Method for producing pluripotent stem cells

Abstract

The present invention provides: a method that is for producing stem cells and that comprises a step for suspension-culturing cells in a culture medium containing a scaffold material that includes atelocollagen; and a method that is for producing differentiated cells and that comprises a step for suspension-culturing cells in a culture medium containing a scaffold material that includes atelocollagen. The present invention also provides stem cells and differentiated cell produced by said methods.

Description

[Technical Field]

[0001] This invention relates to a method for producing stem cells, such as pluripotent stem cells. More specifically, it relates to a method for producing stem cells, which includes a step of suspension culture of cells in a culture medium containing a scaffold material containing atelocollagen. [Background technology]

[0002] Techniques for culturing pluripotent stem cells, such as induced pluripotent stem cells (iPS cells) and embryonic stem cells (ES cells), by adhering them to the bottom surface of cell culture dishes (planar culture) have been developed to date (see Non-Patent Documents 1 and 2). On the other hand, ES cells, which are pluripotent stem cells, originate from the inner cell mass of a blastocyst, and in order to culture them in a manner close to their natural growth state, it is necessary to perform cultures similar to those used in the manufacturing process of organoids, such as suspension culture and semi-suspension culture.

[0003] A suspension culture method for ES cells and iPS cells that forms embryoid bodies (EBs) (three-dimensional cell aggregates formed by suspension culture of pluripotent stem cells) is known. In culture to form embryoid bodies, it is necessary to maintain a uniform size of the embryoid bodies, which specifically requires physical manipulation such as crushing the cell aggregates with the shear stress of a propeller in agitated culture. Therefore, in cell types that are easily susceptible to cell death by physical stress, such as ES cells and iPS cells (see Non-Patent Literature 3), controlling the size of embryoid bodies has been difficult.

[0004] Incidentally, in cell culture, microcarriers are sometimes used as scaffolding materials for cells. Microcarriers are tiny particles, and by adhering adherent animal cells to them and culturing them in this state, it is possible to culture them in large quantities under suspension conditions without significantly altering the properties of the adherent animal cells (see Non-Patent Literature 4). However, no scaffolding material such as microcarriers suitable for adhering pluripotent stem cells to a surface had been found until now.

[0005] It has been reported that the surface of microcarriers used in cell culture needs to be coated with an adhesion substrate made of bio-derived components such as Matrigel (Corning) (a solubilized basement membrane preparation extracted from mouse sarcoma). Furthermore, it is known that in cell culture, small microcarriers with a diameter of 100 μm or less are not suitable for cell proliferation, and that cells do not adhere if negatively charged residues such as carboxymethyl groups are dominant on the surface of the microcarrier (see Non-Patent Document 5). For example, type I collagen, as gelatin, its hydrolyzed component, has a history of being used mainly in planar culture methods called feeder culture as a scaffold material for cell culture dishes of pluripotent stem cells (see Non-Patent Documents 1 and 2). Collagen fibers have a cell adhesion sequence called the RGD sequence, and it has been reported that this sequence results in excellent cell affinity (see Non-Patent Document 6). Gelatin is collagen molecules and fragments that have lost their triple-strand helical structure, and there have been reports of successful pluripotent stem cell culture using gelatin nanofibers (see Patent Document 1). However, while type I collagen functions as a scaffold material for human iPS cells in feeder culture methods using mouse embryonic fibroblasts (MEFs), it has long been known to have weak ability to maintain the adhesion and proliferation of human iPS cells in feederless culture methods. Therefore, when using commercially available Cytodex-3 (GE Healthcare) (dextran beads coated with denatured porcine skin-derived collagen on the surface) which uses type I collagen, the ability to maintain cell adhesion and proliferation is weak in the feederless culture method necessary for the production of clinical iPS cells, and it cannot be said to be practical. Furthermore, Patent Document 1 states that human iPS cells cannot be cultured on 0.1% gelatin, and that human iPS cell proliferation has been successfully achieved by processing gelatin into nanofibers.

[0006] In Patent Document 2, a method is disclosed in which pluripotent stem cells are attached to a microcarrier coated with an extracellular matrix (such as a mixture of laminin, collagen, heparan sulfate proteoglycan, and entactin 1), and the pluripotent stem cells are subjected to suspension culture for 3 or more passages. In Patent Document 3, a method is disclosed in which a polymer compound (polysaccharides such as hyaluronic acid, deacylated gellan gum, diutan gum, xanthan gum, and carrageenan) is used as a medium composition for suspension culture of cells or tissues. In Patent Document 4, a xeno-free and serum-free medium containing bFGF, ascorbic acid, TGFβ-3, etc., and a method for suspension culture of pluripotent stem cells in the medium are disclosed. In Patent Document 5, a scaffold material for stem cells containing a synthetic resin of a specific composition and a culture method using the same are disclosed. Furthermore, in Patent Document 6, a device for culturing pluripotent stem cells, embryoid bodies, etc. is disclosed in which a solution is refluxed between a cell culture tank and a component adjustment liquid storage tank. However, in any of the patent documents, a specific method of using atelocollagen as a coating material for the microcarrier is not shown, and no specific example regarding the culture of pluripotent stem cells using atelocollagen is disclosed.

Prior Art Documents

Patent Documents

[0007]

Patent Document 1

Patent Document 2

[0009] The present invention aims to provide a novel method for establishing and proliferating stem cells that enables culture in a suspension state. Furthermore, this method aims to accelerate the industrial use of stem cells, such as pluripotent stem cells, by enabling cell homogenization and automation of culture. [Means for solving the problem]

[0010] Collagen has a long history of use as a scaffold material for pluripotent stem cell culture, specifically as gelatin. However, its primary purpose was as a scaffold material for feeder culture methods using mouse embryonic fibroblasts (MEFs). In recent years, MEF-based culture methods have become a classical technique, and feederless culture methods have become the mainstream. Feederless culture methods do not require MEFs or gelatin. Therefore, although there is a history of using type I collagen, which constitutes gelatin, in the culture of pluripotent stem cells, in recent years, with the establishment of feederless culture methods, there has been no motivation to use collagen in the culture of pluripotent stem cells, let alone to use atelocollagen instead of collagen, chronologically. Under these circumstances, the inventors deliberately focused on the culture of pluripotent stem cells using collagen, and after diligent research to solve the above problems, they conceived the idea that by using microcarriers coated with atelocollagen instead of collagen in cell culture, it might be possible to efficiently establish and proliferate pluripotent stem cells. Based on this idea, our research revealed that while pluripotent stem cells could not be established from somatic cells using microcarriers coated with type I collagen, they could be established using microcarriers coated with atelocollagen. Since type I collagen and atelocollagen share a large structural basis, this difference in establishment efficiency was surprising. Furthermore, we discovered that culturing pluripotent stem cells using atelocollagen-coated microcarriers allowed for efficient proliferation. Based on these findings, our inventors conducted further research, ultimately completing the present invention.

[0011] In other words, the present invention is as follows: [1] A method for producing pluripotent stem cells, comprising the step of suspension culture of cells in a culture medium containing a free scaffold material containing atelocollagen. [2] The method according to [1], wherein the cells are somatic cells into which a reprogramming factor has been introduced. [3] The method according to [2], wherein the somatic cells are floating cells. [3-1] The method according to [3], wherein the floating cells are hematopoietic cells. [4] The method according to [1], wherein the cells are pluripotent stem cells. [4-1] The method according to [4], wherein the pluripotent stem cells are induced pluripotent stem cells or embryonic stem cells. [4-2] The method according to any one of [1] to [4-1], wherein the cells are derived from humans. [5] The method according to any one of [1] to [4-2], wherein the scaffolding material is a microcarrier. [6] The method according to any one of [1] to [5], wherein the mass percentage concentration of atelocollagen in the scaffolding material is 10% or more. [7-1] The method according to any one of [1] to [6], wherein the scaffolding material is substantially composed of atelocollagen. [7-2] The method according to any one of [1] to [6], wherein the mass percentage concentration of atelocollagen in the scaffolding material is 95% or more. [8] The method according to any one of [1] to [7-2], wherein the step of culturing the cells in suspension is performed using a culture apparatus. [9] Pluripotent stem cells produced by any one of the methods described in [1] to [8].

[10] A pluripotent stem cell proliferation promoter containing atelocollagen and a scaffold material that is released in the culture medium. [10-1] A cell death inhibitor for pluripotent stem cells, containing atelocollagen and a scaffold material that is released in the culture medium. [10-2] A pluripotent stem cell survival support agent containing atelocollagen and a scaffold material that is released in the culture medium.

[11] A step of preparing pluripotent stem cells produced by any one of the methods in [1] to [8], The steps include culturing the prepared cells in a culture medium for differentiation induction, and The process of culturing the cultured cells in suspension culture in a culture medium containing a free scaffold material containing atelocollagen. A method for producing differentiated cells, including

[12] Differentiated cells produced by the method described in

[11] .

[13] A pharmaceutical composition comprising pluripotent stem cells as described in [9] or differentiated cells as described in

[12] . [Effects of the Invention]

[0012] The manufacturing method of the present invention allows for the efficient production and proliferation of stem cells. Pluripotent stem cells produced by the manufacturing method of the present invention can maintain their pluripotency even after suspension culture for at least 8 passages on a scaffold material containing atelocollagen. Furthermore, although this method includes a step of suspension culture of cells, suspension culture not only facilitates the automation and mass culture of culture, but also enables the construction of a complete system in which stem cells obtained by the manufacturing method of the present invention can be cultured while attached to the scaffold material and differentiated into specific cells. Moreover, the scaffold material used in the manufacturing method of the present invention can be prepared simply by coating a microcarrier with atelocollagen, or by molding atelocollagen itself as the scaffold material, making it cost-effective. Furthermore, it is possible to transplant differentiated cells obtained by the method of the present invention into a living organism together with the scaffold material without detaching it from the scaffold material. [Brief explanation of the drawing]

