Modification of blood group antigens

Abstract

Provided herein are cells having genetic modifications of the ABO gene, the RED gene, and / or the FUT1 gene. In some embodiments, the cells express reduced levels of MHC I and / or MHC II antigens. In some cases, the cells are also hypoimmunogenic cells.

Description

Technical Field

[0001] Cross-reference This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 62 / 960,607, filed on January 13, 2020, and U.S. Provisional Application No. 62 / 960,617, filed on January 13, 2020, the disclosures of which are incorporated herein by reference in their entireties.

Background Art

[0002] Blood products can be classified into different groups according to the presence or absence of antigens on the surface of all red blood cells in a person's body (ABO blood type). The A, B, AB, and A1 antigens are determined by the sequence of oligosaccharides on the glycoproteins of red blood cells. The genes of the blood type antigen group provide instructions for making antigen proteins. Blood type antigen proteins perform various functions within the cell membrane of red blood cells. These protein functions include the transport of other proteins and molecules in and out of cells, the maintenance of cell structure, the attachment to other cells and molecules, and the participation in chemical reactions.

[0003] The rhesus (Rh) blood group is the second most important blood group system after the ABO blood group system. The Rh blood group system consists of 49 defined blood group antigens, among which five antigens, D, C, c, E, and e, are the most important. The Rh(D) status of an individual is usually described with a positive or negative suffix after the ABO type. The terms "Rh factor", "Rh positive", and "Rh negative" refer only to the Rh(D) antigen. Antibodies against Rh antigens can be involved in hemolytic transfusion reactions, and antibodies against Rh(D) and Rh(c) antigens pose a significant risk of hemolytic disease of the fetus and newborn. ABO antibodies develop in infancy in all humans. However, rhesus antibodies in Rh-negative humans typically develop only when the person is sensitized. This can occur, for example, by giving birth to an Rh+ infant or by receiving an Rh+ transfusion.

[0004] A, B, H, and Rh antigens are the primary determinants of histocompatibility between blood, tissues, and donors and recipients for cell transplantation. Glycosyltransferase activity encoded by the ABO gene is involved in the production of A, B, AB, and O tissue blood group antigens displayed on the cell surface. Individuals of group A encode an ABO gene product with specificity to produce α(1,3)N-acetylgalactosaminyltransferase activity, while individuals of group B have specificity to produce α(1,3)galactosyltransferase activity. Individuals of type O do not produce any functional galactosyltransferase and therefore do not produce any modifications. Individuals of type AB possess one copy of each and produce both types of modifications. The enzyme product of the ABO gene acts on the H antigen as a substrate; therefore, individuals of type O lacking ABO activity present unmodified H antigens and are often referred to as type O(H).

[0005] The H antigen itself is the product of the α(1,2) fucosyltransferase enzyme encoded by the FUT1 gene. In very rare individuals, the H antigen is completely lost as a result of disruption of the FUT1 gene, and there is no substrate for ABO to produce A or B tissue blood group. These individuals are said to have Bombay tissue blood grouping. The Rh antigen is encoded by the RHD gene, and Rh-negative individuals have a deletion or disruption of the RHD gene.

[0006] The availability of cell lines suitable for therapeutic use is severely limited, and in many cases, available cell lines are not universally histocompatible with all possible recipients.

[0007] There remains a need for new approaches, compositions, and methods for generating tissue blood group cells useful for cell therapy. [Overview of the Initiative]

[0008] In some embodiments, provided herein are isolated cells in which the expression of the ABO gene is partially or completely inactivated by a harmful mutation in the ABO gene or by the insertion of an exon 6 258delG mutation in the ABO gene, and / or the expression of the RHD gene is partially or completely inactivated by a harmful mutation in the RHD gene.

[0009] In some embodiments, the expression of the ABO gene is partially or completely inactivated by insertion or deletion within ACACCT in exon 1; AGTGCG in exon 2; or CAAGCGC, GGCGCA, TGGGCG, ACCACG, GCCGCA, CCACGT, TGCCGT, TACTCG, ACTCGG, GAGCGC, GCCTGG, GTCCTT, TCACGC, TGGACG, TGGTCG, GCTGGC, CACGCG, AGGTGA, or GCATCG of the ABO gene.

[0010] In some embodiments, a harmful mutation in the ABO gene is generated using CRISPR-Cas9 gene editing that includes a guide RNA target sequence containing one selected from the group consisting of Tables A-C.

[0011] In some embodiments, the harmful mutation in the ABO gene includes an insertion / deletion within a coding exon, and the guide RNA target sequence includes SEQ ID NO: 1 or SEQ ID NO: 2.

[0012] In some embodiments, the harmful mutation in the ABO gene includes frameshift insertions / deletions, and the guide RNA target sequence includes SEQ ID NO: 3.

[0013] In some embodiments, the harmful mutation in the ABO gene is a homozygous mutation such that the cell is a tissue blood type O cell.

[0014] In some embodiments, an exon 6 258delG mutation in the ABO gene (e.g., a deletion of G at nucleotide position 258 in exon 6) is generated using CRISPR-Cas9 gene editing, comprising a guide RNA target sequence including one selected from the group consisting of SEQ ID NOs: 3-5, and a homology-directed repair (HDR) template including a sequence encoding the 258delG mutation, a PAM sequence, a spacer region, and two homology arms, each containing a homologous sequence of approximately 10 nucleotides to approximately 1 kb with the ABO gene.

[0015] In some embodiments, one or more silent mutations in the PAM sequence and / or spacer region are further included to ensure that the HDR template is not cleaved by Cas9.

[0016] In some embodiments, an exon 6 258delG mutation of the ABO gene is generated using CRISPR-Cas9 gene editing, which includes a guide RNA target sequence containing one selected from the group consisting of SEQ ID NOs: 3-5, and an HDR template containing one selected from the group consisting of SEQ ID NOs: 6-8.

[0017] In some embodiments, the exon 6 258delG mutation in the ABO gene is a homozygous mutation such that the cell is a tissue blood type O cell.

[0018] In some embodiments, a harmful mutation in the RHD gene is generated by using CRISPR-Cas9 gene editing that includes one or more guide RNA target sequences, one of which is selected from the group consisting of Tables D-F.

[0019] In some embodiments, harmful mutations are generated by using CRISPR-Cas9 gene editing, which includes a deletion of a genomic region containing exons 1-8 of the RHD gene, a guide RNA target sequence containing SEQ ID NO: 11, and another guide RNA containing SEQ ID NO: 12.

[0020] In some embodiments, the harmful mutation in the RHD gene includes frameshift insertions / deletions, and the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0021] In some embodiments, RHD gene expression is partially or completely inactivated by insertion or deletion within exon 2 of the RHD gene (TCATGG, GAGGTG, AACTCG, AGTTTC, TTGGCT, or CACAGC); exon 3 (CCGTGA); exon 4 (GGGTAG, or AGGGAA); exon 5 (TTCGAT, TCAGCG, CATAGT, or ATCGAA); exon 6 (CGTCGG, or TCCGTC); exon 7 (CGGCAA, CGGAGC, TACCGT, GCTTGC, or CTTGCT); or exon 8 (GGTTCT, or TCCTAC).

[0022] In some embodiments, the harmful mutation in the RHD gene is a homozygous mutation such that the cells are rhesus factor (Rh) negative. In some embodiments, the harmful mutation in the RHD gene is a homozygous mutation such that the cells are O-negative.

[0023] In some embodiments, what is provided herein is a cell in which the expression of the ABO gene is partially or completely inactivated by a harmful mutation of the ABO gene or by the insertion of an exon 6 258delG mutation of the ABO gene.

[0024] In some embodiments, the cells are Rh-negative cells. In some embodiments, a harmful mutation in the ABO gene is generated using CRISPR-Cas9 gene editing, which includes a guide RNA target sequence containing one selected from the group consisting of Tables A-C.

[0025] In some embodiments, the harmful mutation in the ABO gene includes an insertion / deletion within a coding exon, and the guide RNA target sequence includes SEQ ID NO: 1 or SEQ ID NO: 2.

[0026] In some embodiments, the deleterious mutation of the ABO gene includes a frameshift insertion / deletion, and the guide RNA target sequence includes SEQ ID NO: 3.

[0027] In some embodiments, the expression of the ABO gene is partially or completely inactivated by an insertion or deletion within ACACCT of exon 1 of the ABO gene; AGTGCG of exon 2; or CAAGCGC, GGCGCA, TGGGCG, ACCACG, GCCGCA, CCACGT, TGCCGT, TACTCG, ACTCGG, GAGCGC, GCCTGG, GTCCTT, TCACGC, TGGACG, TGGTCG, GCTGGC, CACGCG, AGGTGA, or GCATCG of exon 8.

[0028] In some embodiments, the deleterious mutation of the ABO gene is a homozygous mutation such that the cell is an O-negative cell.

[0029] In some embodiments, the 258delG mutation in exon 6 of the ABO gene is generated using CRISPR-Cas9 gene editing, comprising a guide RNA target sequence comprising one selected from the group consisting of SEQ ID NOs: 3-5, a sequence encoding the 258delG mutation, a PAM sequence, a spacer region, and a HDR template comprising two homology arms, each comprising a homologous sequence of about 10 nucleotides to about 1 Kb with the ABO gene.

[0030] In some embodiments, to ensure that the HDR template is not cleaved by Cas9, it further comprises one or more silent mutations in the PAM sequence and / or spacer region.

[0031] In some embodiments, the 258delG mutation in exon 6 of the ABO gene is generated using CRISPR-Cas9 gene editing, comprising a guide RNA target sequence comprising one selected from the group consisting of SEQ ID NOs: 3-5 and a HDR template comprising one selected from the group consisting of SEQ ID NOs: 6-8.

[0032] In some embodiments, the exon 6 258delG mutation in the ABO gene is a homozygous mutation such that the cell is an O-negative cell.

[0033] In some embodiments, provided herein are isolated cells in which the expression of the FUT1 gene is partially or completely inactivated by a harmful mutation of the FUT1 gene, and / or the expression of the RHD gene is partially or completely inactivated by a harmful mutation of the RHD gene.

[0034] In some embodiments, the expression of the FUT1 gene is partially or completely isolated and activated by an insertion or deletion within exon 4 of the FUT1 gene, specifically within ATCGAC, AGTACG, CGCCCT, GTTTGC, CGACAA, GGTGCG, CGCCGT, ACGCCG, CCGGTT, CGCGGG, TTTTCG, ATACCG, GTGCGC, CCATTG, TGTCGG, ATCTGC, CTTTGT, GGGGCC, GGCCAT, TGCGAT, CGTGCA, or ATGGAC.

[0035] In some embodiments, RHD gene expression is partially or completely inactivated by insertion or deletion within exon 2 of the RHD gene (TCATGG, GAGGTG, AACTCG, AGTTTC, TTGGCT, or CACAGC); exon 3 (CCGTGA); exon 4 (GGGTAG, or AGGGAA); exon 5 (TTCGAT, TCAGCG, CATAGT, or ATCGAA); exon 6 (CGTCGG, or TCCGTC); exon 7 (CGGCAA, CGGAGC, TACCGT, GCTTGC, or CTTGCT); or exon 8 (GGTTCT, or TCCTAC).

[0036] In some embodiments, a harmful mutation in the FUT1 gene is generated using CRISPR-Cas9 gene editing that includes a guide RNA target sequence, which is selected from the group consisting of Tables G-I.

[0037] In some embodiments, the harmful mutation includes a deletion in exon 4 of the FUT1 gene and a guide RNA target sequence including SEQ ID NO: 13 or SEQ ID NO: 14.

[0038] In some embodiments, the harmful mutation in the FUT1 gene is a homozygous mutation such that the cell has the Bombay phenotype.

[0039] In some embodiments, harmful mutations in the RHD gene are generated by using CRISPR-Cas9 gene editing that includes one or more guide RNA target sequences, one or more of which are selected from the group consisting of Tables D-F.

[0040] In some embodiments, the harmful mutation includes a deletion of a genomic region containing exons 1-8 of the RHD gene, a guide RNA target sequence containing sequence number 11, and another guide RNA containing sequence number 12.

[0041] In some embodiments, the harmful mutation in the RHD gene includes frameshift insertions / deletions, and the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0042] In some embodiments, the harmful mutation in the RHD gene is a homozygous mutation such that the cell is rhesus factor (Rh) negative.

[0043] In some embodiments, the harmful mutation in the RHD gene is a homozygous mutation such that the cell has the Bombay phenotype and is Rh-negative.

[0044] In some embodiments, what is provided herein are isolated cells in which the expression of the FUT1 gene is partially or completely inactivated by a harmful mutation of the FUT1 gene. In some embodiments, the cells are further Rh-negative cells.

[0045] In some embodiments, the expression of the FUT1 gene is partially or completely inactivated by insertion or deletion within exon 4 of the FUT1 gene, specifically within ATCGAC, AGTACG, CGCCCT, GTTTGC, CGACAA, GGTGCG, CGCCGT, ACGCCG, CCGGTT, CGCGGG, TTTTCG, ATACCG, GTGCGC, CCATTG, TGTCGG, ATCTGC, CTTTGT, GGGGCC, GGCCAT, TGCGAT, CGTGCA, or ATGGAC.

[0046] In some embodiments, a harmful mutation in the FUT1 gene is generated using CRISPR-Cas9 gene editing that includes a guide RNA target sequence, which is selected from the group consisting of Tables G-I.

[0047] In some embodiments, the harmful mutation is generated using CRISPR-Cas9 gene editing, which includes a deletion in exon 4 of the FUT1 gene and a guide RNA target sequence including SEQ ID NO: 13 or SEQ ID NO: 14.

[0048] In some embodiments, the harmful mutation in the FUT1 gene is a homozygous mutation such that the cells are universal Bombay-negative cells.

[0049] In some embodiments, what is provided herein are isolated cells in which the expression of the RHD gene is partially or completely inactivated by a harmful mutation of the RHD gene.

[0050] In some embodiments, the cells have type O or Bombay phenotype.

[0051] In some embodiments, RHD gene expression is partially or completely inactivated by insertion or deletion within exon 2 of the RHD gene (TCATGG, GAGGTG, AACTCG, AGTTTC, TTGGCT, or CACAGC); exon 3 (CCGTGA); exon 4 (GGGTAG, or AGGGAA); exon 5 (TTCGAT, TCAGCG, CATAGT, or ATCGAA); exon 6 (CGTCGG, or TCCGTC); exon 7 (CGGCAA, CGGAGC, TACCGT, GCTTGC, or CTTGCT); or exon 8 (GGTTCT, or TCCTAC).

[0052] In some embodiments, a harmful mutation in the RHD gene is generated by using CRISPR-Cas9 gene editing that includes one or more guide RNA target sequences, one of which is selected from the group consisting of Tables D-F.

[0053] In some embodiments, the harmful mutation includes a deletion of a genomic region containing exons 1-8 of the RHD gene, a guide RNA target sequence containing sequence number 11, and another guide RNA containing sequence number 12.

[0054] In some embodiments, the harmful mutation in the RHD gene includes frameshift insertions / deletions, and the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0055] In some embodiments, the harmful mutation in the RHD gene is a homozygous mutation such that the cell is an O-negative or Bombay-negative cell.

[0056] In some embodiments, what is provided herein are isolated cells in which the expression of the ABO gene is partially or completely inactivated by a harmful mutation of the ABO gene or by the insertion of an exon 6 258delG mutation of the ABO gene.

[0057] In some embodiments, the expression of the ABO gene is partially or completely inactivated by insertion or deletion within ACACCT in exon 1; AGTGCG in exon 2; or CAAGCGC, GGCGCA, TGGGCG, ACCACG, GCCGCA, CCACGT, TGCCGT, TACTCG, ACTCGG, GAGCGC, GCCTGG, GTCCTT, TCACGC, TGGACG, TGGTCG, GCTGGC, CACGCG, AGGTGA, or GCATCG of the ABO gene.

[0058] In some embodiments, a harmful mutation in the ABO gene is generated using CRISPR-Cas9 gene editing that includes a guide RNA target sequence containing one selected from the group consisting of Tables A-C.

[0059] In some embodiments, the harmful mutation in the ABO gene includes an insertion or deletion within a coding exon, and the guide RNA target sequence includes SEQ ID NO: 1 or SEQ ID NO: 2.

[0060] In some embodiments, the harmful mutation in the ABO gene includes frameshift insertions / deletions, and the guide RNA target sequence includes SEQ ID NO: 3.

[0061] In some embodiments, the harmful mutations in the ABO gene are homozygous mutations.

[0062] In some embodiments, the exon 6 258delG mutation of the ABO gene is generated using CRISPR-Cas9 gene editing, comprising a guide RNA target sequence including one selected from the group consisting of sequence numbers 3-5, and an HDR template including a sequence encoding the 258delG mutation, a PAM sequence, a spacer region, and two homology arms, each containing a homologous sequence of approximately 10 nucleotides to approximately 1 kb with the ABO gene.

[0063] In some embodiments, one or more silent mutations in the PAM sequence and / or spacer region are further included to ensure that the HDR template is not cleaved by Cas9.

[0064] In some embodiments, an exon 6 258delG mutation of the ABO gene is generated using CRISPR-Cas9 gene editing, which includes a guide RNA target sequence containing one selected from the group consisting of SEQ ID NOs: 3-5, and an HDR template containing one selected from the group consisting of SEQ ID NOs: 6-8.

[0065] In some embodiments, the exon 6 258delG mutation in the ABO gene is a homozygous mutation.

[0066] In some embodiments, what is provided herein are isolated cells in which the expression of the RHD gene is partially or completely inactivated by a harmful mutation of the RHD gene.

[0067] In some embodiments, RHD gene expression is partially or completely inactivated by insertion or deletion within exon 2 of the RHD gene (TCATGG, GAGGTG, AACTCG, AGTTTC, TTGGCT, or CACAGC); exon 3 (CCGTGA); exon 4 (GGGTAG, or AGGGAA); exon 5 (TTCGAT, TCAGCG, CATAGT, or ATCGAA); exon 6 (CGTCGG, or TCCGTC); exon 7 (CGGCAA, CGGAGC, TACCGT, GCTTGC, or CTTGCT); or exon 8 (GGTTCT, or TCCTAC).

[0068] In some embodiments, harmful mutations in the RHD gene are generated by using CRISPR-Cas9 gene editing that includes one or more guide RNA target sequences, one or more of which are selected from the group consisting of Tables D-F.

[0069] In some embodiments, the harmful mutation includes a deletion of a genomic region containing exons 1-8 of the RHD gene, a guide RNA target sequence containing sequence number 11, and another guide RNA containing sequence number 12.

[0070] In some embodiments, the harmful mutation in the RHD gene includes frameshift insertions / deletions, and the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0071] In some embodiments, the harmful mutation in the RHD gene is a homozygous mutation.

[0072] In some embodiments, what is provided herein are isolated cells in which the expression of the FUT1 gene is partially or completely inactivated by a harmful mutation of the FUT1 gene.

[0073] In some embodiments, the expression of the FUT1 gene is partially or completely inactivated by insertion or deletion within exon 4 of the FUT1 gene, specifically within ATCGAC, AGTACG, CGCCCT, GTTTGC, CGACAA, GGTGCG, CGCCGT, ACGCCG, CCGGTT, CGCGGG, TTTTCG, ATACCG, GTGCGC, CCATTG, TGTCGG, ATCTGC, CTTTGT, GGGGCC, GGCCAT, TGCGAT, CGTGCA, or ATGGAC.

[0074] In some embodiments, a harmful mutation in the FUT1 gene is generated using CRISPR-Cas9 gene editing that includes a guide RNA target sequence, which is selected from the group consisting of Tables G-I.

[0075] In some embodiments, the harmful mutation includes a deletion in exon 4 of the FUT1 gene and a guide RNA target sequence including SEQ ID NO: 13 or SEQ ID NO: 14.

[0076] In some embodiments, the harmful mutation in the RHD gene is a homozygous mutation.

[0077] In some embodiments, the cells are human cells. In further embodiments, the cells are selected from the group consisting of induced pluripotent stem cells, embryonic stem cells (such as RUES2 or H9 cells), adult stem cells, and differentiated cells.

[0078] In some embodiments, the cells include one or more partially or completely inactivated genes encoding one or more MHC-I transcription factors, and / or one or more partially or completely inactivated genes encoding one or more MHC-II transcription factors.

[0079] In some embodiments, the expression of the B2M gene is partially or completely inactivated.

[0080] In some embodiments, the expression of the CIITA gene is partially or completely inactivated.

[0081] In some embodiments, the cells further contain the CD47 transgene.

[0082] In some embodiments, the expression of the B2M and CIITA genes is partially or completely inactivated, and the cells further contain the CD47 transgene.

[0083] In some embodiments, provided herein are pharmaceutical compositions comprising cells according to any of the above.

[0084] In some embodiments, provided herein are methods for treating patients requiring cell replacement therapy, the methods comprising administering cells in accordance with any of the above.

[0085] In some embodiments, the foregoing provides a method for generating manipulated histocompatibility cells, comprising: (a) obtaining isolated cells; (b) introducing into the cells a guide RNA target sequence of an ABO gene comprising a Cas9 nuclease and one selected from the group consisting of Tables A to C; and (c) selecting manipulated cells in which the ABO gene is partially or completely inactivated.

[0086] In some embodiments, the guide RNA target sequence includes one selected from the group consisting of SEQ ID NOs: 1 to 3.

[0087] In some embodiments, the method further comprises (i) introducing a guide RNA target sequence of an RHD gene, comprising one selected from the group consisting of Tables D to F, into cells, and (ii) selecting manipulated cells in which the RHD gene is partially or completely inactivated.

[0088] In some embodiments, the guide RNA target sequence includes SEQ ID NO: 11, and another guide RNA includes SEQ ID NO: 12. In some embodiments, the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0089] In some further embodiments, provided herein are methods for generating manipulated histocompatibility cells, comprising: (a) obtaining isolated cells; (b) introducing into the cells an HDR template comprising a Cas9 nuclease and a guide RNA target sequence for producing an exon 6 258delG mutation of the ABO gene, one selected from the group consisting of SEQ ID NOs: 3-5, and a sequence encoding the 258delG mutation, a PAM sequence, a spacer region, and two homology arms, each containing a homologous sequence of about 10 nucleotides to about 1 kb with respect to the ABO gene; and (c) selecting manipulated cells in which the ABO gene is partially or completely inactivated.

[0090] In some embodiments, one or more silent mutations in the PAM sequence and / or spacer region are further included to ensure that the HDR template is not cleaved by Cas9.

[0091] In some embodiments, the guide RNA target sequence includes one selected from the group consisting of SEQ ID NOs: 3 to 5, and the HDR template includes one selected from the group consisting of SEQ ID NOs: 6 to 8.

[0092] In some embodiments, a method for generating manipulated histocompatibility cells further comprises (i) introducing a guide RNA target sequence of an RHD gene, including one selected from the group consisting of Tables D to F, into cells, and (ii) selecting manipulated cells in which the RHD gene is partially or completely inactivated.

[0093] In some embodiments, the guide RNA target sequence includes sequence number 11, and another guide RNA includes sequence number 12.

[0094] In some embodiments, the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0095] In some embodiments, the foregoing provides a method for generating manipulated histocompatibility cells, comprising: (a) obtaining isolated cells; (b) introducing into the cells a guide RNA target sequence of an RHD gene comprising a Cas9 nuclease and one selected from the group consisting of Tables D to F; and (c) selecting manipulated cells in which the RHD gene is partially or completely inactivated.

[0096] In some embodiments, the guide RNA target sequence includes sequence number 11, and another guide RNA includes sequence number 12.

[0097] In some embodiments, the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0098] In some embodiments, a method for generating manipulated histocompatibility cells further includes (i) introducing a guide RNA target sequence of an ABO gene, which includes one selected from the group consisting of Tables A to C, into cells, and (ii) selecting manipulated cells in which the ABO gene is partially or completely inactivated. In some embodiments, the guide RNA target sequence includes Sequence IDs 1 to 3.

[0099] In some embodiments, a method for generating manipulated histocompatibility cells further comprises (i) introducing into cells an HDR template comprising a guide RNA target sequence for producing an exon 6 258delG mutation of the ABO gene, one selected from the group consisting of Sequence IDs 3-5, and a sequence encoding the 258delG mutation, a PAM sequence, a spacer region, and two homology arms, each comprising a homologous sequence of about 10 nucleotides to about 1 kb with respect to the ABO gene, and (ii) selecting manipulated cells in which the ABO gene is partially or completely inactivated.

[0100] In some embodiments, one or more silent mutations in the PAM sequence and / or spacer region are further included to ensure that the HDR template is not cleaved by Cas9.

[0101] In some embodiments, the guide RNA target sequence includes one selected from the group consisting of SEQ ID NOs: 3 to 5, and the HDR template includes one selected from the group consisting of SEQ ID NOs: 6 to 8. In some embodiments, the herein provides a method for generating manipulated histocompatibility cells, comprising: (a) obtaining isolated cells; (b) introducing a guide RNA target sequence of the FUT1 gene, comprising a Cas9 nuclease and one selected from the group consisting of Tables G to I, into the cells; and (c) selecting manipulated cells in which the FUT1 gene is partially or completely inactivated.

[0102] In some embodiments, the guide RNA includes SEQ ID NO: 13 or SEQ ID NO: 14.

[0103] In some embodiments, a method for generating manipulated histocompatibility cells further comprises (i) introducing a guide RNA target sequence of an RHD gene, including one selected from the group consisting of Tables D to F, into cells, and (ii) selecting manipulated cells in which the RHD gene is partially or completely inactivated.

[0104] In some embodiments, the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0105] In some embodiments, the guide RNA target sequence includes SEQ ID NO: 11, and another guide RNA target sequence includes SEQ ID NO: 12.

[0106] In some embodiments, the isolated cells are isolated human cells.

[0107] In some embodiments, the isolated cells are selected from the group consisting of pluripotent stem cells, induced pluripotent stem cells, embryonic stem cells (such as RUES2 or H9 cells), multipotent stem cells, adult stem cells, and differentiated cells.

[0108] In some embodiments, the isolated cells include one or more partially or completely inactivated genes encoding one or more MHC-I transcription factors, and / or one or more partially or completely inactivated genes encoding one or more MHC-II transcription factors.

[0109] In some embodiments, isolated cells contain the B2M gene, which is partially or completely inactivated.

