inhibitor that broadly inhibits the synthesis of fucose-containing glycans, both the binding of trypsin to the P. clara surface and the degradation of trypsin were inhibited.

[0228] T9SS (Type IX secretion mechanism) is a bacterial mechanism that works in conjunction with the Sec system to transport proteins with a conserved C-terminal domain across the outer membrane to the cell surface. T9SS plays a role in removing the C-terminal domain through protease activity, such as sortase, and then binding the transported protein to polysaccharides on the cell surface.

[0229] The inventors hypothesized that cell surface proteins secreted by T9SS are responsible for trypsin recruitment and degradation, and conducted the following investigations. First, they identified gene sequences in the genomes of P. clara and P. xylaniphila that are presumed to be included in T9SS.

[0230] Figure 15 is a schematic diagram showing the alignment of the T9SS gene composition in the genomes of P. clara (JCM14859), P. xylaniphila (JCM14860), and P. gingivalis (ATCC33277).

[0231] Next, a mutant P. clara (JCM14859) strain lacking the expression of PorU, a basic component of T9SS, was created by homologous recombination of the plasmid sequence. Figure 16 is a schematic diagram illustrating homologous recombination that eliminates PorU expression.

[0232] Figure 17 shows the results of Western blotting analysis of rmPRSS2 degradation after incubation of mutant P.clara (JCM14859) with rmPRSS2. In Figure 17, "PorU mutant" indicates the result for mutant P.clara (JCM14859), and "WT" indicates the result for wild-type P.clara (JCM14859). The results revealed that trypsin degradation was completely lost in mutant P.clara (JCM14859), indicating that T9SS-dependent surface proteins are involved in trypsin degradation.

[0233] Next, to identify cell surface proteins that have an effect on trypsin degradation, proteomic analysis was performed on P. clara culture supernatant in the presence or absence of tunicacamycin. As a result, 20 bacterial-derived proteins were found in tunicacamycin-treated P. clara culture supernatant.

[0234] Therefore, a series of mutant P. clara strains in which the synthesis of tunicamycin-sensitive protein was inhibited were created by introducing plasmid sequences into 20 target gene loci, or by removing gene clusters (Δ03048~03053).

[0235] Figure 18 is a photograph showing the results of Western blot analysis of rmPRSS2 degradation through wild-type (WT) P. clara (JCM14859) or a series of mutant P. clara (JCM14859). In Figure 18, "Δ03048~03053" indicates the results of mutant P. clara with the gene cluster removed, and "00029", "00890", "00822", "00342", "00104", "03191", "00502", "02199", "00472", "01041", "00823", "00729", "00935", "01686", "03166", "00509", "00002", "PorU", "WecA" respectively indicate the results of mutant P. clara in which the described genes were deleted by plasmid insertion.

[0236] As a result, it was revealed that by disrupting the gene encoding the 00502 protein (UniProtKB ID: G5SNC9, outer membrane protein related to Omp28) or the 00509 protein (UniProtKB ID: G5SNC1, protein with unknown function), trypsin degradation in vitro disappeared, similar to the PorU or WecA (target factor of tunicamycin) - deficient mutant strains.

[0237] Subsequently, instead of the insertion mutants, P. clara strains (Δ00502 and Δ00509) lacking the 00502 protein or the 00509 protein were prepared and the same examination was conducted.

[0238] Figure 19 is a photograph showing the results of incubating Δ00502 and Δ00509 with Alexa Fluor 488 - labeled rmPRSS2 respectively and observing the binding of rmPRSS2 to the bacterial surface by confocal microscopy. As a result, it was revealed that the recruitment of trypsin was deleted in both the Δ00502 strain and the Δ00509 strain.

[0239] Figure 20 shows the results of Western blotting analysis of rmPRSS2 degradation after incubation of strains Δ00502 and Δ00509 with rmPRSS2. In Figure 20, "WT" indicates the result for wild-type P. clara (JCM14859). The results revealed that trypsin degradation was lost in both strains Δ00502 and Δ00509.

