Chimeric immunoglobulins

Chimeric immunoglobulins, combining IgG variable regions with IgM/IgA constant regions, address the instability of IgG multimers, enhancing antigen-binding capacity and stability for improved immunodiagnostic performance.

JP7853333B2Active Publication Date: 2026-04-28FAPON BIOTECH INC
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
FAPON BIOTECH INC
Filing Date
2022-03-03
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Current immunodiagnostic reagents rely on monoclonal antibodies that have randomized improvements in titer, leading to inconsistent detection performance due to the instability of naturally occurring IgG multimers and limited antigen-binding sites.

Method used

Development of chimeric immunoglobulins by fusing IgG variable regions with IgM/IgA constant regions, creating stable multimeric antibodies that enhance antigen-binding capacity and stability, suitable for use in diagnostic reagents.

Benefits of technology

The chimeric immunoglobulins exhibit higher titer and stability, enabling improved detection sensitivity and specificity in immunodiagnostic applications, surpassing the performance of conventional IgG antibodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007853333000011
    Figure 0007853333000011
  • Figure 0007853333000012
    Figure 0007853333000012
  • Figure 0007853333000013
    Figure 0007853333000013
Patent Text Reader

Abstract

Provided is a chimeric immunoglobulin, which is obtained by fusing a first polypeptide with a second polypeptide, the first polypeptide comprising an IgG variable region located at the N-terminus, and the second polypeptide comprising an IgACH2-CH3 region or an IgMCH3-CH4 region located at the C-terminus, which has higher titer and still has higher titer than the IgG monomer with the same valency when coated on a solid phase, and therefore can be widely used in the detection field.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] [Cross-reference of related applications] This application claims priority to the Chinese patent application filed on 17 June 2021, application number 202110674660.8, titled "Chimera Immunoglobulin," which is incorporated herein by reference in its entirety.

[0002] This application relates to the field of antibody engineering, and more specifically, to chimeric immunoglobulins. [Background technology]

[0003] Immunoglobulin (Ig) consists of four polypeptide chains, each linked by a different number of interchain disulfide bonds. Ig can exhibit a "Y"-shaped structure, called an Ig monomer, which is the basic unit that makes up antibodies. Natural Ig molecules contain four heterogeneous polypeptide chains, where the two chains with larger molecular weights are called heavy chains (H), and the two chains with smaller molecular weights are called light chains (L). The amino acid composition of the two heavy chains and two light chains in the same Ig molecule is completely identical. The heavy chain molecular weight is 50,000 to 75,000 and consists of 450 to 550 amino acid residues. The amino acid composition and sequence order of the constant (CH) region of the heavy chain differ, and their antigenicity also differs. From this, Ig can be classified into five classes: IgM, IgD, IgG, IgA, and IgE. Of these five classes, IgG, IgD, and IgE all have monomeric structures. IgM is the basic antibody secreted from B cells, and in its secreted form, it is a pentamer composed of five Y-type monomers and has extremely high affinity. Because IgM has a very large molecular weight, it is very effective in antigen agglutination reactions. IgM is a polyvalent antibody. IgA can exist in monomeric, dimeric, trimer, or tetrameric form. Secretory IgA often exists in dimeric or trimer form and is also a polyvalent antibody. Since one monomeric antibody has two antigen-binding sites, IgA usually has four or six antigen-binding sites, and IgM has ten or twelve antigen-binding sites, and both are polyvalent antibodies.

[0004] Antibodies are primarily synthesized from B lymphocytes. Each B lymphocyte has a gene that synthesizes one type of antibody. When a living organism is stimulated by an antigen, many determinants on the antigen molecule activate different B cells, each possessing a different gene. Activated B cells divide and proliferate to form polyclonal cells and synthesize multiple types of antibodies. In 1975, British scientists Kohler and Milstein fused mouse myeloma cells, already accustomed to in vitro culture, with sheep erythrocyte-immunized mouse spleen cells (B lymphocytes). They discovered that the resulting hybrid cells could not only proliferate indefinitely in vitro but also continue to secrete specific antibodies. They found that monoclonal antibodies could be produced from pure cells obtained through clonal culture, thus inventing monoclonal antibody technology. The emergence of monoclonal antibody technology is a major breakthrough in the field of immunology. By the mid-1980s, monoclonal antibody technology had become increasingly sophisticated and began to be widely used in many fields, including biomedical research, biotechnology, clinical diagnosis, and treatment.

[0005] With advances in science and technology, in vitro diagnostics have already become an important aid in clinical medicine diagnosis, playing the role of the physician's eyes. Monoclonal antibodies fully demonstrate their advantages as one of the core raw materials in in vitro diagnostic reagents in clinical medicine. Monoclonal antibodies have high specificity, greatly improving the specificity of antigen-antibody reactions, reducing the possibility of cross-reactivity with other substances, and increasing the reliability of test results. The homogeneity and monolithic biological activity of monoclonal antibodies make it easier to control the results of antigen-antibody reactions, which is advantageous for standardization and normatization.

[0006] Immunodiagnostic reagents are a sub-field of in vitro diagnostic reagents. Immunodiagnosis is the application of immunological theory, techniques, and methods to diagnose various diseases and measure immune status. Methods of immunodiagnosis include radioimmunotherapy, enzyme-linked immunization, chemiluminescence, fluorescence chromatography, or gold colloid chromatography. The basic principles of these methods are as follows: An antigen or antibody is bound to the surface of a solid-phase vector, maintaining its immune activity, and an appropriate marker is selected to form an antigen or antibody-labeled complex with the antigen or antibody by chemical means. During measurement, the subject (of which the antibody or antigen is measured) and the antigen or antibody-labeled complex are reacted with the antigen or antibody on the surface of the solid-phase vector according to different steps. The antigen-antibody complex formed on the solid-phase vector is separated from other substances by washing, and finally, the amount of the labeled complex bound to the solid-phase vector and the amount of the test substance in the sample are in a constant ratio. After adding a substrate that reacts with the labeled complex, the substrate is catalyzed to form a colored product. Since the amount of colored product is directly related to the amount of the test substance in the sample, qualitative or quantitative analysis based on the intensity of the color reaction becomes possible. However, currently, improvements in the titer of immunodiagnostic antibodies often depend on improvements in antibody immunization and screening processes, and the effect is highly randomized, failing to adequately meet detection needs. [Overview of the Initiative]

[0007] A first aspect of the present application relates to an immunoglobulin, which is obtained by fusing a first polypeptide and a second polypeptide, The first polypeptide includes an IgG variable region located at the N-terminus, and The second polypeptide includes an IgACH2-CH3 region or an IgMCH3-CH4 region located at the C-terminus.

[0008] A second aspect of the present application relates to a polymer obtained by polymerizing immunoglobulins as monomers as described above.