[0110] In some further embodiments, the isolated cells used according to the above method further include the CIITA gene, which is partially or completely inactivated. In some further embodiments, the isolated cells include the CD47 transgene. In some further embodiments, the isolated cells include the B2M and CIITA genes, as well as the CD47 transgene, which are partially or completely inactivated.

[0111] In some further embodiments, provided herein are methods for preparing differentiated cells, comprising culturing stem cells prepared according to the above method under differentiation conditions to thereby prepare differentiated cells. In some embodiments, the differentiation conditions are suitable for differentiating stem cells into cell types selected from the group consisting of cardiac cells, hepatocytes, kidney cells, pancreatic cells, nerve cells, immune cells, mesenchymal cells, and endothelial cells.

[0112] In some further embodiments, provided herein are methods for treating a patient in need of cell replacement therapy, comprising administering a population of differentiated cells prepared according to the above method.

[0113] In some embodiments, provided herein are isolated cells derived from the RUES2 cell line, wherein the isolated cells include one or both of the following: (a) modifications that make the isolated cells tissue blood type O, and (b) modifications that make the isolated cells Rh-negative.

[0114] In some further embodiments, modifications that make isolated cells tissue blood type O reduce or eliminate the antigenicity of ABO tissue blood type B antigens.

[0115] In some further embodiments, the modification includes the expression of the ABO gene, which is partially or completely inactivated by a harmful mutation in the ABO gene or by the insertion of an exon 6 258delG mutation into the ABO gene.

[0116] In some further embodiments, the expression of the ABO gene is partially or completely inactivated by insertion or deletion within ACACCT in exon 1; AGTGCG in exon 2; or CAAGCGC, GGCGCA, TGGGCG, ACCACG, GCCGCA, CCACGT, TGCCGT, TACTCG, ACTCGG, GAGCGC, GCCTGG, GTCCTT, TCACGC, TGGACG, TGGTCG, GCTGGC, CACGCG, AGGTGA, or GCATCG of the ABO gene.

[0117] In some further embodiments, a harmful mutation in the ABO gene is generated using CRISPR-Cas9 gene editing that includes a guide RNA target sequence, which is selected from the group consisting of Tables A-C.

[0118] In some further embodiments, the harmful mutation in the ABO gene includes an insertion or deletion within a coding exon, and the guide RNA target sequence includes SEQ ID NO: 1 or SEQ ID NO: 2.

[0119] In some further embodiments, the harmful mutation in the ABO gene includes a frameshift insertion / deletion, and the guide RNA target sequence includes SEQ ID NO: 3.

[0120] In some further embodiments, the harmful mutation in the ABO gene is a homozygous mutation.

[0121] In some further embodiments, the exon 6 258delG mutation of the ABO gene is generated using CRISPR-Cas9 gene editing, comprising a guide RNA target sequence including one selected from the group consisting of SEQ ID NOs: 3–5, and an HDR template including a sequence encoding the 258delG mutation, a PAM sequence, a spacer region, and two homology arms, each containing a homologous sequence of approximately 10 nucleotides to approximately 1 kb with the ABO gene.

[0122] In some further embodiments, one or more silent mutations in the PAM sequence and / or spacer region are further included to ensure that the HDR template is not cleaved by Cas9.

[0123] In some further embodiments, an exon 6 258delG mutation of the ABO gene is generated using CRISPR-Cas9 gene editing, comprising a guide RNA target sequence containing one selected from the group consisting of SEQ ID NOs: 3-5, and an HDR template containing one selected from the group consisting of SEQ ID NOs: 6-8.

[0124] In some further embodiments, the exon 6 258delG mutation in the ABO gene is a homozygous mutation.

[0125] In some further embodiments, modifications that make isolated cells Rh-negative include the expression of the FUT1 gene by which the FUT1 gene is partially or completely inactivated by a harmful mutation of the FUT1 gene.

[0126] In some further embodiments, the expression of the FUT1 gene is partially or completely inactivated by insertion or deletion within exon 4 of the FUT1 gene, specifically within ATCGAC, AGTACG, CGCCCT, GTTTGC, CGACAA, GGTGCG, CGCCGT, ACGCCG, CCGGTT, CGCGGG, TTTTCG, ATACCG, GTGCGC, CCATTG, TGTCGG, ATCTGC, CTTTGT, GGGGCC, GGCCAT, TGCGAT, CGTGCA, or ATGGAC.

[0127] In some further embodiments, a harmful mutation in the FUT1 gene is generated using CRISPR-Cas9 gene editing that includes a guide RNA target sequence, which is selected from the group consisting of Tables G-I.

[0128] In some further embodiments, the harmful mutation includes a deletion in exon 4 of the FUT1 gene and a guide RNA target sequence including SEQ ID NO: 13 or SEQ ID NO: 14.

[0129] In some further embodiments, modifications that make isolated cells Rh-negative reduce or eliminate the antigenicity of one or more rhesus factor antigens.

[0130] In some further embodiments, the modification includes the expression of the RHD gene by which a harmful mutation in the RHD gene partially or completely inactivates the RHD gene.

[0131] In some further embodiments, RHD gene expression is partially or completely inactivated by insertion or deletion within exon 2 of the RHD gene (TCATGG, GAGGTG, AACTCG, AGTTTC, TTGGCT, or CACAGC; exon 3 (CCGTGA; exon 4 (GGGTAG, or AGGGAA); exon 5 (TTCGAT, TCAGCG, CATAGT, or ATCGAA); exon 6 (CGTCGG, or TCCGTC); exon 7 (CGGCAA, CGGAGC, TACCGT, GCTTGC, or CTTGCT); or exon 8 (GGTTCT, or TCCTAC).

[0132] In some further embodiments, a harmful mutation in the RHD gene is generated by using CRISPR-Cas9 gene editing that includes one or more guide RNA target sequences, one of which is selected from the group consisting of Tables D-F.

[0133] In some further embodiments, the harmful mutation includes a deletion of a genomic region containing exons 1–8 of the RHD gene, a guide RNA target sequence containing sequence number 11, and another guide RNA containing sequence number 12.

[0134] In some further embodiments, the harmful mutation in the RHD gene includes a frameshift insertion / deletion, and the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0135] In some embodiments, the isolated cells described above further include one or more partially or completely inactivated genes encoding one or more MHC-I transcription factors, and / or one or more partially or completely inactivated genes encoding one or more MHC-II transcription factors.

[0136] In some embodiments, the isolated cells include a B2M gene that is partially or completely inactivated. In some further embodiments, the isolated cells used according to the above method further include a CIITA gene that is partially or completely inactivated. In some further embodiments, the isolated cells include a CD47 transgene. In some further embodiments, the isolated cells include a B2M and CIITA gene, as well as a CD47 transgene, that are partially or completely inactivated.

[0137] In some embodiments, the foregoing provides a method for generating manipulated histocompatibility cells, comprising: (a) obtaining isolated RUES2 cells or derivatives thereof; (b) introducing into the cells a guide RNA target sequence of an ABO gene comprising a Cas9 nuclease and one selected from the group consisting of Tables A to C; and (c) selecting manipulated cells in which the ABO gene is partially or completely inactivated.

[0138] In some further embodiments, the guide RNA target sequence includes one selected from the group consisting of SEQ ID NOs: 1-3.

[0139] In some further embodiments, a method for generating manipulated histocompatibility cells further comprises (i) introducing a guide RNA target sequence of an RHD gene, including one selected from the group consisting of Tables D to F, into cells, and (ii) selecting manipulated cells in which the RHD gene is partially or completely inactivated.

[0140] In some further embodiments, the guide RNA target sequence includes SEQ ID NO: 11, and another guide RNA includes SEQ ID NO: 12.

[0141] In some further embodiments, the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0142] In some embodiments, the foregoing provides a method for generating manipulated histocompatibility cells, comprising: (a) obtaining isolated RUES2 cells or derivatives thereof; (b) introducing into cells an HDR template comprising a Cas9 nuclease and a guide RNA target sequence for producing an exon 6 258delG mutation of the ABO gene, one selected from the group consisting of SEQ ID NOs: 3-5, and a sequence encoding the 258delG mutation, a PAM sequence, a spacer region, and two homology arms, each containing a homologous sequence of about 10 nucleotides to about 1 kb with respect to the ABO gene; and (c) selecting manipulated cells in which the ABO gene is partially or completely inactivated.

[0143] In some further embodiments, one or more silent mutations in the PAM sequence and / or spacer region are further included to ensure that the HDR template is not cleaved by Cas9.

[0144] In some further embodiments, the guide RNA target sequence includes one selected from the group consisting of SEQ ID NOs: 3 to 5, and the HDR template includes one selected from the group consisting of SEQ ID NOs: 6 to 8.

[0145] In some further embodiments, the method further comprises (i) introducing a guide RNA target sequence of an RHD gene, comprising one selected from the group consisting of Tables D to F, into cells, and (ii) selecting manipulated cells in which the RHD gene is partially or completely inactivated.

[0146] In some further embodiments, the guide RNA target sequence includes SEQ ID NO: 11, and another guide RNA includes SEQ ID NO: 12.

[0147] In some further embodiments, the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0148] In some embodiments, the foregoing provides a method for generating manipulated histocompatibility cells, comprising: (a) obtaining isolated RUES2 cells or derivatives thereof; (b) introducing into the cells a guide RNA target sequence of an RHD gene comprising a Cas9 nuclease and one selected from the group consisting of Tables D to F; and (c) selecting manipulated cells in which the RHD gene is partially or completely inactivated.

[0149] In some further embodiments, the guide RNA target sequence includes SEQ ID NO: 11, and another guide RNA includes SEQ ID NO: 12.

[0150] In some further embodiments, the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0151] In some further embodiments, the method further comprises (i) introducing a guide RNA target sequence for an ABO gene, comprising one selected from the group consisting of Tables A to C, into cells, and (ii) selecting manipulated cells in which the ABO gene is partially or completely inactivated.

[0152] In some further embodiments, the guide RNA target sequences include SEQ ID NOs: 1-3.

[0153] In some further embodiments, the method further comprises (i) introducing into cells an HDR template comprising a guide RNA target sequence for producing an exon 6 258delG mutation of the ABO gene, one selected from the group consisting of SEQ ID NOs: 3-5, and a sequence encoding the 258delG mutation, a PAM sequence, a spacer region, and two homology arms, each comprising a sequence homologous to the ABO gene of about 10 nucleotides to about 1 kb; and (ii) selecting manipulated cells in which the ABO gene is partially or completely inactivated.

[0154] In some further embodiments, one or more silent mutations in the PAM sequence and / or spacer region are further included to ensure that the HDR template is not cleaved by Cas9.

[0155] In some further embodiments, the guide RNA target sequence includes one selected from the group consisting of SEQ ID NOs: 3 to 5, and the HDR template includes one selected from the group consisting of SEQ ID NOs: 6 to 8.

[0156] In some embodiments, the foregoing provides a method for generating manipulated histocompatibility cells, comprising: (a) obtaining isolated RUES2 cells or derivatives thereof; (b) introducing into the cells a guide RNA target sequence of the FUT1 gene comprising a Cas9 nuclease and one selected from the group consisting of Tables G to I; and (c) selecting manipulated cells in which the FUT1 gene is partially or completely inactivated.

[0157] In some further embodiments, the guide RNA target sequence includes SEQ ID NO: 13 or SEQ ID NO: 14.

[0158] In some further embodiments, the method further comprises (i) introducing a guide RNA target sequence of an RHD gene, comprising one selected from the group consisting of Tables D to F, into cells, and (ii) selecting manipulated cells in which the RHD gene is partially or completely inactivated.

[0159] In some further embodiments, the guide RNA target sequence includes SEQ ID NO: 9 or SEQ ID NO: 10.

[0160] In some further embodiments, the guide RNA target sequence includes SEQ ID NO: 11, and another guide RNA target sequence includes SEQ ID NO: 12.

[0161] In some further embodiments, the isolated cells further comprise one or more partially or completely inactivated genes encoding one or more MHC-I transcription factors, and / or one or more partially or completely inactivated genes encoding one or more MHC-II transcription factors.

[0162] In some further embodiments, isolated cells contain the B2M gene, which is partially or completely inactivated.

[0163] In some further embodiments, isolated cells contain the CIITA gene, which is partially or completely inactivated.

[0164] In some further embodiments, the isolated cells contain the CD47 transgene. In some further embodiments, the isolated cells contain the B2M and CIITA genes, as well as the CD47 transgene, which are partially or completely inactivated.

[0165] In some embodiments, what is provided herein is a method for preparing differentiated cells, comprising culturing manipulated histocompatibility cells prepared according to any of the methods described above under differentiation conditions, thereby preparing differentiated cells.

[0166] In some further embodiments, the differentiation conditions are suitable for differentiating stem cells into cell types selected from the group consisting of cardiac cells, hepatocytes, kidney cells, pancreatic cells, nerve cells, immune cells, mesenchymal cells, and endothelial cells.

[0167] In some embodiments, provided herein are methods for treating a patient in need of cell replacement therapy, comprising administering a population of differentiated cells prepared according to any of the methods described above.

[0168] Detailed descriptions of low immunogenic cells, methods for producing them, and methods for using them are found in WO2016183041, filed on 9 May 2015, and WO2018132783, filed on 14 January 2018, and their disclosures, including sequence listings and drawings, are incorporated herein by reference in their entirety.

[0169] Other objects, advantages, and embodiments of the present invention will become apparent from the following detailed description. [Brief explanation of the drawing]

[0170] [Figure 1] An exemplary embodiment of a universal O-negative iPSC is shown. [Figure 2] This paper presents exemplary genome modification strategies for ABO genes that can be used to generate universal O-negative cells. [Figure 3] This paper presents exemplary genome modification strategies for RHD genes that can be used to generate universal O-negative cells. [Figure 4] c.258delG shows three HDR strategies for producing the ABO genotype. [Figure 5A] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5B] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5C] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5D] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5E] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5F]Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5G] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5H] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5I] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5J] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5K] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5L] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5M] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5N] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5O] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5P] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5Q] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5R] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5S] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5T] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5U] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5V] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5W] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5X]Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5Y] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5Z] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5AA] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5AB] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5AC] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5AD] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 5AE] Exemplary ABO target sequences and genomic structures of ABO genes are shown. [Figure 6A] An exemplary ABO 238delG donor template and guide RNA target sequence are shown. [Figure 6B] An exemplary ABO 238delG donor template and guide RNA target sequence are shown. [Figure 6C] An exemplary ABO 238delG donor template and guide RNA target sequence are shown. [Figure 7A] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7B] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7C] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7D] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7E] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7F] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7G] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7H] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7I] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7J] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 7K] Exemplary FUT1 target sequences and the genomic structure of the FUT1 gene are shown. [Figure 8A] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8B] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8C] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8D] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8E] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8F] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8G] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8H] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8I] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8J] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8K] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8L] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8M] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8N] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8O] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8P] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8Q] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8R] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8S] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8T] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8U] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8V] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8W] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8X] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8Y] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8Z] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AA] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AB] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AC] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AD] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AE] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AF] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AG] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AH] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AI] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AJ] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AK] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AL] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AM] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AN] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AO] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AP] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AQ] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AR] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AS] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AT] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AU] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AV] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AW] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AX] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AY]Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8AZ] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BA] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BB] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BC] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BD] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BE] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BF] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BG] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BH] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BI] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BJ] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BK] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BL] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BM] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BN] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BO] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BP] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BQ]Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 8BR] Exemplary RHD target sequences and genomic structures of RHD genes are shown. [Figure 9] Table A shows exemplary ABO gRNA target sequences. [Figure 10A] Table B shows exemplary ABO gRNA target sequences that target coding exons. [Figure 10B] Table B shows exemplary ABO gRNA target sequences that target coding exons. [Figure 10C] Table B shows exemplary ABO gRNA target sequences that target coding exons. [Figure 10D] Table B shows exemplary ABO gRNA target sequences that target coding exons. [Figure 10E] Table B shows exemplary ABO gRNA target sequences that target coding exons. [Figure 11A] Table C shows the ABO gRNA target sequences. [Figure 11B] Table C shows the ABO gRNA target sequences. [Figure 11C] Table C shows the ABO gRNA target sequences. [Figure 11D] Table C shows the ABO gRNA target sequences. [Figure 11E] Table C shows the ABO gRNA target sequences. [Figure 11F] Table C shows the ABO gRNA target sequences. [Figure 11G] Table C shows the ABO gRNA target sequences. [Figure 11H] Table C shows the ABO gRNA target sequences. [Figure 11I] Table C shows the ABO gRNA target sequences. [Figure 11J] Table C shows the ABO gRNA target sequences. [Figure 11K] Table C shows the ABO gRNA target sequences. [Figure 11L] Table C shows the ABO gRNA target sequences. [Figure 11M] Table C shows the ABO gRNA target sequences. [Figure 11N] Table C shows the ABO gRNA target sequences. [Figure 11O] Table C shows the ABO gRNA target sequences. [Figure 11P] Table C shows the ABO gRNA target sequences. [Figure 11Q] Table C shows the ABO gRNA target sequences. [Figure 11R] Table C shows the ABO gRNA target sequences. [Figure 11S] Table C shows the ABO gRNA target sequences. [Figure 11T] Table C shows the ABO gRNA target sequences. [Figure 11U] Table C shows the ABO gRNA target sequences. [Figure 11V] Table C shows the ABO gRNA target sequences. [Figure 11W] Table C shows the ABO gRNA target sequences. [Figure 11X] Table C shows the ABO gRNA target sequences. [Figure 11Y] Table C shows the ABO gRNA target sequences. [Figure 11Z] Table C shows the ABO gRNA target sequences. [Figure 11AA] Table C shows the ABO gRNA target sequences. [Figure 11AB] Table C shows the ABO gRNA target sequences. [Figure 11AC] Table C shows the ABO gRNA target sequences. [Figure 11AD] Table C shows the ABO gRNA target sequences. [Figure 11AE] Table C shows the ABO gRNA target sequences. [Figure 11AF] Table C shows the ABO gRNA target sequences. [Figure 11AG] Table C shows the ABO gRNA target sequences. [Figure 11AH] Table C shows the ABO gRNA target sequences. [Figure 11AI]Table C shows the ABO gRNA target sequences. [Figure 11AJ] Table C shows the ABO gRNA target sequences. [Figure 11AK] Table C shows the ABO gRNA target sequences. [Figure 11AL] Table C shows the ABO gRNA target sequences. [Figure 11AM] Table C shows the ABO gRNA target sequences. [Figure 11AN] Table C shows the ABO gRNA target sequences. [Figure 11AO] Table C shows the ABO gRNA target sequences. [Figure 11AP] Table C shows the ABO gRNA target sequences. [Figure 11AQ] Table C shows the ABO gRNA target sequences. [Figure 11AR] Table C shows the ABO gRNA target sequences. [Figure 11AS] Table C shows the ABO gRNA target sequences. [Figure 11AT] Table C shows the ABO gRNA target sequences. [Figure 11AU] Table C shows the ABO gRNA target sequences. [Figure 11AV] Table C shows the ABO gRNA target sequences. [Figure 11AW] Table C shows the ABO gRNA target sequences. [Figure 11AX] Table C shows the ABO gRNA target sequences. [Figure 11AY] Table C shows the ABO gRNA target sequences. [Figure 11AZ] Table C shows the ABO gRNA target sequences. [Figure 11BA] Table C shows the ABO gRNA target sequences. [Figure 11BB] Table C shows the ABO gRNA target sequences. [Figure 11BC] Table C shows the ABO gRNA target sequences. [Figure 11BD] Table C shows the ABO gRNA target sequences. [Figure 11BE]Table C of the ABO gRNA target sequences is shown. [Figure 11BF] Table C of the ABO gRNA target sequences is shown. [Figure 11BG] Table C of the ABO gRNA target sequences is shown. [Figure 11BH] Table C of the ABO gRNA target sequences is shown. [Figure 11BI] Table C of the ABO gRNA target sequences is shown. [Figure 11BJ] Table C of the ABO gRNA target sequences is shown. [Figure 11BK] Table C of the ABO gRNA target sequences is shown. [Figure 11BL] Table C of the ABO gRNA target sequences is shown. [Figure 11BM] Table C of the ABO gRNA target sequences is shown. [Figure 11BN] Table C of the ABO gRNA target sequences is shown. [Figure 11BO] Table C of the ABO gRNA target sequences is shown. [Figure 11BP] Table C of the ABO gRNA target sequences is shown. [Figure 11BQ] Table C of the ABO gRNA target sequences is shown. [Figure 11BR] Table C of the ABO gRNA target sequences is shown. [Figure 11BS] Table C of the ABO gRNA target sequences is shown. [Figure 11BT] Table C of the ABO gRNA target sequences is shown. [Figure 11BU] Table C of the ABO gRNA target sequences is shown. [Figure 11BV] Table C of the ABO gRNA target sequences is shown. [Figure 11BW] Table C of the ABO gRNA target sequences is shown. [Figure 11BX] Table C of the ABO gRNA target sequences is shown. [Figure 11BY] Table C of the ABO gRNA target sequences is shown. [Figure 11BZ] Table C of the ABO gRNA target sequences is shown. [Figure 12]Table D shows exemplary RHD gRNA target sequences. [Figure 13A] Table E shows exemplary RHD gRNA target sequences that target coding exons. [Figure 13B] Table E shows exemplary RHD gRNA target sequences that target coding exons. [Figure 13C] Table E shows exemplary RHD gRNA target sequences that target coding exons. [Figure 13D] Table E shows exemplary RHD gRNA target sequences that target coding exons. [Figure 14A] Table F shows the RHD gRNA target sequences. [Figure 14B] Table F shows the RHD gRNA target sequences. [Figure 14C] Table F shows the RHD gRNA target sequences. [Figure 14D] Table F shows the RHD gRNA target sequences. [Figure 14E] Table F shows the RHD gRNA target sequences. [Figure 14F] Table F shows the RHD gRNA target sequences. [Figure 14G] Table F shows the RHD gRNA target sequences. [Figure 14H] Table F shows the RHD gRNA target sequences. [Figure 14I] Table F shows the RHD gRNA target sequences. [Figure 14J] Table F shows the RHD gRNA target sequences. [Figure 14K] Table F shows the RHD gRNA target sequences. [Figure 14L] Table F shows the RHD gRNA target sequences. [Figure 14M] Table F shows the RHD gRNA target sequences. [Figure 14N] Table F shows the RHD gRNA target sequences. [Figure 14O] Table F shows the RHD gRNA target sequences. [Figure 14P] Table F shows the RHD gRNA target sequences. [Figure 14Q] Table F of the RHD gRNA target sequences is shown. [Figure 14R] Table F of the RHD gRNA target sequences is shown. [Figure 14S] Table F of the RHD gRNA target sequences is shown. [Figure 14T] Table F of the RHD gRNA target sequences is shown. [Figure 14U] Table F of the RHD gRNA target sequences is shown. [Figure 14V] Table F of the RHD gRNA target sequences is shown. [Figure 14W] Table F of the RHD gRNA target sequences is shown. [Figure 14X] Table F of the RHD gRNA target sequences is shown. [Figure 14Y] Table F of the RHD gRNA target sequences is shown. [Figure 14Z] Table F of the RHD gRNA target sequences is shown. [Figure 14AA] Table F of the RHD gRNA target sequences is shown. [Figure 14AB] Table F of the RHD gRNA target sequences is shown. [Figure 14AC] Table F of the RHD gRNA target sequences is shown. [Figure 14AD] Table F of the RHD gRNA target sequences is shown. [Figure 14AE] Table F of the RHD gRNA target sequences is shown. [Figure 14AF] Table F of the RHD gRNA target sequences is shown. [Figure 14AG] Table F of the RHD gRNA target sequences is shown. [Figure 14AH] Table F of the RHD gRNA target sequences is shown. [Figure 14AI] Table F of the RHD gRNA target sequences is shown. [Figure 14AJ] Table F of the RHD gRNA target sequences is shown. [Figure 14AK] Table F of the RHD gRNA target sequences is shown. [Figure 14AL] Table F of the RHD gRNA target sequences is shown. [Figure 14AM] Table F shows the RHD gRNA target sequences. [Figure 14AN] Table F shows the RHD gRNA target sequences. [Figure 14AO] Table F shows the RHD gRNA target sequences. [Figure 14AP] Table F shows the RHD gRNA target sequences. [Figure 14AQ] Table F shows the RHD gRNA target sequences. [Figure 14AR] Table F shows the RHD gRNA target sequences. [Figure 14AS] Table F shows the RHD gRNA target sequences. [Figure 14AT] Table F shows the RHD gRNA target sequences. [Figure 14AU] Table F shows the RHD gRNA target sequences. [Figure 14AV] Table F shows the RHD gRNA target sequences. [Figure 14AW] Table F shows the RHD gRNA target sequences. [Figure 14AX] Table F shows the RHD gRNA target sequences. [Figure 14AY] Table F shows the RHD gRNA target sequences. [Figure 14AZ] Table F shows the RHD gRNA target sequences. [Figure 14BA] Table F shows the RHD gRNA target sequences. [Figure 14BB] Table F shows the RHD gRNA target sequences. [Figure 14BC] Table F shows the RHD gRNA target sequences. [Figure 14BD] Table F shows the RHD gRNA target sequences. [Figure 14BE] Table F shows the RHD gRNA target sequences. [Figure 14BF] Table F shows the RHD gRNA target sequences. [Figure 14BG] Table F shows the RHD gRNA target sequences. [Figure 14BH] Table F shows the RHD gRNA target sequences. [Figure 14BI]Table F shows the RHD gRNA target sequences. [Figure 14BJ] Table F shows the RHD gRNA target sequences. [Figure 14BK] Table F shows the RHD gRNA target sequences. [Figure 14BL] Table F shows the RHD gRNA target sequences. [Figure 14BM] Table F shows the RHD gRNA target sequences. [Figure 14BN] Table F shows the RHD gRNA target sequences. [Figure 14BO] Table F shows the RHD gRNA target sequences. [Figure 14BP] Table F shows the RHD gRNA target sequences. [Figure 14BQ] Table F shows the RHD gRNA target sequences. [Figure 14BR] Table F shows the RHD gRNA target sequences. [Figure 14BS] Table F shows the RHD gRNA target sequences. [Figure 14BT] Table F shows the RHD gRNA target sequences. [Figure 14BU] Table F shows the RHD gRNA target sequences. [Figure 14BV] Table F shows the RHD gRNA target sequences. [Figure 14BW] Table F shows the RHD gRNA target sequences. [Figure 14BX] Table F shows the RHD gRNA target sequences. [Figure 14BY] Table F shows the RHD gRNA target sequences. [Figure 14BZ] Table F shows the RHD gRNA target sequences. [Figure 14CA] Table F shows the RHD gRNA target sequences. [Figure 14CB] Table F shows the RHD gRNA target sequences. [Figure 14CC] Table F shows the RHD gRNA target sequences. [Figure 14CD] Table F shows the RHD gRNA target sequences. [Figure 14CE]Table F shows the RHD gRNA target sequences. [Figure 14CF] Table F shows the RHD gRNA target sequences. [Figure 14CG] Table F shows the RHD gRNA target sequences. [Figure 14CH] Table F shows the RHD gRNA target sequences. [Figure 14CI] Table F shows the RHD gRNA target sequences. [Figure 14CJ] Table F shows the RHD gRNA target sequences. [Figure 14CK] Table F shows the RHD gRNA target sequences. [Figure 14CL] Table F shows the RHD gRNA target sequences. [Figure 14CM] Table F shows the RHD gRNA target sequences. [Figure 14CN] Table F shows the RHD gRNA target sequences. [Figure 14CO] Table F shows the RHD gRNA target sequences. [Figure 14CP] Table F shows the RHD gRNA target sequences. [Figure 14CQ] Table F shows the RHD gRNA target sequences. [Figure 14CR] Table F shows the RHD gRNA target sequences. [Figure 14CS] Table F shows the RHD gRNA target sequences. [Figure 14CT] Table F shows the RHD gRNA target sequences. [Figure 14CU] Table F shows the RHD gRNA target sequences. [Figure 14CV] Table F shows the RHD gRNA target sequences. [Figure 14CW] Table F shows the RHD gRNA target sequences. [Figure 14CX] Table F shows the RHD gRNA target sequences. [Figure 14CY] Table F shows the RHD gRNA target sequences. [Figure 14CZ] Table F shows the RHD gRNA target sequences. [Figure 14DA]Table F shows the RHD gRNA target sequences. [Figure 14DB] Table F shows the RHD gRNA target sequences. [Figure 14DC] Table F shows the RHD gRNA target sequences. [Figure 14DD] Table F shows the RHD gRNA target sequences. [Figure 14DE] Table F shows the RHD gRNA target sequences. [Figure 14DF] Table F shows the RHD gRNA target sequences. [Figure 14DG] Table F shows the RHD gRNA target sequences. [Figure 14DH] Table F shows the RHD gRNA target sequences. [Figure 14DI] Table F shows the RHD gRNA target sequences. [Figure 14DJ] Table F shows the RHD gRNA target sequences. [Figure 14DK] Table F shows the RHD gRNA target sequences. [Figure 14DL] Table F shows the RHD gRNA target sequences. [Figure 14DM] Table F shows the RHD gRNA target sequences. [Figure 14DN] Table F shows the RHD gRNA target sequences. [Figure 14DO] Table F shows the RHD gRNA target sequences. [Figure 14DP] Table F shows the RHD gRNA target sequences. [Figure 14DQ] Table F shows the RHD gRNA target sequences. [Figure 14DR] Table F shows the RHD gRNA target sequences. [Figure 14DS] Table F shows the RHD gRNA target sequences. [Figure 14DT] Table F shows the RHD gRNA target sequences. [Figure 14DU] Table F shows the RHD gRNA target sequences. [Figure 14DV] Table F shows the RHD gRNA target sequences. [Figure 14DW]Table F shows the RHD gRNA target sequences. [Figure 14DX] Table F shows the RHD gRNA target sequences. [Figure 14DY] Table F shows the RHD gRNA target sequences. [Figure 14DZ] Table F shows the RHD gRNA target sequences. [Figure 14EA] Table F shows the RHD gRNA target sequences. [Figure 14EB] Table F shows the RHD gRNA target sequences. [Figure 14EC] Table F shows the RHD gRNA target sequences. [Figure 14ED] Table F shows the RHD gRNA target sequences. [Figure 14EE] Table F shows the RHD gRNA target sequences. [Figure 14EF] Table F shows the RHD gRNA target sequences. [Figure 14EG] Table F shows the RHD gRNA target sequences. [Figure 14EH] Table F shows the RHD gRNA target sequences. [Figure 14EI] Table F shows the RHD gRNA target sequences. [Figure 14EJ] Table F shows the RHD gRNA target sequences. [Figure 14EK] Table F shows the RHD gRNA target sequences. [Figure 14EL] Table F shows the RHD gRNA target sequences. [Figure 14EM] Table F shows the RHD gRNA target sequences. [Figure 14EN] Table F shows the RHD gRNA target sequences. [Figure 14EO] Table F shows the RHD gRNA target sequences. [Figure 14EP] Table F shows the RHD gRNA target sequences. [Figure 14EQ] Table F shows the RHD gRNA target sequences. [Figure 14ER] Table F shows the RHD gRNA target sequences. [Figure 14ES]Table F shows the RHD gRNA target sequences. [Figure 14ET] Table F shows the RHD gRNA target sequences. [Figure 14 EU] Table F shows the RHD gRNA target sequences. [Figure 14EV] Table F shows the RHD gRNA target sequences. [Figure 14EW] Table F shows the RHD gRNA target sequences. [Figure 14EX] Table F shows the RHD gRNA target sequences. [Figure 14EY] Table F shows the RHD gRNA target sequences. [Figure 14EZ] Table F shows the RHD gRNA target sequences. [Figure 14FA] Table F shows the RHD gRNA target sequences. [Figure 14FB] Table F shows the RHD gRNA target sequences. [Figure 14FC] Table F shows the RHD gRNA target sequences. [Figure 14FD] Table F shows the RHD gRNA target sequences. [Figure 14FE] Table F shows the RHD gRNA target sequences. [Figure 15] Table G shows an example of FUT1 gRNA target sequences. [Figure 16A] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16B] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16C] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16D] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16E] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16F] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16G] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16H] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16I] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16J] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16K] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 16L] Table H shows exemplary FUT1 gRNA target sequences that target coding exons. [Figure 17A] Table I shows the FUT1 gRNA target sequences. [Figure 17B] Table I shows the FUT1 gRNA target sequences. [Figure 17C] Table I shows the FUT1 gRNA target sequences. [Figure 17D] Table I shows the FUT1 gRNA target sequences. [Figure 17E] Table I shows the FUT1 gRNA target sequences. [Figure 17F] Table I shows the FUT1 gRNA target sequences. [Figure 17G] Table I shows the FUT1 gRNA target sequences. [Figure 17H] Table I shows the FUT1 gRNA target sequences. [Figure 17I] Table I shows the FUT1 gRNA target sequences. [Figure 17J] Table I shows the FUT1 gRNA target sequences. [Figure 17K] Table I shows the FUT1 gRNA target sequences. [Figure 17L] Table I shows the FUT1 gRNA target sequences. [Figure 17M] Table I shows the FUT1 gRNA target sequences. [Figure 17N]Table I shows the FUT1 gRNA target sequences. [Figure 17O] Table I shows the FUT1 gRNA target sequences. [Figure 17P] Table I shows the FUT1 gRNA target sequences. [Figure 17Q] Table I shows the FUT1 gRNA target sequences. [Figure 17R] Table I shows the FUT1 gRNA target sequences. [Figure 17S] Table I shows the FUT1 gRNA target sequences. [Figure 17T] Table I shows the FUT1 gRNA target sequences. [Figure 17U] Table I shows the FUT1 gRNA target sequences. [Figure 17V] Table I shows the FUT1 gRNA target sequences. [Figure 17W] Table I shows the FUT1 gRNA target sequences. [Figure 17X] Table I shows the FUT1 gRNA target sequences. [Figure 17Y] Table I shows the FUT1 gRNA target sequences. [Figure 17Z] Table I shows the FUT1 gRNA target sequences. [Figure 17AA] Table I shows the FUT1 gRNA target sequences. [Figure 17AB] Table I shows the FUT1 gRNA target sequences. [Figure 17AC] Table I shows the FUT1 gRNA target sequences. [Figure 17AD] Table I shows the FUT1 gRNA target sequences. [Figure 18] This study demonstrates RUES2-cardiomyocellular survival when incubated with blood-compatible monkey serum, and rejection when incubated with incompatible blood. [Modes for carrying out the invention]