[0240] Next, the genome sequences of Paraprevotella strains were analyzed. Figure 21 is a schematic diagram showing the genome sequence of Paraprevotella strains. As a result, it was revealed that all strains with trypsin-degrading ability possessed the 00502 and 00509 genes. In contrast, none of the Prevotella species examined had homologs of the 00502 and 00509 genes.

[0241] Furthermore, the 00503-00508 genes were conserved in Paraprebotella strains at locations distant from the loci of the 00502 and 00509 genes. Figure 22 shows the results of Western blotting analysis of rmPRSS2 degradation in P.clara mutants lacking each of the 00502-00509 genes after incubation with rmPRSS2. The results showed that the P.clara mutants lacking the 00503-00508 genes possessed trypsin degradation activity, thus ruling out their involvement in the trypsin degradation process.

[0242] [Experimental Example 4] (Study of proteins 00502 and 00509) Recombinant 00502 and 00509 proteins were prepared. Escherichia coli containing an expression vector for either 00502 or 00509 protein was treated with isopropyl-β-thiogalactopyranoside (IPTG) to induce recombinant protein expression, and the expressed recombinant 00502 or 00509 protein was purified from the cell lysate using magnetic agarose beads.

[0243] Figure 23 is a graph showing the results of measuring the protease activity of recombinant 00502 or 00509 protein by cleavage of FITC-labeled casein. Trypsin (1 ng / μL) was used as a positive control. In Figure 23, (-) indicates that no protein was added. Protease activity is expressed as a change in relative fluorescence units. As a result, it was revealed that recombinant 00502 and 00509 proteins do not possess protease activity.

[0244] Figure 24 is a photograph showing the results of Western blotting analysis of rmPRSS2 degradation after incubation with rmPRSS2 using free recombinant 00502 and 00509 proteins, or recombinant 00502 and 00509 proteins bound to microbeads.

[0245] Figure 25 shows a photograph of the binding state between rmPRSS2 and protein-binding beads observed using a confocal microscope after incubation of microbeads containing recombinant 00502 protein, recombinant 00509 protein, and bovine serum albumin (BSA) with rmPRSS2. The scale bar is 5 μm. BSA was used as a negative control.

[0246] As a result, it was revealed that free 00502 and 00509 proteins did not exhibit trypsin degradation activity. On the other hand, recombinant 00502 protein bound to microbeads showed effective recruitment and degradation of trypsin.

[0247] Figure 26 shows photographs of Western blotting analysis of ex vivo trypsin degradation after 24 or 48 hours of incubation of cecal contents of GF mice with culture medium control (-) or recombinant 00502 protein conjugated to microbeads. In Figure 26, "*" indicates the location of cleaved PRSS2 fragments detected by the anti-PRSS2 antibody. The results showed significant trypsin degradation by recombinant 00502 protein conjugated to microbeads.

[0248] These results support the inventors' model in which the 00502 protein acts as a scaffold for trypsin binding and promotes trypsin autolysis. Furthermore, it was revealed that trypsin effectively bound to the recombinant 00509 protein attached to microbeads, but trypsin degradation did not occur.

[0249] These results suggest that the 00502 protein is a major component that exerts trypsin recruitment and autodigestion effects, while the 00509 protein plays a supporting role in trypsin recruitment.

[0250] Figure 27 shows the inventors' proposed model of trypsin degradation mediated by Paraprevotella bacteria. In Figure 27, "Sec" indicates the Sec system, in which proteins are exported across the cytoplasmic membrane.

[0251] As shown in Figure 27, the 00502 and 00509 proteins are transported across the extracellular membrane of Paraprevotella via the type IX secretion mechanism (T9SS). PorU is a fundamental T9SS component that degrades the C-terminal domain (CTD) of T9SS-dependent proteins, linking them to LPS molecules in Paraprevotella bacteria. WecA mediates the initial step in LPS O-glycan synthesis, and disruption of WecA function, for example by tunicamycin treatment, leads to the release of T9SS-dependent proteins. The 00502 protein acts as a major effector component for trypsin recruitment and autodigestion. The 00509 protein, on the other hand, assists in trypsin recruitment.