[0013] [Figure 1] The results of the human iPS cell proliferation test using bead culture in Example 1 (5-6 days after cell seeding) are shown. [Figure 2]The structure of collagen fiber is shown (Source: Hokkaido University of Medical Science Dental Journal, 2008. 27. 7-14). Collagen, a major component of living organisms, is a structural protein, and its structural characteristic is a higher-order structure with three helices. The basic unit of collagen fiber is the microfibril, where molecules (arrows) are offset by 670 Å = D from adjacent molecules, and there is a 0.6 D gap (hole zone) between molecules in the same row. Intermolecular cross-links are formed at the molecular ends (telopeptides). A microfibril is a cylinder (cross-section) with five molecules located at each vertex of a regular pentagon. Many microfibrils come together to form a fibril, many fibrils come together to form a fiber, and many fibers intertwine to form a fiber bundle. [Figure 3] Cell proliferation of hiPSCs in 3D culture using atelocollagen beads. 15M66 cells were counted on days 1, 2, 3, 4, 5, and 6 after seeding at 1 × 10⁵ cells / well on plates coated with iMatrix511, Cytodex 1 coated with iMatrix-511, and Cytodex 3 coated with iMatrix-511. Data are expressed as mean ± SD. **P < 0.01 (A). 15M66 cells were counted on day 6 after seeding at 5 × 10⁴ cells / well on plates coated with iMatrix 511 and on atelocollagen beads (n=3). Data are expressed as mean ± SD (B, left panel). 15M66 cells were cultured for 4 days after seeding at 1 × 10⁵ cells / bioreactor on Synthemax II or atelocollagen beads. Optical microscope image after agitation culture at 60 rpm (C, left panel). The scale bar indicates the specified length. Side view of the bioreactor during agitation culture (D). mRNA expression analysis results. Data represent mean ± SD. **P < 0.01 (E), cell count data (F). n=3. [Figure 4]Study on the proliferation of hiPSCs using atelocollagen beads of different diameters. Light microscope image (A) of strain 15M66 cells attached to atelocollagen beads with diameters of ≤105 μm, 105-250 μm, 250-425 μm, and 425-600 μm. Light microscope image (B, left panel) and cell count (B, right panel) of 15M66 cells 5 days after seeding 5 × 10⁴ cells onto atelocollagen beads with diameters ≤105 μm, 105-250 μm, 250-425 μm, and 425-600 μm. n=6. Light microscope image (C, left panel) and cell count (C, right panel) of 201B7 cells 5 days after seeding 5 × 10⁴ cells onto atelocollagen beads with diameters ≤105 μm, 105-250 μm, 250-425 μm, and 425-600 μm. The data represents the mean ± standard deviation. *P < 0.05. **P < 0.01. [Figure 5] Characteristics of hiPSCs cultured on atelocollagen-coated plates. Light microscope images taken 4 days after seeding of 15M66 cells cultured at 5 × 10⁴ cells / well on iMatrix-511, atelocollagen, or gelatin. Scale bars indicate specified lengths (A), cell count data. Data represent mean ± SD. **P < 0.01 (B). mRNA expression analysis results 4 days after seeding of 15M66 cells at 5 × 10⁴ cells / well on iMatrix-511 or atelocollagen. Correlation with stem cell markers (C), expression of undifferentiated cell markers (D), correlation with pluripotency maintenance markers (E). [Figure 6]Characteristics of hiPSCs cultured on atelocollagen-coated plates. Images of 201B7 cells observed under a light microscope 4 days after seeding at 5 × 10⁴ cells / well on plates coated with iMatrix-511, atelocollagen, or gelatin. Scale bars indicate specified length (A) and cell count data (B). Data are expressed as mean ± SD. Results of mRNA expression analysis 4 days after seeding of 201B7 cells seeded at 5 × 10⁴ cells / well on plates coated with iMatrix-511 or atelocollagen: correlation with stem cell markers (C), expression of undifferentiated cell markers (D). Data are expressed as mean ± SD. *P < 0.05. **P < 0.01. [Figure 7] Differentiation and degeneration status of hiPSCs cultured on atelocollagen-coated plates. Results of mRNA expression analysis of 15M66 cells on iMatrix-511 or atelocollagen 4 days after seeding at 5×10⁴ cells / well. Differentiation markers (A). Results of mRNA expression analysis of 15M66 cells 4 days after cell seeding at 5×10⁴ cells / well on iMatrix-511 or atelocollagen. Epithelial markers, n=6. Data represent mean ± SD. *P < 0.05. **p < 0.01 (B). Mesenchymal markers, n=6. Data represent mean ± SD. *P < 0.05. **p < 0.01 (C). Fluorescence micrograph of 15M66 cells (5×10⁴ cells / well) on iMatrix-511 or atelocollagen. Cells were stained with Kyoto Probe 1 (D, top panel) and Tra-1-60 (D, bottom panel) four days after seeding. Scale bar = 200 μm. [Figure 8]iPSCs were established on atelocollagen beads. 1 × 10⁵ human mononuclear cells were reprogrammed using Sendai virus vectors on atelocollagen beads or Cytodex 3. Light microscope images 15 days after the start of reprogramming. White arrows indicate established hiPSCs (A, left panel) or incompletely established cell aggregates (A, right panel). A total of 1 × 10⁵ human mononuclear cells were reprogrammed on iMatrix-511 or atelocollagen beads using five different Sendai virus vectors (SRVTM iPSC-1, 2, 3, 4, CytoTune 2.0). Colony count / well 15 days after the start of reprogramming. **p<0.01(B). Expression analysis of differentiation markers in mRNA collected 11 days after the start of differentiation induction into cardiomyocytes (C), endodermal cells (D), and neural progenitor cells (E) from hiPSCs established on atelocollagen beads and passed through 8 times on atelocollagen beads. Data are expressed as mean ± SD. *P < 0.05. **P < 0.01. [Figure 9] Effects of iMatrix-511 coated plates, atelocollagen coated plates, and atelocollagen beads on the induction of differentiation into cardiomyocytes. Cardiomyocytes 8 days after the start of differentiation induction from hiPSCs of strain 201B7. Light microscope images are shown (top panel). Immunofluorescence staining with troponin T antibody (second from the top), immunofluorescence staining with Hoechst (third from the top), and a composite image of these stains taken under a microscope (bottom panel). Scale bar = 200 μm. [Figure 10] Degradation of atelocollagen by collagenase. Optical microscope image 0-30 minutes after addition of collagenase (1g / 10ml high-concentration solution, 50 μl / well). Scale bar = 400 μm. [Figure 11]Elucidation of the mechanism by which hiPSCs induce filopodia elongation in response to atelocollagen. Optical microscope image (white arrow) (A) of hiPSCs with filopodia extended and attached to atelocollagen. Optical microscope image 3 days after seeding 15M66 cells at 2.5 × 10⁴ cells / well in wells coated with atelocollagen (B) or wells coated with iMatrix-511 (C), with or without the addition of reagent TC-I 15 at 1 or 10 μg / well. Scale bar = 100 μm. Diagram showing how atelocollagen induces filopodia elongation in hiPSCs. Atelocollagen activates integrin α2β1 in hiPSCs, activating self-renewal and filopodia elongation. This mechanism functions not only under 2D culture conditions (D, left) but also under 3D culture conditions (D, right). [Figure 12] The effect of atelocollagen on Rho family protein signaling factors. Diagram illustrating the signaling pathway in which Rho family protein signaling factors express filopodia. Receptors include GPCR, RTK, and Integrin, but only Integrin is depicted (A). Results of mRNA expression analysis of Rho family protein signaling factors after seeding 5 × 10⁴ cells / well in wells coated with iMatrix-511 or atelocollagen from 201B7 cells (B) or 15M66 cells (C). n = 6. Data represent mean ± SD. *P < 0.05. **p < 0.01. [Figure 13-1] Investigation of the mechanism by which hiPSCs induce filopodia elongation in atelocollagen. Light microscope images. 15M66 cells were seeded at 2.5 × 10⁴ cells / well in iMatrix-511 or atelocollagen-coated wells with or without reagents (control: DMSO, NF023, NF449, SB 225002, GP Antagonist-2A, or dihydromundoreton only) at concentrations of 1 or 10 μg / well, and the cells were observed 3 days later. Scale bar = 100 μm. [Figure 13-2]Investigation of the mechanism by which atelocollagen induces filopodiatric elongation in hiPSCs. Light microscope images. 15M66 cells were seeded at 2.5 × 10⁴ cells / well in iMatrix-511 or atelocollagen-coated wells with or without reagents (VU6015929, merethinib, or DDR1-IN-1 only) at concentrations of 1 or 10 μg / well, and the images show the cells 3 days later. Scale bar = 100 μm. [Figure 14] hiPSCs were cultured in a bioreactor with hollow fiber membranes made of PES material coated with atelocollagen. Optical microscope images (400x magnification) of 15M66 cells (white arrows) attached to a PES membrane without atelocollagen coating (A, left panel) or a PES membrane coated with atelocollagen (A, right panel). Photograph of an automated cell culture system with a bioreactor using hollow fiber membranes made of PES material (B). Optical microscope image of 15M66 cells collected after 4 days of cell detachment with collagenase following seeding of 5 × 10⁵ cells / well in a polyethersulfone (PES) hollow fiber membrane bioreactor (C). mRNA analysis results of cells collected after 4 days of cell detachment with collagenase following seeding of 15M66 cells at 5 × 10⁵ cells / well in an atelocollagen-coated PES hollow fiber membrane bioreactor (D). Expression of undifferentiated cell markers (D), maintenance of pluripotency markers (E), correlation with stem cell markers (F), differentiation markers (G). n = 1. [Figure 15] Observation of hiPSCs cultured in a bioreactor using PES hollow fiber membranes coated with atelocollagen. Hematoxylin-eosin (HE) staining was applied to inner (IC) and outer (EC) sections of the hollow fiber. hiPSC colonies (black arrows). Scale bars indicate specified lengths. [Modes for carrying out the invention]

[0014] Hereinafter, preferred embodiments for carrying out the present invention will be described with reference to the drawings. The embodiments described below are merely examples of typical embodiments of the present invention, and this should not be interpreted as narrowing the scope of the invention.

[0015] 1. Stem cell proliferation promoter As shown in the examples described below, by using a scaffold material containing atelocollagen, pluripotent stem cells could be efficiently produced from somatic cells, and the stem cells could be efficiently proliferated. Therefore, a (pluripotent) stem cell proliferation promoter (hereinafter sometimes referred to as "the agent of the present invention") containing a scaffold material containing atelocollagen is provided. Although not bound by any theory, it is presumed that the above effect of the scaffold material containing atelocollagen is a result of cell death due to shear stress in suspension culture being suppressed by the adhesion of cells such as stem cells and differentiated cells to atelocollagen. Therefore, a cell death inhibitor or cell survival maintenance agent containing a scaffold material containing atelocollagen is also provided.

[0016] The agent of the present invention may also be in the form of a culture medium. Therefore, a culture medium containing a scaffold material containing atelocollagen (hereinafter sometimes referred to as "the culture medium of the present invention") is also provided. The scaffold material containing atelocollagen contained in the culture medium of the present invention will be free in the culture medium. Alternatively, the agent of the present invention can also be used as a culture medium for somatic cell culture, a culture medium for stem cell culture, a differentiation induction medium for inducing differentiation of stem cells, a cell preservation solution for stem cells and stem cell-derived differentiated cells, and an organ preservation solution for organs made from stem cell-derived differentiated cells. In the present invention, the cells to be cultured may be single cells, but typically they are a population of multiple cells. Therefore, unless otherwise specified herein, "cells" includes "population of cells." A population of cells may consist of one type of cell, or it may consist of two or more types of cells.

[0017] Furthermore, the agent of the present invention can be used as a culture medium composition, with a scaffold material containing atelocollagen as an essential component. That is, all or part of the components of the culture medium of the present invention can be used as constituent components, solidified or concentrated as a solution, and then used in various forms, such as a composition for dissolution, dilution, or addition to existing culture media (culture medium supplement), or a set of liquid culture medium and solid components, to ultimately produce the culture medium of the present invention.

[0018] [Scaffolding materials] In this specification, "scaffold material," also known as a scaffold, refers to a material or substrate that functions as a scaffold for cells in cell culture. The atelocollagen-containing scaffold material used in the present invention is not limited as long as it can be used in suspension culture of cells (in other words, it may be free in the culture medium), but it is preferable that it contains a synthetic resin. Furthermore, the above scaffold material may consist of atelocollagen, and specifically, examples include atelocollagen molded into a shape suitable for use as a scaffold material. Typically, the scaffold material used in the present invention is a material other than nanofiber.

[0019] Synthetic resins refer to materials whose main component is a polymer (hereinafter also simply referred to as "polymer") obtained by polymerizing (including polycondensation) polymerizable monomers (hereinafter also simply referred to as "monomers"). The above polymer also includes copolymers of one or more polymerizable monomers. Alternatively, scaffolding materials may be made mainly of inorganic materials such as glass or silicone.

[0020] Examples of the polymers mentioned above include polymers composed of one or more polymerizable monomers such as (un)saturated hydrocarbons, aromatic hydrocarbons, (un)saturated fatty acids, aromatic carboxylic acids, (un)saturated ketones, aromatic ketones, (un)saturated alcohols, aromatic alcohols, (un)saturated amines, aromatic amines, (un)saturated thiols, aromatic thiols, and organosilicon compounds.

[0021] Specific examples of the above polymers include polystyrene, polyolefin, polyether, polyvinyl alcohol, polyvinyl acetal, polyester, poly(meth)acrylic acid ester, epoxy resin, polyamide, polyimide, polyurethane, polycarbonate, cellulose, dextran, and polypeptides (e.g., gelatin). These polymers may be used individually or in combination of two or more types. When combining two or more polymers, they may be used as a mixture, or as a polymer formed by chemically bonding the backbones of two or more polymers.

[0022] Scaffolding materials may be manufactured by known methods or commercially available products may be used. Examples of commercially available products include Cytodex-1 (GE Healthcare).

[0023] Typically, a scaffold material containing atelocollagen can be prepared by coating all or part of the surface of the above-mentioned scaffold material with atelocollagen. As shown in the examples below, the adhesion between pluripotent stem cells and atelocollagen suggests that the pluripotent stem cells are fixed to the atelocollagen through the interaction between integrin α2β1 present on the surface of the pluripotent stem cells and atelocollagen. Therefore, when coating the surface of the scaffold material with atelocollagen, it is sufficient to coat only a part of the scaffold surface, as long as the above interaction occurs to that extent. Furthermore, the purity of the atelocollagen used for coating is not particularly limited, but high purity (for example, 90% or more, more preferably 95% or more, most preferably 100%) is preferable. In order to improve the adhesion between the surface of free scaffold materials such as microcarriers and cells, the material may be coated with any cell-supporting substrate such as extracellular matrix (ECM) in addition to atelocollagen. As shown in the examples below, native collagen had an inhibitory effect on cell proliferation, so it is preferable that the mixture be substantially free of native collagen (for example, 10% or less, more preferably 5% or less (e.g., 4%, 3%, 2%, 1%, 0%)). The cell support substrate can be any substance intended for the adhesion of stem cells or feeder cells (if used). Such cell support substrates include collagen, gelatin, poly-L-lysine, poly-D-lysine, laminin (or a partial structure of laminin), and fibrous materials. Examples include nectin and mixtures thereof, such as Matrigel, and lysed cell membrane preparations (see Lancet, 2005.365.9471.1636-1641). In this specification, "purity" means mass percentage concentration (hereinafter, "mass percentage concentration" will be simply referred to as "concentration") as an indicator of high quality (low percentage of impurities), unless otherwise specified, but may also refer to the concentration of a specific component (e.g., atelocollagen) in a mixture (e.g., a mixture of atelocollagen and other cell-supporting substrates).