[0171] I. Introduction The present invention is partly based on methods for genetically modifying cells to produce tissue blood antigen types suitable for universal transplantation. Methods for gene editing of ABO, RHD, and FUT1 genes to produce universal tissue blood group cells are described. In some embodiments, cells possessing such genetic modifications also undergo genetic alterations in genes that regulate the expression of MHC I and / or MHC II antigens. The cells outlined herein can improve and facilitate the implementation and delivery of cell therapies to patients.

[0172] II. Definition As used herein, “immunogenicity” refers to the property that, when introduced into a subject (e.g., a human subject), enables a substance to induce a detectable immune response (humoral or cellular).

[0173] Where used herein to characterize cells, the term “low immunogenic” generally means that such cells are less likely to cause immune rejection by the recipient to whom they are transplanted. For example, compared to unmodified or unaltered wild-type cells, such low immunogenic cells are less likely to cause immune rejection by the recipient to whom they are transplanted by approximately 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, and 99% or less. In some embodiments, genome editing techniques are used to modulate the expression of MHC I and MHC II genes, and thus generate low immunogenic cells. In some embodiments, low immunogenic cells avoid immune rejection in MHC-incompatible allogeneic recipients. In some cases, differentiated cells produced from low immunogenic stem cells outlined herein avoid immune rejection when administered (e.g., transplanted or grafted) to MHC-incompatible allogeneic recipients. In some embodiments, low immunogenicity cells are protected from T cell-mediated adaptive immune rejection and / or innate immune cell rejection.

[0174] The low immunogenicity of cells can be determined by evaluating the immunogenicity of the cells, including their ability to induce adaptive and innate immune responses. Such immune responses can be measured using assays recognized by those skilled in the art. In some embodiments, immune response assays measure the effect of low immunogenic cells on T cell proliferation, T cell activation, T cell death, NK cell proliferation, NK cell activation, and macrophage activation. In some cases, low immunogenic cells and their derivatives undergo reduced T cell and / or NK cell death upon administration to a subject. In some cases, cells and their derivatives show reduced macrophage phagocytosis compared to unmodified or wild-type cells. In some embodiments, low immunogenic cells induce a reduced or diminished immune response in the recipient subject compared to the corresponding unmodified wild-type cells. In some embodiments, low immunogenic cells are non-immunogenic or unable to induce an immune response in the recipient subject.

[0175] The "HLA" or "Human Leukocyte Antigen" complex is a gene complex that codes for human major histocompatibility complex (MHC) proteins. These cell surface proteins that make up the HLA complex are involved in regulating the immune response to antigens. Humans have two MHC classes, "HLA-I" and "HLA-II". HLA-I includes three proteins, HLA-A, HLA-B, and HLA-C, which present peptides from within the cell, and antigens presented by the HLA-I complex attract killer T cells (also known as CD8+ T cells or cytotoxic T cells). HLA-I proteins are associated with β-2 microglobulin (B2M). HLA-II includes five proteins, HLA-DP, HLA-DM, HLA-DOB, HLA-DQ, and HLA-DR, which present antigens to T lymphocytes from outside the cell. This stimulates CD4+ cells (also known as T helper cells). It should be understood that the use of either "MHC" or "HLA" is not intended to be limiting, as it depends on whether the gene originates from a human (HLA) or mouse (MHC) organism. Therefore, since this relates to mammalian cells, these terms may be used interchangeably herein.

[0176] As used herein, “avoiding rejection,” “escaping rejection,” “preventing rejection,” and similar terms are interchangeable to refer to genetically modified or otherwise modified membrane products and cells according to the present invention that are less likely to be rejected when transplanted into a subject compared to the corresponding products and cells that are not genetically modified according to the invention. In some embodiments, the genetically modified products and cells according to the present invention are less likely to be rejected when transplanted into a subject compared to the corresponding cells that are incompatible with the subject's ABO blood group or Rh factor.

[0177] In this specification, "allogeneic" means the genetic dissimilarity between the host organism and the cell transplant that generates the immune cell response.

[0178] The term “pluripotent cell” refers to a cell that can self-replicate and proliferate while maintaining an undifferentiated state and, under appropriate conditions, can be induced to differentiate into a specific cell type. As used herein, the term “pluripotent cell” encompasses embryonic stem cells and other types of stem cells, including fetal, amniotic, or somatic cells. Exemplary human stem cell lines include the H9 human embryonic stem cell line and the RUES2 human embryonic stem cell line. Further exemplary stem cell lines include those available through the Health Human Embryonic Stem Cell Registry and the Howard Hughes Medical Institute HUES collection (as described in Cowan, CA et al., New England J.Med. 350:13. (2004)). As used herein, “pluripotent stem cells” have the potential to differentiate into any of three germ layers: endoderm (e.g., gastric junctions, gastrointestinal tract, lungs), mesoderm (e.g., muscle, bone, blood, genitourinary tissues), or ectoderm (e.g., epidermal tissues and nervous system tissues). As used herein, the term “pluripotent stem cell” also includes “induced pluripotent stem cells” or “iPSCs,” which are a type of pluripotent stem cell derived from non-pluripotent cells. Examples of parental cells include somatic cells that have been reprogrammed to induce a pluripotent, undifferentiated phenotype by various means. Such “iPS” or “iPSC” cells can be produced by inducing the expression of specific regulatory genes or by the exogenous application of specific proteins. Methods for inducing iPS cells are known in the art and are described further below. (See, for example, Zhou et al., Stem Cells 27(11):2667-74(2009), Huangfu et al, Nature Biotechnol. 26(7):795(2008), Woltjen et al., Nature 458(7239):766-770(2009), and Zhou et al., Cell Stem Cell 8:381-384(2009), each of which is incorporated herein by reference in its entirety.) The generation of induced pluripotent stem cells (iPSCs) is outlined below.As used herein, "hiPSC" refers to human induced pluripotent stem cells.

[0179] Several characteristics of pluripotent stem cells distinguish them from other cells. For example, the ability to produce offspring that, under appropriate conditions, can differentiate into cell types exhibiting collectively lineage-related features from all three germ layers (e.g., endoderm, mesoderm, and ectoderm) is a characteristic of pluripotent stem cells. The expression or non-expression of specific combinations of molecular markers is also a pluripotent stem cell characteristic. For example, human pluripotent stem cells express at least some, and in some embodiments all, of the non-limiting list of SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, TRA-2-49 / 6E, ALP, Sox2, E-cadherin, UTF-1, Oct4, Rex1, and Nanog. Cell morphologies associated with pluripotent stem cells are also characteristics of pluripotent stem cells. Cells do not need to go through pluripotency to be reprogrammed into endodermal progenitor cells and / or hepatocytes.

[0180] As used herein, “non-pluripotent cells” refers to mammalian cells that are not pluripotent. Examples of such cells include differentiated cells and progenitor cells. Examples of differentiated cells include, but are not limited to, cells from tissues selected from bone marrow, skin, skeletal muscle, adipose tissue, and peripheral blood. Exemplary cell types include, but are not limited to, fibroblasts, hepatocytes, myoblasts, neurons, osteoblasts, osteoclasts, and T cells. Starting cells used to generate induced pluripotent cells, endodermal progenitor cells, and hepatocytes may be non-pluripotent cells.

[0181] As used herein, “pluripotent” or “pluripotent cell” refers to a cell type capable of giving rise to a limited number of other specific cell types. For example, induced pluripotent cells can form endodermal cells. Furthermore, pluripotent hematopoietic stem cells can differentiate into several types of blood cells, including lymphocytes, monocytes, and neutrophils.

[0182] Differentiated cells include, but are not limited to, pluripotent, oligopotent, unipotent, progenitor, and terminally differentiated cells. In certain embodiments, low-potential cells are considered "differentiated" in relation to potential cells.

[0183] Somatic cells are cells that make up the body of an organism. Somatic cells include cells that make up organs, skin, blood, bone, and connective tissue in an organism, but do not include germ cells. As used herein, somatic cells include, but are not limited to, cardiac cells, hepatocytes, kidney cells, pancreatic cells, nerve cells, glial cells, immune cells, mesenchymal cells, epithelial cells, and endothelial cells.

[0184] In some embodiments, the term “immune cells” as used herein includes, for example, immune effector cells, as described herein. Exemplary immune effector cells include T cells, e.g., alpha / beta T cells and gamma / delta T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, bone marrow-derived phagocytic cells, or combinations thereof.

[0185] In this specification, “low immunogenic pluripotent cells,” “low immunopluripotent cells,” or “HIP cells” means pluripotent cells that retain their pluripotency while exhibiting a reduced immunological rejection response upon transfer to an allogeneic host. In preferred embodiments, HIP cells do not evoke an immune response. Thus, “low immunogenic” means that the immune response is significantly reduced or eliminated compared to the immune response of the parent (i.e., “wild-type”) cells prior to immunoengineering as outlined herein. In many cases, HIP cells retain pluripotency while being immunosilent. Assays for HIP properties are outlined below.

[0186] In the context of cells, “wild-type” or “wt” means naturally occurring cells. However, in the context of pluripotent stem cells as used herein, this also means iPSCs that may contain nucleic acid alterations resulting in pluripotency but which have not undergone the gene editing procedure of the present invention to achieve low immunogenicity.

[0187] Terms such as “treat,” “medicate,” and “therapy” applied to isolated cells include subjecting cells to any type of process or condition, or performing any type of operation or procedure on cells. Where applied to subjects, these terms refer to administering cells or cell populations to an individual in which a target polynucleotide sequence (e.g., B2M) has been ex vivo modified according to the method described herein. The individual is typically ill or injured, or at higher risk of becoming ill compared to the average member of the population, and therefore requires such attention, care, or management.

[0188] As used herein, the terms “to treat” and “treatment” mean administering to a subject an effective amount of cells having a target polynucleotide sequence ex vivo modified according to the method herein, such that the subject has relief of at least one symptom or improvement of the disease, for example, a beneficial or desirable clinical outcome. For the purposes of the present invention, beneficial or desirable clinical outcomes include, but are not limited to, relief of one or more symptoms, reduction of the severity of the disease, a stable (i.e., non-worsening) state of the disease, delay or slowing of disease progression, improvement or mitigation of the condition, and remission (partial or total), whether detectable or undetectable. To treat also includes extending survival time compared to the survival expected without treatment. As such, those skilled in the art will recognize that treatment may improve the disease state but may not be a complete cure of the disease. As used herein, the term “treatment” includes prevention. Alternatively, if the progression of the disease is reduced or stopped, treatment is “effective.” “Treatment” also means extending survival time compared to the survival expected without treatment. Those requiring treatment include individuals already diagnosed with polynucleotide sequence expression disorders, as well as those likely to develop such disorders due to genetic susceptibility or other factors.

[0189] "Treatment" or "prevention" of a disease or disorder means delaying or preventing the onset of such disease or disorder, reversing, mitigating, improving, inhibiting, slowing or stopping its progression, or worsening or aggravating the progression or severity of a condition associated with such disease or disorder. In one embodiment, the symptoms of the disease or disorder are reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%.

[0190] As used herein, the terms “administer,” “introduce,” and “transplant” are interchangeable in the context of placing cells, for example, cells described herein containing a target polynucleotide sequence modified according to the method of the present invention, into a target by a method or route that results in at least partial localization of the introduced cells to a desired site. The cells can be transplanted directly into the desired site or administered by any suitable route that results in delivery to a desired site in the target in which the transplanted cells or at least a portion of the cellular components remain viable. The survival time of cells after administration to a target can range from a few hours, e.g., 24 hours to several days, to several years. In some cases, cells may also be administered to a site other than the desired site, such as intrahepatically or subcutaneously, e.g., in a capsule, in order to maintain the transplanted cells at the transplant site and prevent migration of the transplanted cells.

[0191] As used herein, the term “effective dose” means a sufficient amount of a pharmaceutical composition to significantly and positively modify (e.g., provide a positive clinical response) the symptom and / or condition being treated. The effective dose of an active ingredient for use in a pharmaceutical composition will vary depending on the specific condition being treated, the severity of the condition, the duration of treatment, the nature of the concomitant therapy, the specific active ingredient used, the specific pharmaceutically acceptable excipients and / or carriers used, and similar factors, including the knowledge and expertise of the attending physician.

[0192] As used herein, the term “pharmaceutically acceptable” means an excipient, composition, and / or dosage form suitable for use in contact with human and animal tissues, within the bounds of sound medical judgment, without excessive toxicity, irritation, allergic reactions, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0193] RNA molecules that bind to CRISPR-Cas components and target them to specific locations within target DNA are referred to herein as “guide RNA,” “gRNA,” or “small guide RNA,” and may also be referred to herein as “DNA targeting RNA,” and the guide RNA comprises at least two nucleotide segments: at least one “DNA binding segment” and at least one “polypeptide binding segment.” “Segment” means a part, section, or region of a molecule, e.g., a contiguous segment of nucleotides in an RNA molecule. The definition of “segment” is not limited to a specific number of total base pairs unless otherwise specified. In some embodiments, targeting is achieved by hybridizing a portion of the gRNA with DNA (e.g., via a gRNA targeting domain) and by binding a portion of the gRNA molecule to an RNA-inducing nuclease or other effector molecule (e.g., via at least a gRNA tracr). In some embodiments, the gRNA molecule consists of a single adjacent polynucleotide molecule, referred herein as “single guide RNA” or “sgRNA,” etc. In other embodiments, the gRNA molecule comprises multiple, usually two, polynucleotide molecules, which can typically associate themselves through hybridization and are referred herein to as “dual guide RNA” or “dgRNA,” etc. The gRNA molecule is described in more detail below and generally includes a targeting domain and a tracr. In other embodiments, the targeting domain and tracr are located on a single polynucleotide. The guide RNA can be introduced into target cells as an isolated RNA molecule or by using an expression vector containing DNA encoding the guide RNA.

[0194] As used herein, the term “guide RNA target” includes each and any of the RNA sequences of the guide RNA targets described herein, as well as their variants used for gene editing. In some embodiments, the guide RNA target includes a target sequence to which the guide RNA binds, thereby enabling gene editing of the target sequence. The guide RNA target may correspond to a target sequence and may not include a PAM sequence.

[0195] The "DNA-binding segment" (or "DNA-targeting sequence") of the guide RNA contains a nucleotide sequence that is complementary to a specific sequence in the target DNA.

[0196] The guide RNA can contain one or more polypeptide-binding sequences / segments. The polypeptide-binding segment (or "protein-binding sequence") of the guide RNA interacts with the RNA-binding domain of the Cas protein.

[0197] As used herein, the term “Cas9 molecule” refers to Cas9 wild-type protein, Cas9 protein modifications, Cas9 protein variants, Cas9 orthologues, and combinations thereof, all derived from the type II CRISPR-Cas9 system.

[0198] The terms “donor polynucleotide,” “donor template,” and “donor oligonucleotide” are used interchangeably and refer to polynucleotides that provide a nucleic acid sequence intended to be incorporated into a selected nucleic acid target site, at least in part. Generally, donor polynucleotides are single-stranded or double-stranded polynucleotides. For example, the Operation II CRISPR-Cas9 system can be used in combination with a donor DNA template to modify a DNA target sequence in genomic DNA, and the genomic DNA is modified to include at least a portion of the donor DNA template in the DNA target sequence. In some embodiments, the vector contains a donor polynucleotide, and in other embodiments, the donor polynucleotide is an oligonucleotide.

[0199] As used herein, the term “HDR” refers to homology-directed repair, the process of repairing DNA damage using homologous nucleic acids (e.g., endogenous homologous sequences, e.g., sister chromatids, or exogenous nucleic acids, e.g., template nucleic acids). HDR typically acts when significant excision occurs in a double-strand break, forming at least one single-stranded portion of DNA. In normal cells, HDR typically involves a series of steps including break recognition, break stabilization, excision, single-stranded DNA stabilization, DNA crossover intermediate formation, crossover intermediate degradation, and ligation. In some cases, HDR requires nucleotide sequence homology and uses a donor template (e.g., donor DNA template) or donor oligonucleotide to repair the sequence where the double-strand break occurred (e.g., a DNA target sequence). This results in, for example, the transcription of genetic information from the donor template DNA to the DNA target sequence. If the donor template DNA sequence or oligonucleotide sequence differs from the DNA target sequence, and some or all of the donor template DNA polynucleotide or oligonucleotide is incorporated into the DNA target sequence, HDR can result in alterations (e.g., insertions, deletions, mutations) of the DNA target sequence. In some embodiments, the entire donor template DNA polynucleotide, a portion of the donor template DNA polynucleotide, or a copy of the donor polynucleotide is incorporated into the site of the DNA target sequence.

[0200] As used herein, the terms “non-homologous end join” or “NHEJ” refer to ligation-mediated repairs and / or non-template-mediated repairs.

[0201] The methods of the present invention can be used to modify a target polynucleotide sequence within a cell. The present invention is intended to modify a target polynucleotide sequence within a cell for any purpose. In some embodiments, the target polynucleotide sequence within a cell is modified to produce mutant cells. As used herein, “mutant cell” refers to a cell having a genotype that results in a genotype different from its original genotype. In some cases, a “mutant cell” exhibits a mutant phenotype, for example, when a normally functioning gene is modified using the CRISPR / Cas system of the present invention. In other examples, for example, when the CRISPR / Cas system of the present invention is used to correct a mutant genotype, a “mutant cell” exhibits a wild-type phenotype. In some embodiments, the target polynucleotide sequence within a cell is modified to correct or repair a gene mutation (e.g., to restore a normal phenotype to the cell). In some embodiments, the target polynucleotide sequence within a cell is modified to induce a gene mutation (e.g., to disrupt the function of a gene or genomic element).

[0202] In some embodiments, the modification is an indel. As used herein, “indel” refers to a mutation resulting from an insertion, deletion, or combination thereof. As will be understood by those skilled in the art, an indel in the coding region of a genome sequence will result in a frameshift mutation unless the length of the indel is a multiple of 3. In some embodiments, the modification is a point mutation. As used herein, “point mutation” refers to a substitution that replaces one of the nucleotides. Using the CRISPR / Cas system of the present invention, point mutations in indels of any length or in target polynucleotide sequences can be induced.