[0252] The exact mechanism by which the 00502 protein, rather than the 00509 protein, promotes trypsin autodigestion is still unknown. However, it is speculated that the binding of trypsin to the 00502 protein alters the structure of trypsin, making autodigestion more likely.

[0253] [Experimental Example 5] (The establishment of the P. clara strain contributes to the maintenance of IgA levels.) To confirm the contribution of proteins 00502 and 00509 to trypsin degradation in vivo, GF mice colonized with one of three P. clara (JCM14859) strains (wild-type (WT), Δ00502, or Δ00509) were analyzed.

[0254] Since the P. clara strain did not colonize mice on its own, the P. clara strain was inoculated together with two non-trypsin-degrading strains (2-mix: Bacteroides uniformis 3H3 and Parabacteroides merdae 1D4). Inoculation with the 2-mix allowed all three P. clara strains to effectively colonize the mouse intestines.

[0255] Figure 28 is a graph showing the results of quantifying P. clara strain DNA in the feces of GF mice inoculated with 2-mix. In Figure 28, "ns" indicates no significant difference. The results revealed that deletion of the 00502 gene or the 00509 gene does not affect the abundance of the P. clara strain in vivo.

[0256] Figure 29 is a graph showing the results of fecal trypsin activity measurements in GF mice inoculated with P. clara strain (wild type (WT), Δ00502, or Δ00509) along with a 2-mix. In Figure 29, "*" and "***" indicate statistically significant differences at p<0.05 and p<0.001, respectively. As a result, consistent with the in vitro results, mice colonized with the Δ00502 P. clara strain maintained high trypsin activity in their feces, while mice colonized with the Δ00509 P. clara strain showed a partial decrease in trypsin activity.

[0257] Next, the importance of 00502 was examined under conditions where a more complex microbiome community exists. Figure 30 is a graph showing the results of fecal trypsin activity measurements in GF mice inoculated with P. clara strains (wild-type (WT), Δ00502) along with the aforementioned 34-mix (35-mix with P. clara (1C4) removed). In Figure 30, "**" indicates a statistically significant difference at p<0.01. As a result, it was revealed that mice colonized with Δ00502 P. clara had higher fecal trypsin activity than mice colonized with wild-type (WT) P. clara.

[0258] Based on these results, it was confirmed that the essential role of the 00502 protein is to promote trypsin degradation in vivo.

[0259] Next, we investigated the effects of regulation of intestinal trypsin levels by wild-type (WT) and mutant P. clara on important intestinal defense factors such as IgA and antimicrobial peptides.

[0260] Figure 31 is a photograph showing the results of a Western blot analysis of trypsin (PRSS2), type II transmembrane serine protease (TMPRSS2), IgA heavy chain, κ light chain, and the antimicrobial peptides Reg3β and Chymotrypsin-like Elastase 3B (CELA3B) in the feces of GF mice inoculated with P. clara strain (wild type (WT), Δ00502, or Δ00509) along with a 2-mix.

[0261] As a result, colonization of mice with the wild-type P. clara strain revealed higher levels of IgA heavy chains (α chains) in their feces compared to colonization of mice with the Δ00502 or Δ00509 P. clara strains. In contrast, the κ light chain was trypsin-resistant, and the levels of κ light chains in the feces were similar among mice colonized with various P. clara strains. Furthermore, Reg3β, an antimicrobial peptide against Gram-negative bacteria, was trypsin-resistant, similar to the κ light chain.

[0262] These results indicate that, in vivo, the establishment of the P. clara strain protects IgA from trypsin-mediated degradation.

[0263] Figure 32 is a photograph showing the results of Western blotting analysis of trypsin (PRSS2), IgA heavy chain, κ light chain, and Chymotrypsin-like Elastase 3B (CELA3B) after incubation at 37°C for 48 hours of GF mouse feces, GF mouse feces inoculated with 2-mix and wild-type P. clara strain, a sample of the above two mixed samples, and a sample of the above two mixed samples to which a trypsin inhibitor (TCLK) was added.