[0024] The shape of the scaffold material used in the present invention is not particularly limited, but examples include cylindrical, elongated sphere, and spherical shapes, with a spherical shape being preferred. Specific examples of such spherical scaffold materials include microcarriers. As shown in the examples below, it has been demonstrated that pluripotent stem cells can proliferate in culture using a bioreactor, regardless of whether microcarriers with diameters of 105 μm or less, 105-250 μm, 250-425 μm, or 425-600 μm are used. The size of the scaffold material is also not particularly limited, but when using spherical materials such as microcarriers, the particle size (diameter) of the scaffold material is typically 50-1000 μm, may be 70-700 μm, and preferably 100-400 μm. Furthermore, in one preferred embodiment, from the viewpoint of cell proliferation rate, the particle size is 600 μm. The particle size can be measured by the Coulter counter method described in the international standard ISO 13319 "Measurement of particle size distribution - Electrical sensing zone method".

[0025] Type I collagen molecules consist of approximately 95% helical portion and approximately 5% non-helical portion (telopeptide) (Figure 2). This non-helical portion is a highly antigenic region and is cleaved by proteases (protein-degrading enzymes). The atelocollagen contained in the scaffold material is a highly purified natural polymer material with extremely low antigenicity, obtained by digesting and removing the highly antigenic telopeptide portion with proteases such as pepsin (see Matrix, 1992, 12. 274-281). On the other hand, collagen present in living organisms is an insoluble fibrous protein with a "triple helix structure" in which three polypeptide chains wind a helix, and is also called native collagen. The origin of the atelocollagen used in this invention is not limited, and examples include those derived from mammals (e.g., humans, mice, rats, monkeys, cattle, horses, pigs, dogs, etc.). From the viewpoint of preventing contamination with components from different animal species, it is preferable to use atelocollagen of the same origin as the cells being cultured. Such atelocollagen may be produced by known methods, or commercially available products may be used. For example, atelocollagen can be purified by treating collagen extracted from cells or tissues containing atelocollagen, or collagen secreted from cultured cells, with a protease.

[0026] [Stem cells] The "stem cells" covered by this invention refer to immature cells that have the ability to self-replicate and differentiate and proliferate, and include pluripotent stem cells, multipotent stem cells, unipotent stem cells, etc., depending on their differentiation ability. "Pluripotent stem cells" are generally defined as undifferentiated cells that have the "ability to self-regenerate" which allows them to proliferate while maintaining an undifferentiated state, and the "pluripotency" which allows them to differentiate into all three germ layer lineages.

[0027] Pluripotent stem cells are cells that have the ability to differentiate into all tissues and cells that make up a living organism. Pluripotent stem cells are cells that have the ability to differentiate into multiple types of tissues and cells, though not all of them. Unipotent stem cells are cells that have the ability to differentiate into specific tissues or cells.

[0028] The origin of the stem cells is not particularly limited and may be cells from rodents such as rats, mice, hamsters, and guinea pigs; lagomorphs such as rabbits; ungulates such as pigs, cattle, goats, and sheep; carnivores such as dogs and cats; and primates such as humans, monkeys, rhesus monkeys, marmosets, orangutans, and chimpanzees.

[0029] Specific examples of stem cells include mesenchymal stem cells that differentiate into myoblasts, vascular endothelial cells, osteoblasts, adipocytes, muscle cells, cardiomyocytes, chondrocytes, etc.; neural stem cells that differentiate into neurons and glial cells; hematopoietic stem cells or bone marrow stem cells that differentiate into leukocytes, erythrocytes, platelets, mast cells, dendritic cells, etc.; embryonic stem cells (ES cells) and induced pluripotent stem cells (iPS cells), which are known to progress from a spheroid state to the formation of a pseudo-embryo called an embryoid body (EB body) before proceeding to the differentiation and induction steps into various tissues; embryonic germ (EG) cells derived from primordial germ cells; multipotent germlinEStem (mGS) cells isolated during the establishment culture process of GS cells from testicular tissue; and multipotent adult progenitor cells (MAPCs) isolated from bone marrow. When the above-mentioned pluripotent stem cells are ES cells or any cells derived from a human embryo, these cells may be produced by destroying the embryo or by producing them without destroying the embryo; however, from an ethical standpoint, it is preferable that the cells be produced without destroying the embryo. Furthermore, it is preferable that the human ES cells used in this invention are established from a human embryo within 14 days of fertilization.

[0030] Examples of pluripotent stem cells include the aforementioned ES cells or iPS cells. Stem cells established by culturing early embryos created by nuclear transplantation of somatic cell nuclei are also preferred as pluripotent stem cells (Nature, 1997.385.810-813; Science, 1998.280.1253-1256; Nature Biotechnology, 1999.17.456-461; Nature, 1998.394.369-374; Nature Genetics, 1999.22.127-128; Proc Natl Acad Sci USA, 1999.96.14984-14989; Nature Genetics, 2000.24.372-376).

[0031] For example, the human ES cell lines WA01(H1) and WA09(H9) are available from the WiCell Research Institute, and KhES-1, KhES-2, and KhES-3 are available from the Institute for Frontier Medical Sciences, Kyoto University (Kyoto, Japan). In addition, the human ES cell line KthES11 for clinical research is available from the Institute for Frontier Medical Sciences, Kyoto University.

[0032] Examples of iPS cells include cells that acquire multipotency similar to ES cells by introducing multiple genes or proteins (reprogramming factors) into somatic cells such as skin cells. Examples of iPS cells include those obtained by introducing the Oct3 / 4 gene, Klf4 gene, C-Myc gene, and Sox2 gene, and iPS cells obtained by introducing the Oct3 / 4 gene, Klf4 gene, and Sox2 gene (Nature Biotechnology, 2008.26.101-106). Examples of initialization factors include Oct3 / 4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, beta-catenin, Lin28b, Sall1, Sall4, ESrrb, Nr5a2, Tbx3, or Glis1. These initialization factors may be used individually or in combination.The combinations of initialization factors are WO2007 / 069666, WO2008 / 118820, WO2009 / 007852, WO2009 / 032194, WO2009 / 058413, WO2009 / 057831, WO2009 / 075119, WO2009 / 079007, WO2009 / 091659, WO2009 / 101084, WO2009 / 101407, WO2009 / 102983, WO2009 / 114949, WO2009 / 117439, WO2009 / 126250, WO2009 / 126251, WO2009 / 126655, WO2009 / 157593, WO2010 / 009015, WO2010 / 033906, WO2010 / 033920, WO2010 / 042800, WO2010 / 050626, WO2010 / 056831, WO2010 / 0 68955, WO2010 / 098419, WO2010 / 102267, WO2010 / 111409, WO2010 / 111422, WO2010 / 115050, WO2010 / 124290, WO2010 / 147395, WO2010 / 147612, Nat Biotechnol,2008.26.795-797, Cell Stem Cell,2008.2.525-528, Stem Cells,2008.26.2467-2474, Nat Biotechnol,2008.26.1269-1275, Cell Stem Cell,2008.3.568-574, Cell Stem Cell,2008.3.475-479, Cell Stem Cell,2008.3.132-135, Nat Cell Biol,2009.11.197-203, Nat Biotechnol,2009.27.459-461, Proc Natl Acad Sci Examples of combinations are given in USA, 2009.106.8912-8917, Nature, 2009.461.643-649, Cell Stem Cell, 2009.5.491-503, Cell Stem Cell, 2010.6.167-74, Nature, 2010.463.1096-1100, Stem Cells, 2010.28.713-720, and Nature, 2011.474.225-229.

[0033] iPS cells are available from designated institutions (RIKEN BioResource Center, Kyoto University). Furthermore, the establishment of clinical-grade iPS cells is also underway in Japan (Kyoto University Hospital, Kyoto University iPS Cell Research Institute https: / / www.cira.kyoto-u.ac.jp / j / rESearch / stock.html), the Kyoto University iPS Cell Research Foundation https: / / www.cira-foundation.or.jp / j / , and the United States (ClinicalTrials.gov Identifier:NCT03434808, ClinicalTrials.gov Identifier:NCT02056613), as well as at FUJIFILM Cellular Dynamics, Inc. (FCDI), a US subsidiary of Fujifilm Corporation. The technology of the present invention can also be used for the establishment and maintenance culture of such iPS cells.

[0034] More specifically, examples of human iPS cells include the 253G1 strain (RIKEN Cell Bank No. HPS0002), the 201B7 strain (RIKEN Cell Bank No. HPS0063), the 409B2 strain (RIKEN Cell Bank No. HPS0076), the 454E2 strain (RIKEN Cell Bank No. HPS0077), the HiPS-RIKEN-1A strain (RIKEN Cell Bank No. HPS0003), the HiPS-RIKEN-2A strain (RIKEN Cell Bank No. HPS0009), the HiPS-RIKEN-12A strain (RIKEN Cell Bank No. HPS0029), the NiPS-B2 strain (RIKEN Cell Bank No. HPS0223), as well as iPS cells for clinical use, iPS cells for medical use, iPS cells for regenerative medicine, and myiPS (Kyoto University iPS Cell Research Foundation).

[0035] Examples of pluripotent stem cells include mesenchymal stem cells, hematopoietic stem cells, neural stem cells, bone marrow stem cells, and germline stem cells, among other somatic stem cells. Preferably, the pluripotent stem cells are mesenchymal stem cells, and more preferably bone marrow mesenchymal stem cells. In a broad sense, mesenchymal stem cells refer to a population of stem cells or their progenitor cells that are capable of differentiating into all or some of the mesenchymal cells, such as osteoblasts, chondrocytes, and lipoblasts.

[0036] [culture medium] In this specification, "suspension culture" means culture carried out under conditions that maintain a state in which cells or cell aggregates are suspended in the culture medium, that is, culture under conditions that do not allow strong cell-substrate junctions and cell-cell junctions to form between cells or cell aggregates and the culture vessel and feeder cells (if used). When cells adhere to the scaffold material that is free in the culture medium, the cells themselves also become free in the culture medium. Furthermore, "free" or "free" also includes a state in which the scaffold material or cells or cell aggregates attached to the scaffold material float in the culture medium when the culture vessel is gently shaken. In addition, the culture medium of the present invention can be prepared by adding free scaffold material such as a microcarrier containing atelocollagen, either alone or in combination, to a culture medium (basic medium) that has been conventionally used for the culture of somatic cells, the culture of stem cells produced from somatic cells, and the induction of differentiated cells from stem cells. Examples of such culture media include the following.

[0037] Examples of the above-mentioned basal media include RPMI-1640 medium, Eagle's MEM medium, Dulbecco's modified MEM medium, Glasgow's MEM medium, α-MEM medium, 199 medium, IMDM medium, DMEM medium, Hybridoma Serum free medium, Chemically Defined Hybridoma Serum Free medium, Ham's Medium F-12, Ham's Medium F-10, Ham's Medium F12K, ATCC-CRCM30, DM-160, DM-201, BME, Fischer, McCoy's 5A, Leibovitz's L-15, RITC80-7, MCDB105, MCDB107, MCDB131, MCDB153, MCDB201, NCTC109, NCTC135, Waymouth's MB752 / 1, CMRL-1066, Williams' medium E, and Brinster's BMOC-3. Examples include, but are not limited to, Medium, E8 Medium (Thermo Fisher Scientific), ReproFF2, Primate ES Cell Medium, ReproStem (ReproCELL, Inc.), ProculAD (Rohto Pharmaceutical Co., Ltd.), MSCBM-CD, MSCGM-CD (Lonza), EX-CELL302 medium (SAFC) or EX-CELL-CD-CHO (SAFC), ReproMed™ iPSC Medium (ReproCELL, Inc.), Cellartis MSC Xeno-Free Culture Medium (Takara Bio Inc.), TESR-E8 (Veritas Inc.), StemFit® AK02N, AK03N (Ajinomoto Co., Inc.), and mixtures thereof.

[0038] The concentration of atelocollagen in the scaffolding material ((mass of atelocollagen / mass of scaffolding material containing atelocollagen) × 100) is not particularly limited, as long as it is a concentration that exhibits a cell death inhibitory effect on cells. Such a concentration can be appropriately set by those skilled in the art using the methods described in the examples and conventionally known methods. The concentration of atelocollagen in the scaffolding material is, for example, 0.1% or more (e.g., 0.1%, 1%, 3%, 5%, 10%, 20%, 25%, 30%, or more) and 100% or less. If the scaffolding material is coated with a cell-supporting substrate containing atelocollagen, the concentration of atelocollagen in the cell-supporting substrate is 90% or more (e.g., 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 97%, 98%, 99%, or 100%). In one embodiment of the present invention, the scaffolding material is substantially composed of atelocollagen, but "substantially composed of atelocollagen" means not only that the concentration of atelocollagen is 100%, but also that it is close to 100% (for example, 95% or more, preferably 95.5% or more (e.g., 96%, 97%, 98%, 99%, or 100%)).