[0009] A third aspect of the present application relates to isolated nucleic acids encoding immunoglobulins as described above.

[0010] A fourth aspect of this application relates to a vector containing nucleic acids as described above.

[0011] A fifth aspect of the present application relates to host cells containing the above-described nucleic acids or transformed by the above-described vectors.

[0012] A sixth aspect of the present application relates to a method for producing immunoglobulin, which includes expressing a host cell as described above or expressing a fused first polypeptide and second polypeptide, and immunoglobulin produced by the above production method.

[0013] A seventh aspect of this application relates to a method for producing a polymer, which includes polymerizing immunoglobulin produced by the above-described method for producing immunoglobulin as monomers, and to a polymer produced by the above-described method.

[0014] The eighth aspect of this application relates to a solid-phase vector having the above-described polymer coated on its surface.

[0015] A ninth aspect of this application relates to a kit or test specimen containing the above-described polymer or solid-phase vector.

[0016] A tenth aspect of the present application includes contacting the above-described polymer or solid-phase vector with the antigen to form a conjugate, and detecting the conjugate, The present invention relates to a method for detecting an antigen, wherein the antigen is an antigen capable of specifically binding to the IgG variable region.

[0017] An eleventh aspect of this application relates to the use of the polymer, solid-phase vector, kit, or test specimen in immunodetection. [Effects of the Invention]

[0018] The immunoglobulin provided in the present application, in which IgG is chimerized with IgM / IgA, has a higher titer and, when coated on a solid phase, still has a higher titer compared to IgG monomers of the same valence, so it can be widely used in the detection field.

[0019] Details of one or more embodiments of the present application are described in the following drawings and description. Other features, objects, and advantages of the present application will become apparent from the specification, drawings, and claims.

Brief Description of the Drawings

[0020] To more clearly explain the specific embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings that need to be used in the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative labor.

[0021] [Figure 1] The electrophoresis results of MA-9G7TB1 and MA-9G7TB2 IgG / IgM hybrid recombinant antibodies in an embodiment of the present application are shown. [Figure 2] The electrophoresis results of 3E50TB2 hybrid recombinant antibody in an embodiment of the present application are shown. [Figure 3] The electrophoresis results of 5F27TB2 hybrid recombinant antibody in an embodiment of the present application are shown. [Figure 4] The electrophoresis results of 21C5TB2 hybrid recombinant antibody in an embodiment of the present application are shown.

Modes for Carrying Out the Invention

[0022] The following provides detailed references to embodiments of the Application, describing one or more examples below. Each example provided is for interpretation purposes only and does not limit the Application. In fact, it will be apparent to those skilled in the art that various modifications and changes can be made to the Application without departing from the scope or spirit of the Application. For example, features described or mentioned as part of one embodiment can be used in another embodiment to bring about further embodiments.

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as that generally understood by those skilled in the art of this application. Terms used in this specification are for illustrative purposes only and do not limit the application. The terms "and / or" as used herein include any and all combinations of one or more related listed items.

[0024] The inventors of this invention unexpectedly discovered during experiments that normal IgG antibodies polymerize in response to changes in storage conditions such as temperature and buffering conditions. The appearance of multimeric antibodies is directly manifested when the antibody activity is significantly higher than that of monomeric antibodies during the use of diagnostic reagents. However, naturally occurring IgG multimers are unstable. Combining the characteristics of IgA and IgM antibodies, their hydrophilic and hydrophobic properties in their constant regions, and the goal of obtaining uniform, highly expressed multimeric antibodies, the inventors discovered that the performance of the constructed IgG / IgA and IgG / IgM chimeric antibodies in detection by diagnostic reagents is far superior to that of IgG class antibodies, and that they have a significant advantage in terms of chimeric antibody uniformity and expression level.

[0025] This allows for the construction of IgG / IgA and IgG / IgM chimeric antibodies, which are then used as the coated or labeled ends of in vitro diagnostic detection reagents. The IgG / IgA and IgG / IgM chimeric antibodies of this invention can replace existing IgG antibodies, thereby obtaining detection kits with superior activity.

[0026] In a first embodiment, the present invention provides an immunoglobulin obtained by fusing a first polypeptide and a second polypeptide, however, The first polypeptide includes an IgG variable region located at the N-terminus, and The second polypeptide contains either an IgACH2-CH3 region or an IgMCH3-CH4 region located at the C-terminus.

[0027] In some embodiments, the IgG in the first polypeptide further comprises a CH1 region.

[0028] In some embodiments, the IgA or IgM in the second polypeptide further comprises a CH1 region.

[0029] In some embodiments, the first polypeptide further comprises a hinge region of IgG.

[0030] In some embodiments, the second polypeptide further comprises a hinge region of IgA or IgM.

[0031] In some embodiments, the IgG in the first polypeptide further comprises a CH1-CH2 region.

[0032] In some embodiments, the IgG in the first polypeptide further comprises a CH1-CH2-CH3 region.

[0033] In some embodiments, the IgM in the second polypeptide further comprises a CH1-CH2 region.

[0034] In some embodiments, the IgG is IgG1, IgG2, IgG3, or IgG4.

[0035] In some embodiments, at least one of the first polypeptide and the second polypeptide includes a CH1 region.

[0036] In some embodiments, at least one of the first polypeptide and the second polypeptide includes a hinge region.

[0037] IgG, IgA, and IgM may be independently selected from the same or different species, for example, from rodents (mice, rats), rabbits, sheep, goats, horses, chickens, cattle, dogs, and humans.

[0038] In a second embodiment, the present invention provides a polymer obtained by polymerizing immunoglobulins as monomers as described above.

[0039] In some embodiments, the polymer is obtained by polymerizing two, three, or four immunoglobulin monomers having an IgACH2-CH3 region.

[0040] In some embodiments, the polymer is obtained by polymerizing five immunoglobulin monomers having an IgMCH3-CH4 region.

[0041] In some embodiments, the polymer is further conjugated with a signaling substance.

[0042] In a third embodiment, embodiments of the present application provide isolated nucleic acids encoding immunoglobulins as described above.

[0043] In a fourth embodiment, the present invention further provides a vector containing the nucleic acid described above.

[0044] The term "vector" refers to a nucleic acid delivery tool into which polynucleotides can be inserted. If a vector can express a protein encoded by the inserted polynucleotide, it is called an expression vector. A vector can be introduced into a host cell by transformation, transduction, or transfection so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs), phages such as lambda phages or M13 phages, and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papovaviruses (such as SV40). In some embodiments, the vector of the present application includes regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRESs), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals and poly-U sequences).

[0045] In a fifth embodiment, the embodiments of the present application further provide host cells containing the nucleic acids described above or transformed with the vectors described above.