[0264] The results from lane 1 showed that trypsin was present in the feces of GF mice, indicating that the IgA heavy chain was degraded. Furthermore, the results from lane 2 showed that in the feces of GF mice inoculated with wild-type P. clara strain along with 2-mix, trypsin levels were reduced and the IgA heavy chain remained. In addition, the results from lane 3 showed that the trypsin remaining in the feces of GF mice degraded the IgA heavy chain remaining in the feces of GF mice inoculated with wild-type P. clara strain along with 2-mix. Furthermore, the results from lane 4 showed that the addition of a trypsin inhibitor inhibited the degradation of the IgA heavy chain in lane 3. Finally, the results from lanes 3 and 4 showed that the IgA heavy chain is more easily degraded into trypsin than the κ light chain.

[0265] [Experimental Example 6] (Investigation of the impact of P. clara colonization on enteropathogenic bacterial infections) We investigated whether trypsin degradation mediated by P. clara strain can maintain IgA levels even under conditions of infection by enteric pathogens.

[0266] GF mice were inoculated with 2-mix or 2-mix plus wild-type (WT) or Δ00502 P.clara strain, and 14 days later, they were infected with Citrobacter rodentium (C. rodentium), a mouse pathogen that primarily infects the large intestine.

[0267] Figure 33 is a graph showing the weight changes of mice in each group after C. rodentium infection. In Figure 33, "**" and "***" indicate a statistically significant difference at p<0.01 and p<0.001, respectively (2-mix + Δ00502 vs. 2-mix). Also, "#" indicates a statistically significant difference at p<0.05 (2-mix + WT vs. 2-mix).

[0268] The upper panel of Figure 34 shows images of the large intestine of each mouse 7 days after C. rodentium infection. In the 2-mix group, the cecum was pale and contracted. The lower panel of Figure 34 shows representative micrographs of hematoxylin-eosin stained cecal tissue.

[0269] Figure 35 is a graph showing the histological scores of cecal tissue based on hematoxylin and eosin staining. In Figure 35, "ns" indicates no significant difference, and "***" indicates a significant difference at p<0.001.

[0270] As a result, the 2-mix group exhibited rapid weight loss and severe cecal inflammation following C. rodentium infection. In contrast, P. clara-colonized mice showed less severe weight loss and cecal inflammation. Surprisingly, this was similar for both the 2-mix + WT group and the 2-mix + Δ00502 group. These results suggest that the P. clara strain protects against C. rodentium infection through a mechanism independent of trypsin degradation.

[0271] Figure 36 is a photograph showing the results of Western blotting analysis of total IgA, C. rodentium-specific IgA, and Chymotrypsin-like Elastase 3B (CELA3B) in feces.

[0272] As a result, despite similar levels of cecal inflammation, the 2-mix+WT group of mice maintained high total IgA levels, and it was revealed that, compared to the 2-mix+Δ00502 group, a considerable amount of C. rodentium-specific IgA was present as early as 7 days after C. rodentium infection.

[0273] Figure 37 shows a photograph of the results of evaluating the agglutination effect by fecal IgA in ex vivo incubation of live C. rodentium and fecal fluid. The results showed significant bacterial agglutination when the fecal microbiota of the 2-mix+WT group was incubated with live C. rodentium. This result indicates the presence of C. rodentium-specific IgA.

[0274] From the above, it was shown that the P. clara strain enhances the adaptive immune response to the pathogen by protecting pathogen-specific IgA, in addition to providing a protective effect against C. rodentium infection through an unknown mechanism.

[0275] [Experimental Example 7] (Trypsin degradation via the P. clara strain enhances the vaccine's effectiveness against C. rodentium infection.) The degradation of trypsin via the P. clara strain and the resulting protection of pathogen-specific IgA may enhance the effectiveness of oral vaccines against enteropathogens, leading to greater resistance when re-exposed to the same pathogen.