[0039] Furthermore, the concentration of atelocollagen in the culture medium is not particularly limited, and the cell proliferation rate can be controlled by appropriately setting the concentration of atelocollagen. The concentration of atelocollagen in the culture medium is, for example, 0.01 to 20%, preferably 0.05 to 5%, and more preferably 0.1 to 2%. It is also preferable that the concentration of atelocollagen in the culture medium be 0.5% to 20%, 1% to 15%, or 5% to 10%.

[0040] Furthermore, the culture medium may be supplemented with physiologically active substances and nutritional factors necessary for cell survival or proliferation, as needed. These additives may be added to the culture medium beforehand or added during cell culture. The method of addition during culture may be in any form, such as a single solution or a mixture of two or more solutions, and may be added continuously or intermittently.

[0041] Examples of physiologically active substances include insulin, IGF-1, transferrin, albumin, coenzyme Q10, various cytokines (interleukins (IL-2, IL-7, IL-15, etc.), stem cell factors (SCF), activin, etc.), various hormones, and various growth factors (leukemia suppressor factor (LIF), basic fibroblast growth factor (bFGF), TGF-β, etc.). Nutritional factors include sugars, amino acids, vitamins, hydrolyzed products, or lipids. Examples of sugars include glucose, mannose, or fructose, and they are used individually or in combination of two or more. Examples of amino acids include L-alanine, L-arginine, L-asparagine, L-aspartic acid, L-cysteine, L-glutamic acid, L-glutamine, glycine, L-histidine, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine, or L-valine, which are used individually or in combination of two or more. Examples of vitamins include d-biotin, D-pantothenic acid, choline, folic acid, myo-inositol, niacinamide, pyrodoxal, riboflavin, thiamine, cyanocobalamin, or DL-α-tocopherol, which are used individually or in combination of two or more. Examples of hydrolyzed products include those obtained by hydrolyzing soybeans, wheat, rice, peas, corn, cottonseed, and yeast extracts. Lipids include cholesterol, linoleic acid, or linolenic acid.

[0042] Furthermore, antibiotics such as kanamycin, streptomycin, penicillin, or hygromycin may be added to the culture medium as needed. When adding acidic substances such as sialic acid to the culture medium, it is desirable to adjust the pH of the medium to a neutral range suitable for cell growth, which is pH 5 to 9, preferably pH 6 to 8.

[0043] The culture medium of the present invention may be a serum-containing medium (e.g., fetal bovine serum (FBS), human serum, or horse serum) or a serum-free medium. From the viewpoint of preventing contamination with components from other animal species, it is preferable to use a serum-free medium or a serum derived from the same animal species as the cells being cultured. Here, a serum-free medium means a medium that does not contain unprocessed or unpurified serum. A serum-free medium may contain purified blood-derived components or animal tissue-derived components (e.g., growth factors).

[0044] The culture medium of the present invention may or may not contain serum substitutes, as well as serum. Examples of serum substitutes include albumin substitutes such as albumin, lipid-rich albumin, and recombinant albumin, plant starch, dextran, protein hydrolysates, transferrin or other iron transporters, fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thioglycerol, or equivalents thereof. Specific examples of serum substitutes include those prepared by the method described in International Publication No. 98 / 30679, or commercially available knockout serum replacements [KSR] (Life Technologies), chemically defined lipid concentrated (Life Technologies), and Glutamax (Life Technologies). Examples of bio-derived factors include platelet-rich plasma (PRP) and conditioned medium components of human mesenchymal stem cells.

[0045] [Cell preservation solution and organ preservation solution] Examples of cell and organ preservation solutions that have been widely used in clinical practice include University of Wisconsin Organ Preservation Solution (UW solution), HBSS (Hank's Balanced Salt Solution), histidine-tryptophan-ketogluta-rate (HTK) solution, Euro-Collins solution, Celsior solution, ET-Kyoto solution, IGL-1 solution, and EP-TU solution.

[0046] 2. Method for producing stem cells In another embodiment, the present invention provides a method for producing stem cells (hereinafter sometimes referred to as "the method for producing stem cells of the present invention") which includes the step of suspension culture of cells in the culture medium of the present invention. By culturing stem cells in the culture medium of the present invention, the stem cells proliferate (i.e., stem cells are produced) due to the self-regenerative ability of the stem cells. Therefore, a method for proliferating stem cells (or a method for maintenance culture) which includes the step of suspension culture of stem cells in the culture medium of the present invention is also provided. As shown in the examples below, pluripotent stem cells produced by the production method of the present invention can maintain their pluripotency (in other words, the ability to differentiate into all three germ layer lineages) even after suspension culture in the culture medium of the present invention for at least 8 passages, and are therefore also suitable for maintenance culture.

[0047] Furthermore, in the method for producing stem cells of the present invention, if the stem cells are pluripotent stem cells, pluripotent stem cells can be established by culturing and reprogramming the cells that will serve as the raw material for the pluripotent stem cells (starting cells). Therefore, in another aspect of the present invention, a method for producing pluripotent stem cells (hereinafter sometimes referred to as "the method for producing pluripotent stem cells of the present invention") or a method for establishing pluripotent stem cells is provided, which includes a step of suspension culture of cells in the culture medium of the present invention. In this specification, the term "the method for producing stem cells of the present invention" may be used to encompass both the method for producing stem cells of the present invention and the method for producing pluripotent stem cells of the present invention.

[0048] In yet another embodiment, stem cells produced by the method of the present invention are also provided.

[0049] [cell] In the method for producing pluripotent stem cells of the present invention, the cells cultured in the culture medium of the present invention are not limited to cells that serve as raw materials for pluripotent stem cells (starting cells). For example, if the pluripotent stem cells produced are iPS cells, the starting cells may be somatic cells into which the above-mentioned reprogramming factors have been introduced. Alternatively, somatic cells in the process of reprogramming (e.g., cells expressing at least Oct4) may be used. The somatic cells used in the method for producing pluripotent stem cells of the present invention may be suspension cells (e.g., hematopoietic cells) or adherent cells, but suspension cells are preferred. Examples of somatic cells used in the manufacturing method of the present invention include, but are not limited to, fibroblasts from the skin, skin cells, visual cells, brain cells, hair cells, oral mucosa cells, lung cells, hepatocytes, gastric mucosal cells, intestinal cells, spleen cells, pancreatic cells, kidney cells, neural stem cells, mesenchymal stem cells derived from wisdom teeth, tissue stem cells, tissue progenitor cells, hematopoietic cells (e.g., hematopoietic stem cells, peripheral blood mononuclear cells (including T cells and non-T cells), umbilical cord blood cells, etc.), epithelial cells, endothelial cells (e.g., vascular endothelial cells), muscle cells, etc.

[0050] Methods for introducing reprogramming factors into somatic cells include, when the reprogramming factor is in the form of DNA, for example, vectors such as viruses, plasmids, and artificial chromosomes, lipofection, liposomes, and microinjection; when it is in the form of RNA, for example, lipofection and microinjection; and when it is in the form of protein, for example, lipofection, fusion with cell membrane-permeable peptides (e.g., HIV-derived TAT and polyarginine), and microinjection. Methods using viral vectors include, but are not limited to, methods using retroviral vectors, methods using episomal vectors, methods using Sendai virus vectors such as ID Pharma's reprogramming kit "CytoTune(registered trademark)-iPS 2.0", methods using lentiviral vectors, and methods using adenovirus vectors. Furthermore, the method for producing pluripotent stem cells of the present invention may include a step of introducing reprogramming factors into somatic cells.

[0051] The cells being cultured may be dispersed or non-dispersed. Dispersed cells are those that have been treated to promote cell dispersion. Dispersed cells include single cells or cells that form small cell clusters consisting of several cells (typically 2-50, 2-20, or 2-10). Dispersed cells may be suspension cells or cells attached to free scaffolding materials such as microcarriers.

[0052] [Culture method] The step of suspension culturing cells in the culture medium of the present invention may be a step of pre-adding a scaffold material containing atelocollagen to the culture medium and then suspension culturing cells in such a medium, or a step of adding a scaffold material containing atelocollagen during cell culture and then suspension culturing. Furthermore, cells may be suspension cultured in the culture medium of the present invention for the entire duration of cell culture in the manufacturing method of the present invention, or cells may be suspension cultured in the culture medium of the present invention for only a portion of the period. For example, when establishing pluripotent stem cells, cells may be suspension cultured in the culture medium of the present invention only at the stage when pluripotent stem cells or adherent cells in the process of reprogramming appear. Also, cells may be cultured in the culture medium of the present invention from the initial stage of establishing pluripotent stem cells (for example, the stage of starting the culture of somatic cells into which reprogramming factors have been introduced). Furthermore, in the manufacturing method of the present invention, when the scaffold material containing atelocollagen is no longer needed, the scaffold material may be removed, or the scaffold material and cells may be separated. Specifically, for example, it is known that atelocollagen can be dissolved by adding a 0.1% concentration of collagenase and treating it at 37°C for more than one hour. Therefore, in the manufacturing method of the present invention, collagenase may be added to the culture medium at any time, or the culture medium may be replaced with one containing collagenase.

[0053] The culture vessels used for suspension culture are not particularly limited as long as they are capable of "suspension culture," and can be appropriately determined by those skilled in the art. Examples of such culture vessels include flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, micropores, multi-plates, multi-well plates, chamber slides, petri dishes, tubes, trays, culture bags, or roller bottles. Furthermore, bioreactors are exemplified as containers for suspension culture. These culture vessels are preferably cell-non-adherent in order to enable suspension culture. As cell-non-adherent culture vessels, those whose surfaces have not been artificially treated (e.g., coated with extracellular matrix, etc.) for the purpose of improving adhesion to cells can be used.

[0054] Suspension culture can be carried out, for example, by seeding cells in the various containers mentioned above and shaking or agitating the container in an appropriate manner, or by stirring the culture medium in the container. Alternatively, suspension culture can be carried out using culture equipment such as bioreactors or automated culture systems. Specifically, cell culture can be performed using bioreactors or automated culture systems that enable high-density culture while controlling pH, temperature, oxygen concentration, etc., and automatically performing cell seeding, medium exchange, cell image acquisition, and cultured cell retrieval in a closed environment under mechanical control. Methods for supplying cells with the required substances without excess or deficiency by replenishing new culture medium during culture using these devices include fed-batch culture, continuous culture, and perfusion culture, and any of these methods can be used in the manufacturing method of the present invention. Furthermore, culture vessels used in bioreactors and automated culture systems include open-system culture vessels (e.g., culture vessels with lids) that are easy to open and close and have a large contact area with the outside world, and closed-system culture vessels (e.g., cartridge-type culture vessels) that are not easy to open and close and have a small contact area with the outside world, but any of these culture vessels can be used in the manufacturing method of the present invention.

[0055] When using a bioreactor equipped with a stirring bar as a container for suspension culture, the rotation speed can be set as appropriate. While not particularly limited, examples of bioreactor rotation speeds include 10 to 100 rpm, 80 to 100 rpm for a 5 mL bioreactor, 30 to 50 rpm for a 100 mL bioreactor, and 10 to 30 rpm for a 500 mL bioreactor.

[0056] The cell culture density is not particularly limited as long as the cells can proliferate. Preferably, it is 1.0 × 10⁻⁶. 1 ~1.0×10 9 Cells / ml, more preferably 1.0 × 10⁶ 2 ~1.0×10 9 cells / ml, more preferably 1.0 × 10⁶ 3 ~1.0×10 9 Cells / ml, most preferably 3.0 × 10⁶ 4 ~1.0×10 9 The value is cells / ml.

[0057] When performing adherent culture of stem cells on a free scaffold material such as a microcarrier, the culture may be performed in the presence of feeder cells. Feeder cells can be stromal cells such as fetal fibroblasts (see, for example, Manipulating the Mouse Embryo: A Laboratory Manual, Fourth Edition (Cold Spring Harbor Laboratory PrESs, 2014), Gene Targeting: A Practical Approach (Oxford University PrESs, 1993), Proc Natl Acad Sci USA, 1981.78.12.7634-7638, Nature, 1981.292.5819.154-156, J. Virol, 1969.4.5.549-553, Science, 1996.272.5262.722-724, J Cell Physiol, 1982.112.1.89-95, International Publication WO2001 / 088100, International Publication WO2005 / 080554).