[0046] The term "host cell" refers to a cell that can be used for vector introduction, and includes, but is not limited to, prokaryotic cells such as Escherichia coli and Bacillus subtilis, fungal cells such as yeast cells and Aspergillus, insect cells such as Drosophila S2 cells and Sf9 cells, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK293 cells, and human cells. The host cell is preferably a eukaryotic cell, and more preferably a mammalian cell.

[0047] In a sixth embodiment, the present invention provides a method for producing immunoglobulin, which includes expressing the above-mentioned host cells.

[0048] Embodiments of the present application further provide a method for producing immunoglobulin, comprising fusing a first polypeptide and a second polypeptide and expressing them, however, The first polypeptide includes an IgG variable region located at the N-terminus, and The second polypeptide contains either an IgACH2-CH3 region or an IgMCH3-CH4 region located at the C-terminus.

[0049] In some embodiments, the immunoglobulin, IgG in the first polypeptide, further comprises a CH1 region.

[0050] In some embodiments, the IgA or IgM in the second polypeptide further comprises a CH1 region.

[0051] In some embodiments, the first polypeptide further comprises a hinge region of IgG.

[0052] In some embodiments, the second polypeptide further comprises a hinge region of IgA or IgM.

[0053] In some embodiments, the IgG in the first polypeptide further comprises a CH1-CH2 region.

[0054] In some embodiments, the IgG in the first polypeptide further comprises a CH1-CH2-CH3 region.

[0055] In some embodiments, the IgM in the second polypeptide further comprises a CH1-CH2 region.

[0056] In some embodiments, the IgG is IgG1, IgG2, IgG3, or IgG4.

[0057] In some embodiments, at least one of the first polypeptide and the second polypeptide includes a CH1 region. In some embodiments, at least one of the first polypeptide and the second polypeptide includes a hinge region.

[0058] Embodiments of the present invention further provide immunoglobulins produced by the immunoglobulin production method described above.

[0059] In a seventh embodiment, the present invention provides a method for producing a polymer, which includes polymerizing immunoglobulins produced by the above-described method for producing immunoglobulins as monomers.

[0060] In some embodiments, two, three, or four immunoglobulin monomers having an IgACH2-CH3 region are polymerized.

[0061] In some embodiments, five immunoglobulin monomers having an IgMCH3-CH4 region are polymerized.

[0062] Embodiments of the present invention further provide a polymer produced by the above-described method for producing a polymer.

[0063] In the eighth embodiment, the present invention provides a solid-phase vector having the above-described polymer coated on its surface.

[0064] In some embodiments, the solid-phase vector is a plastic vector, a microparticle, or a membrane vector, the plastic vector may be a polystyrene vector, the microparticle may be a magnetic microparticle, and the membrane vector may be a nitrocellulose membrane, a glass cellulose membrane, or a nylon membrane.

[0065] In some embodiments, the solid-phase vector is selected from test tubes, EP tubes, multi-well plates, chromatography columns, and wells of micro-reaction plates.

[0066] In this application, the term "fine particles" may refer to spheres, approximately spheres, cubes, polyhedra, or irregular shapes. The diameter of the fine particles may be 10 nm to 1 mm, for example, 100 nm, 500 nm, 1 μm, 10 μm, 100 μm, 500 μm, and preferably 400 nm to 10 μm.

[0067] The fine particles are preferably magnetic fine particles, and their components include a magnetic substance. The magnetic substance may be a metal (a single metal or an alloy), a nonmetal, or a composite formed by a metal and a nonmetal. Examples of metals include iron, aluminum-nickel-cobalt metal, etc., examples of nonmetals include ferrite nonmetals (preferably Fe2O3 or Fe3O4 magnetic nanoparticles), and examples of composites formed by a metal and a nonmetal include neodymium-iron-boron-rubber magnetic composite materials.

[0068] The multiwell plate is preferably an ELISA plate, which may have 8 wells, 16 wells, 32 wells, 48 ​​wells, 64 wells, 96 wells, or more.

[0069] In a ninth embodiment, the present invention provides a kit or test specimen containing the above-described polymer or solid-phase vector.

[0070] In some embodiments, the test specimen includes a sample pad, a binding pad, a reaction film, and an absorption pad, wherein the reaction film is provided with a detection region and a quality inspection region.

[0071] The polymer is coated onto the detection area and / or dropped onto the binding pad.

[0072] If both the detection region and the binding pad contain a polymer, it is easily understood that the antigen epitopes to which the IgG variable region of the polymer binds will be different, and the second polypeptide terminal domain may be the same or different.

[0073] In some embodiments, the kit may further include sample pretreatment reagents (e.g., sample purification and concentration reagents, dissolving solutions, etc.), washing solutions (e.g., water, etc.), buffer solutions (e.g., PBS or Tris, etc.), colorimetric reagents for signaling substances (e.g., ECL or DAB as a signaling substance for horseradish peroxidase, etc.).

[0074] In the tenth embodiment of the present application, an embodiment provides a method for detecting an antigen, the method being Forming a conjugate by contacting the above-mentioned polymer or solid-phase vector with the antigen, This includes detecting the conjugate body, However, the antigen is an antigen that can specifically bind to the IgG variable region.

[0075] The conjugate can be detected by any method well known to those skilled in the art, for example, a double antibody sandwich method, in which the antigen is contacted with the solid-phase vector, and then the conjugate is detected using another antibody against the antigen (which is generally labeled with a signaling substance, or detected with a secondary antibody labeled with a signaling substance).

[0076] Alternatively, a general antibody can be used as the antibody coated on a solid-phase vector, incubated with the antigen to be detected, and the resulting polymer is detected as a free detection antibody (which is generally labeled with a signaling substance, or detected with a secondary antibody labeled with a signaling substance).

[0077] The antigen is detected by using a solid-phase vector coated with a multimer in combination with another multimer, where the multimer coated on the solid-phase vector and the other multimer are paired antibodies.

[0078] The signaling substance may be any one of the following: a fluorescent substance, quantum dots, digoxigenin-labeled probe, biotin, radioisotopes, radiocontrast agents, paramagnetic ion fluorescent microspheres, electron-densified materials, chemiluminescent markers, ultrasound contrast agents, photosensitizers, gold colloid, or enzymes. In some embodiments, the signaling substance is gold colloid, fluorescein, fluorescent microspheres, acridinium ester, horseradish peroxidase, alkaline phosphatase, or β-galactosidase.

[0079] In an eleventh embodiment, embodiments of the present application provide the use of the above-described polymers, solid-phase vectors, kits, or test specimens in immunodetection.

[0080] Embodiments of the present invention further provide the above-described polymers, solid-phase vectors, kits, or test specimens for immunodetection.

[0081] Embodiments of the present invention further provide an immunodetection method, which includes performing immunodetection using the above-described polymer, solid-phase vector, kit, or test specimen.

[0082] In a further embodiment, the present invention provides an immunodiagnostic kit comprising a macromer of IgG-IgM or IgG-IgA chimeric immunoglobulin.