[0276] To confirm this hypothesis, the following investigation was conducted. Figure 38 is a schematic diagram showing the schedule of this experiment. GF mice, which were colonized with either WT or Δ00502 P.clara strain in addition to 2-mix, were orally vaccinated with peracetic acid-inactivated C. rodentium once a week for three weeks. Subsequently, they were orally infected with live C. rodentium.

[0277] Figure 39 is a graph showing the change in mouse body weight after C. rodentium infection. In Figure 39, "*" indicates a statistically significant difference at p<0.05. The results showed that mice that had been pre-inoculated with the wild-type P. clara strain experienced reduced weight loss.

[0278] Next, cecal patches and luminal contents were collected from mice 14 days after C. rodentium infection, and the CFU of C. rodentium was measured. Figure 40 is a graph showing the measured CFU of C. rodentium in the cecal patch. Figure 41 is a graph showing the measured CFU of C. rodentium in the luminal contents.

[0279] As a result, although the amount of C. rodentium in the cecum was similar in both the 2-mix+WT group and the 2-mix+Δ00502 group, the infiltration of C. rodentium into the cecal tissue was suppressed in the 2-mix+WT group.

[0280] Figure 42 is a photograph showing the results of Western blotting analysis of trypsin (PRSS2), total IgA, C. rodentium-specific IgA, and Chymotrypsin-like Elastase 3B (CELA3B) in the contents of the cecal lumen.

[0281] As a result, significantly elevated total IgA levels and significantly elevated C. rodentium-specific IgA levels were detected in the cecum of mice colonized with the wild-type (WT) P. clara strain. This suggests that the vaccine played a significant role in the superior protective effect against C. rodentium invasion in the 2-mix+WT group.

[0282] These results support the inventors' view that delivering the P. clara strain enables the host to respond more effectively to previously encountered intestinal pathogens.

[0283] [Experimental Example 8] (The P. clara strain protects mice from coronavirus infection.) Trypsin and trypsin-like proteases such as type II transmembrane serine protease (TMPRSS2) are known to be involved in the activation of protein degradation of the coronavirus spike protein and in the fusion of the virus with the host cell membrane.

[0284] TMPRSS2 is expressed as a transmembrane protein in the epithelial cells of the lungs and intestines, but it can undergo autocleavage to release its protease domain. Interestingly, in Experiment Example 5 described above, the inventors found that the amount of TMPRSS2 in the feces of GF mice engrafted with the wild-type P. clara strain was reduced. This suggests that the P. clara strain has an effect similar to the release of the active form of TMPRSS2 in vivo. This indicates that free TMPRSS2, together with trypsin, may be promoting coronavirus infection in the intestines.

[0285] We investigated the potential of the P. clara strain to protect against coronavirus intestinal infection through the degradation of trypsin and TMPRSS2. Specifically, we examined the effect of P. clara colonization on infection with mouse hepatitis virus (MHV) (mouse tropic coronavirus).

[0286] Figure 43 is a schematic diagram illustrating the outline of the MHV infection experiment. GF mice were inoculated with either WT or Δ00502 P.clara (JCM14859) strain along with 2-mix, and oral MHV infection was performed 14 days later.

[0287] Figure 44 shows a graph of the survival curve of mice after MHV infection. The results clearly showed that establishing the wild-type P. clara strain extended the survival of mice after lethal MHV infection.

[0288] Figure 45 is a graph showing the results of measuring MHV viral titers in the liver, brain, and feces. In Figure 45, "*", "**", and "***" indicate statistically significant differences at p<0.05, p<0.01, and p<0.01, respectively.

[0289] The results showed that establishing the wild-type P. clara strain significantly protected against viral spread in the liver and brain. Furthermore, mice in the 2-mix+WT group excreted significantly fewer viral particles in their feces compared to mice in the 2-mix+Δ00502 group.

[0290] Figure 46 shows representative images of hematoxylin-eosin staining results for liver tissue from mice in each group. Histological analysis revealed that mice colonized with the wild-type P. clara strain were protected from necrotizing liver pathology caused by MHV.