[0058] In the manufacturing method of the present invention, some cells may be released from the free scaffold material such as microcarriers. Examples of suspension culture of stem cells include suspension culture on a carrier (J Biotechnol, 2007.132.2.227-236) or suspension culture using a high molecular weight polymer such as methylcellulose (Stem Cell Reports, 2014.2.5.734-745).

[0059] Suspension culture of stem cells includes dispersed culture and aggregated suspension culture of stem cells. Dispersed culture of stem cells refers to the culture of suspended stem cells and includes the dispersed culture of single cells or small cell aggregates consisting of several (e.g., 2-20) stem cells. If dispersed culture is continued, the cultured dispersed cells will form larger stem cell aggregates, after which aggregated suspension culture can be performed. Examples of such aggregated suspension cultures include embryoid body culture (see Curr Opin Cell Biol, 1995.7.6.862-869), SFEB method (Nature Neuroscience, 2005.8.3.288-296, international publication WO2005 / 123902), and sphere culture, in which cell lines are subcultured by mechanical treatment using a mesh filter (Stem Cell Reports, 2014.2.5.734-745).

[0060] Culture conditions such as temperature, dissolved CO2 concentration, dissolved oxygen concentration, and pH can be appropriately set based on techniques conventionally used for culturing cells derived from animal tissue. For example, the culture temperature is not particularly limited but may be 30-40°C, preferably 37°C. The temperature at which organ preservation solutions or cell preservation solutions are used may be 0°C to room temperature, preferably 0°C to 4°C. The dissolved CO2 concentration may be 1-10%, preferably 2-5%. The oxygen partial pressure may be 1-10%. The number of culture days is not particularly limited as long as stem cells are produced, but is usually 2 days or more, preferably 3 days or more, more preferably 4 days or more. The upper limit of the culture period is also not particularly limited, but is usually 30 days or less, preferably 25 days or less.

[0061] The contents of the basal culture medium, physiologically active substances, and nutritional factors are all based on the contents of "1. Stem Cell Proliferation Promoters".

[0062] 3. Method for producing differentiated cells As described above, scaffold materials containing atelocollagen may have a cell death inhibitory effect on cells such as stem cells and differentiated cells. Therefore, the agent or culture medium of the present invention can also be used when producing differentiated cells from stem cells. Accordingly, a method for producing differentiated cells (hereinafter sometimes referred to as "the method for producing differentiated cells of the present invention") is also provided, which includes a step of suspension culture of cells in the culture medium of the present invention. In the method for producing differentiated cells of the present invention, the cells cultured in the culture medium of the present invention may be stem cells (including stem cells produced by the method of the present invention), cells after differentiation induction (e.g., cells in the process of differentiation such as precursor cells of differentiated cells), or even differentiated cells.

[0063] In one embodiment of the method for producing differentiated cells of the present invention, (1) A step of preparing stem cells produced by the manufacturing method of the present invention or a step of producing stem cells by the manufacturing method of the present invention, (2) A step of culturing the prepared cells in a culture medium for differentiation induction, (3) Step of cultured cells in a microsuspension culture in the culture medium of the present invention. Method for producing differentiated cells, including It will be provided.

[0064] In yet another embodiment, differentiated cells produced by the differentiated cell production method of the present invention are also provided.

[0065] The step of suspension culturing cells in the culture medium of the present invention may be a step of pre-adding a scaffold material containing atelocollagen to the culture medium and then suspension culturing the cells in such a medium, or it may be a step of adding a scaffold material containing atelocollagen during cell culture and then culturing the cells. Furthermore, cells may be suspension cultured in the culture medium of the present invention for the entire duration of cell culture in the differentiated cell production method of the present invention, or cells may be suspension cultured in the culture medium of the present invention for only a portion of the duration. For example, in the differentiated cell production method of the present invention, when the scaffold material containing atelocollagen is no longer needed, the scaffold material may be removed, or the scaffold material and cells may be separated. Specifically, for example, since it is known that atelocollagen dissolves when a 0.1% concentration of collagenase is added and treated at 37°C for 1 hour or more, in the production method of the present invention, collagenase may be added to the culture medium at any time, or the culture medium may be replaced with a culture medium containing collagenase.

[0066] The differentiated cells produced by the differentiated cell production method of the present invention are not particularly limited, and include, for example, osteoblasts, nerve cells, hepatocytes, smooth muscle cells, adipocytes, cardiomyocytes, epithelial cells, retinal pigment epithelial cells, dendritic cells and other immune cells.

[0067] In one embodiment, the step of suspension culture of cells in the culture medium of the present invention is the step of suspension culture of stem cells in a differentiation induction medium containing a scaffold material containing atelocollagen. Stem cell differentiation induction can be performed, for example, in the differentiation induction process of cardiomyocytes, by adding 0.5 ng / ml BMP-4 to the culture medium (e.g., STEMdiff APEL Medium, STEMCELL), replacing the medium after 1 day with one containing 10 ng / ml BMP-4, 10 ng / ml Activin A, and 5 ng / ml bFGF, replacing the medium after 4 days with one containing 10 ng / ml VEGF and 150 ng / ml Dkk1, and replacing the medium after 8 days with one containing 10 ng / ml VEGF, 150 ng / ml Dkk1, and 10 ng / ml bFGF, thereby confirming cardiomyocytes with autonomous beating. Examples of clinical trials include sheets containing human ES cell-derived cardiomyocyte progenitor cells ((CD15+, Isl-1+) progenitors) encapsulated in fibrin batches (ClinicalTrials.gov Identifier:NCT02057900). Furthermore, a group led by Professor Yoshiki Sawa of Osaka University is developing and clinically applying "cardiac sheets," which are made by culturing iPS cell-derived cardiomyocytes into sheets and attaching them to the hearts of heart failure patients to promote functional regeneration (http: / / www2.med.osaka-u.ac.jp / surg1 / technology / regenerative-medicine / ), and cells cultured using the present invention could also be used in this method. Furthermore, as an activity aimed at elucidating the pathogenesis, examples such as risk assessment of heart disease using patient-derived cardiac disease model iPS cells (ClinicalTrials.gov Identifier:NCT02413450) (ClinicalTrials.gov Identifier:NCT01517425, ClinicalTrials.gov Identifier:NCT01865981) have also been reported, and cells cultured using the present invention can also be used in this method.

[0068] Furthermore, for example, the differentiation induction process of chondrocytes can be carried out by culturing mesenchymal stem cells in a culture medium (90% αMEM medium, 10% fetal bovine serum (FBS), 2 mM L-glutamine, 0.1 μM dexamethasone). In addition, by adding differentiation-inducing agents such as retinoic acid to the culture medium, it is possible to differentiate stem cells into neural cells and other types of cells. Differentiation-inducing agents that can be used include BMP inhibitors, Wnt inhibitors, Nodal inhibitors, and retinoic acid. For the formation of megakaryocytes, which are necessary in the platelet differentiation induction process, factors such as thrombopoietin (TPO), interleukin-3 (IL-3), interleukin-6 (IL-6), and stem cell factor (SCF) can be used via germ cells induced in serum-containing medium (20% FCS).

[0069] The contents of "1. Stem cell proliferation promoter and 2. Method for producing stem cells" are entirely based on the contents of "1. Stem cell proliferation promoter and 2. Method for producing stem cells." In this case, "method of production of the present invention" shall be read as "method for producing differentiated cells of the present invention," "stem cells" cultured in the culture medium of the present invention shall be read as "stem cells, cells after differentiation induction, or cells in the process of differentiation," and "stem cells" produced shall be read as "differentiated cells."

[0070] Furthermore, the differentiated cells may be produced using a single, integrated system. For example, stem cells produced by the manufacturing method of the present invention can be cultured in suspension while attached to a scaffold material, and then cultured in suspension in a differentiation-inducing medium while maintaining the attached state, thereby allowing for continuous cell proliferation and differentiation on the scaffold material.

[0071] 4. Cellular Therapeutic Compositions The present invention also provides a cell therapy composition (hereinafter sometimes referred to as "the pharmaceutical composition of the present invention") containing stem cells or differentiated cells (hereinafter sometimes referred to as "cells of the present invention") produced by the method of production of the present invention or the method of production of differentiated cells of the present invention. The cells of the present invention may be dispersed cells, cell populations forming cell aggregates of a predetermined shape, or differentiated cell populations forming tissue structures or organelles (such as tissue construction using a bio-3D printer). Since the cell therapy composition can be used as a cell source for regenerative medicine, the pharmaceutical composition of the present invention can be used, for example, in cell transplantation therapy. Furthermore, the present invention also encompasses a method for treating or preventing a disease in which an effective amount of the cells of the present invention is administered or transplanted into a mammal (e.g., human, mouse, rat, monkey, cattle, horse, pig, dog, etc.) that is the target of treatment or prevention. The cells of the present invention may be those isolated from a scaffold material. Furthermore, if the scaffold material does not have a serious effect on the living body upon transplantation (for example, such as high-purity atelocollagen, which is degraded in the living body), the cells can be used in transplantation therapy while still attached to the scaffold material.

[0072] When using the cells of the present invention in cell transplantation therapy, it is desirable to use cells derived from iPS cells established from somatic cells whose HLA genotype is identical or substantially identical to that of the recipient individual, from the viewpoint of preventing rejection. Here, "substantially identical" means that the HLA genotype matches to the extent that the immune response to the transplanted cells can be suppressed by immunosuppressants. For example, somatic cells having an HLA type in which the three gene loci of HLA-A, HLA-B, and HLA-DR, or four gene loci including HLA-C, match. If the above cells are derived from a patient with a disease, it is preferable to repair the gene mutations causing the disease beforehand using methods such as genome editing (e.g., CRISPR system, TALEN, ZFN, etc.). If sufficient cells cannot be obtained due to age, constitution, etc., it is also possible to transplant them in a state where rejection is avoided by embedding them in capsules or porous containers made of polyethylene glycol or silicone.

[0073] The cells of the present invention are manufactured as parenteral preparations such as injections, suspensions, drip infusions, etc., by mixing with a pharmaceutically acceptable carrier according to conventional means. Therefore, in one aspect, a method for producing a cell-based pharmaceutical composition including a step of formulating the cells of the present invention is also provided. Such a production method may include (1) a step of preparing stem cells produced by the production method of the present invention or a step of producing stem cells by the production method of the present invention, and / or (2) a step of preparing differentiated cells produced by the production method of the differentiated cells of the present invention or a step of producing differentiated cells by the production method of the differentiated cells of the present invention. Furthermore, a step of storing stem cells or differentiated cells can be included.

[0074] Examples of pharmaceutically acceptable carriers that can be included in the parenteral preparation include aqueous liquids for injection such as physiological saline, isotonic solutions containing glucose and other adjuvants (e.g., D-sorbitol, D-mannitol, sodium chloride, etc.). The pharmaceutical composition of the present invention may be formulated with, for example, buffers (e.g., phosphate buffer, sodium acetate buffer), soothing agents (e.g., benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (e.g., human serum albumin, polyethylene glycol, etc.), preservatives, antioxidants, and the like. When formulating the pharmaceutical composition of the present invention as an aqueous suspension, for example, the cells may be suspended in the above aqueous liquid so as to be about 1×10 6 ~about 1×10 8 cells / mL. Also, the dosage or transplantation amount and the number of administrations or transplantations of the cells or pharmaceutical composition of the present invention can be appropriately determined according to the age, body weight, symptoms, etc. of the mammal to be administered.

[0075] The pharmaceutical composition of the present invention is provided in a state of cryopreservation under conditions normally used for cell cryopreservation, and can be thawed and used at the time of use. In this case, it may further contain serum or a substitute thereof, an organic solvent (e.g., DMSO), etc. In this case, the concentration of serum or a substitute thereof is not particularly limited but may be about 1 to about 30% (v / v), preferably about 5 to about 20% (v / v). The concentration of the organic solvent is not particularly limited but may be 0 to about 50% (v / v), preferably about 5 to about 20% (v / v).

[0076] The present invention will be described below with reference to examples. However, the present invention is not limited to these examples. [Examples]

[0077] (material and method) In the following examples, except where the method is described within the examples, the following materials were used or the experiments were conducted using the following methods.