[0203] As used herein, “knockout” includes deleting all or part of a target polynucleotide sequence in a manner that interferes with the function of the target polynucleotide sequence. For example, knockout can be achieved by modifying the target polynucleotide sequence by inducing an indel in the functional domain (e.g., the DNA-binding domain) of the target polynucleotide sequence. Those skilled in the art will readily understand how to knock out a target polynucleotide sequence or part of it based on the details described herein using the CRISPR / Cas system of the present invention.

[0204] The process of "gene knockout" inactivates a specific gene within a host cell in which it resides, resulting in either the non-production of the desired protein or an inactive form, as understood by those skilled in the art and further described below. This can be achieved in several different ways, including removing a nucleic acid sequence from a gene, interrupting its sequence with other sequences, altering the reading frame, or altering the regulatory components of the nucleic acid. For example, all or part of the coding region of the desired gene can be removed or replaced with a "nonsense" sequence; all or part of regulatory sequences such as promoters can be removed or replaced; the translation initiation sequence can be removed or replaced, and so on.

[0205] In some embodiments, the modification results in the knockout of a target polynucleotide sequence or a portion thereof. Knocking out a target polynucleotide sequence or a portion thereof using the CRISPR / Cas system of the present invention may be useful for a variety of applications. For example, knocking out a target polynucleotide sequence within a cell can be performed in vitro for research purposes. For ex vivo purposes, knocking out a target polynucleotide sequence within a cell may be useful to treat or prevent disorders associated with the expression of the target polynucleotide sequence (e.g., by knocking out a mutant allele within a cell ex vivo and then introducing the knocked-out mutant allele into the target cell).

[0206] In this specification, “knock-in” means the process of adding genetic function to a host cell, thereby increasing the level of the encoded protein. As will be understood by those skilled in the art, this can be achieved in several ways, including adding one or more additional copies of a gene to a host cell, or modifying the regulatory components of an endogenous gene that increases protein expression. This can be achieved by modifying a promoter, adding a different promoter, adding an enhancer, or modifying other gene expression sequences.

[0207] As used herein, “vector” or “multiple vectors” refers to a tool that enables or facilitates the transfer of entities from one environment to another.

[0208] As used herein, the term “packaging cell” includes cells that contain some or all of the elements necessary for packaging an infectious recombinant virus or viral vector. Packaging cells may lack a recombinant viral vector. Typically, such packaging cells contain one or more vectors capable of expressing viral structural proteins. Cells containing only some of the elements necessary for the production of enveloped viral particles are useful as intermediate reagents in the generation of viral particle-producing cell lines through subsequent steps of transient transfection, transduction, or stable incorporation of each additional required element. These intermediate reagents are encompassed within the term “packaging cell.”

[0209] As used herein, “viral particle” means a replicative or defective virus, or a viral vector derived therefrom, which may or may not contain the nucleotide of interest.

[0210] An "enveloped virus" refers to a virus that contains a proteinaceous viral envelope surrounding the viral capsid. Such enveloped viruses include orthomyxoviruses and paramyxoviruses, herpesviruses, togaviruses, lentiviruses, and retroviruses. During cell infection by an enveloped virus, the host cell's plasma membrane is modified to contain several virus-encoded proteins, and the viral nucleoprotein core, once it leaves the host cell in which it was assembled, is encased in the modified membrane to form the viral envelope.

[0211] Lentiviral vectors are part of a larger group of retroviral vectors. A detailed list of lentiviruses can be found in Coffin, J. Met. al. (1997) Retroviruses, Cold Spring Harbor Laboratory Press, 758-63. Lentiviruses can be divided into primate and non-primate groups. Examples of primate lentiviruses include, but are not limited to, human immunodeficiency virus (HIV), the causative agent of human acquired immunodeficiency syndrome (AIDS), and simian immunodeficiency virus (SIV). Examples of non-primate lentiviruses include the prototype “slow virus” Visna / Maegivirus (VMV), as well as related canine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and the recently reported feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).

[0212] The lentivirus family differs from retroviruses in that lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis, P. et al. (1992) EMBO J 11:3053-8; Lewis, P. F et al. (1994) J. Virol. 68:510-6). In contrast, other retroviruses such as MLV cannot infect non-dividing cells or slowly dividing cells, such as the cells that make up muscle, brain, lung, and liver tissue.

[0213] Lentiviral vectors can be "primate" vectors. Lentiviral vectors can also be "non-primate" vectors (i.e., derived from viruses that do not primarily infect primates, especially humans). Examples of non-primate lentiviruses can be any member of the Lentiviridae family that does not naturally infect primates.

[0214] In some embodiments, the lentiviral vector is a pseudotyped lentiviral vector. A pseudotyped lentiviral vector contains vector particles that possess glycoproteins derived from other enveloped viruses. Pseudotyping is a mechanism for expanding the cytotropy of enveloped viruses through the formation of phenotypically mixed particles or pseudotypes. In some embodiments, the vector may be pseudotyped with the fusion envelope G glycoprotein of vesicular stomatitis virus (VSV-G). The pseudotyped protein may be derived from rabies virus, MLV, Ebola virus, baculovirus, paramyxovirus (e.g., measles virus, Hendra virus, Nipah virus), and filovirus.

[0215] In some embodiments, the lentiviral vector is either an HIV-1 or HIV-2 derivative vector. HIV-1 vectors contain cis-acting elements also found in simple retroviruses. The sequence extending within the gag open reading frame has been shown to be crucial for HIV-1 packaging. Therefore, HIV-1 vectors often contain the relevant portion of the gag with a mutated translation start codon. Furthermore, most HIV-1 vectors also contain a portion of the env gene, including the RRE. Rev binds to the RRE, enabling the transport of full-length or single-spliced ​​mRNA from the nucleus to the cytoplasm. In the absence of Rev and / or RRE, full-length HIV-1 RNA accumulates in the nucleus. Alternatively, the requirements for Rev and RRE can be relaxed by using constitutive transport elements from certain simple retroviruses, such as the Mason-Pfizer monkey virus. The viral protein Tat is required for efficient transcription from the HIV-1 LTR promoter. Most HIV-2 derivative vectors are structurally very similar to HIV-1 vectors. Similar to HIV-I vectors, HIV-2 vectors also require RRE for efficient transport of full-length or single-spliced ​​viral RNA. The HIV-derived vectors used in this invention are not limited to HIV strains.

[0216] In some embodiments, the plasmid vector used to produce a viral genome in a host cell / packaging cell contains sufficient lentiviral genetic information to enable the packaging of the RNA genome into viral particles that are not independently replicable but can infect target cells in the presence of the packaging component, in order to produce infectious viral particles in the final target cell. In preferred embodiments, the vector lacks functional gag-pol and / or env genes and / or other genes essential for replication. In some embodiments, the plasmid vector contains transcriptional regulatory sequences that are operably ligated to the lentiviral genome to direct the transcription of the genome in the host cell / packaging cell. These regulatory sequences may be native sequences associated with the transcribed viral sequence (i.e., the 5'U3 region) or heterologous promoters such as another viral promoter (e.g., the CMV promoter).

[0217] In some embodiments, the vector is embedded defective. Embedded defective lentiviral vectors (IDLVs) can be produced, for example, by packaging the vector with a catalytically inactive integrase (e.g., HIV integrase with the D64V mutation at the catalytic site; Naldini, L. et al. (1996) Science 272:263-7, Naldini, L. et al. (1996) Proc. Natl. Acad. Sci. USA 93:11382-8, Leavitt, A et al. (1996) J. Virol. 70:721-8), or by modifying or deleting the essential att sequence from the vector LTR (Nightingale, S. J et al. (2006) Mol. Ther. 13:1121-32), or by any combination of the above.

[0218] In some embodiments, the lentiviral vector is herpes simplex virus (HSV). Herpes simplex virus (HSV) is an enveloped, double-stranded DNA virus that naturally infects neurons. HSV can accommodate large sections of foreign DNA, which makes it an attractive vector system and has been used as a vector for gene delivery to neurons. The use of HSV in therapeutic procedures requires that the strain be attenuated so that a lysis cycle cannot be established. When HSV vectors are used in human gene therapy, the gene of interest is preferably inserted into an essential gene. This is necessary because if the vector virus encounters a wild-type virus, the transfer of the heterologous gene into the wild-type virus can occur by recombination. However, as long as the NOI is inserted into an essential gene, recombination also deletes the essential gene in the recipient virus, preventing the heterologous gene from "escaping" into a population of wild-type viruses that can replicate.

[0219] In other embodiments, the lentiviral vector is a vaccinia virus-derived vector. Vaccinia virus is a large enveloped virus with a linear, double-stranded DNA genome of approximately 190 kb. Vaccinia virus can accommodate up to approximately 25 kb of foreign DNA, which is also useful for the delivery of large genes. Several decayed vaccinia virus strains are known in the art and are suitable for gene therapy applications, such as MVA and NYVAC strains.

[0220] "Nucleic acid," "nucleic acid molecule," "oligonucleotide," or "polynucleotide" refers to a macromolecule containing covalently linked nucleotides. The term "nucleic acid" includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which can be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA.

[0221] A "gene" refers to an assembly of nucleotides that encode a polypeptide, including cDNA and genomic DNA nucleic acid molecules. A "gene" also refers to a nucleic acid fragment that can act as a regulatory sequence before (5' non-coding sequence) and after (3' non-coding sequence) a coding sequence.

[0222] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein and refer to polymeric forms of amino acids of any length, which may include coding and non-coding amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having a modified peptide backbone.

[0223] As used herein, “amino acid” refers to a compound containing both a carboxyl (--COON) and an amino (--NH.sub.2) group. “Amino acid” refers to both natural and unnatural, i.e., synthetic amino acids. Natural amino acids with three-letter and one-letter abbreviations include alanine (Ala;A); arginine (Arg, R); asparagine (Asn;N); aspartic acid (Asp;D); cysteine ​​(Cys;C); glutamine (Gln;Q); glutamic acid (Glu;E); glycine (Gly;G); histidine (His;H); isoleucine (Ile;I); leucine (Leu;L); lysine (Lys;K); methionine (Met;M); phenylalanine (Phe;F); proline (Pro;P); serine (Ser;S); threonine (Thr;T); tryptophan (Trp;W); tyrosine (Tyr;Y); and valine (Val;V).

[0224] "Amino acid substitution" refers to a polypeptide or protein comprising one or more substitutions of a wild-type or naturally occurring amino acid at that amino acid residue with amino acids different from the wild-type or naturally occurring amino acid. The substituted amino acids of the present invention may be synthetic or naturally occurring amino acids. In certain embodiments, the substituted amino acid is a naturally occurring amino acid selected from the group consisting of A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, and V. Substitutive variants may be described using abbreviated systems; for example, a substitution variant in which the fifth (5.sup.th) amino acid residue is substituted may be abbreviated as "X5Y", where "X" is the wild-type or naturally occurring amino acid to be substituted, "5" is the amino acid residue in the protein or polypeptide, and "Y" is the substituted, or non-wild-type or non-naturally occurring amino acid.

[0225] The term "recombinant," when used in relation to nucleic acid molecules, peptides, polypeptides, or proteins, means a novel combination of genetic material not known to exist in nature. Recombinant molecules can be produced by any of the well-known techniques available in the field of recombinant technology, including but not limited to polymerase chain reaction (PCR), gene splicing (e.g., using restriction endonucleases), and solid-state synthesis of nucleic acid molecules, peptides, or proteins.

[0226] An "isolated" polypeptide, protein, peptide, or nucleic acid is a molecule that has been removed from its natural environment. It should also be understood that an "isolated" polypeptide, protein, peptide, or nucleic acid may be formulated with excipients such as diluents or adjuvants and may still be considered isolated.

[0227] As used herein, the terms “regulatory sequence,” “regulatory element,” and “modulatory element” are interchangeable and refer to a polynucleotide sequence that is upstream (5' non-coding sequence), internal, or downstream (3' untranslated sequence) of an expressed polynucleotide target. Regulatory sequences affect, for example, the timing of transcription, the amount or level of transcription, RNA processing or stability, and / or the translation of related structural nucleotide sequences. Regulatory sequences include activator-binding sequences, enhancers, introns, polyadenylation-recognition sequences, promoters, repressor-binding sequences, stem-loop structures, translation initiation sequences, translation leader sequences, transcription termination sequences, translation termination sequences, and primer-binding sites.

[0228] As used herein, “promoter,” “promoter sequence,” or “promoter region” refers to a DNA regulatory region / sequence that can bind to RNA polymerase and participate in the initiation of transcription of downstream coding or non-coding sequences. In some embodiments, the promoter sequence includes a transcription initiation site and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at a level detectable beyond the background. In some embodiments, the promoter sequence includes a transcription initiation site and a protein-binding domain involved in RNA polymerase binding. Eukaryotic promoters often contain “TATA” and “CAT” boxes, but are not necessarily so.

[0229] Constitutive promoters are typically active under most conditions, i.e., they promote transcription. Inducible promoters are typically active only in the presence of a given molecular factor (e.g., IPTG) or under specific environmental conditions (e.g., a particular CO2 concentration, nutrient level, light, heat). In the absence of those conditions, inducible promoters typically do not tolerate significant or measurable levels of transcriptional activity. For example, inducible promoters can be induced according to temperature, pH, hormones, metabolites (e.g., lactose, mannitol, amino acids), light (e.g., wavelength-specific), osmotic potential (e.g., salt-inducible), heavy metals, or antibiotics. Numerous standard inducible promoters will be known to those skilled in the art.

[0230] As used herein, the term “operably linked” refers to polynucleotide or amino acid sequences arranged in a functional relationship with one another. For example, a promoter or enhancer is operably linked to a coding sequence if it controls or contributes to the regulation of the transcription of the coding sequence. An operably linked DNA sequence encoding a regulatory sequence is typically adjacent to the coding sequence. However, an enhancer can function even if separated from the promoter by more than several kilobases. Thus, some polynucleotide elements can be operably linked but not adjacent. A coding sequence can be operably linked to a regulatory sequence in either the sense or antisense direction.

[0231] The terms “vector” and “plasmid” are used interchangeably and, as used herein, refer to polynucleotide vehicles for introducing genetic material into cells. Vectors can be linear or circular. Vectors can be integrated into a target genome of a host cell or replicate independently within the host cell. Vectors may include, for example, an origin of replication, a multicloning site, and / or selectable markers. Expression vectors typically include an expression cassette. Vectors and plasmids include, but are not limited to, integration vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, viral vectors, cosmids, and artificial chromosomes. The term “vector” also includes both viral and nonviral means for introducing nucleic acid molecules into cells in vitro, in vivo, or ex vivo. Vectors can be introduced into desired host cells by known methods, including, but not limited to, transfection, transduction, cell fusion, and lipofection. Vectors may include a variety of regulatory elements, including promoters.

[0232] The term "expression cassette" refers to a recombinant or synthetically produced polynucleotide construct that includes a regulatory sequence operably linked to a selected polynucleotide in order to promote the expression of that selected polynucleotide in a host cell. For example, the regulatory sequence can promote the transcription of the selected polynucleotide in the host cell, or both the transcription and translation of the selected polynucleotide in the host cell. Expression cassettes can be, for example, integrated into the genome of a host cell or present in an expression vector.

[0233] As used herein, the term “expression” refers to the transcription of polynucleotides from a DNA template, for example, to mRNA or other RNA transcripts (e.g., non-coding RNA such as structures or scaffolds). The term further refers to the process by which the transcribed mRNA is translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene products.” Expression may include splicing mRNA in eukaryotic cells if the polynucleotides are derived from genomic DNA.

[0234] As used herein, “transfection” means introducing an exogenous nucleic acid molecule, including a vector, into a cell. A “transfected” cell contains an exogenous nucleic acid molecule within the cell, while a “transformed” cell is one in which the exogenous nucleic acid molecule within the cell induces a phenotypic change in the cell. The transfected nucleic acid molecule may be incorporated into the genomic DNA of the host cell and / or may be maintained extrachromosomally, either temporarily or long-term, by the cell. A host cell or organism expressing an exogenous nucleic acid molecule or fragment is referred to as a “recombinant,” “transformed,” or “transgenic” organism. In some embodiments, the present invention relates to a host cell comprising any of the expression vectors described herein, for example, an expression vector comprising a polynucleotide encoding a Cas protein or a variant thereof. In some embodiments, the present invention relates to a host cell comprising an expression vector comprising a polynucleotide encoding a Cas3, Cas9, or Cas10 protein or a variant thereof.

[0235] In some embodiments, the modification results in a decrease in the expression of the target polynucleotide sequence. The terms “decrease,” “reduced,” “reduction,” and “decrease” are all used herein to generally mean a decrease of a statistically significant amount. However, to avoid misunderstanding, “decrease,” “reduced,” “reduction,” and “decrease” mean a decrease of at least 10% compared to a reference level, e.g., at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to 100% (i.e., a level of non-existence compared to a reference sample), or any decrease between 10% and 100% compared to a reference level.

[0236] The terms “increased,” “enhance,” “boost,” or “activate” are all used herein to generally mean an increase of a statistically significant amount. To avoid misunderstanding, the terms “increased,” “enhance,” or “activate” mean an increase of at least 10% compared to a reference level, e.g., at least 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to 100%, or any increase between 10% and 100% compared to a reference level, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times, or any increase between 2 times and 10 times or more compared to a reference level.

[0237] The terms “inactivate” or “deactivate” are used herein to generally mean that the expression of the gene of interest is reduced compared to a reference level, or that it is not expressed in a functional or active protein form. The terms “partially inactivate” or “partially deactivate” refer to the expression of the gene of interest that is reduced compared to a reference level but not removed, or that the proportion of proteins expressed by the gene still retains their activity and function. The terms “completely inactivate” or “completely deactivate” as used herein mean that the gene of interest does not express any protein, or that all expressed proteins encoded by the gene of interest are inactive and nonfunctional.

[0238] As used herein, the term “exogenous” is intended to mean that the referenced molecule or referenced polypeptide is introduced into the cell of interest. Polypeptides can be introduced, for example, by introducing the encoding nucleic acid into the cell’s genetic material, such as by integration into chromosomes, or as non-chromosomal genetic material such as plasmids or expression vectors. Therefore, the term used in relation to the expression of encoding nucleic acids refers to the introduction of the encoding nucleic acid into the cell in an expressible form.

[0239] The term "endogenous" refers to a reference molecule or polypeptide that is present within the cell. Similarly, when used in relation to the expression of encoding nucleic acids, the term refers to the expression of encoding nucleic acids that are contained within the cell and not introduced exogenously.

[0240] As used herein, the term “modification” refers to alterations that physically differentiate a modified molecule from its parent molecule. In one embodiment, a variant polypeptide comprises one or more modifications that differentiate the function of the variant polypeptide from that of an unmodified polypeptide. For example, amino acid changes in a variant polypeptide affect its receptor binding profile. In other embodiments, a variant polypeptide comprises substitutions, deletions, or insertions, or a combination thereof. In yet another embodiment, a variant polypeptide comprises one or more modifications that increase its affinity for a receptor compared to the affinity of an unmodified polypeptide. In one embodiment, a variant polypeptide comprises one or more substitutions, insertions, or deletions compared to the corresponding native or parent sequence. In certain embodiments, a variant polypeptide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31-40, 41-50, or 51 or more modifications.

[0241] As used herein, the terms “inhibitor,” “activator,” and “modulator” refer to agents that affect the function or expression of biologically relevant molecules. The term “modulator” includes both inhibitors and activators. These may be identified using in vitro and in vivo assays for the expression or activity of target molecules. In some cases, “inhibitors” are agents that, for example, inhibit expression or bind to a target molecule or protein. They may partially or completely block a stimulus or have protease inhibitory activity. They may reduce, decrease, prevent, or delay activation, including inactivation, desensitization, or downregulation of the activity of the target protein described. Modulators may be antagonists or agonists of a target molecule or protein. In some cases, “activators” are agents that, for example, induce or activate the function or expression of a target molecule or protein. They may bind to, stimulate, increase, open, activate, or promote target molecule activity. Activators may be agonists of a target molecule or protein. The terms “subject” and “individual” are used interchangeably herein and refer to animals, for example, humans from whom cells can be obtained and / or to whom treatment including prophylactic treatment with the cells described herein is offered. For treatments of these infections, conditions or diseases specific to a particular animal, such as a human subject, the term “subject” refers to that particular animal. “Non-human animal” and “non-human mammal” are used interchangeably herein and include mammals such as rats, mice, rabbits, sheep, cats, dogs, cattle, pigs, and non-human primates. The term “subject” also includes all vertebrates, including but not limited to mammals, reptiles, amphibians, and fish. However, advantageously, a subject is a mammal such as a human, or a domesticated mammal, such as a dog, cat, or horse, or a production mammal, such as a cattle, sheep, or pig.

[0242] The terms “homologous” and “homologous sequence” refer to a bioactive molecule that is similar to a reference molecule at the nucleotide sequence, peptide sequence, functional, or structural level. Homologous molecules may include sequence derivatives that share a specific percentage of identity with the reference sequence. Thus, in one embodiment, a homologous or derivative sequence shares at least 70 percent of sequence identity. In a particular embodiment, a homologous or derivative sequence shares at least 80 or 85 percent of sequence identity. In a particular embodiment, a homologous or derivative sequence shares at least 90 percent of sequence identity. In a particular embodiment, a homologous or derivative sequence shares at least 95 percent of sequence identity. In a more specific embodiment, a homologous or derivative sequence shares at least 50, 55, 60, 65, 70, 75, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent of sequence identity. In one embodiment, homologous or derivative sequences share 100% sequence identity with a reference sequence. Homologous or derivative nucleic acid sequences can also be defined by their ability to remain bound to a reference nucleic acid sequence under high stringence hybridization conditions. Homogenetics having structural or functional similarity to a reference molecule may be chemical derivatives of the reference molecule. Methods for detecting, generating, and screening structural and functional homologs, as well as derivatives, are known in the art.

[0243] All maximum numerical limits given throughout this specification are intended to include all lower numerical limits, such that lower numerical limits are explicitly described herein. All minimum numerical limits given throughout this specification will include all higher numerical limits, such that higher numerical limits are explicitly described herein. All numerical ranges given throughout this specification will include all narrower numerical ranges that fall within such wider numerical ranges, such that narrower numerical ranges are explicitly described herein.

[0244] In the context of two or more nucleic acid or polypeptide sequences, the terms “sequence identity” or “% identity” refer to two or more sequences or subsequences that, when compared to and aligned with the largest corresponding sequence, have a specific percentage of identical nucleotide or amino acid residues, measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN, or other algorithms available to those skilled in the art) or by visual inspection. Depending on the application, the “identity” percentage may exist across regions of the sequences being compared, for example, across functional domains, or across the entire length of the two sequences being compared. In sequence comparison, typically one sequence acts as a reference sequence compared to the test sequence. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer, subsequence coordinates are specified as needed, and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the percentage sequence identity of the test sequence relative to the reference sequence based on the specified program parameters.

[0245] The optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv.Appl.Math.2:482 (1981), by searching for similar methods of Proc.Nat'l.Acad.Sci.USA 85:2444 (1988) using the homology alignment algorithm of Needleman & Wunsch, J.Mol.Biol.48:443 (1970), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (575 Science Dr., Madison, Wis.)), or by visual inspection (see Ausubel et al. below in general).

[0246] An example of a suitable algorithm for determining sequence identity and sequence similarity percentages is found in Altschul et al., J.Mol. This is the BLAST algorithm described in Biol. 215:403-410 (1990). Software for performing BLAST analysis is available through the National Center for Biotechnology Information.

[0247] The implementation of specific embodiments will employ conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA technology, genetics, immunology, and cell biology, which are within the scope of the art, unless otherwise indicated, many of which are described below for illustrative purposes. Such techniques are well described in the literature.For example, Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001), Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989), Maniatis et al., Molecular Cloning: A Laboratory Manual (1982), Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008), Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985), Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992), Transcription and Translation(B.Hames & See monographs in journals such as S. Higgins, Eds., 1984; Perbal, A Practical Guide to Molecular Cloning (1984); Harlow and Lane, Antibodies (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998); Current Protocols in Immunology QEColigan, AMKruisbeek, DH Margulies, EM Shevach and W. Strober, eds., 1991); Annual Review of Immunology; and Advances in Immunology.

[0248] It should be noted that claims can be constructed to exclude any optional elements. Therefore, this statement is intended to serve as a prior art against the use of exclusive terms such as "only" or "only" in relation to the enumeration of claim elements or the use of "negative" limitations. As will be apparent to those skilled in the art upon reading this disclosure, each individual embodiment described and illustrated herein has distinct components and features, which may be readily separated from, or combined with, features of any of several other embodiments without departing from the scope or spirit of the invention. Any enumerated method may be performed in the order of the enumerated events, or in any other logically possible order. Any methods and materials similar or equivalent to those described herein may also be used in carrying out or testing the invention, but representative exemplary methods and materials are described herein.

[0249] In describing the present invention, the following terms are used and defined as shown below.

[0250] Before further describing the present invention, it should be understood that the present invention is not limited to the specific embodiments described and is therefore naturally subject to change. It should also be understood that the terminology used herein is solely for the purpose of describing specific embodiments and is not intended to limit the scope of the present invention, as it is limited only by the appended claims.

[0251] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Where a range of values ​​is provided, unless the context explicitly indicates otherwise, each intermediate value between the upper and lower limits of that range, up to one-tenth of the lower limit, and any other specified or intermediate values ​​in that specified range are understood to be included in this invention. The upper and lower limits of these smaller ranges may independently be included in their smaller ranges and are also included in this invention, subject to any specifically excluded limits within the specified range. Where a range is indicated that includes one or both limits, a range excluding one or both of the limits that they include is also included in this invention. A particular range is indicated herein by a number preceded by the term “approximately”. The term “approximately” is used herein to literally support the exact number that follows and the number that is close to or nearly the number that follows the term. When determining whether a number is close to or nearly the number that is specifically cited, the close or nearly unquoted number may be a number that, in the given context, provides a substantially equivalent to the specifically cited number.

[0252] All publications, patents, and patent applications cited herein are incorporated herein by reference to the same extent that each individual publication, patent, or patent application is specifically and individually incorporated by reference. Furthermore, each cited publication, patent, or patent application is incorporated herein by reference to disclose and explain the subject matter relating to which the publication is cited. No citation of any publication is for disclosure prior to the filing date and should not be construed as acknowledging that the invention described herein is not given prior rights to such publication for the sake of prior invention. Furthermore, the publication dates presented may differ from the actual publication dates and may need to be verified separately.