[0291] These results indicate that carriership of the P. clara strain provides a protective effect to the host during coronavirus infection.

[0292] [Experimental Example 9] (Detection of Paraprevotella species and related genes in the human microbiome) A novel gut microbiota gene catalog consisting of approximately 6 million non-redundant complete genes collected from six geographically distinct cohorts was created, and the abundance and prevalence of the Paraprevotella genus, trypsin-related gene 00502, and gene 00509 were analyzed.

[0293] A homology search using USEARCH ublast (protein level) on a non-redundant gut microbiota gene catalog containing 5,929,528 genes resulted in hits with a minimum e-value of 0.1 being concentrated.

[0294] Figure 47 shows the homologs of genes related to trypsin degradation (gene 00502 and gene 00509) and the species that encode them, as searched on a computer.

[0295] Figure 48 shows the structure of the gene locus related to trypsin degradation in each bacterial species and the sequence identity (%) of the gene in the P. clara strain.

[0296] As a result, it was first confirmed that the 00502 gene of the P.clara strain and the 00502 gene homolog of the P.xylanphila strain are identical or nearly identical. Similarly, it was confirmed that the 00509 gene of the P.clara strain and the 00509 gene homolog of the P.xylanphila strain are identical or nearly identical. Furthermore, for the 00503-00508 genes, located between the 00502 and 00509 genes, it was confirmed that the genes of the P.clara strain and the gene homologs of the P.xylanphila strain are identical or nearly identical.

[0297] Furthermore, we identified two metagenomic species (MSP 0303 and MSP 0335) that possess homologs of the 00502-00509 genes, and confirmed that they may belong to the genus Paraprevotella.

[0298] Two metagenomic species annotated to the genus Paraprevotella (MSP 0303 and MSP 0335) encoded all or nearly all homologs of genes 00502–00509 of the P. clara strain. Five MSPs annotated to Bacteroidetes (MSP 0081, MSP 0224, MSP 0288, MSP 0410, and MSP 0435) encoded homologs of genes 00502 and 00509, but lacked homologs of genes 00503–00508.

[0299] Furthermore, Prevotella muris was thought not to possess a homolog of the 00509 gene.

[0300] In metagenomic analysis, the genus Paraprevotella showed an average relative abundance of up to 3%, with its abundance varying significantly across cohorts (7-50% of the sample). P. clara was the most abundant species, followed by P. xylaniphilla.

[0301] These data suggest that Paraprebotella species constitute a significant portion of the human microbiome, which may be related to individual differences in susceptibility to intestinal pathogen infections.

[0302] Human trypsin levels, like those in mice, are thought to be regulated by trypsin-degrading bacterial species such as Paraprevotella. Elevated fecal trypsin levels have been reported in patients with inflammatory bowel diseases (IBD), such as ulcerative colitis (UC) and Crohn's disease (CD). Therefore, we measured fecal trypsin activity in a Japanese cohort consisting of non-IBD control (healthy individuals), ulcerative colitis (UC), and Crohn's disease (CD) patients.

[0303] Figure 49 is a graph showing the results of trypsin activity measurements. In Figure 49, "*" indicates a statistically significant difference (p<0.05). The results revealed that UC patients and CD patients had higher trypsin activity in their feces compared to the non-IBD control group.

[0304] Next, we analyzed the Paraprevotella carriage rates in subgroups of two IBD cohorts (PRISM and HMP2): the non-IBD control group, the UC group, and the CD group. Figure 50 shows graphs illustrating the Paraprevotella carriage rates in the populations of patients diagnosed with ulcerative colitis (UC) and Crohn's disease (CD) in the PRISM and HMP2 cohorts. The results showed that Paraprevotella was more prevalent in non-IBD samples than in UC and CD patients in both studies. Furthermore, this trend was statistically significant in the larger HMP2 cohort.

[0305] These results suggest that Paraprevotella colonization is associated with gut health.