[0083] In some embodiments, the immunoglobulin is obtained by fusing a first polypeptide and a second polypeptide, however, The first polypeptide includes an IgG variable region located at the N-terminus, and The second polypeptide contains either an IgACH2-CH3 region or an IgMCH3-CH4 region located at the C-terminus.

[0084] In some embodiments, the immunoglobulin, IgG in the first polypeptide, further comprises a CH1 region.

[0085] In some embodiments, the IgA or IgM in the second polypeptide further comprises a CH1 region.

[0086] In some embodiments, the first polypeptide further comprises a hinge region of IgG.

[0087] In some embodiments, the second polypeptide further comprises a hinge region of IgA or IgM.

[0088] In some embodiments, the IgG in the first polypeptide further comprises a CH1-CH2 region.

[0089] In some embodiments, the IgG in the first polypeptide further comprises a CH1-CH2-CH3 region.

[0090] In some embodiments, the IgM or IgA in the second polypeptide further comprises a CH1-CH2 region.

[0091] In some embodiments, the IgG is IgG1, IgG2, IgG3, or IgG4.

[0092] In some embodiments, at least one of the first polypeptide and the second polypeptide includes a CH1 region.

[0093] In some embodiments, at least one of the first polypeptide and the second polypeptide includes a hinge region.

[0094] In some embodiments, the polymer is obtained by polymerizing two, three, or four immunoglobulin monomers having an IgACH2-CH3 region, or by polymerizing five immunoglobulin monomers having an IgMCH3-CH4 region.

[0095] In some embodiments, the polymer is further conjugated with a signaling substance.

[0096] In some embodiments, the kit further includes a sample pretreatment reagent, a washing solution, a buffer solution, and a colorimetric reagent.

[0097] In some embodiments, the kit further includes a sample pad, a binding pad, a reaction membrane, and an absorption pad, wherein the reaction membrane is provided with a detection area and a quality inspection area.

[0098] In some embodiments, the kit may further contain another antibody, which may be a polymer or a monomer.

[0099] In some embodiments, the polymer may be immobilized on a solid-phase vector including a nitrocellulose membrane, latex, magnetic beads, or an ELISA plate.

[0100] In some embodiments, the polymer can be labeled with signaling substances such as nanoparticles, chemiluminescent substances, fluorescent substances, radioactive substances, colloids, and enzymes.

[0101] The proposed implementation of this application will be described in detail below with reference to the examples provided. [Examples]

[0102] In the following examples, restriction endonucleases and PrimeStarDNA polymerase were purchased from Takara. The pMD-18T vector was purchased from Takara, the plasmid extraction kit was purchased from Tenkon Co., Ltd., and primer synthesis and gene sequencing were performed by Invitrogen.

[0103] Example 1: Production of polynucleotides encoding the IgM and IgA heavy chain constant regions

[0104] In this application, the polynucleotide encoding the CH region of the mouse antibody can be obtained from mouse peripheral blood cell DNA by PCR, and can also be obtained from hybridoma cell lines that secrete the corresponding type of monoclonal antibody by PCR.

[0105] Obtaining polynucleotides encoding the IgMCH region Using the PCR method, polynucleotides encoding the mouse IgM-CH region were obtained from the genome of hybridoma cell line 6M9 (obtainable from faponbiotech) that secretes IgM-type mouse monoclonal antibodies. The primers used are as follows: Forward primer sequence (5'→3'): GAGAGTCAGTCCTTCCCAAATGTCTTCCCCCTCGTCTC (Sequence ID 1) Reverse primer sequence (5'→3'): CCCGAATTCTTATCAATAGCAGGTGCCACCTGTGTCAGACATGATCAG (Sequence ID 2)

[0106] Using a reverse primer, the EcoRI restriction enzyme recognition site (GAATTC) was introduced immediately after the stop codon TGATAA (anticodon TTATCA). A double stop codon was employed at this site. Approximately 1.4 kb of polynucleotide was obtained by PCR and introduced into a pMD-18T vector for sequencing and confirmation.

[0107] The polynucleotide in question encodes the mouse IgM-CH region, and its amino acid sequence from the N-terminus to the C-terminus is as follows: [ka]

[0108] Obtaining polynucleotides encoding the IgACH region The polynucleotide encoding the IgACH region was obtained from isolated rat peripheral blood cell DNA (obtainable from faponbiotech) using PCR. The primers used are as follows: Forward primer sequence (5'→3'): GAGTCTGCGAGAAATCCCACCATCTACCCACTGACACTC (Sequence ID 4) Reverse primer sequence (5'→3'): CCCGAATTCTCAGTAGCAGATGCCATCTCCCTCTGACATGAT (Sequence ID 5)

[0109] Using a reverse primer, the EcoRI restriction enzyme recognition site was introduced immediately after the stop codon TGA (anticodon TCA). Approximately 1kb of polynucleotide was obtained using PCR, introduced into a pMD-18T vector, and used for sequence confirmation by sequencing.

[0110] The polynucleotide in question encodes the mouse IgA-CH region, and its amino acid sequence from the N-terminus to the C-terminus is as follows: [ka]

[0111] A similar method is used to produce polynucleotides of CH1, CH2, CH3, and CH4 domains or combinations thereof that encode the IgMCH region, or to produce polynucleotides of CH1, CH2, and CH3 domains or combinations thereof that encode the IgACH region.

[0112] Example 2: Construction of an expression plasmid for an IgG / IgM hybrid recombinant antibody.

[0113] In this embodiment, an anti-Pan-PLDH9G7 monoclonal antibody (hereinafter referred to as MA9G7) is used as the IgG antibody, the sequence of which is described in the Chinese patent with publication number CN111363044A, which is incorporated herein by reference. The antibody can be selected from any one antibody having any one set of mutations from mutation combinations 1 to 56 in paragraphs

[0087] to

[0089] of CN111363044A, for example mutation combination 32, and they have similar properties.

[0114] The sequence of IgM itself exhibits characteristics of a multimer. First, the polynucleotide encoding segment 1 of the heavy chain variable region (VH) of MA9G7 was ligated to the polynucleotide encoding the IgMCH region using bridge PCR. The amino acid sequence of segment 1 of the VH region of MA9G7 is as follows: [ka]

[0115] Approximately 1.8kb of polynucleotides were obtained by PCR, and then the pcDNA was obtained after digestion with the corresponding restriction enzymes by HindIII / EcoRI dual enzyme digestion. TM 3.4TOPO (R) The resulting vector was concatenated and named pcDNA3.4A-9G7TB1VCH.