[0078] <Reagents> StemFit AK03N was obtained from Ajinomoto Healthy Supply Co., Ltd. (Tokyo, Japan). iMatrix-511 was obtained from Matrixome Co., Ltd. (Osaka, Japan). CHIR 99021 (CT 99021) was obtained from Axon Medchem LLC (Reston, Virginia, USA). 10-mmol / L Y-27632 solution, D-PBS(-), and 0.5 mol / l-EDTA solution (pH 8.0) were obtained from Nacalai Tesque (Kyoto, Japan). RPMI 1640 medium, B-27 without insulin. TM TrypL TM Select Enzyme (1X), GlutaMAX TMSupplements, troponin T, Cardiac Isoform Ab-1 (Clone 13-11), PSC cardiomyocyte differentiation kit, and PSC neuronal cell induction culture were obtained from Thermo Fisher Scientific K.K. (Kanagawa, Japan). 100 x non-essential amino acids (NEAAs) were obtained from MP Biomedicals, LLC (Irvine, California, USA). Recombinant human activin A was obtained from BioLegend, Inc. (Santiago, California, USA). Recombinant human BMP-4 was obtained from PeproTech (Cranberry, New Jersey, USA). Kyoto Probe 1 (KP-1) was obtained from Goryo Chemical Co., Ltd. (Sapporo, Japan). Human GloLIVE TRA-1-60(R) NorthernLights TMThe antibody conjugated with NL557 was obtained from R&D Systems, Inc. (Minneapolis, Minnesota, USA). The peptide-GFOGER bioink was obtained from Sigma-Aldrich Co. LLC (St. Louis, Missouri, USA). The atelocollagen acidic solution (5 mg / mL, pH 3.0) and collagen (atelocollagen) microspheres were obtained from Takasaki Co., Ltd. (Tokyo, Japan). The low-concentration Synthemax® II microcarrier, 10 g vial, was obtained from Corning (Corning, New York, USA). The GLS250 gelatin solution (1.0 mg / g) was purchased from Nitta Gelatin Inc. (Osaka, Japan). Cytodex® 1 gamma and Cytodex® 3 gamma were obtained from GE Healthcare Bio-Sciences AB (Uppsala, Sweden). CultureSure® DMSO was obtained from FUJIFILM Wako Pure Chemical Corporation (Tokyo, Japan). The PES membrane was obtained from Terumo Blood and Cell Technologies (Lakewood, Colorado, USA). TC-I 15 was obtained from Tocris Bioscience (Bristol, England). The GP antagonist-2A, NF023, NF449, and SB 225002 were obtained from Calbiochem (San Diego, California, USA). Dihydromunduletone was obtained from MedChemExpress LLC (Monmouth Junction, New Jersey, USA). VU6015929, Melesstinib (LY2801653), and DDR1-IN-1 were obtained from Selleck Chemicals LLC (Houston, Texas, USA).

[0079] <Maintenance culture of hiPSCs> The hiPSC strains 201B7 and 15M66 were established by Shinya Yamanaka (Kyoto University iPS Cell Research Foundation) and obtained from the Kyoto University iPS Cell Research Foundation (Kyoto, Japan). The publicly available method (CiRA_Ff-iPSC_protocol_Eng_v140310) was used for iPSC culture (https: / / www.cira.kyoto-u.ac.jp / j / research / img / protocol / Ff-iPSC-culture_protocol_E_v140311.pdf). The ABLE 5 mL Disposable Bioreactor and ABLE Bioreactor Magnetic Stir System Base 5 mL were obtained from ABLE (Tokyo, Japan). The Quantum (Terumo BCT) operation procedure followed the manufacturer's instructions and the standard protocol. The bioreactor coating material was 100 mL of atelocollagen acidic solution (5 mg / mL, pH 3.0) (Koken Co., Ltd., Tokyo, Japan). HE staining was performed at Biopathology Laboratory Co., Ltd. (Oita, Japan).

[0080] <Cell Differentiation Assay> • Differentiation into cardiomyocytes To induce differentiation into cardiomyocytes, hiPSCs were cultured in StemFit AK03N medium in a 6-well plate according to the manufacturer's instructions (Thermo Fisher Scientific, Inc.), and then cultured on a carrier until confluence using a PSC cardiomyocyte differentiation kit. • Differentiation into endoderm of the embryo To induce differentiation into endoderm, hiPSCs were cultured in StemFit AK03N medium in 6-well plates until confluence. Differentiation into endoderm was performed according to a previously reported protocol (Si-Tayeb, K. et al., Hepatology 51, 297-305 (2010)). Differentiation into neural progenitor cells To induce differentiation into neural progenitor cells, hiPSCs were cultured in StemFit AK03N medium in a 6-well plate according to the manufacturer's instructions (Thermo Fisher Scientific), and cultured on a carrier using PSC Neural Cell Induction Medium until confluent.

[0081] <Cell Proliferation Assay> Cell proliferation was measured using a Countess (Thermo Fisher Scientific).

[0082] <Maintenance Culture of Human Mononuclear Cells> Purified and characterized normal human PBMCs (10M cells / vial) from Japanese donors were obtained from Fujifilm Wako Pure Chemical Corporation. To prepare the medium for human mononuclear cells, stem cell factor / c-Kit ligand (SCF; final concentration 50 ng / mL), thrombopoietin (TPO; final concentration 10 ng / mL), Flt3L (final concentration 20 ng / mL), IL-6 (final concentration 50 ng / mL), IL-3 (20 ng / mL), and G-CSF (10 ng / mL) were added to the mixed solution of Solution A and Solution B of StemFit AK03N (Ajinomoto Healthy Supply Co., Ltd., Tokyo, Japan). The following protocol is a method for culturing human peripheral blood mononuclear cells (PBMCs) and is a brief description of the procedure commonly performed in the inventors' laboratory. (1) Thaw a cryovial of normal human PBMCs in a 37 °C water bath for 1 minute. (2) Dissolve PBMCs in 5 mL of the mixed solution of Solution A and Solution B of StemFit AK03N and centrifuge the sample (5 minutes at 22 °C, 440 g). (3) After removing the supernatant, add 1 mL of the medium for human mononuclear cells, mix, and count the number of cells. In this example, a total of 3 x 10 6 cells / mL were added to the medium for human mononuclear cells. (4) Seed the cells in a 24-well plate at a volume of 1 mL / well. (5) Incubate the cells at 37 °C, 5% CO2 for 5 days.

[0083] <hiPSC Establishment Protocol> hiPSCs were established using TOKIWA-Bio SRV iPS-1 Vector, TOKIWA-Bio SRV iPS-2 Vector, TOKIWA-Bio SRV iPS-3 Vector, and TOKIWA-Bio SRV iPS-4 Vector, in accordance with the manufacturer's instructions (Tokiwa Bio Co., Ltd.). In short, 1 × 10⁻¹⁶ 5 The cells were dispensed into microcentrifuge tubes and centrifuged (300 g × 5 min). After removing the supernatant, 10 μL of the vector included in the kit was added. Then, another 10 μL of human mononuclear cell culture medium was added, and the solution was incubated at 37°C for 2 hours. The centrifugation was repeated (300 g × 5 min), followed by three washes with human mononuclear cell culture medium. Culture was then started using human mononuclear cell medium, and 2 / 3 volume of StemFit AK03N medium was added on days 1, 3, 5, and 7 of the culture. The medium was changed with StemFit AK03N medium on days 9, 11, and 13 after the start of culture. Cell passage and colony picking were performed from day 15 of the culture.

[0084] hiPSCs were established using CytoTune®-iPS 2.0 vector in accordance with the manufacturer's instructions (ID Pharma Co., Ltd., Tokyo, Japan). In short, 1 x 10⁻¹⁶ hiPSCs. 5 The cells were dispensed into microcentrifuge tubes and centrifuged (300 g × 5 min). Following the datasheet provided with the kit, the vectors included in the kit—7.14 μL of Tube KOS (orange cap), 6.66 μL of Tube KLF4 (red cap), and 10.00 μL of Tube C-MYC (white cap)—were added to 2 mL of human mononuclear cell medium. Then, a total of 1 × 10¹⁶ cells were added. 5 Cells were seeded onto a 6-well plate. Culture was started in human mononuclear cell medium supplemented with various vectors (MOI=5). Next, 2 / 3 volume of StemFit AK03N medium was added on days 1, 3, 5, and 7 of the culture. On days 9, 11, and 13 of the culture, the medium was replaced with StemFit AK03N medium. Cell passage and colony picking were performed from day 15 of the culture.

[0085] <Real-time polymerase chain reaction (PCR) and quantitative PCR (qPCR) arrays> RNA was prepared using the SuperPREP II Cell Lysis & RT Kit (Toyobo Co., Ltd., Osaka, Japan) for quantitative PCR, according to the manufacturer's instructions. Real-time PCR was performed using the StepOnePlus system (Life Technologies, Carlsbad, California, USA). Luna Universal qPCR Master Mix (New England Biolabs Inc., Ipswich, Massachusetts, USA) was used according to the manufacturer's instructions. For mRNA expression analysis, a TaqMan Array 96-Well FAST Plate (Human Stem Cell Pluripotency, Applied Biosystems) was used. TM Fast Advanced Master Mix (Thermo Fisher Scientific) was used according to the manufacturer's instructions. Gene expression was calculated using the ΔΔCt method. Target gene expression was corrected by the expression of housekeeping genes. Primers were designed for human β-actin, OCT3 / 4, NANOG, SOX2, brachiuri (T), NKX2.5, troponin T (cTnT), SOX17, FOXA2, HNF4A, PAX6, MAP2, SOX1, CDH1, CDH2, integrin α5, and integrin β1. Gene names were obtained from the U.S. National Library of Medicine (NIH) website (https: / / www.ncbi.nlm.nih.gov / pubmed / ). Human β-actin, OCT3 / 4, NANOG, SOX2, Brachyuris (T), NKX2.5, troponin T (cTnT), SOX17, FOXA2, HNF4A, PAX6, MAP2, SOX1, CDH1, CDH2, integrin α5, and integrin β1 were designed using the Primer 3 Plus application (http: / / www.bioinformatics.nl / cgi-bin / primer3plus / primer3plus.cgi). Other primers were purchased from Takara Bio Inc. (Shiga, Japan).

[0086] The primers used for PCR are as follows: <Undifferentiated ES cells> Human OCT3 / 4 (NM_002701.4) 144 bp (Forward) GACAGGGGGAGGGGAGGAGCTAGG (Sequence 1) (Reverse) CTTCCCTCCAACCAGTTGCCCCAAAC (Sequence No. 2) Human NANOG (NM_024865.2) 391 bp (Forward) CAGCCCCGATTCTTCCACCAGTCCC (Sequence No. 3) (Reverse) CGGAAGATTCCCAGTCGGGTTCACC (Sequence No. 4) Human SOX2 (NM_003106.2) 151 bp (Forward) GGGAAATGGGAGGGGTGCAAAAGAGG (Sequence No. 5) (Reverse) TTGCGTGAGTGTGGATGGGATTGGTG (Sequence No. 6)

[0087] <Mesoderm> Human-brown cucumber (T) (NM_001270484.1) 211 bp (Forward) GCTGAACTCCTTGCATAAGTATGAG (Sequence No. 7) (Reverse) CATCTCTTTGTGATCACTTCTTTCC (Sequence No. 8) Human NKX2.5 (NM_001166175.1) 221 bp (Forward) GAAATTTTAAGTCACCGTCTGTCTC (Sequence ID 9) (Reverse) AGTAATGGTAAGGGATCCTCGTG (Sequence No. 10) Human troponin T (cTnT) (NM_001001432.1) 238 bp (Forward) ATGAGCGGGAGAAGGAGCGGCAGAAC (Sequence No. 11) (Reverse) TCAATGGCCAGCACCTTCCTCCTCTC (Sequence No. 12)

[0088] <Endoderm> Human SOX17 (NM_022454.3) 608 bp (Forward) CGCTTTCATGGTGTGGGCTAAGGACG (Sequence No. 13) (Reverse) TAGTTGGGGTGGTCCTGCATGTGCTG (Sequence No. 14) Human FOXA2 (NM_153675.2) 216 bp (Forward) TGGGAGCGGTGAAGATGGAAGGGCAC (Sequence No. 15) (Reverse) TCATGCCAGCGCCCACGTACGACGAC (Sequence No. 16) Human HNF4A (NM_000457.4) 239 bp (Forward) GAACAGGAGCTCTTAACTACAGTGG (Sequence No. 17) (Reverse) CTGTCAAGAGTCATGAATTCTCCTT (Sequence ID 18)

[0089] <Ectoderm> Human PAX6 (NM_001604.4) 317 bp (Forward) ACCCATTATCCAGATGTGTTTGCCCGAG (Sequence No. 19) (Reverse) ATGGTGAAGCTGGGCATAGGCGGCAG (Sequence No. 20) Human MAP2 (NM_001039538.1) 212 bp (Forward) CAGGTGGCGGACGTGTGAAAATTGAGAGTG (Sequence No. 21) (Reverse) CACGCTGGATCTGCCTGGGGACTGTG (Sequence No. 22) Human SOX1 (NM_005986.3) 158 bp (Forward) ACTCTCTCTGAGGTTCTTTGACTGA (Sequence No. 23) (Reverse) AGCTTTTCATAGTCTGTGCCTCTAA (Sequence No. 24)