[0253] III. Detailed Description of Embodiments A. Manipulated histocompatibility cells As can be understood, the methods provided herein can be carried out on any type of nucleated cell. In some embodiments, the cell (e.g., unmodified cell) is a type A cell. In some embodiments, the cell is a type B cell. In some embodiments, the cell is a type AB cell. In some embodiments, the cell is a type O cell. In some embodiments, the cell is a type O cell. In some embodiments, the cell is a type A Rh+ (e.g., A+) cell. In some embodiments, the cell is a type A RH- (e.g., A-) cell. In some embodiments, the cell is a type B Rh+ (e.g., B+) cell. In some embodiments, the cell is a type B Rh- (e.g., B-) cell. In some embodiments, the cell is a type AB Rh+ (e.g., AB+) cell. In some embodiments, the cell is a type AB Rh- (e.g., AB-) cell. In some embodiments, the cell is a type O Rh+ (e.g., O+) cell. In some embodiments, the cell (e.g., unmodified cell) is a type hh cell and has the Bombay phenotype.

[0254] In some embodiments, the manipulated histocompatibility cells outlined herein are produced using gene editing to modify one or more of the tissue blood antigens of the cells, including the A, B, H, and Rh antigens. In some embodiments, the manipulated histocompatibility cells are produced using gene editing to modify, for example, type A cells to type O cells, type B cells to type O cells, type AB cells to type O cells, type A+ cells to type O- cells, type A- cells to type O- cells, type A- cells to type O- cells, type AB+ cells to type O- cells, type AB- cells to type O- cells, type B+ cells to type O- cells, and type B- cells to type O- cells.

[0255] In some embodiments, cells from blood type A individuals or group A cells are genetically modified with the ABO gene to no longer produce a functional glycosyltransferase having α(1,3)N-acetylgalactosaminyltransferase activity. In some embodiments, cells from blood type B individuals or group B cells are genetically modified with the ABO gene to no longer produce a functional glycosyltransferase having α(1,3)galactosyltransferase activity. In some embodiments, cells from blood type A individuals, blood type B individuals, or blood type AB individuals are manipulated according to the methods described herein to produce cells lacking ABO activity. In some cases, such cells lacking ABO activity express or present an unmodified H antigen.

[0256] In some embodiments, the manipulated tissue-compatible cells contain gene modifications within the ABO gene. In some embodiments, the gene modification affects one allele of the ABO gene. In some embodiments, the gene modification affects two alleles of the ABO gene. In some embodiments, the gene modification is an insertion, deletion, or disruption of the ABO gene. In some embodiments, the gene modification is a homozygous modification of the ABO gene. In some embodiments, the gene modification is a heterozygous modification of the ABO gene.

[0257] In some embodiments, the manipulated histocompatibility cells contain a gene modification within the FUT1 gene. In some embodiments, the gene modification affects one allele of the FUT1 gene. In some embodiments, the gene modification affects two alleles of the FUT1 gene. In some embodiments, the gene modification is an insertion, deletion, or disruption of the FUT1 gene. In some embodiments, the gene modification is a homozygous modification of the FUT1 gene. In some embodiments, the gene modification is a heterozygous modification of the FUT1 gene.

[0258] In some embodiments, the manipulated histocompatibility cells contain gene modifications within the RHD gene. In some embodiments, the gene modification affects one allele of the RHD gene. In some embodiments, the gene modification affects two alleles of the RHD gene. In some embodiments, the gene modification is an insertion, deletion, or disruption of the RHD gene. In some embodiments, the gene modification is a homozygous modification of the RHD gene. In some embodiments, the gene modification is a heterozygous modification of the RHD gene.

[0259] In some embodiments, the manipulated histocompatibility cells include genetic modification of the ABO gene so that the cell does not produce a functional ABO gene product. In some embodiments, the manipulated histocompatibility cells include genetic modification of the FUT1 gene so that the cell does not produce a functional FUT1 gene product. In some embodiments, the manipulated histocompatibility cells include genetic modification of the RHD gene so that the cell does not produce a functional RHD gene product.

[0260] In some embodiments, the manipulated histocompatibility cells include gene modifications in one or more genes encoding histocompatibility determinants. In some embodiments, the cells include gene modifications of the ABO gene and the RHD gene. In some cases, the manipulated cells are O-negative cells.

[0261] In some embodiments, the manipulated cells include gene modifications of the FUT1 gene and the RHD gene. Thus, the manipulated cells may be O-negative cells.

[0262] Gene editing using rare cleavage endonucleases, such as Cas9 but not limited to these, is used to target and disrupt one or more genes encoding histocompatibility determinants, such as the ABO gene, FUT1 gene, and RHD gene but not limited to these.

[0263] In some cases, targeted disruption of the ABO gene targets one of its coding exons. In other cases, targeted disruption of the FUT1 gene targets one of its coding exons. In specific cases, targeted disruption of the RHD gene targets one of its coding exons. In some embodiments, the entire or a large portion of the gene's coding sequence is disrupted or excised. In some embodiments, insertions and deletions by CRISPR / Cas9 editing are introduced into cells to disrupt the ABO gene, the RHD gene, and / or the FUT1 gene.

[0264] In some embodiments, RNA-induced DNA nucleases are used to target the coding sequence of the ABO gene, introducing harmful mutations into the ABO gene and disrupting ABO function. In other embodiments, the untranslated region, intron sequence, and / or exon sequence of ABO are targeted.

[0265] In some embodiments, harmful mutations in the ABO gene include indels. In some embodiments, harmful mutations in the ABO gene include deletions. In some embodiments, harmful mutations in the ABO gene include insertions. In some embodiments, harmful mutations in the ABO gene include frameshift mutations. In some embodiments, harmful mutations in the ABO gene include substitutions. In some embodiments, harmful mutations in the ABO gene include point mutations. In some embodiments, harmful mutations in the ABO gene reduce gene expression. In some embodiments, harmful mutations in the ABO gene include loss-of-function mutations.

[0266] In some embodiments, RNA-induced DNA nucleases are used to target the coding sequence of the FUT1 gene, introducing harmful mutations into the FUT1 gene and disrupting FUT1 function. In other embodiments, the untranslated region, intron sequence, and / or exon sequence of FUT1 are targeted.

[0267] In some embodiments, harmful mutations in the FUT1 gene include indels. In some embodiments, harmful mutations in the FUT1 gene include deletions. In some embodiments, harmful mutations in the FUT1 gene include insertions. In some embodiments, harmful mutations in the FUT1 gene include frameshift mutations. In some embodiments, harmful mutations in the FUT1 gene include substitutions. In some embodiments, harmful mutations in the FUT1 gene include point mutations. In some embodiments, harmful mutations in the FUT1 gene reduce gene expression. In some embodiments, harmful mutations in the FUT1 gene include loss-of-function mutations.

[0268] In some embodiments, RNA-induced DNA nucleases are used to target the coding sequence of the RHD gene to introduce harmful mutations into the RHD gene and disrupt RHD function. In other embodiments, the untranslated region, intron sequence, and / or exon sequence of the RHD are targeted.

[0269] In some embodiments, harmful mutations in the RHD gene include indels. In some embodiments, harmful mutations in the RHD gene include deletions. In some embodiments, harmful mutations in the RHD gene include insertions. In some embodiments, harmful mutations in the RHD gene include frameshift mutations. In some embodiments, harmful mutations in the RHD gene include substitutions. In some embodiments, harmful mutations in the RHD gene include point mutations. In some embodiments, harmful mutations in the RHD gene reduce gene expression. In some embodiments, harmful mutations in the RHD gene include loss-of-function mutations.

[0270] In some embodiments, cell histocompatibility is determined using complement-mediated cell death assays. A non-limiting example of such assays is the XCelligence SP platform (ACEA BioSciences).

[0271] The histocompatible cells of the present invention can be produced from cells in culture, such as cultured mammalian cells, such as cultured human cells. In some embodiments, the cells are stem cells. In some embodiments, the stem cells retain pluripotency. In some embodiments, the stem cells retain differentiation ability. In some embodiments, the cells are pluripotent or non-pluripotent stem cells, pluripotent or non-pluripotent stem cells, progenitor cells or non-progenitor cells, differentiated or undifferentiated cells, etc. In some embodiments, the cells are primary cells or cell lines (e.g., mammalian cell lines including human cell lines).

[0272] In some embodiments, the histocompatible cells of the present invention are produced from cells that are pluripotent stem cells, induced pluripotent stem cells, embryonic stem cells (e.g., RUES2 or H9 cells), adult stem cells, and pluripotent stem cells. In certain embodiments, the cells are differentiated cells derived from or generated from pluripotent stem cells, induced pluripotent stem cells, embryonic stem cells (e.g., RUES2 or H9 cells), adult stem cells, and pluripotent stem cells. Such differentiated cells may be cell types of any tissue or organ of the body. In some embodiments, the cells are any type useful for cell system therapy.

[0273] In some embodiments, the tissue-compatible cells of the present invention are produced from cells produced from any organ or tissue of the body, including but not limited to epithelial, connective, muscle, or nerve tissue or cells, and combinations thereof. In some cases, cells are derived from any eukaryotic (e.g., mammalian) organ system, e.g., from the cardiovascular system (heart, vascular system); from the digestive system (esophagus, stomach, liver, gallbladder, pancreas, intestine, colon, rectum, and anus); from the endocrine system (hypothalamus, pituitary gland, pineal gland or pineal gland, thyroid gland, parathyroid gland, adrenal gland); from the excretory system (kidneys, ureters, bladder); from the lymphatic system (lymph nodes, lymphatic vessels, tonsils, adenoid body, thymus, spleen); from the cutaneous system (skin, hair, nails); from the muscular system (e.g., skeletal muscle); from the nervous system (brain, spinal cord, nerves); from the reproductive system (ovaries, uterus, mammary glands, testes, prostate); from the respiratory system (pharynx, larynx, trachea, bronchi, lungs, diaphragm); from the skeletal system (pelvis, cartilage); and combinations thereof.

[0274] In some embodiments, the histocompatible cells of the present invention are produced from cells derived from highly mitotic tissues (e.g., healthy, highly mitotic tissues such as epithelium, embryonic tissue, bone marrow, and intestinal crypts).

[0275] In some embodiments, the histocompatibility cells of the present invention are produced from adult stem cells, which are stem cells from any organ or tissue of the body, including but not limited to epithelial, connective, muscle, or nerve tissue or cells, and combinations thereof. In some cases, the histocompatible cells of the present invention are produced from cells from any eukaryotic (e.g., mammalian) organ system, such as the cardiovascular system (heart, vascular system); the digestive system (esophagus, stomach, liver, gallbladder, pancreas, intestine, colon, rectum, and anus); the endocrine system (hypothalamus, pituitary gland, pineal gland or pineal gland, thyroid gland, parathyroid gland, adrenal gland); the excretory system (kidney, ureter, bladder); the lymphatic system (lymph nodes, lymphatic vessels, tonsils, adenoid body, thymus, spleen); the cutaneous system (skin, hair, nails); the muscular system (e.g., skeletal muscle); the nervous system (brain, spinal cord, nerves); the reproductive system (ovaries, uterus, mammary glands, testes, prostate); the respiratory system (pharynx, larynx, trachea, bronchi, lungs, diaphragm); the skeletal system (pelvis, cartilage); and combinations thereof. In many embodiments, pluripotent stem cells are cells that have the ability to self-regenerate and develop (differentiate) into two or more specialized cell types present in specific organs or tissues of the body, as described herein.

[0276] In some embodiments, the histocompatible cells of the present invention are produced from cells that are progenitor cells, such as bone marrow stromal cells, bone marrow-derived adult progenitor cells (MAPCs), endothelial progenitor cells (EPCs), blasts, intermediate progenitor cells formed in the subventricular zone, neural stem cells, muscle stem cells, satellite cells, liver stem cells, hematopoietic stem cells, bone marrow stromal cells, epidermal stem cells, embryonic stem cells (e.g., RUES2 or H9 cells), mesenchymal stem cells, umbilical cord stem cells, progenitor cells, muscle progenitor cells, myoblasts, cardiomyocytes, neural progenitor cells, glial progenitor cells, neuronal progenitor cells, and hepatocytes.

[0277] B. Methods for modifying the expression of histocompatibility-determining blood determinants Provided herein are methods for modifying intracellular nucleic acid sequences to generate genetically modified cells. Exemplary techniques for such modifications include homologous recombination, knock-in techniques, zinc finger nucleases (ZFNs), activator-like effector nucleases (TALENs), CRISPR / Cas9, and other site-specific nuclease techniques. These techniques enable double-strand DNA breaks at desired locus sites. These controlled double-strand breaks facilitate homologous recombination at specific locus sites. This process focuses on targeting specific sequences of nucleic acid molecules, such as chromosomes, with endonucleases that recognize and bind to those sequences, inducing double-strand breaks in the nucleic acid molecules. The double-strand breaks are repaired by either error-prone non-homologous end joining (NHEJ) or homologous recombination (HR).

[0278] In one embodiment, cells are manipulated using CRISPR / Cas technology, as is known in the art. Numerous CRISPR-based techniques exist; see, for example, Doudna and Charpentier, Science, doi:10.1126 / science.1258096. CRISPR technologies and kits are commercially available.

[0279] In some embodiments, the cells of the present invention are prepared using a transcription activator-like effector nuclease (TALEN) methodology. TALEN is a restriction enzyme combined with a nuclease that can be manipulated to bind to and cleave substantially any desired DNA sequence. TALEN kits are commercially available.

[0280] In some embodiments, cells are manipulated using zinc finger nuclease technology. Zinc finger nucleases are artificial restriction enzymes produced by fusing a zinc finger DNA-binding domain with a DNA-cleaving domain. The zinc finger domain can be manipulated to target specific desired DNA sequences, thereby allowing zinc finger nucleases to target unique sequences within complex genomes. By leveraging endogenous DNA repair mechanisms, these reagents can be used to precisely modify the genomes of higher organisms, similar to CRISPR and TALEN.

[0281] As will be understood by those skilled in the art, several different techniques can be used to manipulate cells to be hematopoietic, and in some embodiments, to be low immunogenic, as outlined herein.

[0282] 1. Genetic modification of ABO genes This specification provides a method for producing tissue blood group O cells from any other tissue blood group cells using gene editing tools such as CRISPR / Cas, TALE nucleases, zinc finger nucleases, other viral gene editing systems, or RNA interference such as CRISPR / Cas9 gene editing.

[0283] In some embodiments, the Cas9 editing system is used to target ABO gene sequences to introduce insertions or deletions into the genes, thereby disrupting their function and, in some cases, inactivating them. In some embodiments, a single guide RNA is used. In some embodiments, dual guide RNAs are used. In some embodiments, one of the gRNA target sequences in Table 1, A, B, and C is used. In some cases, two or more gRNA target sequences in Table 1, A, B, and C are used for gene editing.

[0284] In some embodiments, a frameshift deletion, such as a single frameshift deletion, is introduced into the ABO gene to inactivate the gene. In some cases, the deletion is produced using a Cas9 editing system and the guide RNA target sequence shown in Table 1. In some embodiments, the manipulated histocompatibility cells contain a homozygous frameshift deletion in the ABO gene. In some embodiments, the insertion deletion (indel) is introduced into a coding exon such as exon 1. In some embodiments, the insertion deletion (indel) is introduced into a coding exon such as exon 2. In some embodiments, the insertion deletion (indel) is introduced into a coding exon such as exon 8. In some cases, the indel is produced using a Cas9 editing system and the guide RNA target sequence shown in Table 1. In some embodiments, the manipulated histocompatibility cells contain a homozygous indel in the ABO gene. [Table 1]

[0285] In some embodiments, insertions and deletions are generated to introduce a 258delG mutation into exon 6 of the ABO gene by gene editing, e.g., homology-directed repair (HDR). In some cases, the ABO 258delG variant is knocked into the ABO gene. In some embodiments, manipulated type O cells are produced using an HDR donor template encoding a specific ABO Cas9 protospacer flanking motif (PAM) gRNA target sequence and the 258delG mutation. In some embodiments, the ABO exon 6-7 gRNA target sequence (ABO exon 6-7 gRNA 1) and donor template (ABO 258delG donor template guide 1) from Table 2 are used. The donor template contains the 258delG variant and a silent mutation that disrupts the PAM site on the reverse strand. In some embodiments, the donor mold includes two homology arms, each containing homologous sequences of approximately 10 nt to 1 Kb (e.g., 20 nt, 30 nt, 40 nt, or 50 nt to 1 Kb).

[0286] In some embodiments, the ABO exon 6-7 gRNA target sequence (ABO exon 6-7 gRNA 2) and donor template (ABO 258delG donor template guide 2) shown in Table 2 are used. The donor template includes a 258delG variant and a silent mutation that introduces two mismatches into the gRNA sequence to prevent continuous editing of the repair genomic sequence. In some embodiments, the donor template includes two homologies, each containing homologous sequences of approximately 10 nt to 1 Kb (e.g., 20 nt, 30 nt, 40 nt, or 50 nt to 1 Kb).

[0287] In some embodiments, the ABO exon 6-7 gRNA target sequence (ABO exon 6-7 gRNA 3) and donor template (ABO 258delG donor template guide 3) shown in Table 2 are used. The donor template includes a 258delG variant and a silent mutation that introduces two mismatches into the gRNA sequence to prevent continuous editing of the repair genomic sequence. In some embodiments, the donor template includes two homology arms, each containing a homologous sequence of approximately 10 nt to 1 Kb (e.g., 20 nt, 30 nt, 40 nt, or 50 nt to 1 Kb).

[0288] In some embodiments, the ABO exon 6-7 gRNA target sequence (ABO exon 6-7 gRNA 4) and donor template (ABO 258delG donor template guide 4) shown in Table 2 are used. The donor template includes a 258delG variant and a silent mutation that introduces two mismatches into the gRNA sequence to prevent continuous editing of the repair genomic sequence. In some embodiments, the donor template includes two homology arms, each containing a homologous sequence of approximately 10 nt to 1 Kb (e.g., 20 nt, 30 nt, 40 nt, or 50 nt to 1 Kb). [Table 2]

[0289] In some embodiments, the manipulated tissue-compatible cells contain a homozygous 258delG mutation in the ABO gene.

[0290] 2. Gene modification of the RHD gene Provided herein are methods for producing Rh-negative cells by gene editing the RHD gene using gene editing tools such as, but not limited to, CRISPR / Cas, TALE nucleases, zinc finger nucleases, other virus-based gene editing systems, or RNA interference. In some embodiments, gene editing targets the coding sequence of the RHD gene. In some cases, the cells do not produce a functional RHD gene product. In the absence of the RHD gene product, the cells are completely deficient in Rh blood group antigens.

[0291] In some embodiments, the Cas9 editing system is used to target RHD gene sequences to introduce insertions or deletions into the genes, thereby disrupting their function and, in some cases, inactivating them. In some embodiments, a single guide RNA is used. In some embodiments, dual guide RNAs are used. In some embodiments, one of the gRNA target sequences in Table 3, D, E, and F is used. In some cases, two or more gRNA target sequences in Table 3, D, E, and F are used for gene editing.

[0292] In some embodiments, frameshift insertions and deletions are introduced into any coding sequence of a gene. In some embodiments, modifications within the UTR, intron, or exon of a gene are added to disrupt the function of the RHD gene. In some embodiments, CRISPR / Cas9 editing is utilized, including one or more gRNA target sequences from Table 3, D, E, and F.

[0293] In some embodiments, the modification is introduced into the RHD gene to inactivate the gene. In some embodiments, a coding exon such as exon 1 or exon 2 of the RHD gene is targeted. In some embodiments, coding exon 4 of the RHD gene is targeted. In some embodiments, coding exon 5 of the RHD gene is targeted. In some embodiments, coding exon 6 of the RHD gene is targeted. In some embodiments, coding exon 7 of the RHD gene is targeted. In some embodiments, coding exon 8 of the RHD gene is targeted. In some cases, the deletion is produced using a Cas9 editing system and a guide RNA target sequence targeting the 5' end sequence of the RHD gene, and a guide RNA target sequence for an exon such as exon 8. In some embodiments, one gRNA target sequence is RHD 5'UTR guide 1 in Table 3, and one gRNA target sequence is RHD exon 8 guide 1 in Table 3. In some embodiments, the manipulated histocompatibility cells contain homozygous modification of the RHD gene, thereby inactivating the gene. [Table 3]

[0294] In some embodiments, the gRNA target sequence is for exon 1 or exon 2 of the RHD gene. In some embodiments, the gRNA target sequence is a gRNA from Table 3 that induces a frameshift mutation to inactivate exon 1 or exon 2.

[0295] 3. Genetic modification of the FUT1 gene This specification provides a method for producing tissue blood group O cells from any other tissue blood group cells by editing the FUT1 gene using gene editing tools such as, but not limited to, CRISPR / Cas9, TALE nucleases, zinc finger nucleases, other viral gene editing systems, or RNA interference. In some embodiments, gene editing targets the coding sequence of the FUT1 gene. In some cases, the cells do not produce a functional FUT1 gene product. In the absence of FUT1, the cells completely lack the H antigen and have Bombay Hist blood group (hh).

[0296] In some embodiments, the Cas9 editing system is used to target the FUT1 gene sequence to introduce insertions or deletions into the gene, thereby disrupting its function and, in some cases, inactivating it. In some embodiments, a single guide RNA is used. In some embodiments, dual guide RNAs are used. In some embodiments, one of the gRNA target sequences from Table 4, G, H, and I is used. In some cases, two or more gRNA target sequences from Table 4, G, H, and I are used for gene editing.

[0297] In some embodiments, modifications are introduced into the FUT1 gene to inactivate the gene. In some embodiments, coding exons, such as exon 4 of the FUT1 gene, are targeted. In some cases, deletions are produced using a Cas9 editing system and guide RNA target sequences, as shown in Table 4. In some embodiments, the manipulated histocompatible cells contain homozygous modifications to the FUT1 gene, thereby inactivating the gene. [Table 4]

[0298] In some embodiments, frameshift insertions and deletions are introduced into any coding sequence of a gene. In some embodiments, modifications within the UTR, intron, or exon of a gene are added to disrupt the function of the FUT1 gene. In some embodiments, CRISPR-Cas9 editing is used that includes one or more gRNA target sequences from Table 4, G, H, and I.

[0299] In some embodiments, the first gene modification disrupts the function of the ABO gene, and the second gene modification disrupts the function of the RHD gene. In some embodiments, the first gene modification disrupts the function of the FUT1 gene, and the second gene modification disrupts the function of the RHD gene.

[0300] In general, these methods can be used individually or in combination. In some embodiments, the cells also include B2M gene modification, CIITA gene modification, and CD47 transgene. In some embodiments, the cells have a B2M homozygous null genotype. In some embodiments, the cells have a CIITA homozygous null genotype. In some embodiments, the cells overexpress CD47. In some embodiments, the modified cells have B2M - / - , CIITA - / - It possesses gene modifications including, but not limited to, CD47 tg.

[0301] In some embodiments, in the generation of hypoimmunogenic cells, including hypoimmunogenic pluripotent stem cells and hypoimmunogenic induced pluripotent stem cells, CRISPR may be used to reduce the expression of active B2M and / or CIITA proteins in the manipulated cells using a viral technique (e.g., lentivirus) to knock in CD47 functionality. Also, as will be understood by those skilled in the art, a CRISPR step to knock out B2M is sequentially utilized, followed by a CRISPR step to knock out CIITA with a final lentivirus step to knock in CD47 functionality, although these genes can be manipulated in different orders using different techniques.

[0302] C. Additional modifications for generating hypoimmunogenic cells This specification provides cells comprising modifications of one or more targeted polynucleotide sequences that control the expression of MHC I and / or MHC II. In some embodiments, the expression of both MHC I and MHC II is controlled by one or more targeted polynucleotide sequences, such as those described herein.

[0303] In some embodiments, the cell includes genomic modification of one or more target polynucleotide sequences that control MHC I expression. In some embodiments, the cell includes genomic modification of one or more target polynucleotide sequences that control MHC II expression. In some embodiments, a gene editing system is used to modify one or more target polynucleotide sequences. In some embodiments, the targeted polynucleotide sequences are one or more selected from the group consisting of B2M, CIITA, and NLRC5. In certain embodiments, the cell genome is modified to reduce or delete key components of HLA expression.

[0304] In some embodiments, the disclosure provides stem cells (e.g., pluripotent stem cells or induced pluripotent stem cells) or populations thereof, comprising a genome in which genes have been edited to delete a continuous stretch of genomic DNA, thereby reducing or eliminating the surface expression of MHC class I molecules in the cells or populations thereof. In some embodiments, the stem cells retain pluripotency. In some embodiments, the stem cells retain differentiation ability. In certain embodiments, the disclosure provides stem cells (e.g., pluripotent stem cells or induced pluripotent stem cells) or populations thereof, comprising a genome in which genes have been edited to delete a continuous stretch of genomic DNA, thereby reducing or eliminating the surface expression of MHC class II molecules in the cells or populations thereof. In certain embodiments, the disclosure provides stem cells (e.g., pluripotent stem cells or induced pluripotent stem cells) or populations thereof, comprising a genome in which one or more genes have been edited to delete a continuous stretch of genomic DNA, thereby reducing or eliminating the surface expression of MHC class I and II molecules in the cells or populations thereof. Efficient interference with the expression of MHC I and / or MHC II proteins can be achieved by one or more of the following: (1) directly targeting polymorphic HLA alleles (HLA-A, -B, -C) and MHC-II genes; (2) removing B2M, which prevents surface transport of all MHC-I molecules; and / or (3) deleting components of MHC enhanosomes that are important for HLA expression, such as LRC5, RFX-5, RFX-related ankyrin-containing protein (RFX-ANK), RFX-related protein (RFX-AP), IRF1, NF-Y, and CIITA.

[0305] In certain embodiments, the expression of MHC I or MHC II is regulated by targeting and deleting adjacent stretches of genomic DNA, thereby reducing or eliminating the expression of target genes selected from the group consisting of B2M, CIITA, and NLRC5.

[0306] In some embodiments, MHC I expression is reduced by targeting and deleting adjacent stretches of genomic DNA, thereby reducing or eliminating the expression of HLA-A, HLA-B, and HLA-C. In some embodiments, MHC I expression is reduced or eliminated by genomic modification of the B2M gene. In some cases, genomic modification is performed using the CRISPR / Cas system.