[0116] Subsequently, a polynucleotide encoding segment 2 of the VH region of MA9G7 was selected and ligated to a polynucleotide encoding the IgMCH region from CH2 to the C-terminus using bridge PCR. The amino acid sequence of segment 2 of the VH region of MA9G7 is as follows: [ka]

[0117] A DNA fragment of approximately 1.8 KB was obtained by PCR, and then pcDNA was obtained by HindIII / EcoRI double enzyme cleavage. TM 3.4TOPO (R) It is linked to a vector and abbreviated as pcDNA3.4A-9G7TB2VCH.

[0118] Since the polymeric properties of IgM depend on the heavy chain, the light chain clones of the antibodies in this example were constructed using the light chain plasmid construction method disclosed in Chinese Patent Publication No. CN111363044A.

[0119] Example 3: Production of MA-9G7TB1 and MA-9G7TB2 IgG / IgM hybrid recombinant antibody expression.

[0120] 1. Linearization of recombinant antibody expression plasmids The following enzyme cleavage system was prepared: 50 µl restriction enzyme buffer, 100 µl / tube of recombinant plasmid, and 10 µl of PvuI enzyme were added, and the mixture was supplemented with sterile water up to 500 µl. The enzyme cleavage was carried out overnight in a 37°C water bath. First, the system was extracted using the same volume as the enzyme cleavage system with phenol / chloroform / isoamyl alcohol (25:24:1) (bottom layer), followed by chloroform (aqueous phase). The DNA was precipitated by standing on ice with 0.1 times the volume (aqueous phase) of 3M sodium acetate and 2 times the volume of ethanol. The DNA precipitate was rinsed with 70% ethanol to remove the organic solvent, and after the ethanol had evaporated, it was redissolved with an appropriate amount of sterile water, and finally the concentration was measured.

[0121] 2. Stable transfection of recombinant antibody expression plasmids and stable pressure screening of cell lines. Using ultrapure water, the pcDNA3.4A-9G7TB1VCH plasmid and light chain plasmid were diluted in a 1:1 ratio to 40 ug / 100 ul. A new centrifuge tube was taken, and the CHO cell concentration was added to the tube to obtain a concentration of 1.43 × 10⁻⁶. 7The solution was adjusted to cells / ml, 100 µl of plasmid was mixed with 700 µl of cells, and the mixture was transferred to an electric rotating cup for electrotransfection. After transfection, the cells were cultured, counted the following day, and cultured under pressure for approximately 25 days in 25 µl / L MSX 96 wells.

[0122] Under a microscope, the clone wells where cells were growing were observed and labeled, and the confluence was recorded. The culture supernatant was taken and the sample was sent for detection. Cell lines with high antibody concentrations and relative concentrations were selected and transferred to 24-well plates. After approximately 3 days, they were transferred to 6-well plates, and after 3 days, the cells were preserved and batch cultured, with a cell density of 0.5 × 10⁶. 6 Adjust to cells / ml, perform batch culture in a 2.2 ml volume, and then 0.3 × 10⁶ 6 Cells were cultured at a cell density of cells / ml, and the cell line was stored in 2 ml. After 7 days, supernatant samples from batch cultures in 6-well plates were sent for detection. Cell lines with low antibody concentration and small cell diameter were selected, transferred to TPP tubes, stored, and subcultured to obtain cell lines expressing MA-9G7TB1IgG / IgM hybrid recombinant antibody.

[0123] The pcDNA3.4A-9G7TB2VCH plasmid and light chain plasmid were transfected and screened against the pcDNA3.4A-9G7TB1VCH plasmid according to the method described above to obtain cell lines expressing the MA-9G7TB2IgG / IgM hybrid recombinant antibody.

[0124] 3. Cell enlargement and culture After the cells were revived, they were first inoculated into a 125 ml shaking flask containing 100% Dynamis medium. The inoculation volume was 30 ml, the cells were rotated at a speed of 120 r / min, the temperature was 37°C, and the cells were cultured on a shaking bed containing 8% carbon dioxide. After 72 hours of culture, 5 × 10⁶ cells were cultured. 5Inoculate at an inoculation density of cells / ml and expand the culture. Calculate the expanded culture volume according to production needs. The medium used was 100% Dynamis medium. Thereafter, the expanded culture was carried out once every 72 h. When the cell amount meets the production needs, the inoculation density is strictly controlled at about 5×10 5 cells / ml for production.

[0125] 4. Production and purification in shake flasks Production parameters of the shake flask: The shaking bed had a rotation speed of 120 r / min, a temperature of 37 °C, and a carbon dioxide content of 8%. The materials were supplemented by flow addition. After culturing in the shake flask for 72 h, the materials were supplemented daily, and HyClone TM CellBoost TM Feed7a was added by flowing, and the daily flow addition amount was one-thousandth of the initial culture volume of HyClone TM CellBoost TM Feed7b was added by flowing, and the supplementation was carried out until the 12th day (the materials were also supplemented on the 12th day). Glucose was added at 3 g / L on the 6th day. Samples were collected on the 13th day. Using two types of fillers, captoL (cytiva) and CHT (Bio-Rad), affinity chromatography was used to purify in two steps to obtain multimeric antibodies of MA-9G7TB1 and MA-9G7TB2 IgG / IgM hybrid recombinant antibodies. 10 μl of the purified antibody (concentration is 1 mg / ml) was taken for reducing SDS-PAGE, and the electrophoresis results are as shown in Figure 1. In Figure 1, the left lane is the band of MA-9G7TB1 IgG / IgM recombinant antibody, and the right lane is the band of MA-9G7TB2 IgG / IgM recombinant antibody. Each lane shows two bands. The relative molecular mass (Mr) of one band is 70 - 75 kD (heavy chain), and the other Mr is 20 - 35 kD (light chain).

[0126] Example 4 Use of MA-9G7TB1 and MA-9G7TB2 IgG / IgM Hybrid Recombinant Antibodies Manufacture of test strips for MA-9G7TB1 gold colloid detection

[0127] 1. Manufacturing of nitrocellulose membranes Preparation of nitrocellulose membranes: MA-9G7TB1 recombinant antibody was diluted to 1-5 mg / ml with coating buffer, a T line (calibration curve) was drawn, and the T line was positioned near the gold colloid end. Sheep anti-mouse IgG antibody (produced by faponbiotech Co., Ltd., catalog number BA-PAB-MU0001) was diluted to 1-5 mg / ml with coating buffer, a C line (control line) was drawn, and the C line was positioned near the absorbent pad. The membranes were dried at 37°C, sealed, and prepared for use.

[0128] 2. Production of gold colloid and gold-labeled monoclonal antibodies 2.1 Production of Gold Colloid Using double-distilled deionized water, 1% chloroauric acid was diluted to 0.01%, boiled in an electric furnace, and 2 ml of 1% trisodium citrate was added per 100 ml of 0.01% chloroauric acid. Boiling was continued until the liquid turned bright red, at which point heating was stopped. After cooling to room temperature, the lost water was replenished. The resulting gold colloid was pure and transparent, free of precipitates and suspended matter, and had a shelf life of one week.