[0090] <Epithelial marker genes> Human cadherin 1 (CDH1) (NM_004360.4) 191 bp (Forward) GCCACATCTTGACTAGGTATTGTCT (Sequence ID 25) (Reverse) GCAGCACTTTAGGCACTATTCTAAG (Sequence ID 26) HA324529 (TJP1) (Forward) GCACGGGCATTGTTTAATGTC (Sequence No. 27) (Reverse) GGATTCAGTCCACAAAGGTGTTTAC (Sequence No. 28) HA380619 (MUC1) (Forward) GAACTACGGGCAGCTGGACA (Sequence No. 29) (Reverse) CTGCCACCATTACCTGCAGAA (Sequence No. 30) HA265338 (COL4A1) (Forward) CCAGGATTTATAGGCGAAATTGGA (Sequence No. 31) (Reverse) CATCTCTGCCAGGCAAACCTC (Sequence No. 32) HA346490 (SDC1) (Forward) GGATCAGAGATGCACCACCM (Sequence ID 33) (Reverse) CCAGCAGATGAGCATGGTCAG (Sequence No. 34)

[0091] <Mesenchymal marker genes> Human cadherin 2 (CDH2) (NM_001792.4) 219 bp (Forward) AGTGTTCCCAAGACAATTCAGTAAG (Sequence No. 35) (Reverse) GGGTTGATAATGAAGATACCAGTTG (Sequence No. 36) HA283325 (VIM) (Forward) AACCTGGCCGAGGACATCA (Sequence ID 37) (Reverse) TCAAGGTCAAGACGTGCCAGA (Sequence No. 38) HA333211 (FN1) (Forward) GGCCAGATGATGAGCTGCAC (Sequence No. 39) (Reverse) GGAGCAAATGGCACCGAGATA (Sequence No. 40) Human integrin α5 (NM_002205.4) 229 bp (Forward) CTGCTACCTCTCCACAGATAACTTC (Sequence ID 41) (Reverse) GATCAGGTACTCGGGGTAATAAGAT (Sequence No. 42) Human integrin β1 (NM_002211.3) 179 bp (Forward) CTGAAGACTATCCCATTGACCTCTA (SEQ ID NO: 43) (Reverse) GCTAATGTAAGGCATCACAGTCTTT (SEQ ID NO: 44) HA328103 (SNAI1) (Forward) CCAGTGCCTCGACCACTATG (SEQ ID NO: 45) (Reverse) TTAGAGTCCTGCAGCTCGCTGTA (SEQ ID NO: 46)

[0092] <Rho family protein signaling factor> HA311735 (CDC42) (Forward) TTGACTTCTGGGTCTTAAACTGCTG (SEQ ID NO: 47) (Reverse) CCATGGTGGGTCTGGAACTC (SEQ ID NO: 48) HA339862 (WASL) (Forward) GGAGTTCAGTCCAGGCATGAAG (SEQ ID NO: 49) (Reverse) TGCTCACAGTGCAGGATGGTAG (SEQ ID NO: 50) HA356749 (RAC1) (Forward) CCTGTAGTCGCTTTGCCTATTGA (SEQ ID NO: 51) (Reverse) AGGGTCCCACGCTGTATTCTC (SEQ ID NO: 52) HA342384 (CYFIP1) (Forward) TCCTGACGGACCACATCCTG (SEQ ID NO: 53) (Reverse) TCGGCCTCAATTTCGTCGTA (SEQ ID NO: 54) HA349400 (DIAPH1) (Forward) CCAGCTTCTGCCACGCTTTA (SEQ ID NO: 55) (Reverse) CCCATAGTCCAGATGAGATGCAC (SEQ ID NO: 56) HA390884 (RHOA) (Forward) CAGCTGCMGGTACTCTGGTGA (Sequence ID 57) (Reverse) CTCTGCCACAGCTGCATGAA (Sequence No. 58) HA355736 (ROCK1) (Forward) TGCAACTGGAACTCAACCAAGAA (Sequence ID 59) (Reverse) GCTGGCCAACTGCATCTGAA (Sequence ID 60) HA359025 (ROCK2) (Forward) GCAAGTCACTGCCGAGCTTC (Sequence ID 61) (Reverse) GCTGTCACACAGTGCTTATGTTCA (Sequence No. 62) HA271276 (ROCK1P1) (Forward) ACAAATATCACAGGCTTCAGGGTTA (Sequence No. 63) (Reverse) TGTAGGCAAACCCGCGATA (Sequence No. 64) HA102338 (DIAPH3) (Forward) CTCAGAGGCCTGTTCTGAAAGTTTG (Sequence ID 65) (Reverse) GGCGACTGGAGTCCTTGTTGA (Sequence No. 66) HA368551 (PFN1) (Forward) CCATCGTGGGCTACAAGGA (Sequence ID 67) (Reverse) CAAGTGTCAGCCCATTCACGTAA (Sequence No. 68) HA260170 (PFN2) (Forward) GTGTCCACGGAGGCACACTTA (Sequence No. 69) (Reverse) GGGTTGTTGATGAAGACAGTTGCTA (Sequence No. 70) HA118642 (PFN4) (Forward) TGTGTGTAGCATCACCAGGTTTCA (Sequence ID 71) (Reverse) GGCAAA TCCATTCACCAGTGTTC (Sequence ID 72) HA347617 (PFN5P) (Forward) ACCATGTACCTGCGCACCAA (Sequence ID 73) (Reverse) CTGTCCAATCACCACAAGCCTTA (Sequence No. 74)

[0093] <Adhesion GPCR genes> HA339122 (GPRC5A) (Forward) AATTGGAGGTGGCAGCTTCAG (Sequence No. 75) (Reverse) GGGCCACAGMTTTCCMAGA (Sequence No. 76) HA372963 (ADGRG1) (Forward) AGCTGCCTGGTGTCTGCTGTA (Sequence ID 77) (Reverse) AGCAAGGGCAATGCAGCTC (Sequence ID 78) HA251255 (ADGRG2) (Forward) ATGAGGTACATACACTGCCGCTTC (Sequence ID 79) (Reverse) TGGGCCAGAGTGTACCAGTCATA (Sequence No. 80) HA362862 (ADGRL2) (Forward) ATAAATGAGCCGGGCAGCTT (Sequence ID 81) (Reverse) CCATCAGTCTGCATCATTGATCTT (Sequence No. 82) HA352953 (ADGRG6) (Forward) TGGCTCCAGCAGATGATGAGA (Sequence No. 83) (Reverse) CGTGAAAGCCAAGCTGGGTAA (Sequence No. 84) HA161540 (ADGRF4) (Forward) GAGATGCTTTGAGGATGAGGATGTC (Sequence No. 85) (Reverse) TCCATTGGTTGGGCCTAGTGA (Sequence No. 86)

[0094] <Housekeeping gene> Human β-actin (NM_001101.5) 223 bp (Forward) TGACATTAAGGAGAAGCTGTGCTAC (Sequence ID 87) (Reverse) CTTCATGATGGAGTTGAAGGTAGTT (Sequence No. 88)

[0095] <Staining analysis> Live staining was performed using KP-1 (Goryo Chemical Co., Ltd., Hokkaido, Japan), AntiTRA-1-60, Mouse-Mono (TRA-1-60), NL557, and GloLIVE (R&D Systems, Inc., Minneapolis, Minnesota, USA). Images were recorded using a BZ-X800 fluorescence microscope (Keyence Corporation, Osaka, Japan).

[0096] <Statistical analysis> Statistical analysis was performed using Student's t-test to compare the means of two samples. Comparisons between multiple groups (three or more groups) were performed using one-way ANOVA with the StatPlus software program (AnalystSoft, Walnut, California, USA). Statistical significance was set at *P < 0.05 or **P < 0.01 for all tests.

[0097] [Example 1: Establishment of iPS cells] The efficiency of human iPS cell establishment was compared and evaluated using atelocollagen microcarriers and collagen microcarriers.

[0098] (method) Human mononuclear cells used for establishing human iPS cells were purchased from PRECISION (Human PBMC 93219, Lot 2010114001). The culture method for human mononuclear cells was carried out according to the "Protocol for Establishing Research iPS Cells ver. 1.1" (available from the Kyoto University iPS Cell Research Foundation website: https: / / www.cira-foundation.or.jp / j / research / img / protocol / 20210507new_protocol_ver1_1.pdf). Furthermore, the protocol for establishing iPS cells using Sendai virus vectors was "SRV TM iPS cell induction protocol from human peripheral blood mononuclear cells and monocytes using iPSC-2 Vector (TKB_P-003-02)" (available from Tokiwa Bio's website: https: / / tokiwa-bio.com / jp / wp / wp-content / uploads / 2020 / 12 / 3_%E3%83%92%E3%83%88%E6%9C%AB%E6%A2%A2%E8%A1%80%E5%8D%98%E6%A0%B8%E7%90%83%E3%83%BB%E5%8D% This was carried out in accordance with 98%E7%90%83%E3%81%8B%E3%82%89%E3%81%AEiPS%E7%B4%B0%E8%83%9E%E8%AA%98%E5%B0%8E%E3%83%95%E3%82%9A%E3%83%AD%E3%83%88%E3%82%B3%E3%83%AB_02.pdf). Specifically, the following steps were taken. (1) Add IL-6 (50 ng / mL), SCF (50 ng / mL), TPO (10 ng / mL), Flt3L (20 ng / mL), IL-3 (20 ng / mL), and G-CSF (10 ng / mL) to a mixture of StemFit AK03 (Ajinomoto) medium A and B to prepare a medium for granulocytes. (2) Human mononuclear cells are 1.5 × 10⁻⁶ 6 Seeds are seeded at a concentration of cell / mL into one well of a 24-well plate (Sumitomo Bakelite MS-80240) and cultured using granulocytic cell culture medium. (3) Collect the cells on the third day after sowing, and measure the cells in 1.0 × 10⁶ units. 5 Dispense into cell / tube (1.5 mL tube) and centrifuge (300 g x 5 min x 4°C). (4) Add 10 μL of SRV iPSC-2 vector (Tokiwa Bio S1011694A, Lot T002) to the cell pellet obtained after centrifugation. (5) Add 10 μL of granulocytic cell culture medium. (6) Leave to stand in a CO2 incubator (37°C) for 2 hours. (7) Wash with granulocytic cell culture medium and centrifuge (repeat 3 times). (8) Culture in a medium for granulocytes. At this time, add the microcarriers shown in the experimental conditions below. (9) On days 1, 3, 5, and 7 after culturing in granulocyte-based cell medium, add a mixture of solutions A, B, and C of StemFit AK03 (Ajinomoto) medium (2 / 3 volume). (10) After culturing in granulocyte-based cell medium, the culture medium is changed on days 9, 11, and 13 with a mixture of StemFit AK03 (Ajinomoto) medium solutions A, B, and C.

[0099] The experimental conditions for microcarriers are as follows: Experimental conditions [1] Collagen microcarrier: Add 300 μg (equivalent to 100,000 beads) of Cytodex-3 (GE Healthcare) (dextran beads coated with denatured porcine skin-derived collagen) to 6 wells. Experimental conditions [2] Atelocollagen microcarriers: Atelocollagen-beads (MIC-00) (microcarriers for cell culture) (purity 95.5% or higher) were added to 6 wells at a concentration of 300 μg (equivalent to 100,000 beads) / well (approximately 1%).

[0100] (result) The results are shown in Table 1. Under experimental condition [1], the number of iPS cell colonies observed within 5 fields of view in a well 10 days after Sendai virus vector infection was 0,0,0,0,0 (average 0 cells / field of view). Under experimental condition [2], the number of iPS cell colonies observed within 5 fields of view in a well 10 days after Sendai virus vector infection was 1,1,3,1,1 (average 1.4 cells / field of view). In addition, under experimental condition [2], the colonies were confirmed to be living iPS cell colonies by observing the emergence of pseudopods using a light microscope (×400) 15 days after Sendai virus vector infection (Figure 1). The cells were passaged once, and the cell count performed on day 12 is described below. When the surface of the cell culture microcarrier was collagen, the total number of cells was 1.76 × 10 4 cells / ml, number of living cells: 0.00×10 0 The cell count was 0% (viable cell rate), indicating no viable cells were observed. When the surface was atelocollagen, the total cell count was 6.39 × 10⁶. 5 cells / ml, number of viable cells: 4.22×10 5 The cell density was 66% (66% viable cells), indicating the presence of viable cells. To confirm that these cells were iPS cells, mRNA was obtained from 1 / 10th the amount of cell suspension used for passage, and real-time PCR was performed to analyze the mRNA expression of iPS cell markers. The results confirmed the expression of iPS cell markers: OCT3 / 4 (CT value: 20.94), NANOG (CT value: 20.93), SOX2 (CT value: 21.56), and β-actin (CT value: 17.37). Furthermore, since strong cell reprogramming may be induced immediately after iPS cell establishment due to residual vectors, six passages were performed after establishment, and the cells from the sixth passage were immunofluoresced with the iPS cell marker Tra-1-60 (Human GloLIVE TRA-1-60(R) NorthernLights). TM (NL557-conjugated Antibody). As a result, the cells established on atelocollagen were identified as Tra-1-60 positive cells and were determined to be iPS cells.