[0306] Figure 51 shows the results of incubation of recombinant mouse trypsin (rmPRSS2, with added C-terminal His-tag) with Prevotella rodentium strain, Prevotella muris strain, wild-type P. clara strain (P. clara(WT)) as a positive control, and P. clara strain with the 00502 gene knocked out (P. clara(00502KO)) as a negative control, followed by measurement of trypsin degradation by Western blotting. The results revealed that Prevotella rodentium strain and Prevotella muris strain possess trypsin degradation activity.

[0307] Figure 52 shows the results of a Western blot experiment in which the Prevotella rara (MSP 0081) strain, the wild-type P.clara strain as a positive control (P.clara(WT)), and the P.clara strain with the 00502 gene knocked out as a negative control (P.clara(00502KO)) were incubated with recombinant mouse trypsin (rmPRSS2, with added C-terminal His-tag), and trypsin degradation was measured. The results revealed that the Prevotella rara (MSP 0081) strain possesses trypsin degradation activity. [Industrial applicability]

[0308] According to the present invention, a technique for controlling the activity of proteases can be provided.

Claims

1. A composition for degrading trypsin or TMPRSS2, comprising at least one bacterium selected from the group consisting of Prevotella rara, Prevotella rodentium, and Prevotella muris as an active ingredient.

2. The trypsin or TMPRSS2 decomposition composition according to claim 1, wherein the bacteria are live bacteria.

3. The trypsin or TMPRSS2 decomposition composition according to claim 1, wherein the bacteria are dead bacteria.

4. An isolated 00502 protein having the amino acid sequence described in Sequence ID No. 5, immobilized on a solid surface, or an isolated protein having 90% or more sequence identity with the amino acid sequence described in Sequence ID No. 5 and having trypsin-binding ability, A composition for the decomposition of trypsin or TMPRSS2, containing as an active ingredient.

5. An isolated 00502 protein consisting of the amino acid sequence described in Sequence ID No. 5, immobilized on a solid surface, or an isolated protein having 90% or more sequence identity with the amino acid sequence described in Sequence ID No. 5 and having trypsin-binding ability, and An isolated 00509 protein consisting of the amino acid sequence described in Sequence ID No. 18, immobilized on a solid surface, or an isolated protein having 90% or more sequence identity to the amino acid sequence described in Sequence ID No. 18 and possessing trypsin-binding ability, A composition for the decomposition of trypsin or TMPRSS2, containing as an active ingredient.

6. A composition for degrading trypsin or TMPRSS2 according to any one of claims 1 to 5, for the treatment of diseases caused by trypsin or TMPRSS2.

7. The trypsin or TMPRSS2 decomposition composition according to claim 6, wherein the disease caused by the trypsin or TMPRSS2 is inflammatory bowel disease (ulcerative colitis, Crohn's disease), irritable bowel syndrome, infection, acute pancreatitis, or chronic pancreatitis.

8. The trypsin or TMPRSS2 degradation composition according to claim 7, wherein the infectious disease is a viral infection or a bacterial infection.

9. The trypsin or TMPRSS2 decomposition composition according to claim 7 or 8, wherein the inflammatory bowel disease, irritable bowel syndrome, or infection is a disease involving TMPRSS2 or IgA.

10. An antibody or antigen-binding fragment thereof that specifically binds to the 00502 protein, for detecting activity that degrades trypsin or TMPRSS2 by detecting the 00502 protein having the amino acid sequence described in Sequence ID No.

5.

11. A primer set or probe for detecting the activity that degrades trypsin or TMPRSS2 by detecting a gene consisting of the nucleotide sequence described in Sequence ID No.

1.

12. A quasi-drug for diseases caused by trypsin or TMPRSS2, comprising at least one bacterium selected from the group consisting of Prevotella rara, Prevotella rodentium, and Prevotella muris as an active ingredient.

13. An isolated 00502 protein having the amino acid sequence described in Sequence ID No. 5, immobilized on a solid surface, or an isolated protein having 90% or more sequence identity with the amino acid sequence described in Sequence ID No. 5 and having trypsin-binding ability, A quasi-drug for diseases caused by trypsin or TMPRSS2, containing as an active ingredient.

Images