[0129] 2.2 Production of gold colloid-labeled antibodies The pH of the gold colloid was adjusted to 8.2 using 0.1M potassium carbonate. MA-labeled antibody from another strain (obtainable from faponbiotech) was added according to the gold colloid at a concentration of 8-10 μg antibody / 1 ml. The mixture was heated with a magnetic stirrer for 30 minutes until homogeneous, and BSA was added while stirring until the final concentration reached 1%. The mixture was then allowed to stand for 1 hour. The liquid was centrifuged at 13000 rpm at 4°C for 30 minutes, the supernatant was discarded, and the precipitate was washed twice with the labeling wash and storage solution. The precipitate was resuspended in one-tenth the volume of the initial gold colloid in the labeling wash and storage solution, and stored at 4°C for use. The shelf life was one week.

[0130] 3. Manufacturing of gold marking pads The gold-labeled pads were immersed in blocking solution for 30 minutes and then dried at 37°C. The prepared gold colloid-labeled antibody was then evenly spread on the gold-labeled pads, with the solution spread over 20 square centimeters per milliliter. The pads were freeze-dried, sealed, and stored at 4°C for use.

[0131] 4. Manufacturing of sample pads for test specimens The sample pad was immersed in a blocking solution (containing BSA) for 30 minutes, then dried at 37°C, sealed, and stored at 4°C for use.

[0132] 5. Assembly of the test specimen for detection An absorbent pad (purchased from Millipore), a nitrocellulose membrane, a gold-labeled pad, and a sample pad were placed on a non-absorbent support sheet and cut into small strips 3 mm wide. Ten small strips were placed in each bag, a desiccant was added, and the bags were vacuum-sealed to obtain MA-9G7TB1 gold colloid detection test specimens. Gold colloid detection test strips were prepared using MA-9G7TB2 recombinant antibody and MA-9G7 recombinant antibody, following the method described for the preparation of MA-9G7TB1 gold colloid detection test strips. The mass concentration of the T-ray hybrid recombinant antibody was the same as that of the control antibody.

[0133] 6. Use of test specimens for colloid detection Using pre-assembled detection test strips, the presence or absence of Pan-PLDH protein (hereinafter referred to as MA protein) in the test material was detected, thereby identifying the activity of the MA antibody in detecting the MA protein. During detection, the MA protein first binds to the gold colloid-labeled MA antibody to form an MA-gold colloid-labeled-MA antibody complex. Due to the action of capillaries, the MA-gold colloid-labeled-MA antibody complex migrates forward along the nitrocellulose membrane. Upon reaching the calibration curve, the MA-gold colloid-labeled-MA antibody complex binds to the MA-coated antibody, forming an MA antibody-MA-gold colloid-labeled-MA antibody complex, which concentrates on the calibration curve and forms a red precipitate line. Table 1 shows the corresponding detection data. The intensity of the red precipitate line indicates the strength of the reaction; a deeper red indicates a stronger reaction, while a deeper red indicates a weaker reaction. The strength of the reaction is also indicated using a combination of the letter C and a number; a smaller number after C indicates a stronger reaction, while a smaller number after C indicates a weaker reaction. If no red precipitate line is formed, it is indicated by B.

[0134] [Table 1]

[0135] Example 5: Construction, production, and use of a gold colloid platform for SARS-CoV-23E50TB2 and 5F27TB2 IgG / IgM hybrid recombinant antibodies.

[0136] In this embodiment, the 3E50 antibody is used as the IgG antibody, which is described in Chinese Patent Publication No. CN112239501A and incorporated herein by reference. The antibody may be selected from any one of the antibodies having one of the mutation combinations 1 to 68 in paragraphs

[0049] to

[0052] of CN112239501A, for example, mutation combination 50, and they have similar properties. In this embodiment, the 5F27 antibody is used as the IgG antibody, which is described in Chinese Patent CN112239500A and incorporated herein by reference. The antibody may be selected from any one of the antibodies having one of the mutation combinations 1 to 42 in paragraphs

[0048] to

[0049] of CN112239500A, for example, mutation combination 20, and they have similar properties.

[0137] 1. Expression plasmids for SARS-CoV-23E50TB2IgG / IgM and 5F27TB2IgG / IgM recombinant antibodies were constructed using the same method as the MA-9G7TB2 expression plasmid construction method described in Example 2. The expressed SARS-CoV-23E50TB2 and 5F27TB2IgG / IgM recombinant antibodies are formed by conjugating the VH+CH1 segment (including the hinge region) of 3E50 and 5F27IgG, respectively, to the CH2-CH3-CH4 segment of the above-mentioned IgM.

[0138] 2. SARS-CoV-23E50TB2 and 5F27TB2IgG / IgM recombinant antibodies were prepared according to the expression method of MA-9G7TB2 recombinant antibody in Example 3. Figures 2 and 3 show the electrophoresis results of 3E50TB2 and 5F27TB2IgG / IgM hybrid recombinant antibodies, respectively.

[0139] 3. The use of SARS-CoV-23E50TB2 and 5F27TB2IgG / IgM recombinant antibodies was evaluated according to the method of Example 4, and the specific performance evaluation results are shown in the table below.

[0140] [Table 2]

[0141] [Table 3]

[0142] [Table 4]

[0143] Example 6: Construction, production, and use of a fluorescence chromatography platform for CTNI21C5TB2 IgG / IgM hybrid recombinant antibody.

[0144] In this embodiment, an Anti-cTnI-21C5 monoclonal antibody (hereinafter referred to as CTNI21C5) is used as the IgG antibody, the sequence of which is described in Chinese Patent Publication No. CN111018983A and is incorporated herein by reference. The antibody may be one of the antibodies having any one set of mutations from mutation combination 1 to mutation combination 56 in paragraphs

[0080] to

[0084] of CN111018983A, for example mutation combination 37, and they have similar properties.

[0145] 1. The expression plasmid for the CTNI21C5TB2IgG / IgM recombinant antibody was constructed according to the construction method of the MA-9G7TB2 expression plasmid in Example 2. The expressed CTNI21C5TB2IgG / IgM recombinant antibody is an antibody formed by conjugating the VH+CH1 segment (including the hinge region) of CTNI21C5IgG to the CH2-CH3-CH4 segment of the above-mentioned IgM. The expression plasmid for the CTNI21C5TB1IgG / IgM recombinant antibody was constructed according to the construction method of the MA-9G7TB1 expression plasmid in Example 2. The expressed CTNI21C5TB1IgG / IgM recombinant antibody is an antibody formed by conjugating the heavy chain variable region (VH) segment of CTNI21C5IgG with the CH segment of the above-mentioned IgM. Furthermore, expression plasmids for CTNI21C5TB3 and CTNI-TBQIgG / IgM recombinant antibodies were constructed. Specifically, the expressed CTNI-TBQIgG / IgM recombinant antibody is an antibody formed by conjugating the full-length CTNI21C5 antibody (including the complete constant region) with the CH3-CH4 segment of IgM. Specifically, the expressed CTNI21C5TB3IgG / IgM recombinant antibody is an antibody formed by conjugating the VH+CH1-CH2 segment of IgG (including the hinge region) with the CH3-CH4 segment of IgM.