[0307] In some embodiments, the cells and methods described herein include genome editing of human cells to cleave the CIITA gene sequence, and editing the genome of such cells to modify one or more additional target polynucleotide sequences, such as but not limited to B2M and NLRC5. In some embodiments, the cells and methods described herein include genome editing of human cells to cleave the B2M gene sequence, and editing the genome of such cells to modify one or more additional target polynucleotide sequences, such as but not limited to CIITA and NLRC5. In some embodiments, the cells and methods described herein include genome editing of human cells to cleave the NLRC5 gene sequence, and editing the genome of such cells to modify one or more additional target polynucleotide sequences, such as but not limited to B2M and CIITA.

[0308] In some embodiments, the cells also include modifications to increase the expression of one selected from the group consisting of HLA-C, HLA-E, HLA-G, PD-L1, CTLA-4-Ig, C1 inhibitors, and IL-35. In some embodiments, the cells are generated by regulating the expression of one or more genes important for HLA expression, such as RFX-5, RFX-related ankyrin-containing protein (RFX-ANK), RFX-related protein (RFX-AP), IRF1, NFY-A, NFY-B, NFY-C, and CIITA, as described in WO2016 / 183041, which are incorporated herein by reference in whole, and specifically incorporated with respect to the relevant techniques outlined therein. In additional embodiments, further modifications to producer cells include modifying the expression of one or more genes such as OX40, GITR, 4-1BB, CD28, B7-1, B7-2, ICOS, CD27, HVEM, SLAM, CD226, PD1, CTLA4, LAG3, TIGIT, TIM3, CD160, BTLA, CD244, CD30, TLT, VISTA, B7-H3, PD-L2, LFA-1, CD2, CD58, ICAM-3, TCRA, TCRB, FOXP3, HELIOS, ST2, PCSK9, CCR5, and / or APOC3, as described in WO2016 / 183041, which are incorporated herein by reference in whole, and specifically incorporated with respect to the relevant techniques outlined therein.

[0309] In some embodiments, cells are produced by introducing one or more transgenes, such as PDL-1, HLA-G, CD47, CD200, FASLG, CLC21, MFGE8, and / or SERPIN B9, as described in WO2018 / 227286, or by introducing genes encoding biologics that act as agonists of PDL-1, HLA-G, CD47, CD200, FASLG, CLC21, MFGE8, and / or SERPIN 9, which are incorporated herein by reference in whole, specifically with respect to the relevant techniques outlined therein. In some embodiments, cells are produced by introducing transgenes containing PDL-1, HLA-G, and CD47. In some embodiments, cells are produced by introducing transgenes containing PDL-1 and HLA-G. In some embodiments, cells are produced by introducing transgenes containing PDL-1 and CD47. In some embodiments, cells are generated by the introduction of one or more transgenes such as TGFβ, CD73, CD39, LAG3, IL1R2, ACKR2, TNFRSF22, TNFRSF23, TNFRS10, DAD1, and / or IFNγR1 d39, as described in WO2018 / 227286, or by further introduction of genes encoding biologics that act as agonists of TGFβ, CD73, CD39, LAG3, IL1R2, ACKR2, TNFRSF22, TNFRSF23, TNFRS10, DAD1, and / or IFNγR1 d39, which are incorporated herein by reference in whole, and specifically incorporated with respect to the relevant technologies outlined therein.

[0310] In some embodiments, cells are generated by further introducing a suicide gene into the cells, which is activated by a trigger that causes cell death. In one embodiment, the suicide gene is the herpes simplex virus thymidine kinase gene (HSV-tk), and the trigger is ganciclovir. In another embodiment, the suicide gene is the Escherichia coli cytosine deaminase gene (EC-CD), and the trigger is 5-fluorocytosine (5-FC). In yet another embodiment, the suicide gene is an inducible caspase protein, and the trigger is a specific chemoinducer (CID) of dimerization.

[0311] In some cases, gene editing systems such as the CRISPR / Cas system are used to facilitate the insertion of hypoimmune factors, such as hypoimmune factors, into safe harbor loci, including AAVS, HPRT, CCR5, and ROSA26 loci, thereby actively inhibiting immune rejection. In some embodiments, the hypoimmune factor is inserted into a single safe harbor locus in a cell. In other embodiments, the hypoimmune factor is inserted into one or more safe harbor loci. In some cases, the hypoimmune factor is inserted into the safe harbor locus using an expression vector, such as a lentiviral expression vector.

[0312] Assays for determining the low immunogenicity of cells are generally described herein and in WO2018 / 132783 incorporated herein by reference. For example, low immunogenicity can be assayed using several techniques. These techniques include administration to allogeneic hosts, as well as monitoring of T cell and / or B cell responses in host animals. T cell function can be assessed by ELISpot, ELISA, FACS, PCR, or mass cytometry (CYTOF). B cell response or antibody response can be assessed using FACS or Luminex.

[0313] In some embodiments, low immunogenic cells exhibit a reduced level of immunogenicity compared to reference cells, e.g., unmodified or immunogenic cells. In some embodiments, the reduced level is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2x, 3x, 5x, 10x, 20x, 50x, or 100x.

[0314] In some embodiments, low immunogenicity cells promote a reduction in macrophage phagocytosis compared to reference cells, e.g., a decrease of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, and the reduction in macrophage phagocytosis is determined by assaying the phagocytic index in vitro.

[0315] In some embodiments, low immunogenic cells result in a reduction of cytotoxicity-mediated cytolysis by PBMCs, e.g., a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, compared to reference cells, e.g., unmodified or immunogenic cells.

[0316] In some embodiments, low immunogenic cells result in reduced NK-mediated cytolysis, e.g., a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or greater reduction in NK-mediated cytolysis compared to reference cells, e.g., unmodified or immunogenic cells, and NK-mediated cytolysis is assayed in vitro by a chromium-releasing assay or a europium-releasing assay.

[0317] In some embodiments, low immunogenic cells result in a reduction of CD8+ T cell-mediated cytolysis, e.g., a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or greater reduction of CD8 T cell-mediated cytolysis compared to reference cells, e.g., unmodified cells or immunogenic cells.

[0318] In some embodiments, low immunogenic cells induce a reduction in CD4+ T cell proliferation and / or activation, e.g., 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or greater, compared to reference cells, e.g., unmodified or immunogenic cells, and CD4 T cell proliferation is assayed in vitro (e.g., modified or unmodified mammalian source cells, and co-culture assays of CD4+ T cells with CD3 / CD28 Dynabeads).

[0319] In some embodiments, low immunogenic cells cause a reduction in T-cell IFN-gamma secretion, e.g., a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or greater reduction in T-cell IFN-gamma secretion compared to reference cells, e.g., unmodified or immunogenic cells, and T-cell IFN-gamma secretion is assayed in vitro, for example, by IFN-gamma ELISPOT.

[0320] In some embodiments, low immunogenic cells cause a reduction in immunogenic cytokine secretion, such as 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or greater, compared to reference cells, e.g., unmodified or immunogenic cells, and immunogenic cytokine secretion is assayed in vitro using ELISA or ELISpot.

[0321] In some embodiments, low immunogenic cells induce increased secretion of immunosuppressive cytokines, e.g., 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more compared to reference cells, e.g., unmodified or immunogenic cells, and immunosuppressive cytokine secretion is assayed in vitro using ELISA or ELISPOT.

[0322] Cells described herein can also be evaluated for immunogenicity. In some embodiments, cells are analyzed for the presence of antibodies on the cell surface, for example, by staining with an anti-IgM antibody. In other embodiments, immunogenicity is evaluated by a PBMC cell lysis assay. In some embodiments, cells are incubated with peripheral blood mononuclear cells (PBMCs) and then evaluated for lysis by PBMCs. In other embodiments, immunogenicity is evaluated by a natural killer (NK) cell lysis assay. In some embodiments, cells are incubated with NK cells and then evaluated for lysis by NK cells. In other embodiments, immunogenicity is evaluated by a CD8+ T cell lysis assay. In some embodiments, cells are incubated with CD8+ T cells and then evaluated for lysis by CD8+ T cells.

[0323] 1. CIITA In certain embodiments, the inventions disclosed herein regulate (e.g., reduce or eliminate) the expression of MHC II genes by targeting and regulating (e.g., reducing or eliminating) the expression of class II transactivators (CIITA). In some embodiments, the regulation occurs using a CRISPR / Cas system, where CIITA is a member of the LR or nucleotide-binding domain (NBD) leucine-rich repeat (LRR) family of proteins that regulates MHC II transcription by binding to the MHC enhanceosome.

[0324] In some embodiments, the target polynucleotide sequence of the present invention is a variant of CIITA. In some embodiments, the target polynucleotide sequence is a homolog of CIITA. In some embodiments, the target polynucleotide sequence is an ortholog of CIITA.

[0325] In some embodiments, the reduction or elimination of CIITA expression reduces or eliminates the expression of one or more of the following MHC class II: HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR.

[0326] In some embodiments, the low immunogenic cells outlined herein include gene modifications that target the CIITA gene. In some embodiments, the gene modification targeting the CIITA gene by a rarecut endonuclease includes a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene is selected from the group consisting of SEQ ID NOs. 5184-36352 in Appendix 1 (Table 12 of WO2016183041) provided herein. In some embodiments, the cells have a reduced ability to induce an immune response in the recipient.

[0327] Assays for testing whether the CIITA gene is inactivated are known and described herein. In one embodiment, the resulting genetic modification and decreased HLA-II expression of the CIITA gene by PCR can be assayed by FACS analysis. In another embodiment, CIITA protein expression is detected using Western blotting of cell lysates probed with an antibody against the CIITA protein. In yet another embodiment, the presence of inactivated genetic modification is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).

[0328] 2. B2M In certain embodiments, the invention disclosed herein modulates (e.g., reduces or eliminates) the expression of MHC-I genes by targeting and modulating (e.g., reducing or eliminating) the expression of accessory chain B2M. In some embodiments, the modulation occurs using a CRISPR / Cas system, and by modulating (e.g., reducing or deleting) the expression of B2M, surface transport of MHC-I molecules is blocked, making the cells less immunogenic. In some embodiments, the cells have a reduced ability to induce an immune response in the recipient.

[0329] In some embodiments, the target polynucleotide sequence of the present invention is a variant of B2M. In some embodiments, the target polynucleotide sequence is a homolog of B2M. In some embodiments, the target polynucleotide sequence is an ortholog of B2M.

[0330] In some embodiments, the reduction or elimination of B2M expression reduces or eliminates the expression of one or more of the following MHC I molecules: HLA-A, HLA-B, and HLA-C.

[0331] In some embodiments, the low immunogenic cells outlined herein include genetic modifications that target the B2M gene. In some embodiments, the genetic modification that targets the B2M gene by a rarecut endonuclease includes a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the B2M gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the B2M gene is selected from the group consisting of Sequence IDs 81240 to 85644 in Appendix 2 (Table 15 of WO2016 / 183041) provided herein.

[0332] Assays for testing whether the B2M gene is inactivated are known and described herein. In one embodiment, gene modification and decreased HLA-I expression resulting from PCR of the B2M gene can be assayed by FACS analysis. In another embodiment, B2M protein expression is detected using Western blotting of cell lysates probed with an antibody against the B2M protein. In yet another embodiment, the presence of inactivating gene modification is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).

[0333] 3.NLRC5 In certain embodiments, the invention disclosed herein modulates (e.g., reduces or eliminates) the expression of MHC-I genes by targeting and modulating (e.g., reducing or eliminating) the expression of the NLR family, CARD DOMEI-containing 5 / NOD27 / CLR16.1 (NLRC5). In some embodiments, the modulation occurs using the CRISPR / Cas system, and NLRC5 is a key regulator of the MHC-I-mediated immune response. Similar to CIITA, NLRC5 is highly induced by IIFN-γ and can translocate to the nucleus. NLRC5 activates the promoter of MHC-I genes and induces the transcription of MHC-I and related genes involved in MHC-I antigen presentation.

[0334] In some embodiments, the target polynucleotide sequence of the present invention is a variant of NLRC5. In some embodiments, the target polynucleotide sequence is a homolog of NLRC5. In some embodiments, the target polynucleotide sequence is an ortholog of NLRC5.

[0335] In some embodiments, reduction or elimination of NLRC5 expression reduces or eliminates the expression of one or more of the following MHC I molecules: HLA-A, HLA-B, and HLA-C.

[0336] In some embodiments, the low immunogenic cells outlined herein include genetic modifications that target the NLRC5 gene. In some embodiments, the genetic modification targeting the NLRC5 gene by a rarecut endonuclease includes a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the NLRC5 gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the NLRC5 gene is selected from the group consisting of SEQ ID NOs. 36353 to 81239 in Appendix 3 (Table 14 of WO2016183041) provided herein. In some embodiments, the cells have a reduced ability to induce an immune response in the recipient subject.

[0337] Assays for testing whether the NLRC5 gene is inactivated are known and described herein. In one embodiment, the resulting genetic modification and decreased HLA-I expression of the NLRC5 gene by PCR can be assayed by FACS analysis. In another embodiment, NLRC5 protein expression is detected using Western blotting of cell lysates probed with an antibody against the NLRC5 protein. In yet another embodiment, the presence of inactivated genetic modification is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).

[0338] 4. HLA-A / B / C In some embodiments, the low immunogenic cells of the present invention do not express or show reduced expression of one or more of HLA-A, HLA-B, and HLA-C.

[0339] In some embodiments, the disclosure provides stem cells (e.g., low immunogenic stem cells) or populations of cells or populations of cells comprising a genome in which the HLA-A gene has been edited to delete a contiguous stretch of genomic DNA, thereby reducing or eliminating the surface expression of MHC class I molecules in the cells or populations of cells. The contiguous stretch of genomic DNA can be deleted by contacting the cells or populations of cells with a Cas protein or nucleic acid encoding a Cas protein and at least one ribonucleic acid or at least one pair of ribonucleic acids.

[0340] In certain embodiments, the Disclosure provides a method for modifying a target HLA-A sequence within a cell, comprising clustering the HLA-A sequence and contacting it with a regularly arranged short palindromic sequence repeat-associated (Cas) protein and at least one ribonucleic acid or at least one pair of ribonucleic acids, wherein the ribonucleic acid is hybridized to a target motif of the target HLA-A polynucleotide sequence via the Cas protein, the target HLA-A polynucleotide sequence is cleaved, and at least one ribonucleic acid or at least one pair of ribonucleic acids is cleaved.

[0341] In some embodiments, the disclosure provides stem cells (e.g., low immunogenic stem cells) or populations of cells or populations of cells comprising a genome in which the HLA-B gene has been edited to delete a contiguous stretch of genomic DNA, thereby reducing or eliminating the surface expression of MHC class I molecules in the cells or populations of cells. The contiguous stretch of genomic DNA can be deleted by contacting the cells or populations of cells with a Cas protein or nucleic acid encoding a Cas protein and at least one ribonucleic acid or at least one pair of ribonucleic acids.

[0342] In certain embodiments, the present disclosure provides a method for modifying a target HLA-B sequence within a cell, comprising clustering the HLA-B sequence and contacting it with a regularly arranged short palindromic sequence repeat-associated (Cas) protein and at least one ribonucleic acid or at least one pair of ribonucleic acids, wherein the ribonucleic acid is hybridized to a target motif of the target HLA-B polynucleotide sequence via the Cas protein, the target HLA-B polynucleotide sequence is cleaved, and at least one ribonucleic acid or at least one pair of ribonucleic acids is cleaved.

[0343] In some embodiments, the disclosure provides stem cells (e.g., low immunogenic stem cells) or populations thereof, comprising a genome in which the HLA-C gene is edited to delete a contiguous stretch of genomic DNA, thereby reducing or eliminating the surface expression of MHC class I molecules in the cells or populations thereof. The contiguous stretch of genomic DNA can be deleted by contacting the cells or populations thereof with a Cas protein or nucleic acid encoding a Cas protein and at least one ribonucleic acid or at least one pair of ribonucleic acids.

[0344] In certain embodiments, the Disclosure provides a method for modifying a target HLA-C sequence within a cell, comprising clustering the HLA-C sequence and contacting it with a regularly arranged short palindromic sequence repeat-associated (Cas) protein and at least one ribonucleic acid or at least one pair of ribonucleic acids, wherein the ribonucleic acid is hybridized to a target motif of the target HLA-C polynucleotide sequence via the Cas protein, the target HLA-C polynucleotide sequence is cleaved, and at least one ribonucleic acid or at least one pair of ribonucleic acids is cleaved.

[0345] 5. CD47 In some embodiments, the inventions disclosed herein modulate (e.g., increase) the expression of CD47. In some embodiments, the disclosure provides stem cells (e.g., low immunogenic stem cells) or a population thereof, in which the stem cell genome is modified to express CD47. In some embodiments, the disclosure provides a method for modifying a stem cell genome to express CD47. In certain embodiments, at least one ribonucleic acid or at least one pair of ribonucleic acids can be used to facilitate the insertion of CD47 into a stem cell line. In certain embodiments, at least one ribonucleic acid or at least one pair of ribonucleic acids is selected from the group consisting of SEQ ID NOs 200784 to 231885 in Appendix 4 (Table 29 of WO2016183041) provided herein.

[0346] D. Methods of gene modification The present invention aims to modify a target polynucleotide sequence using any method available to those skilled in the art. In some embodiments, the method involves utilizing the CRISPR / Cas system of the present invention. For example, a base editing system including, but not limited to, an inactivated Cas9 protein can be used. Any CRISPR / Cas system capable of modifying a target polynucleotide sequence (e.g., a target gene) within a cell can be used. Such a CRISPR / Cas system can utilize a variety of Cas proteins (Haft et al. PLoS Comput Biol. 2005;1(6)e60). Molecular mechanisms of such Cas proteins that enable the CRISPR / Cas system to modify a target polynucleotide sequence within a cell include RNA-binding proteins, endonucleases and exonucleases, helicases, and polymerases. In some embodiments, alternatives to the CRISPR / Cas system can be used to modify a target polynucleotide sequence within a cell, including, but not limited to, site-directed recombinases (SSRs), zinc finger nucleases, TALE nucleases, meganucleases (also known as homing endonucleases), and the like.

[0347] CRISPR systems can be classified into two main classes, Class 1 and Class 2, which are further classified into different types and subtypes. The classification of CRISPR systems is based on the effector Cas protein that can cleave specific nucleic acids. In Class 1 CRISPR systems, the effector module consists of a multi-protein complex, while in Class 2 systems, only one effector protein is used. Class 1 CRISPR includes types I, III, and IV, and Class 2 CRISPR includes types II, V, and VI. Any of these types of CRISPR systems can be used according to the present invention, but there are three types of CRISPR systems that incorporate RNA and Cas proteins preferred for use according to the present invention: Type I (exemplified by Cas3), Type II (exemplified by Cas9), and Type III (exemplified by Cas10). Type II CRISPR is one of the best-characterized systems. In some embodiments, the CRISPR / Cas system is a CRISPR Type I system. In some embodiments, the CRISPR / Cas system is a CRISPR Type II system. In some embodiments, the CRISPR / Cas system is a CRISPR type V system. In some embodiments, the CRISPR / Cas system is a CRISPR type VI system.

[0348] The CRISPR / Cas system of this technology can be used to modify any target polynucleotide sequence within a cell. Those skilled in the art will readily understand that the desired target polynucleotide sequence to be modified in any particular cell may correspond to any genomic sequence whose expression is associated with impairment or otherwise facilitates the entry of pathogens into the cell. For example, a desired target polynucleotide sequence to be altered within a cell may be a polynucleotide sequence corresponding to a genomic sequence containing a disease-related single nucleotide polymorphism. In such an example, the CRISPR / Cas system of this technology can be used to correct the disease-related SNP within the cell by replacing the cell with the wild-type allele. As another example, a polynucleotide sequence of a target gene involved in the entry or proliferation of a pathogen into a cell may be a suitable target for deletion or insertion to disrupt the function of the target gene in order to prevent the pathogen from entering and proliferating within the cell.

[0349] In some embodiments, the target polynucleotide sequence is a genome sequence. In some embodiments, the target polynucleotide sequence is a human genome sequence. In some embodiments, the target polynucleotide sequence is a mammalian genome sequence. In some embodiments, the target polynucleotide sequence is a vertebrate genome sequence.

[0350] In some embodiments, the CRISPR / Cas system of the present invention comprises a Cas protein and at least one to two ribonucleic acids (e.g., guide RNA or guide RNA target sequence) that can hybridize the Cas protein to a target motif of a target polynucleotide sequence. As used herein, “protein” and “polypeptide” are used interchangeably to refer to a series of amino acid residues linked by peptide bonds (i.e., polymers of amino acids), and include modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs. Exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, paralogs, fragments and other equivalents, variants, and the analogs described above.

[0351] In some embodiments, the Cas protein includes one or more amino acid substitutions or modifications. In some embodiments, one or more amino acid substitutions include conservative amino acid substitutions. In some cases, substitutions and / or modifications can prevent or reduce proteolysis and / or extend the half-life of the polypeptide in cells. In some embodiments, the Cas protein may include peptide bond substitutions (e.g., urea, thiourea, carbamate, sulfonylurea, etc.). In some embodiments, the Cas protein may contain naturally occurring amino acids. In some embodiments, the Cas protein may contain alternative amino acids (e.g., D-amino acids, beta-amino acids, homocysteine, phosphoserine, etc.). In some embodiments, the Cas protein may be modified to include a moiety (e.g., pegylation, glycosylation, lipidation, acetylation, end-capping, etc.).

[0352] In some embodiments, the Cas protein includes a core Cas protein. Exemplary Cas core proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 or Csx12), Cas10, Cas11, Cas12, Cas13, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, This includes, but is not limited to, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csa1, Csa2, Csa3, Csa4, Csa5, their homologs, or modifications thereof. In some embodiments, the Cas protein includes the Cas protein of the E. coli subtype (also known as CASS2). Exemplary Cas proteins of the E.Coli subtype include, but are not limited to, Cse1, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, the Cas protein includes Cas proteins of the Ypest subtype (also known as CASS3). Exemplary Cas proteins of the Ypest subtype include, but are not limited to, Csy1, Csy2, Csy3, and Csy4. In some embodiments, the Cas protein includes Cas proteins of the Nmeni subtype (also known as CASS4). Exemplary Cas proteins of the Nmeni subtype include, but are not limited to, Csn1 and Csn2. In some embodiments, the Cas protein includes Cas proteins of the Dvulg subtype (also known as CASS1). Exemplary Cas proteins of the Dvulg subtype include Csd1, Csd2, and Cas5d.In some embodiments, the Cas protein includes Cas proteins of the Tneap subtype (also known as CASS7). Exemplary Cas proteins of the Tneap subtype include, but are not limited to, Cst1, Cst2, and Cas5t. In some embodiments, the Cas protein includes Cas proteins of the Hmari subtype. Exemplary Cas proteins of the Hmari subtype include, but are not limited to, Csh1, Csh2, and Cas5h. In some embodiments, the Cas protein includes Cas proteins of the Apern subtype (also known as CASS5). Exemplary Cas proteins of the Apern subtype include, but are not limited to, Csa1, Csa2, Csa3, Csa4, Csa5, and Cas5a. In some embodiments, the Cas protein includes Cas proteins of the Mtube subtype (also known as CASS6). Exemplary Cas proteins of the Mtube subtype include, but are not limited to, Csm1, Csm2, Csm3, Csm4, and Csm5. In some embodiments, the Cas protein includes RAMP module Cas proteins. Exemplary RAMP module Cas proteins include, but are not limited to, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6. See, for example, Klompe et al., Nature 571, 219-225 (2019) and Strecker et al., Science 365, 48-53 (2019).

[0353] In some embodiments, the Cas protein comprises one of the Cas proteins described herein or a functional portion thereof. As used herein, “functional portion” refers to a portion of a peptide that forms a complex with at least one ribonucleic acid (e.g., guide RNA (gRNA)) and retains its ability to cleave a target polynucleotide sequence. In some embodiments, the functional portion comprises a combination of operably linked Cas9 protein functional domains selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional portion comprises a combination of operably linked Cas12a (also known as Cpf1) protein functional domains selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional domains form a complex. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of a RuvC-like domain. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of an HNH nuclease domain. In some embodiments, the functional portion of the Cas12a protein includes the functional portion of the RuvC-like domain.

[0354] In some embodiments, the exogenous Cas protein may be introduced into cells in polypeptide form. In certain embodiments, the Cas protein may be coupled to or fused with a cell-permeable polypeptide or cell-permeable peptide. As used herein, “cell-permeable polypeptide” and “cell-permeable peptide” refer to polypeptides or peptides, respectively, that facilitate the uptake of molecules into cells. The cell-permeable polypeptide may contain a detectable label.

[0355] In certain embodiments, the Cas protein can be coupled to or fused to a charged protein (e.g., positively charged, negatively charged, or neutrally charged overall). Such coupling may be covalent. In some embodiments, the Cas protein can be fused to positively supercharged GFP to significantly increase the Cas protein's ability to penetrate cells (Cronican et al. ACS Chem Biol. 2010;5(8):747-52). In certain embodiments, the Cas protein can be fused to a protein transduction domain (PTD) to facilitate its entry into cells. Exemplary PTDs include Tat, oligoarginine, and penetratin. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a cell-permeable peptide. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a PTD. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a tat domain. In some embodiments, the Cas9 protein includes a Cas9 polypeptide fused to an oligoarginine domain. In some embodiments, the Cas9 protein includes a Cas9 polypeptide fused to a penetratin domain. In some embodiments, the Cas9 protein includes a Cas9 polypeptide fused to a positively supercharged GFP. In some embodiments, the Cas12a protein includes a Cas12a polypeptide fused to a cell-permeable peptide. In some embodiments, the Cas12a protein includes a Cas12a polypeptide fused to a PTD. In some embodiments, the Cas12a protein includes a Cas12a polypeptide fused to a tat domain. In some embodiments, the Cas12a protein includes a Cas12a polypeptide fused to an oligoarginine domain. In some embodiments, the Cas12a protein includes a Cas12a polypeptide fused to a penetratin domain. In some embodiments, the Cas12a protein includes a Cas12a polypeptide fused to a positively supercharged GFP.

[0356] In some embodiments, the Cas protein is introduced into cells containing a target polynucleotide sequence in the form of a nucleic acid encoding the Cas protein. The process of introducing the nucleic acid into cells can be achieved by any preferred technique. Preferred techniques include transfection via calcium phosphate or lipids, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises modified DNA as described herein. In some embodiments, the nucleic acid comprises mRNA. In some embodiments, the nucleic acid comprises modified mRNA (e.g., synthetic modified mRNA) as described herein.