[0146] 2. CTNI21C5TB2, CTNI21C5TB3, the full-length antibody CTNI-TBQ, and the CTNI21C5TB1 IgG / IgM recombinant antibody were prepared according to the manufacturing method for expressing the MA-9G7TB2 recombinant antibody described in Example 3. Figure 4 shows the electrophoresis results of the 21C5TB2 hybrid recombinant antibody.

[0147] 3. Use of the CTNI21C5TB2 recombinant antibody fluorescence chromatography platform 3.1 Preparation of reagent cards for CTNI21C5TB2, CTNI21C5TB3, full-length antibody CTNI-TBQ, CTNI21C5TB1, and CTNI21C5 fluorescence chromatography detection. 3.1.1 Manufacturing of Nitrocellulose Membranes Nitrocellulose membrane preparation: Dilute CTNI21C5TB2 recombinant antibody to 1-2 mg / ml with coating buffer, draw a T line (calibration curve), position the T line close to the end of the gold-labeled pad and approximately 5 mm away from it. Dilute sheep anti-mouse IgG antibody (produced by faponbiotech Co., Ltd., catalog number BA-PAB-MU0001) to 1-2 mg / ml with coating buffer, draw a C line (control line), position the C line close to the absorbent pad and approximately 3 mm away from it. Dry at 37°C, seal, and prepare for use.

[0148] 3.1.2 Production of fluorescent chromatography-labeled monoclonal antibodies 1 ml of fluorescent microspheres with a 1% solid content was taken, the supernatant was removed by centrifugation, an equal volume of labeled activating solution was added and mixed uniformly with ultrasound, then activators EDC (final concentration 5 mg / ml) and NHS (final concentration 5 mg / ml) were added, and the mixture was shaken uniformly in the dark for 20 minutes, after which the supernatant was removed by centrifugation, an equal volume of labeled coupling solution was added and mixed uniformly with ultrasound, then 0.2-1 mg of CTNI-labeled antibody from another strain was added, and the mixture was shaken uniformly in the dark for 3 hours, after which the mixture was mixed uniformly, and finally, a labeled blocking solution was added to block the labeling, and the mixture was shaken in the dark for 45 minutes to complete the labeling process, the supernatant was removed by centrifugation, the microspheres were redissolved in microsphere-labeled storage solution and mixed uniformly with ultrasound, and stored at 4°C for use. The shelf life was 1 month.

[0149] 3.1.3 Manufacturing of fluorescent labeling pads The marker was diluted 5 to 10 times with marker diluent, and then the diluted marker was sprayed onto a fiberglass pad using a liquid sprayer. The marking pad was sealed and prepared for use at 4°C.

[0150] 3.1.4 Preparation of sample pads for test specimens The glass fiber pads were immersed in a blocking solution (containing BSA) for 30 minutes, dried at 37°C, sealed, and prepared for use at 4°C.

[0151] 3.1.5 Assembly of the detection reagent card An absorbent pad (purchased from Millipore), a nitrocellulose membrane, a labeling pad, and a sample pad were placed on a non-absorbent support sheet, cut into small 3mm wide strips, placed in a card case, with one card per bag. A desiccant was added, and the aluminum foil bag was vacuum-sealed to obtain a reagent card for CTNI21C5TB2 fluorescence chromatography detection. Using CTNI21C5TB3, the full-length antibody CTNI-TBQ, CTNI21C5TB1, and the CTNI21C5 fluorescence chromatography detection reagent card, fluorescence chromatography detection reagent cards were prepared according to the method described for the preparation of the CTNI21C5TB2 fluorescence chromatography detection reagent card, and the mass concentrations of CTNI21C5TB1, the full-length antibody CTNI-TBQ, CTNI21C5TB2, and the CTNI21C5TB3 IgG / IgM hybrid recombinant antibody (T-ray hybrid recombinant antibody) were the same as those of the control antibody.

[0152] 3.2 Test Results of the CTNI21C5TB2 Recombinant Antibody Fluorescence Chromatography Platform Purchased CTNI antigen was used as the detection sample. The aluminum foil bag was torn open and the test card was removed. 50 μL of sample was drawn from each detection sample, added to the sample diluent, and thoroughly mixed. After mixing, 50 μL was drawn and placed in the sample addition well of the test card. The reaction time after adding the sample to the test card was 15 min, and the fluorescence detector was automatically tested and the results were read. Simultaneously, 30 clinical baseline samples collected from the hospital were used as detection samples, and the sample association r of 21C5TB2 or 21C5 antibodies was detected. The specific test results are shown in Table 5, showing that the detection sensitivity of the 21C5TB2 antibody was greater than that of 21C5. Using the same principle and according to the above test method, the association r of 30 samples detected using 21C5TB1, 21C5TB3, and 21C5TBQ antibodies was all 0.9 or higher, and the sensitivity was 21C5TB2 > 21C5TB3 > 21C5TBQ > 21C5TB1.

[0153] [Table 5]

[0154] Example 7: Construction, production, and use of a fluorescence chromatography platform for CKMB10C5TB4 IgG / IgA hybrid recombinant antibody.

[0155] In this embodiment, an Anti-CKMB10C5 monoclonal antibody (hereinafter referred to as CKMB10C5) is used as the IgG antibody, and the sequence of said monoclonal antibody is described in Chinese Patent Publication No. CN111349168A, which is incorporated herein by reference. The antibody can be randomly selected from antibodies having any one set of mutations from mutation combination 1 to mutation combination 56 in paragraphs

[0096] to

[0098] of CN111349168A, for example mutation combination 11, and they have similar properties.

[0156] 1. Construction of an expression plasmid for the CKMB10C5TB4IgG / IgA hybrid recombinant antibody. First, a polynucleotide encoding the VH region and a portion of the CH1 segment of CKMB10C5 was ligated to a polynucleotide encoding a fragment from the hinge region to the C-terminus of the CH region of IgA using bridge PCR. A DNA fragment of approximately 1.5kb was obtained by PCR, and pcDNA was obtained by HindIII / EcoRI double enzyme cleavage. TM 3.4TOPO (R) It was concatenated to a vector and abbreviated as pcDNA3.4A-10C5TB3VCH. CKMB10C5TB1IgG / Ig A The recombinant antibody expression plasmid was constructed by referring to the construction method of the MA-9G7TB1 expression plasmid in Example 2. Expressed CKMB10C5TB1IgG / Ig A The recombinant antibody uses the VH segment of CKMB10C5IgG as described above. A This antibody is formed by binding to the CH segment of [the molecule]. Also, CTNI-TBQIgG / Ig A Recombinant antibody expression plasmids were constructed. Specifically, the expressed CTNI-TBQIgG / Ig A Recombinant antibodies are antibodies formed by ligating a full-length CKMB10C5 antibody (including the complete constant region) with the same IgA fragment described above. The antibody light chain clones in this embodiment were constructed using the light chain plasmid construction method disclosed in Chinese Patent Publication No. CN111349168A.

[0157] 2. CKMB10C5TB4, CKMB10C5TB1 and CTNI-TBQIgG / Ig A The recombinant antibody was produced according to the method for expressing the MA-9G7TB2 recombinant antibody in Example 3. Using two types of fillers, captoL (cytiva) and CHT (Bio-Rad), the antibody was purified in two steps by affinity chromatography to obtain the antibody.

[0158] 3. Use of the CKMB10C5TB4 recombinant antibody fluorescence chromatography platform 3.1 The preparation of reagent cards for fluorescence chromatography detection of the full-length antibodies CKMB-TBQ, CKMB10C5, and CKMB10C5TB4 is the same as described in Example 6, the only difference being that each set of hybrid recombinant antibodies in this example is an IgA dimer, and the mass concentration of the T-line hybrid recombinant antibody in the full-length antibodies CKMB-TBQ and CKMB10C5TB4 IgG / IgA hybrid recombinant antibodies is the same as that of the control antibody.

[0159] 3.2 CKMB10C5TB4 Recombinant Antibody Fluorescence Chromatography Platform Test Results The purchased CKMB antigen was used as the detection sample. The aluminum foil bag was torn open and the test card was removed. 50 μL of sample was drawn from each detection sample, added to the sample diluent, and thoroughly mixed. Another 50 μL was then drawn and added to the sample addition well on the test card. The reaction time after adding the sample to the test card was 15 min, and the fluorescence detector automatically tested and read the results. Simultaneously, 30 clinical baseline samples collected from the hospital were used as detection samples, and the sample relevance r of 10C5TB4 or 10C5 antibodies was detected. The specific test results are shown in Table 6. It was found that the detection sensitivity of the 10C5TB4 antibody was greater than that of 10C5, and the relevance r of all 30 detected samples was 0.9 or higher. Using the same principle and following the above test method, the relevance r of 30 samples detected using 10C5TB1 and 10C5TBQ antibodies was all 0.9 or higher, and the sensitivity was 10C5TB4 > 10C5TBQ > 10C5TB1.

[0160] [Table 6]

[0161] Each of the technical features of the embodiments described above can be combined in any way, and for the sake of brevity, not all possible combinations of each of the technical features in the embodiments described above have been explained. However, as long as there is no inconsistency in these combinations of technical features, they should all be considered to fall within the scope described herein.

[0162] The embodiments described above merely illustrate some of the embodiments of the present application, and although the descriptions are specific and detailed, they cannot be interpreted as limiting the scope of the claims. Furthermore, a person skilled in the art could make several modifications and improvements without departing from the concept of the present application, and all of these fall within the scope of protection. Therefore, the scope of protection of the present application should be in accordance with the attached claims.

Claims

1. Obtained by fusing the first polypeptide and the second polypeptide, The first polypeptide consists of a heavy chain variable region of IgG located at the N-terminus, a CH1 region and a hinge region, and The second polypeptide is an immunoglobulin consisting of an IgMCH2-CH3-CH4 region located at the C-terminus.

2. The IgG is IgG1, IgG2, IgG3, or IgG4. The immunoglobulin according to claim 1.

3. It is a polymer, A polymer obtained by polymerizing the immunoglobulin described in claim 1 or 2 as a monomer.

4. An isolated nucleic acid encoding an immunoglobulin according to claim 1 or 2.

5. A vector containing the nucleic acid described in claim 4.

6. A host cell containing the nucleic acid described in claim 4, or a host cell transformed by the vector described in claim 5.

7. A method for producing an immunoglobulin, comprising expressing the nucleic acid in a host cell according to claim 6 to obtain the immunoglobulin.

8. This includes fusing a first polypeptide and a second polypeptide and expressing them, The first polypeptide consists of a heavy chain variable region of IgG located at the N-terminus, a CH1 region and a hinge region, and The second polypeptide comprises an IgMCH2-CH3-CH4 region located at the C-terminus, and is a method for producing immunoglobulin.

9. The IgG is IgG1, IgG2, IgG3, or IgG4. The manufacturing method according to claim 8.

10. An immunoglobulin produced by the manufacturing method described in any one of claims 7 to 9.

11. A method for producing a polymer, A method for producing a polymer, comprising polymerizing an immunoglobulin produced by the manufacturing method described in any one of claims 7 to 9 as a monomer.

12. A polymer produced by the manufacturing method described in claim 11.

13. A solid-phase vector having a polymer described in claim 3 or 12 coated on its surface.

14. A kit or test specimen containing the polymer according to claim 3 or 12, or the solid-phase vector according to claim 13.

15. A method for detecting an antigen, Forming a conjugate by contacting the polymer according to claim 3 or 12, or the solid-phase vector according to claim 13, with the antigen, This includes detecting the conjugate body, A method for detecting an antigen, wherein the antigen is an antigen that can specifically bind to the IgG variable region.

16. Use in the manufacture of a reagent for immunodetection of the polymer according to claim 3 or 12, the solid-phase vector according to claim 13, or the kit or test piece according to claim 14.

17. An immunoassay method comprising detecting an antigen using the polymer described in claim 3 or 12, the solid-phase vector described in claim 13, or the kit or test piece described in claim 14.

18. The immunoglobulin according to any one of claims 1 to 2, characterized in that the CH2, CH3, and CH4 regions of IgM are selected from the CH2, CH3, and CH4 regions of IgM in SEQ ID NO: 3, or the CH1 region and hinge region of IgG are selected from the CH1 region and hinge region of IgG in SEQ ID NO:

8.

19. The manufacturing method according to any one of claims 8 to 9, characterized in that the CH2, CH3, and CH4 regions of IgM are selected from the CH2, CH3, and CH4 regions of IgM in SEQ ID NO: 3, or the CH1 region and hinge region of IgG are selected from the CH1 region and hinge region of IgG in SEQ ID NO: 8.

Citation Information

Patent Citations

  • Humanized IgM monoclonal antibody standard substance and preparation method thereof

    CN112961237A

  • Expression Techniques for Proteins Containing Hybrid-Isotypic Antibody Portions

    JP2004525630A

  • Hybrid steady-state region

    JP2015501291A

  • Dbpa antibodies and uses thereof

    WO2020041360A1