[0357] Cas9 mediates genome editing at a site complementary to a 20-nucleotide sequence (e.g., a protospacer) within the bound guide RNA. Furthermore, the target site must contain a protospacer adjacency motif (PAM) at the 3' end adjacent to the 20-nucleotide target site; for Streptococcus pyogenes Cas9, the PAM sequence is NGG. The method of the present invention assumes the use of any ribonucleic acid capable of orienting the Cas protein to a target motif of a target polynucleotide sequence and hybridizing thereto. In some embodiments, at least one of the ribonucleic acids comprises tracrRNA. In some embodiments, at least one of the ribonucleic acids comprises CRISPR RNA (crRNA). In some embodiments, a single ribonucleic acid comprises a guide RNA that orients the Cas protein to a target motif of a target polynucleotide sequence in a cell and hybridizes thereto. In some embodiments, at least one of the ribonucleic acids comprises a segment that orients the Cas protein to a target motif of a target polynucleotide sequence in a cell and hybridizes thereto. In some embodiments, both of the 1-2 ribonucleic acids include segments that orient the Cas protein to a target motif of a target polynucleotide sequence in the cell and hybridize thereto, and the ribonucleic acids of the present invention can be selected to hybridize to a variety of different target motifs depending on the specific CRISPR / Cas system used and the sequence of the target polynucleotide, as will be understood by those skilled in the art. The 1-2 ribonucleic acids can also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence. In some embodiments, the 1-2 ribonucleic acids hybridize to a target motif that contains at least two mismatches when compared to all other genomic nucleotide sequences in the cell. The gRNA molecule generally includes a targeting domain and a tracr. In some embodiments, the targeting domain and tracr are located on a single polynucleotide. In some embodiments, the gRNA molecule consists of a single adjacent polynucleotide molecule, which is referred herein as a “single guide RNA” or “sgRNA,” etc.In other embodiments, the gRNA molecule consists of multiple, usually two, polynucleotide molecules which can typically associate themselves through hybridization and are referred to herein as “dual guide RNA” or “dgRNA” or “two-part guide RNA.”

[0358] It has been suggested that complementarity between the guide RNA and target DNA is required in the 7-12 base pairs adjacent to the PAM end (3' end of the guide RNA) of the target site, and that mismatches are acceptable at the non-PAM end (5' end of the guide RNA). In some embodiments, there is at least one mismatch between the DNA-binding segment of the guide RNA and the target DNA; in some embodiments, there are at least two mismatches between the DNA-binding segment of the guide RNA and the target DNA; in some embodiments, there are at least three mismatches between the DNA-binding segment of the guide RNA and the target DNA; in some embodiments, there are at least four mismatches between the DNA-binding segment of the guide RNA and the target DNA; in some embodiments, there are at least five mismatches between the DNA-binding segment of the guide RNA and the target DNA; in some embodiments, the Cas protein is complexed with one or two ribonucleic acid sequences (e.g., gRNA); in some embodiments, the Cas protein is complexed with two ribonucleic acid sequences; in some embodiments, the Cas protein is complexed with one ribonucleic acid sequence. In some embodiments, the Cas protein is encoded by a modified nucleic acid (e.g., synthetically modified mRNA) as described herein.

[0359] The method of the present invention envisions the use of any ribonucleic acid sequence that can orient the Cas protein to a target motif of a target polynucleotide sequence and hybridize thereto. In some embodiments, a single guide RNA is used. In some embodiments, dual guide RNAs are used. In some embodiments, at least one of the ribonucleic acid sequences comprises tracrRNA, and in some embodiments, at least one of the ribonucleic acid sequences comprises CRISPR RNA (crRNA). In some embodiments, the single ribonucleic acid comprises guide RNA that orients the Cas protein to a target motif of a target polynucleotide sequence in a cell and hybridizes thereto. In some embodiments, the ribonucleic acid sequence is a guide RNA comprising crRNA and tracrRNA that hybridizes the Cas protein toward a target motif of a target polynucleotide sequence in a cell.

[0360] The ribonucleic acid sequence of a guide RNA specific to a target sequence (e.g., a protospacer) can be designed by replacing thymine with uracil in the crRNA and adding a tracrRNA sequence. The guide RNA does not contain a PAM sequence that functions as a binding signal for the Cas protein. From the target sequence, a guide RNA containing a crRNA complementary to the target sequence can be designed. The guide RNA sequence is also designed with minimal off-targeting binding and cleavage. In some cases, off-target prediction methods and algorithms, including those described in Hsu et al., Nature Biotechnology, 2013, 31, 827-832, are used to evaluate the guide RNA target sequence. Provided herein are guide RNAs containing RNA sequences corresponding to gRNA targets disclosed in either the table or figure.

[0361] The ribonucleic acids of the present invention can be selected to hybridize to a variety of different target motifs depending on the specific CRISPR / Cas system used and the sequence of the target polynucleotide, as will be understood by those skilled in the art. One or two ribonucleic acids can also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence. In some embodiments, one or two ribonucleic acids hybridize to a target motif containing at least two mismatches when compared with all other genomic nucleotide sequences in the cell. In some embodiments, one or two ribonucleic acids hybridize to a target motif containing at least one mismatch when compared with all other genomic nucleotide sequences in the cell. In some embodiments, one or two ribonucleic acids are designed to hybridize to a target motif directly adjacent to a deoxyribonucleic acid motif recognized by the Cas protein. In some embodiments, each of the one or two ribonucleic acids is designed to hybridize to a target motif directly adjacent to a deoxyribonucleic acid motif recognized by the Cas protein adjacent to a mutant allele located between the target motifs.

[0362] In some embodiments, each of one or two ribonucleic acids contains a guide RNA that directs the Cas protein to a target motif of a target polynucleotide sequence in the cell and hybridizes to it.

[0363] In some embodiments, one or two ribonucleic acids (e.g., guide RNA) are complementary to and / or hybridize sequences on the same strand of the target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNA) are complementary to and / or hybridize sequences on the opposite strand of the target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNA) are not complementary to and / or hybridize sequences on the opposite strand of the target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNA) are complementary to and / or hybridize overlapping target motifs of the target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNA) are complementary to and / or hybridize target motifs of the target polynucleotide sequence.

[0364] In some embodiments, the target nucleic acid sequence for genome editing may have a specific sequence at its 3' end, named a protospacer-adjacent motif or protospacer-associated motif (PAM). The PAM is present within the targeted nucleic acid sequence but not within the crRNA produced to target it. In some embodiments, the protospacer-adjacent motif (PAM) may correspond to 2–5 nucleotides starting very close to or near the protospacer at the distal end of the leader. The sequence and location of the PAM vary between different systems. Non-limiting examples of PAM motifs include NNAGAA (SEQ ID NO: 98), NAG, NGG, NGGNG (SEQ ID NO: 99), AWG, CC, CC, CCN, TCN, and TTC. Different type II CRISPR systems have different PAM requirements. For example, the S. pyogenes system requires the NGG sequence, where N is any nucleotide. In some cases, the Cas9 protein can be manipulated to recognize a specific PAM motif or a non-native PAM motif. In some cases, the selected target sequence may include smaller or larger PAM motifs along with any combination of amino acids. In some embodiments, the selected target sequence includes a PAM motif comprising at least 3, preferably 4, more preferably 5 nucleotides, which are recognized by the Cas9 protein or a variant thereof.

[0365] In some embodiments, the nucleic acid encoding the Cas protein and the nucleic acids encoding at least one or two ribonucleic acids are introduced into the cell via viral transduction (e.g., lentiviral transduction). In some embodiments, the Cas protein is complexed with one or two ribonucleic acids. In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid (e.g., synthetically modified mRNA) as described herein. In some embodiments, the guide RNA comprises a peptide nucleic acid (PNA) or a locked nucleic acid (LNA).

[0366] Table 1 provides exemplary gRNA sequences useful for CRISPR / Cas-based targeting of the genes described herein. The sequences can be found in WO2016 / 183041, filed on 9 May 2016, and the disclosure, including the table, annexes, and sequence listings, is incorporated herein by reference in its entirety.

[0367] Further disclosures of the CRISPR / Cas system can be found in U.S. Patents No. 8,697,359, 8,993,233, 8,795,965, 8,771,945, 8,889,356, 8,865,406, 8,999,641, 8,945,839, 8,932,814, 8,871,445, 8,906,616, and 8,895,308; Yan et al., Science 363,88-91 (2019); Moon et al., Experimental & Molecular The disclosure, including figures, figure legends, and method descriptions, is provided in Medicine (2019) 51:130 and Tachibana, Science (2019; www.sciencemag.org / features / 2019 / 09 / beyond-crispr-what-s-current-and-upcoming-genome-editing), and is incorporated herein by reference in its entirety. Table 5 provides exemplary gRNA sequences useful for CRISPR / Cas-based targeting of the genes described herein. The sequences can be found in WO2016183041, filed on 9 May 2016, and the disclosure, including tables, annexes, and sequence listings, is incorporated herein by reference in its entirety. [Table 5]

[0368] In some embodiments, the cells of the present invention are prepared using a transcription activator-like effector nuclease (TALEN) methodology.

[0369] A "TALE-nuclease" (TALEN) is intended to be a fusion protein consisting of a nucleic acid binding domain typically derived from a transcription activator-like effector (TALE) and a single nuclease catalytic domain for cleaving a nucleic acid target sequence. The catalytic domain is preferably a nuclease domain, and more preferably an endonuclease domain such as I-TevI, ColE7, NucA, and Fok-I. TALE-nucleases are specific reagents because they need to bind to DNA in pairs under a heterodimer configuration, which is essential for dimerization of the cleavage domain (e.g., Fok-1). Each of the left and right heterodimer members recognizes a different nucleic acid sequence of approximately 14–20 bp, and the overall specificity spans a target sequence of 30–50 bp. To induce site-directed mutation, two individual TALEN arms, separated by a 14–20 base pair spacer region, dimerize with the FokI monomer in close proximity, generating a targeted double-strand break. In certain embodiments, the TALE domain can be fused to meganucleases such as I-CreI and I-Onul or their functional variants. In some embodiments, the TALE-nuclease is a heterodimeric nuclease. In some embodiments, the TALE-nuclease is a monomeric TALE-nuclease. Monomeric TALE-nucleases are TALE-nucleases that do not require dimerization for specific recognition and cleavage, such as the fusion of the catalytic domain of I-TevI ​​and an engineered TAL repeat described in WO2012138927. The transcription activator-like effector (TALE) is a protein derived from the bacterial species Xanthomonas and comprises multiple repeat sequences, each repeat containing two residues (RVD) at positions 12 and 13, specific to each nucleotide base of the nucleic acid targeting sequence. Binding domains with similar base-to-base specific nucleic acid binding properties (MBBBDs) can also be derived from novel modular proteins recently discovered by the applicant in different bacterial species.Novel modular proteins have the advantage of exhibiting greater sequence variability than TAL repeats. Preferably, the RVDs associated with the recognition of different nucleotides are HD for recognizing C, NG for recognizing T, NI for recognizing A, NN for recognizing G or A, NS for recognizing A, C, G or T, HG for recognizing T, IG for recognizing T, NK for recognizing G, HA for recognizing C, ND for recognizing C, HI for recognizing C, HN for recognizing G, NA for recognizing G, SN for recognizing G or A, and YG for recognizing T, TL for recognizing A, VT for recognizing A or G, and SW for recognizing A. In another embodiment, key amino acids 12 and 13 can be mutated for other amino acid residues to modulate, and in particular to enhance, their specificity for nucleotides A, T, C, and G. TALEN kits are commercially available.

[0370] In some embodiments, cells are manipulated using zinc finger nucleases (ZFNs). A "zinc finger-binding protein" is a protein or polypeptide that binds to DNA, RNA, and / or other proteins, preferably in a sequence-specific manner, as a result of the stabilization of its protein structure by the coordination of zinc ions. The term zinc finger-binding protein is often abbreviated as zinc finger protein or ZFP. Individual DNA-binding domains are typically called "finger." A ZFP has at least one finger, usually two, three, or six. Each finger binds to 2-4 base pairs of DNA, typically 3-4 base pairs. ZFPs bind to nucleic acid sequences called target sites or target segments. Each finger typically contains approximately 30 amino acids, zinc chelates, and a DNA-binding subdomain. Studies have demonstrated that a single zinc finger in this class consists of an α-helix containing two invariant histidine residues coordinated with zinc, along with two cysteine ​​residues in a single β-turn (see, e.g., Berg & Shi, Science 271:1081-1085 (1996)).

[0371] In some embodiments, the cells of the present invention are prepared using homing endonucleases. Such homing endonucleases are well known in the art (Stoddard 2005). Homing endonucleases recognize DNA target sequences and generate single-strand or double-strand degradation. Homing endonucleases are highly specific and recognize DNA target sites in the range of 12 to 45 base pairs (bp) in length, typically in the range of 14 to 40 bp. Homing endonucleases according to the present invention may correspond, for example, to LAGLIDADG endonuclease, HNH endonuclease, or GIY-YIG endonuclease. A preferred homing endonuclease according to the present invention may be an I-CreI variant.

[0372] In some embodiments, the cells of the present invention are prepared using meganucleases. Meganucleases are, by definition, sequence-specific endonucleases that recognize large sequences (Chevalier, BS and BLStoddard, Nucleic Acids Res., 2001, 29, 3757-3774). These can cleave specific sites within living cells, thereby enhancing gene targets near the cleavage site by more than 1000 times (Puchta et al., Nucleic Acids Res., 1993, 21, 5034-5040, Rouet et al., Mol.Cell.Biol., 1994, 14, 8096-8106, Choulika et al., Mol.Cell.Biol., 1995, 15, 1968-1973, Puchta et al., Proc.Natl.Acad.Sci.USA, 1996, 93, 5055-5060, Sargent et al., Mol.Cell.Biol., 1997, 17, 267-77, Donoho et al., Mol.Cell.Biol., 1998, 18, 4070-4078, Elliott et al. al., Mol. Cell. Biol., 1998, 18, 93-101, Cohen-Tannoudji et al., Mol. Cell. Biol., 1998, 18, 1444-1448).

[0373] In some embodiments, the cells of the present invention are prepared using RNA silencing or RNA interference (RNAi) to knock down (e.g., reduce, eliminate, or inhibit) the expression of polypeptides such as low-immunity factors. Useful RNAi methods include those utilizing synthetic RNAi molecules, short interfering RNAs (siRNAs), PIWI-interacting NRAs (piRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNAs), and other transient knockdown methods recognized in the art. RNAi reagents, including sequence-specific shRNAs, siRNAs, and miRNAs, are commercially available. For example, CIITA can be knocked down in pluripotent stem cells by introducing CIITA siRNA or a CIITA shRNA-expressing virus into cells. In some embodiments, RNA interference is used to reduce or inhibit the expression of at least one selected from the group consisting of CIITA, B2M, ABO, RHD, and FUT1.

[0374] In some embodiments, the rarecut endonuclease is introduced into cells containing a target polynucleotide sequence in the form of a nucleic acid encoding the rarecut endonuclease. The process of introducing the nucleic acid into cells can be achieved by any preferred technique. Preferred techniques include transfection via calcium phosphate or lipids, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises modified DNA as described herein. In some embodiments, the nucleic acid comprises mRNA. In some embodiments, the nucleic acid comprises modified mRNA (e.g., synthetic modified mRNA) as described herein.

[0375] The process of introducing nucleic acids into cells can be achieved by any suitable technique. Gene editing systems used herein, such as CRISPR, TALEN, and ZFN systems, can be delivered into cells by any suitable technique, including but not limited to calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using viral vectors. In some embodiments, the gene editing systems of the present invention are delivered into cells by electroporation. In some embodiments, the electroporation system is a fluid electroporation system, and an example of a suitable fluid electroporation system suitable for use in some embodiments of the present invention is the commercially available MaxCyte STX system, and there are several commercially available alternative electroporation devices that may be suitable for use in the present invention, such as the AgilePulse system or ECM830 available from BTX-Harvard Apparatus, Cellaxess Elektra (Cellectricon), Nucleofector (Lonza / Amaxa), GenePulser MXcell (BIORAD), iPorator-96 (Primax), or iPORTer96 (Ambion). In some embodiments, the electroporation system forms a closed, sterile system for the cells. In some embodiments, the electroporation system is a pulsed electroporation system, as described herein, and forms a closed, sterile system for the cells.

[0376] E. Overexpression of tolerance factors For all techniques described herein, recombinant nucleic acids can be generated using well-known recombinant techniques. In certain embodiments, overexpression of tolerance factors is achieved by utilizing regulatory sequences within the expression construct. In certain embodiments, recombinant nucleic acids encoding immunotolerogenic factors can be operably ligated to one or more regulatory nucleotide sequences in the expression construct. The regulatory nucleotide sequences are generally appropriate for the host cells being treated and the recipient. Many types of appropriate expression vectors and suitable regulatory sequences are known in the art for various host cells and are compatible with the techniques disclosed herein. Typically, one or more regulatory nucleotide sequences may include, but are not limited to, promoter sequences, leader or signal sequences, ribosome binding sites, transcription start and termination sequences, translation start and termination sequences, and enhancer or activator sequences. Constitutive or inductive promoters known in the art are also considered. Promoters may be either naturally occurring promoters or hybrid promoters combining elements of two or more promoters. Expression constructs may reside in cells on episomes, such as plasmids, or expression constructs may be inserted into chromosomes. In certain embodiments, the expression vector includes a selectable marker gene to allow selection of transformed host cells. Certain embodiments include an expression vector comprising a nucleotide sequence encoding a variant polypeptide operably linked to at least one regulatory sequence. Regulatory sequences for use herein include promoters, enhancers, and other expression regulatory elements. In certain embodiments, the expression vector is designed for selection of the host cell to be transformed, a specific variant polypeptide to be expressed, the copy number of the vector, its ability to control its copy number, and / or the expression of other encoded proteins, such as antibiotic markers.

[0377] Examples of suitable mammalian promoters include, for example, promoters from the following genes: elongation factor 1 alpha (EF1α) promoter, hamster ubiquitin / S27a promoter (WO97 / 15664), monkey vacuolar virus 40 (SV40) early promoter, adenovirus major late promoter, mouse metallothionein-I promoter, Roussarcoma virus (RSV) long terminal repeat region, mouse mammary tumor virus promoter (MMTV), Moloney's mouse leukemia virus long terminal repeat region, and human cytomegalovirus (CMV) early promoter. Examples of other heterozoan mammalian promoters include actin, immunoglobulin, or heat shock promoters. In additional embodiments, promoters for use in mammalian host cells can be obtained from the genomes of viruses such as polyomaviruses, fowlpox virus (UK2,211,504, published July 5, 1989), bovine papillomavirus, aerosarcoma virus, cytomegalovirus, retroviruses, hepatitis B virus, and Simian virus 40 (SV40). In further embodiments, heterologous mammalian promoters are used. Examples include actin promoters, immunoglobulin promoters, and heat shock promoters. Early and late promoters of SV40 are conveniently obtained as SV40 restriction fragments that also contain the origin of replication of the SV40 virus (Fiers et al, Nature 273:113-120 (1978)). The very early promoter of human cytomegalovirus is conveniently obtained as a Hind III restriction enzyme fragment (Greenaway et al, Gene 18:355-360 (1982)). The aforementioned references are incorporated in their entirety by reference.

[0378] The process for introducing polynucleotides into cells as described herein can be achieved by any preferred technique. Preferred techniques include transfection via calcium phosphate or lipids, electroporation, and transduction or infection using viral vectors. In some embodiments, polynucleotides are introduced into cells via viral transduction (e.g., lentiviral transduction).

[0379] Once altered, the presence of expression of any of the molecules described herein can be assayed using known techniques such as Western blotting, ELISA assays, and FACS assays.

[0380] F. Assays for maintaining low immunogenicity and pluripotency Once low immunogenic cells are generated, they can be assayed for the retention of their low immunogenicity and / or pluripotency, as described in WO2016183041 and WO2018132783.

[0381] In some embodiments, low immunogenicity is assayed using several techniques, such as those illustrated in Figures 13 and 15 of WO2018132783. These techniques include transplantation into allogeneic hosts and monitoring of low immunogenic pluripotent cell proliferation (e.g., teratomas) that evade the host immune system. In some cases, low immunogenic pluripotent cell derivatives can be transduced to express luciferase and then tracked using bioluminescence imaging. Similarly, the T cell and / or B cell response of the host animal to such cells is tested to confirm that the cells do not provoke an immune response in the host animal. T cell function is assessed by ELISpot, ELISA, FACS, PCR, or mass cytometry (CYTOF). B cell response or antibody response is assessed using FACS or Luminex. Additionally or alternatively, as commonly shown in Figures 14 and 15 of WO2018132783, cells may be assayed for their ability to evade innate immune responses, e.g., NK cell death.

[0382] In some embodiments, the immunogenicity of cells is assessed using T cell immunoassays such as T cell proliferation assays, T cell activation assays, and T cell death assays, which are recognized by those skilled in the art. In some cases, a T cell proliferation assay involves pre-treating cells with interferon-gamma, co-culturing the cells with labeled T cells, and assaying the presence of a T cell population (or proliferating T cell population) after a pre-selected time. In some cases, a T cell activation assay involves co-culturing T cells with cells outlined herein and determining the expression levels of T cell activation markers in the T cells.

[0383] In vivo assays can be performed to evaluate the immunogenicity of the cells outlined herein. In some embodiments, the viability and immunogenicity of low immunogenic cells are determined using allogeneic humanized immunodeficiency mouse models. In some cases, low immunogenic pluripotent stem cells are transplanted into allogeneic humanized NSG-SGM3 mice and assayed for cell rejection, cell viability, and teratoma formation. In some cases, transplanted low immunogenic pluripotent stem cells or their differentiated cells exhibit long-term survival in the mouse model.

[0384] Additional techniques for determining the immunogenicity of cells, including low immunogenicity, are described, for example, Deuse et al., Nature Biotechnology, 2019, 37, 252-258 and Han et al., Proc Natl Acad Sci USA, 2019, 116(21), 10441-10446, and disclosures including figures, legends for figures and tables, and descriptions of methods are incorporated herein by reference in their entirety.

[0385] Similarly, the retention of pluripotency is tested in several ways. In one embodiment, pluripotency is assayed by the expression of specific pluripotency-specific factors, as commonly described herein and shown in Figure 29 of WO2018132783. Additionally or alternatively, pluripotent cells differentiate into one or more cell types as an indicator of pluripotency.

[0386] As will be understood by those skilled in the art, the successful reduction of MHCI function (HLA I if the cells are derived from human cells) in pluripotent cells can be measured using techniques known in the art, such as using commercially available HLA-A, B, and C antibodies that bind to the alpha chain of the human major histocompatibility gene HLA class I antigen, or using FACS techniques that use labeled antibodies that bind to the HLA complex.

[0387] Furthermore, cells can be tested to confirm that the HLAI complex is not expressed on the cell surface. This can be assayed by FACS analysis using antibodies against one or more HLA cell surface components, as described above.

[0388] The success of reducing MHC II function (or HLA II if the cells are derived from human cells) in pluripotent cells or their derivatives can be measured using techniques known in the art, such as Western blotting, FACS, and RT-PCR, which use antibodies against proteins.

[0389] Furthermore, cells can be tested to confirm that HLA II combinations are not expressed on the cell surface. In this case as well, the assay is performed as is known in the art (see, for example, Figure 21 in WO2018132783), and is generally performed using either Western blotting or FACS analysis based on commercially available antibodies that bind to human HLA class II HLA-DR, DP, and most DQ antigens.

[0390] In addition to reduced HLA I and II (or MHC I and II), the hypoimmunogenic cells of the present invention have reduced sensitivity to macrophage phagocytosis and NK cell death. The resulting hypoimmunogenic cells "evade" immune macrophages and innate immune pathways through the expression of one or more CD47 transgenes.

[0391] G. Maintenance of hypoimmunogenic pluripotent stem cells When low immunogenic pluripotent stem cells are generated, they can maintain an undifferentiated state, as is known from the maintenance of iPSC cells. For example, cells can be cultured on Matrigel using a medium that prevents differentiation and maintains pluripotency. Furthermore, they can be placed in a medium under conditions that maintain pluripotency. Methods for culturing pluripotent stem cells are recognized in the art and are described, for example, in WO2016183041 and WO2018132783.

[0392] H. Differentiation of hypoimmunogenic pluripotent stem cells The present invention provides hypoimmunogenic pluripotent cells that differentiate into different cell types for subsequent transplantation into a subject. As will be understood by those skilled in the art, the method for differentiation using known methods depends on the desired cell type. Cells differentiate in suspension and become gel matrix forms such as Matrigel, gelatin, or fibrin / thrombin forms, which can facilitate cell survival. In some cases, differentiation can be assayed, as is known in the art, by generally evaluating the presence of cell-specific markers.

[0393] In some embodiments, hypoimmunogenic pluripotent cells are differentiated into hepatocytes to address loss of hepatocyte function or cirrhosis. Several techniques can be used to differentiate hypoimmunogenic pluripotent cells into hepatocytes. See, for example, Pettinato et al., doi:10.1038 / spre32888, Snykers et al., Methods Mol Biol 698:305-314 (2011), Si-Tayeb et al, Hepatology 51:297-305 (2010), and Asgari et al., Stem Cell Rev(:493-504 (2013) (all of which are incorporated herein by reference, specifically regarding methodologies and reagents for differentiation). Differentiation is assayed as is known in the art by assessing the presence of hepatocyte-related and / or specific markers, including but not limited to albumin, alpha-fetoprotein, and fibrinogen. Differentiation can also be measured functionally, such as ammonia metabolism, LDL storage and uptake, ICG uptake and release, and glycogen storage.

[0394] In some embodiments, low immunogenic pluripotent cells are differentiated into beta-like cells or pancreatic islet organoids for transplantation to address type 1 diabetes mellitus (T1DM). This cell system is a promising method for addressing T1DM. See, for example, Ellis et al., doi / 10.1038 / nrgastro.2017.93 (incorporated herein by reference). Furthermore, Pagliuca et al. have reported successful differentiation of β cells from human iPSCs (see doi / 10.106 / j.cell.2014.09.040, the whole report, specifically the methods and reagents outlined therein for the large-scale production of functional human β cells from human pluripotent stem cells, is incorporated herein by reference). Furthermore, Vegas et al. demonstrate the production of human β-cells from human pluripotent stem cells, followed by encapsulation to avoid host immune rejection (doi:10.1038 / nm.4030, the whole report, specifically the methods and reagents outlined therein for the large-scale production of functional human β-cells from human pluripotent stem cells, is incorporated herein by reference).

[0395] Differentiation is assayed, as is known in the art, by evaluating the presence of β-cell-related or specific markers, including but not limited to insulin. Differentiation can also be measured functionally, such as by measuring glucose metabolism. See, for example, Murarō et al., doi:10.1016 / j.cels.2016.09.002 (the whole work is incorporated herein for the biomarkers specifically outlined therein).

[0396] In some embodiments, low immunogenic pluripotent cells are differentiated into retinal pigment epithelium (RPE) to address diseases that threaten the vision of the eye. Human pluripotent stem cells have been differentiated into RPE cells using the techniques outlined in Kamao et al., Stem Cell Reports 2014:2:205-18 (the whole of which is incorporated herein by reference, specifically for the methods and reagents outlined therein for differentiation techniques and reagents). See also Mandai et al., doi:10.1056 / NEJMoa1608368 (the whole of which is also incorporated for techniques for generating sheets of RPE cells and transplanting them into patients).

[0397] Differentiation can generally be assayed, as is known in the art, by assessing the presence of RPE cell-related and / or specific markers, or by functionally measuring them. See, for example, Kamao et al., doi:10.1016 / j.stemcr.2013.12.007 (the entire work, specifically for the markers outlined in the first paragraph of the results section, is incorporated herein).

[0398] In some embodiments, hypoimmunogenic pluripotent cells are differentiated into cardiomyocytes to address cardiovascular disease. Techniques for differentiating hypoimmunogenic induced pluripotent stem cells into cardiomyocytes are known in the art and are discussed in the examples. Differentiation can be assayed, as is known in the art, by assessing the presence of cardiomyocyte-related or specific markers, or by functional measurement. See, for example, Loh et al., doi:10.1016 / j.cell.2016.06.001 (the whole work, specifically concerning methods for differentiating stem cells including cardiomyocytes, is incorporated herein by reference).

[0399] In some embodiments, low immunogenic pluripotent stem cells are differentiated into endothelial colony-forming cells (ECFCs) to form new blood vessels to address peripheral artery disease. Techniques for differentiating endothelial cells are known. For example, see Prasain et al., doi:10.1038 / nbt.3048, whose entirety, specifically a method and reagents for generating endothelial cells from human pluripotent stem cells, as well as a transplantation technique, are incorporated herein by reference. Differentiation can generally be assayed, as is known in the art, by assessing the presence of endothelial cell-related or specific markers, or by functional measurement.

[0400] In some embodiments, hypoimmunogenic pluripotent stem cells are differentiated into thyroid progenitor cells and thyroid follicular organelles, which can secrete thyroid hormones to address autoimmune thyroiditis. Techniques for differentiating thyroid cells are known in the art. For example, see Kurmann et al., doi:10.106 / j.stem 2015.09.004, whose entirety, specifically a method and reagents for generating thyroid cells from human pluripotent stem cells, as well as transplantation techniques, are expressly incorporated herein by reference. Differentiation can generally be assayed, as is known in the art, by assessing the presence of thyroid cell-related or specific markers, or by functional measurement.

[0401] Additional descriptions of methods for differentiating hypoimmunogenic pluripotent cells can be found, for example, in Deuse et al., Nature Biotechnology, 2019, 37, 252-258 and Han et al., Proc Natl Acad Sci USA, 2019, 116(21), 10441-10446.

[0402] I. Treatment As will be understood by those skilled in the art, differentiated low immunogenic pluripotent cell derivatives can be transplanted using techniques known in the art, depending on both the cell type and the end use of these cells. Generally, the cells of the present invention can be transplanted either intravenously or by injection at a specific site in the patient. When transplanted at a specific site, the cells can be suspended in a gel matrix to prevent dispersion while the cells are retained.

[0403] In some embodiments, cells or their pharmaceutical compositions are administered to a subject systemically (e.g., orally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally) or topically. In some embodiments, cells or their pharmaceutical compositions are administered to a subject so that the cells reach a target tissue selected from the liver, lungs, heart, spleen, pancreas, gastrointestinal tract, kidneys, testes, ovaries, brain, reproductive organs, central nervous system, peripheral nervous system, skeletal muscle, endothelium, inner ear, or eye. In some embodiments (e.g., the subject has an autoimmune disease), cells or their pharmaceutical compositions are co-administered with immunosuppressants, such as glucocorticoids, cell proliferation inhibitors, antibodies, or immunophilin modulators. In some embodiments (e.g., the subject has cancer or an infectious disease), cells or their pharmaceutical compositions are co-administered with immunostimulants, such as adjuvants, interleukins, cytokines, or chemokines.

[0404] In some embodiments, cells or their pharmaceutical compositions are delivered ex vivo to tissues or organs, such as human tissues or organs. In some embodiments, the compositions are delivered ex vivo to tissues in a state of injury (e.g., from trauma, disease, hypoxia, ischemia, or other damage).

[0405] In other embodiments, the cells or their pharmaceutical compositions are used in vivo, i.e., in humans or mammals. In addition to humans, the compositions described herein may also be used to similarly modulate the function or physiology of cells or tissues of a variety of other organisms, including but not limited to farm or working animals (e.g., horses, cattle, sheep, pigs, chickens, etc.) and pet or zoo animals (e.g., cats, dogs, lizards, birds, lions, tigers, bears, etc.).

[0406] In some embodiments, the universal O-negative cells described herein are administered to recipient subjects determined to be ABO blood type A, B, AB, or O. In some embodiments, the universal O-negative cells are administered to recipient subjects determined to be Rh factor positive or Rh factor negative. In some embodiments, the universal O-negative cells are administered to recipient subjects determined to be ABO blood type A, B, AB, or O and Rh factor positive. In certain embodiments, the universal O-negative cells are administered to recipient subjects determined to be ABO blood type A, B, AB, or O and Rh factor negative. In some embodiments, the Bombay phenotype cells described herein are administered to recipient subjects determined to be ABO blood type A, B, AB, or O. In some embodiments, the Bombay phenotype cells are administered to recipient subjects determined to have the Bombay phenotype.

[0407] In some embodiments, the cells are not targeted by the immune system in question.

[0408] In some embodiments, the described cells are administered alone or formulated as a pharmaceutical composition. Administration of the pharmaceutical composition may be transdermal or parenteral (including intravenous, intratumoral, intraperitoneal, intramuscular, intracavitary, and subcutaneous). In certain cases, administration further includes bolus or continuous perfusion.

[0409] In some embodiments, the cells or their composition are co-administered to the recipient with additional agents, such as therapeutic agents. In some embodiments, the co-administered therapeutic agent is an immunosuppressant, such as a glucocorticoid (e.g., dexamethasone), a cell proliferation inhibitor (e.g., methotrexate), an antibody (e.g., muromonab-CD3), or an immunophilin modulator (e.g., cyclosporine or rapamycin). In some embodiments, the immunosuppressant reduces the immune-mediated clearance of cells. In some embodiments, the cells or their composition are co-administered with an immunostimulant, such as an adjuvant, interleukin, cytokine, or chemokine.

[0410] In some embodiments, a therapeutically effective amount of cells or a composition thereof is administered to treat the disease. In some embodiments, the cell composition is administered with a pharmaceutically acceptable carrier. In some embodiments, the cells are any one of the cells described herein, including differentiated cells derived from stem cells.

[0411] IV. Examples Example 1: Universal Tissue Blood Group Cell Engineering A.Cell culture Gibco Human Episomal iPSC strain (ThermoFisher Scientific, A1895) was obtained, cultured in StemFlex Medium (ThermoFisher Scientific, A3349401), and administered at 0.5 μg / cm³. 2Cells were grown in Vitronectin Recombinant Human Protein (ThermoFisher Scientific, A31804) coated plates or flasks. Cells were subculturised when they reached approximately 90–95% confluence. For subculturing, cells were first washed twice with DPBS- / - (Life Technologies, 14190250). Accutase (ThermoFisher Scientific, A1110501) was added, and cells were incubated at 37°C for 5 minutes, or until cells were detached by gently shaking the plate or flask. Cells were tightly resuspended to facilitate single-cell suspension, then washed with DMEM / F12 (ThermoFisher Scientific, 11330057), and spun down at 250 g for 3 minutes. The supernatant was removed, and the cell pellet was resuspended in StemFlex medium + 10 μM Y-27632 (Fisher Scientific, 12-545-0). Next, the cells were counted and seeded at an appropriate density into fresh Vitronectin-coated plates or flasks in StemFlex medium + 10 μM Y-27632. The following day, the medium was replaced with StemFlex medium without Y-27632 and changed every two days until the cells reached 90–95% confluence.

[0412] B. Guide RNA and HDR template design Synthetic guide RNAs (sgRNAs) for ABO, RHD, and FUT1 were designed using the Benchling CRISPR Guide RNA Design tool with genome sequences from ENSEMBL:ABO (ENSG00000175164), RHD (ENSG00000187010), and FUT1 (ENSG00000174951). For ABO, three gRNA sequences targeting exon 6 / 7 were used in combination with a homology repair (HDR) template encoding c.258delG and 100 base pairs of upstream and downstream homologous sequences. The guide RNA directed to the exon 6-7 gRNA1 target (5'-GCCAGCCAAGGGGTACCACG-3'; SEQ ID NO: 24) pairs with single-strand repair template 1 (5'-TGGGGGCGGCCGTGTGCCAGAGGCGCATGTGGGTGGCACCCTGCCAGCTCCATGTGACCGCACGCCTCTCTCCATGTGCAGTAGGAAGGATGTTCTCGTGTACCCCTTGGCTGGCTCCCATTGTCTGGGAGGGCACATTCAACATCGACATCCTCAACGAGCAGTTCAGGCTCCAGAACACCACCATTGGGTTAACTGTG-3'; SEQ ID NO: 25). The guide RNA directed to the exon 6-7 gRNA2 target (5'-GATGTCCTCGTGGTACCCCT-3'; SEQ ID NO: 26) pairs with single-strand repair template 2 (5'-TGGGGGCGGCCGTGTGCCAGAGGCGCATGTGGGTGGCACCCTGCCAGCTCCATGTGACCGCACGCCTCTCTCTCCATGTGCAGTAGGAAGGATGTCCTCGTAAACCCCTTGGCTGGCTCCCATTGTCTGGGAGGGCACATTCAACATCGACATCCTCAACGAGCAGTTCAGGCTCCAGAACACCACCATTGGGTTAACTGTG-3'; SEQ ID NO: 27).The guide RNA directed to the exon 6-7 gRNA3 target (5'-AATGTGCCCTCCCAGACAAT-3'; SEQ ID NO: 28) pairs with single-strand repair template 3 (5'-TGGGGGCGGCCGTGTGCCAGAGGCGCATGTGGGTGGCACCCTGCCAGCTCCATGTGACCGCACGCCTCTCTCCATGTGCAGTAGGAAGGATGTCCTCGTGTACCCCTTGGCTGGCTCCCATTGTTTGGGAGGGCACTTTCAACATCGACATCCTCAACGAGCAGTTCAGGCTCCAGAACACCACCATTGGGTTAACTGTG-3'; SEQ ID NO: 29). Alternatively, a guide RNA directed to the exon 1 gRNA target (5'-GGCCAGCGTCCGCAACACCT-3'; SEQ ID NO: 30) or the exon 2 gRNA target (5'-GGATCATAGGTCGAAGTGCG-3'; SEQ ID NO: 31) is used to introduce double-strand breaks (DSBs) into exons 1 and 2 of the initial codon. In RHD, two gRNA sequences targeting the exon 2 target sequence (5'-CACCGACAAAGCACTCATGG-3'; SEQ ID NO: 32) and the exon 3 target sequence (5'-TGGCCAAGATCTGACCGTGA-3'; SEQ ID NO: 33) are used to introduce DSBs into exons 1 and 2 of the initial codon. Alternatively, a gRNA targeting the 5'UTR target sequence (5'-TGGTTGTGCTGGCCTCTCTA-3'; SEQ ID NO: 34) is used in combination with a gRNA targeting exon 8 (5'-GGAGGCGCTGCGGTTCCTAC-3'; SEQ ID NO: 35) to delete the entire coding sequence of the gene from the genome. In FUT1, two gRNA sequences targeting exon 4 (the only coding exon) contain and are used, including a guide RNA directed to the exon 4 gRNA1 target (5'GGTCTGGACACAGGATCGAC-3'; SEQ ID NO: 36) and a guide RNA directed to the exon 4 gRNA2 target (5'-GATTACCAAACCGGCCATTG-3'; SEQ ID NO: 37) to induce a DSB to the coding sequence of the gene.

[0413] C. Cell engineering gRNAs targeting either ABO or FUT1 were complexed with recombinant SpyFi Cas9 protein obtained from Aldevron in nuclease-free water at room temperature for 15 minutes. Cells were harvested using ACCUTASE cell desorption solution with STEMFLEX and vitronectin, pelleted and resuspended in Lonza NUCLEOFECTOR buffer P3+RNP complex, and transferred to Lonza NUCLEOCUVETTE containers. Cells were electroporated in a Lonza 4D-NUCLEOFECTOR core unit using the CA-137 program and supplemented with STEMFLEX medium containing CLONER supplement. Cells were transferred to two vitronectin-coated wells of a 24-well plate containing STEMFLEX medium with CLONER supplement. Cells were grown and then electroporated again with an RNP complex containing gRNAs targeting the RHD gene. Cells were stained with antibodies against A and Rh antigens, and the negative cell population was sorted into a single well of a 96-well plate by FACS. Next, individual clones were stained again to confirm that the cells were O-type Rh-negative or Bombay-type Rh-negative, which was confirmed by genome analysis.

[0414] Genomic assays to characterize D.ABO, RHD, and FUT1 gene editing Using primers specific to these regions, amplicons containing the target regions of ABO, RHD, and FUT1 were constructed and sequenced using the Illumina NextSeq sequencing platform. The results were aligned to the human genome and analyzed for insertions and deletions (indels).

[0415] Phenotypic assays for characterizing E.ABO, RHD, and FUT1 gene knockout (KO). Single-cell cloning of gene-edited cells was performed in 96-well plates using a Hana single-cell dispenser (Namocell). Single-cell deposition and clonal cell proliferation were monitored using a CELIGO imaging simeter (Nexcelcom). The single-cell clones were passaged and expanded into the following three cohorts: 1. cell maintenance and cell banking; 2. genomic characterization by next-generation sequencing (NGS); and 3. phenotypic characterization.

[0416] F. Phenotypic characterization by immunofluorescence [Table 6] The cells were washed with PBS and fixed with 4% paraformaldehyde in PBS for 15 minutes. The cells were then washed again and blocked in 5% donkey serum in PBS / TWEEN-20 for 15 minutes at room temperature. The cells were rinsed three times in PBS before applying the primary antibody. The antibody was diluted overnight at 4°C in blocking buffer (5% donkey serum / PBS) according to the dilutions specified in Table 6 above. The cells were then rinsed three times in PBS, and the Alexa-488 and Alexa-647 conjugated antibody, diluted 1:500 in PBS, was added to the cells for 30 minutes at room temperature. The antibody conjugated with Alexa Fluor 488 was incubated overnight, and no secondary antibody was required. The cells were washed three times, and Hoechst, diluted in PBS, was added to the cells. The cells were prepared for imaging with a Cytation5 cell imaging reader. Wild-type (WT) cells were maintained throughout the workflow, and gene knockout was confirmed against WT cell expression levels.

[0417] Functional assays to validate G.ABO, RHD, and FUT1 knockout Human serum from O-negative individuals was obtained from a vendor. A complement-mediated cell killing assay was performed using the XCelligence® SP platform (ACEA BioSciences). 96-well E plates (ACEA BioSciences) were coated with collagen (Sigma-Aldrich), and universal O-type Rh-negative or Bombay-type Rh-negative iPSCs were plated in 100 μl of cell-specific medium. Human O-negative serum was added after the cell index reached 0.7. Heat-inactivated serum was used as a negative control. Data were standardized and analyzed using RTCA software (ACEA).

[0418] Example 2: Differentiation of RUES2 embryonic stem cells, which are B-positive cells. Human RUES2 embryonic stem cells (Lacoste et al., Cell Stem Cell 5(3):332-342(2009); hPSCReg ID:RUESe002-A) were differentiated into cardiomyocyte-like cells. When the resulting RUES2-derived cells were incubated with macaque serum of blood type B using a real-time cell analysis assay (XCelligence®; Figure 18), they survived but died when incubated with human serum of blood type O or porcine serum of blood type A. This result indicates that RUES2 and its derived differentiated cardiomyocytes are of blood type B.

[0419] Furthermore, undifferentiated RUES2 cells were characterized by PCR assays for blood type (see, e.g., Mohamed et al., Blood Res. 15(4):274-278 (2016)) and Rh status. Specifically, pairs of oligonucleotide primers recognizing the sequences of exon 4 and exon 5 of Rh D and Rh CcEe, respectively, were synthesized and used on the genomic DNA of Rh D phenotype cells. After an initial cycle of denaturation at 99°C for 5 minutes, 35 cycles were performed consisting of denaturation at 95°C for 1 minute, primer annealing at 55°C for 1.5 minutes, and extension at 72°C for 2.5 minutes, followed by a final cycle of 72°C for 9 minutes. The Rh CcEe gene is distinguished from the Rh D gene by a deletion in intron 4 between exons 4 and 5, resulting in a DNA fragment that is 600 bp smaller than the DNA fragment obtained from the CcEe gene. With primers A9 and A6, PCR products of approximately 1200 bp originated from the CcEe gene, while smaller PCR products of approximately 600 bp originating from the RhD gene were absent when the donor was Rh-negative. The PCR products were size-separated on a 2% agarose gel, stained with ethidium bromide, and visualized by UV irradiation. As a result, it was confirmed that the RUES2 cells were type B and Rh-positive.

[0420] Exemplary oligonucleotide primer sequences: A6.5'TGACCCTGAGATGGCTGT 3' (Antisense) (Sequence ID 21) A9.5'ACGATACCCAGTTTGTCT 3'(Sense)(Sequence No. 22)

[0421] Further techniques for determining the Rh status of cells using PCR assays are described, for example, in Simsek et al., Blood, 1995, 85(10), 2975-2980, and Arce et al., Blood, 1993, 82(651), and disclosures including figures, figure legends, and method descriptions are incorporated herein by reference in their entirety.

[0422] Example 3: Human ABO gene genome Human episomal iPSCs (Gibco) were positive for blood group A. Cells were edited to be O-positive by generating indels within the ABO gene. Guide RNA UCUCUCCAUGUGCAGUAGGA (SEQ ID NO: 17) complexed with S.pyogenes(sp)as9 to form ribonucleoprotein (RNP). RNP was then delivered to cells via electroporation. Cells were then harvested for two days before evaluation of the editing. ABO gene editing was evaluated by PCR amplification of the editing site and Sanger sequencing of the amplicon.

[0423] Using the edited pool, single cells were seeded for clonal proliferation by single-cell dilution. The resulting clones were validated using Sanger sequencing, and two homozygous ABO KO clones were selected. The two selected clones were +1 indel and +2 indel. The resulting cells were functionally assayed to be blood type O positive.

[0424] Example 4: Genome modification of human iPSCs from A+ to O+ Human episomal iPSCs (Gibco) were edited from A-positive (A+) to O-positive (O+) by introducing the ABO 258delG mutation in exon 6 via homology-directed repair (HDR). Guide RNA CAGUAGGAAGGAUGUCCUCG (SEQ ID NO: 18) was complexed with sp Cas9 to form ribonucleoprotein (RNP). The RNP and donor template (described below) were then delivered to cells via electroporation. The cells were then harvested for two days before evaluation of the edits. ABO gene editing was evaluated by PCR amplification of the edit site and Sanger sequencing of the amplicon.

[0425] Donor mold: CTCCATGTGACCGCACGCCTCTCTCCATGTGCAGTAGGAAGGATGTCCTCGTGTACCCCTTGGCTGGCTCCCATTGTCTGGGAGGGCACATTCAACATCGAC (Sequence ID 19).

[0426] Using the edited pool, single cells were seeded for clonal proliferation by single-cell dilution. The resulting clones were validated using Sanger sequencing, and two homozygous ABO 258delG mutant clones were selected. The resulting cells were functionally assayed to be blood type O positive.

[0427] Example 5: Human FUT1 gene genome Human episomal iPSCs (Gibco) were edited from A-positive to Bombay phenotype and Rh-positive by generating indels in the FUT1 gene. The guide RNA CUGGAUGUCGGAGGAGUACG (SEQ ID NO: 23) complexed with S. pyogenes(sp)Cas9 to form ribonucleoprotein (RNP). The RNP was then delivered to cells via electroporation. The cells were then harvested for two days before evaluation of the edits. Editing of the FUT1 gene was evaluated by PCR amplification of the edit site and Sanger sequencing of the amplicon.

[0428] Using the edited pool, single cells were seeded for clonal proliferation by single-cell dilution. The resulting clones were validated using Sanger sequencing, and two homozygous FUT1 KO clones were selected. The resulting cells were functionally assayed to be Bombay phenotype, Rh-positive.

[0429] All headings and section titles are used for clarity and reference purposes only and should not be considered limiting. For example, those skilled in the art will recognize the usefulness of combining various aspects from different headings and sections as needed, in accordance with the spirit and scope of the invention as described herein.

[0430] All references cited herein are incorporated herein by reference in their entirety for the same degree as each individual publication or patent or patent application is specifically and individually indicated by reference as if it were incorporated in its entirety for the sole purpose.

[0431] As will be apparent to those skilled in the art, many modifications and variations of this application may be made without departing from the spirit and scope of this application. The specific embodiments and examples described herein are provided only as examples, and this application should be limited only by the terminology of the appended claims, in addition to the entire scope of the equivalent for which the claims are granted.

Claims

1. A differentiated manipulated cell, (a) Gene modifications in blood group antigen genes, wherein the blood group antigen gene is the FUT1 gene, and (b) (i) One or more molecules that control the expression of one or more major histocompatibility class I (MHC-I) molecules and / or one or more MHC-I molecules; and / or (ii) One or more MHC class II (MHC-II) molecules and / or one or more molecules that control the expression of one or more MHC-II molecules Gene modifications that reduce or delete, and (c) A gene modification that increases the expression of CD47, The increased expression described in (c) above is compared to isolated cells without the modification, and the gene modification Manipulated cells, including those mentioned above.

2. The manipulated cell according to claim 1, wherein the FUT1 gene is partially or completely inactivated by insertion or deletion within exon 2 or 4.

3. (a) Insertion or deletion of the 5' untranslated region (UTR) of the RHD gene, (b) Insertion or deletion of exon 1, 2, 3, 4, 5, 6, 7, or 8 of the RHD gene The manipulated cell according to claim 1, further comprising an RHD gene that is partially or completely inactivated by the said method.

4. The manipulated cells according to claim 1, wherein the cells are Rh-negative cells.

5. The manipulated cells according to claim 1, wherein the cells have the Bombay phenotype.

6. The manipulated cell according to claim 1, wherein the cell is a human cell.

7. The manipulated cells according to claim 1, wherein the cells are selected from the group consisting of induced pluripotent stem cells, embryonic stem cells, adult stem cells, and differentiated cells.

8. The manipulated cell according to claim 1, wherein the one or more molecules that control the expression of the one or more MHC-I molecules control the expression of the cell surface proteins of the one or more MHC-I molecules.

9. The manipulated cell according to claim 1, wherein the one or more molecules that control the expression of the one or more MHC-II molecules control the expression of the cell surface proteins of the one or more MHC-II molecules.

10. The one or more modifications described above One or more MHC-I molecules; One or more MHC-II molecules; or One or more MHC-I molecules and one or more MHC-II molecules The manipulated cells according to claim 1, which reduce the expression of the cell.

11. The modified cell according to claim 1, wherein the one or more modifications reduce the expression of one or more molecules selected from the group consisting of B2M, TAP 1, NLRC5, CIITA, HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, HLA-DR, HLA-DM, HLA-DOA, HLA-DOB, RFX5, RFXANK, RFXAP, NFY-A, NFY-B, NFY-C, IRF1, and any combination thereof.

12. The manipulated cell according to claim 1, wherein the one or more modifications reduce the expression of the one or more MHC-I molecules that are cell surface proteins.

13. The manipulated cell according to claim 1, wherein the one or more modifications reduce the surface transport of the one or more MHC-I molecules.

14. The manipulated cell according to claim 1, wherein one or more of the modifications reduce the expression of B2M.

15. The manipulated cell according to claim 1, wherein one or more of the modifications reduce the expression of HLA-A, HLA-B, and / or HLA-C.

16. The manipulated cell according to claim 1, wherein the one or more modifications reduce the expression of the one or more MHC-II molecules that are cell surface proteins.

17. The modified cell according to claim 1, wherein the one or more modifications reduce the surface transport of the one or more MHC-II molecules.

18. The manipulated cell according to claim 1, wherein one or more of the modifications reduce the expression of CIITA.

19. The manipulated cell according to claim 1, wherein one or more of the modifications reduce the expression of HLA-DM, HLA-DOA, HLA-DOB, HLA-DP, HLA-DQ, and / or HLA-DR.

20. A pharmaceutical composition comprising the manipulated cells described in claim 1.

21. The pharmaceutical composition according to claim 20 for use in a method of treating a patient in need of treatment, comprising administering the manipulated cells according to claim 1 to the patient.

22. A method for generating differentiated manipulated cells, (a) Introducing CRISPR-Cas nuclease and guide RNA targeting blood group antigen genes into isolated cells, (b) Selecting differentiated manipulated cells in which the blood group antigen gene is partially or completely inactivated, The differentiated manipulated cells include one or more modifications, and the one or more modifications are (i) (1) One or more molecules that control the expression of one or more major histocompatibility class I (MHC-I) molecules and / or one or more MHC-I molecules; and / or (2) One or more MHC class II (MHC-II) molecules and / or one or more molecules that control the expression of one or more MHC-II molecules Inactivates or destroys one or more alleles, and (ii) Increase the expression of CD47, The increased expression of (ii) above was compared to isolated cells without modification. The aforementioned blood group antigen gene is the FUT1 gene. method.

Images