[0101] [Table 1]

[0102] From these results, it became clear that iPS cells cannot be established in a three-dimensional environment when the surface of the cell culture microcarrier is collagen, but they can be established in a three-dimensional environment when the surface is atelocollagen.

[0103] [Example 2: Proliferation of human iPS cells] We tested the proliferation of established iPS cells using atelocollagen microcarriers. On the other hand, we were unable to establish iPS cells using the collagen microcarrier Cytodex-3 (GE Healthcare), so proliferation tests were not performed. Meanwhile, we conducted culture experiments using established human iPS cells with the collagen microcarrier Cytodex-3 (GE Healthcare), but the cells did not proliferate. (Human iPS cells and culture methods) Human iPS cells were cultured according to the "Protocol: Establishment and Maintenance Culture of Human iPS Cells in a Feeder-Free Environment (Kyoto University Center for iPS Cell Research and Application)" (https: / / www.cira.kyoto-u.ac.jp / j / rESearch / img / protocol / hiPSprotocolFf_140311.pdf).

[0104] Experimental conditions [3]: 5 mL of StemFit AK03 (Ajinomoto) containing Y-27632 (Fujifilm Wako) at a concentration of 10 μM was added to each well of a 6-well plate (FALCON 353046) in 1.0 × 10 5 Human iPS cell line (15M66) at a concentration of cells / mL / well was mixed with 300 μg (equivalent to 100,000 beads) of Atelocollagen-beads (MIC-00) (microcarrier for cell culture) per well. The culture medium was not changed until day 6 after seeding. On day 6 after seeding, the cells were detached with trypsin-EDTA and counted.

[0105] (result) The results are shown in Table 2. The cell proliferation capacity in 3D culture using atelocollagen as a scaffold material for cell culture microcarriers is determined by the cell seeding volume (1.0 × 10⁻⁶). 5 For cells, the average number of cells on day 6 of culture was 2.4 × 10⁶. 6 These were cells. This result indicates that atelocollagen microcarriers are a suitable scaffold material for three-dimensional culture. In mouse iPS cells, it has been reported that when cultured using Cytodex-3, iPS cells only proliferated fourfold in 7 days (Cytotechnology, 2016. 68. 45-59) (and it also appears that proliferation occurs in the gaps between beads rather than on the bead surface), so the effect of atelocollagen microcarriers was more significant than that of conventional techniques.

[0106] [Table 2]

[0107] [Example 3: Effects of concentration and mixing ratio of gelatin, collagen, laminin, and atelocollagen coating on human iPS cell culture (evaluation of cell proliferation)] (method) Human iPS cells were cultured using cell 201B7 according to the following method (Kyoto University Center for iPS Cell Research and Application protocol: https: / / www.cira.kyoto-u.ac.jp / j / research / img / protocol / hipsprotocolFf_140311.pdf). The following three types of coating materials were used. (1) Gelatin (GLS250, Nitta Gelatin, 0.1% gelatin solution) (2) Native collagen (AteloCell® IAC-50, Koken, 5 mg / mL (=0.5%) native collagen acidic solution) (3) Atelocollagen (AteloCell® IPC-50, Koken, 5 mg / mL (=0.5%) atelocollagen acidic solution) A total of 200 μL of coating material was applied to a 6-well plate (Sumitomo Bakelite: MS-80060) using a cell scraper, and then coated. The plate was incubated in a 37°C, 5% CO2 incubator for 24 hours. After coating, the wells were washed twice with 2 mL of PBS for 5 minutes each before being used for culture. 5 × 10 4 Human induced pluripotent stem cells (201B7) at a concentration of cells / mL / well were seeded into 3 wells of a 6-well plate with 1.5 mL of StemFit medium (AK03, Ajinomoto) containing 10 μM Y-27632 (CultureSure® Y-27632, Fujifilm Wako Pure Chemical Industries) (n=3). After seeding, the medium without Y-27632 was replaced on days 1 and 3. On day 5 after seeding, the cells were detached with trypsin-EDTA and the number of viable cells was counted.

[0108] (Coat conditions: volume %) (1) Gelatin 100.0% + Atelocollagen 0.0% (2) Gelatin 97.4% + Atelocollagen 2.6% (3) Gelatin 95.0% + Atelocollagen 5.0% (4) Gelatin 90.0% + Atelocollagen 10.0% (5) Gelatin 70.0% + Atelocollagen 30.0% (6) Gelatin 50.0% + Atelocollagen 50.0% (7) Gelatin 30.0% + Atelocollagen 70.0% (8) Gelatin 10.0% + Atelocollagen 90.0% (9) Gelatin 5.0% + Atelocollagen 95.0% (10) Gelatin 0.0% + Atelocollagen 100.0% (11) Native Collagen 100.0% + Atelocollagen 0.0% (12) Native collagen 97.4% + Atelocollagen 2.6% (13) Native collagen 95.0% + Atelocollagen 5.0% (14) Native collagen 90.0% + Atelocollagen 10.0% (15) Native collagen 70.0% + Atelocollagen 30.0% (16) Native Collagen 50.0% + Atelocollagen 50.0% (17) Native Collagen 30.0% + Atelocollagen 70.0% (18) Native Collagen 10.0% + Atelocollagen 90.0% (19) Native Collagen 5.0% + Atelocollagen 95.0% (20) Native Collagen 0.0% + Atelocollagen 100.0%

[0109] (result) The mass (mg) of each coating material contained in 100 mL of coating solution and the number of viable cells on day 5 after the start of cell culture [×10 4 The mean ± standard deviation is shown in the table below.

[0110] [Table 3-1]

[0111] [Table 3-2]

[0112] These results showed that cell proliferation was best with 100% atelocollagen. When combined with gelatin and the atelocollagen content was less than 98%, the number of viable cells was equal to or decreased to the number of seeded cells. It was revealed that the presence of atelocollagen on the surface of the scaffold material provides an excellent cell proliferation-promoting effect on iPSCs, but this effect is impaired when other coating materials are present. Specifically, it was suggested that the aforementioned effect is largely maintained if the proportion of other coating materials is less than 2%.

[0113] [Example 4: Culturing hiPSCs using atelocollagen beads] Currently, 2D culture, in which the culture substrate is coated with scaffold material from establishment to subsequent culture, is the mainstream method for producing clinical-grade iPS cells. However, there are challenges in industrial production of clinical-grade iPS cells aimed at mechanization and mass production. We investigated whether it is possible to establish and expand iPS cells using microcarriers that take advantage of the characteristics of both 2D and 3D culture.

[0114] iMatrix-511 (a recombinant peptide of the cell adhesion active site of laminin 511) is the most versatile culture scaffold material used for culturing clinical human iPS cells (hiPSCs). In this study, iMatrix-511 was coated onto the cell culture microcarriers Cytodex 1 (with protein-adsorbing surface treatment) and Cytodex 3 (collagen-coated) (27.6 μl / 10 ml PBS). Human mononuclear cell line 15M66 (a research strain for clinical hiPSCs) was used, with a cell concentration of 1 × 10⁶. 5Cell counts were obtained on days 1, 2, 3, 4, 5, and 6 after seeding in a cells / well (6-well plate). The results showed that the number of hiPSCs grown on the two types of iMatrix-511 coated beads was significantly lower than on the control plate (iMatrix-511 coated plate), indicating almost no cell proliferation (Figure 3A). The iMatrix-511 coating method was repeatedly tested through trial and error. The usefulness of various materials other than iMatrix-511 as scaffolding materials was also evaluated. However, it was not possible to culture hiPSCs while they remained attached to the beads. Therefore, a new biomaterial to which hiPSCs can adhere was sought. As a result, we found that atelocollagen extracted by acid treatment from collagen, the raw material for gelatin used in feeder culture methods (Ludwig, TE et al., Nat Methods 3, 637-646 (2006); Takahashi, K. et al., Cell 131, 861-872 (2007)), induced extremely long elongation of filopopods of hiPSCs (Figure 11A, upper and lower panels). The long filopopods were strong enough to fix the atelocollagen and hiPSCs together like tent ropes.

[0115] Plates coated with iMatrix-511 (9.2 μl / 1.5 ml PBS / well [6-well plate]) and atelocollagen beads (500 μl / well [6-well plate]) were prepared. Cell concentration 1 × 10⁻⁶ 5 15M66 cell line was seeded in cells / well (6-well plate). Six days after seeding, the cells were detached and counted (Figure 3B, left panel) (Figure 3B, right panel shows light microscope images from day 1 and day 6). Cells cultured on iMatrix-511 coated plates and cells cultured on atelocollagen beads were similar in total cell number, viable cell number, and dead cell number. The cells adhered to the iMatrix-511 coated plates and atelocollagen beads from the day after seeding and subsequently proliferated.

[0116] Next, we performed rotational culture (60 rpm) using a bioreactor, the most versatile three-dimensional culture method (Figure 3D). A total of 1 × 10⁶ cells of the 15M66 strain were cultured in Synthemax II (Corning; 500 μl / reactor; Single-use bio-reactor [IABLE]) and atelocollagen beads (500 μl / reactor). 5 Figure 3C shows an optical microscope image of cells four days after seeding. Under swirling culture conditions (60 rpm) using a bioreactor, cells adhered to both Synthemax II and atelocollagen beads. The number of cells is shown in Figure 3F. The number of live and dead cells was similar between cells cultured with both Synthemax II and atelocollagen beads. Furthermore, mRNA expression analysis of cells cultured in swirling culture (60 rpm) using a bioreactor confirmed that the expression of the undifferentiated markers OCT3 / 4 and SOX2 was similar in both Synthemax II and atelocollagen beads. NANOG expression in cells cultured with atelocollagen beads was significantly lower than in cells cultured with Synthemax II (Figure 3E). Atelocollagen beads with a concentration of approximately 3 million beads / 15 ml were mixed with beads with a diameter of 100-400 μm. Next, we investigated whether the size of the beads affected hiPSC cell adhesion and proliferation. Four types of beads with diameters of 105 μm or less, 105-250 μm, 250-425 μm, and 425-600 μm were prepared, and cell adhesion of strain 15M66 is shown in light microscope images (Figure 4A).

[0117] In this example, the 105 μm diameter beads were thought to constantly exert compressive force on the cell aggregate due to the small space between the beads. Cell adhesion was observed with four different bead diameters for strains 15M66 and 201B7: ≤105 μm, 105–250 μm, 250–425 μm, and 425–600 μm, with all bead sizes being used. Cells were seeded in wells containing atelocollagen beads (500 μl / well [6-well plate]). Light microscope images taken 5 days after cell seeding are shown (15M66 strain: left panel of Figure 4B, 201B7 strain: left panel of Figure 4C). Total cells, live cells, and dead cells were counted (15M66 strain: right panel of Figure 4B, 201B7 strain: right panel of Figure 4C). Both strains 15M66 and 201B7 proliferated more on larger diameter atelocollagen beads than on smaller beads. In strain 201B7, the total number of cells and viable cells cultured on 600 μm diameter atelocollagen beads was significantly higher than the total number of cells cultured on 105 μm diameter atelocollagen beads. This result may have been influenced by the amount of space between beads, the curvature angle of the bead surface, or the amount of culture medium flowing between the beads.

[0118] [Example 5: Verification of the undifferentiated potential of hiPSCs cultured on atelocollagen] 5 x 10 415M66 cells were seeded at a concentration of cells / well (12-well plate) and cultured on iMatrix-511 coated plates (9.2 μl / well), atelocollagen coated plates (plates coated with atelocollagen of 95.5% purity or higher; the same applies hereafter) (200 μl / well), and gelatin coated plates. Cells adhered to the iMatrix-511 and atelocollagen coated plates but not to the gelatin coated plates (Figure 5A). Cells on iMatrix-511 and atelocollagen coated plates showed filopodia, and filopodia were observed significantly more abundantly on the atelocollagen coated plate (Figure 5A bottom center) than on the iMatrix-511 coated plate (Figure 5A bottom left). Cell counts were performed on day 4 after seeding. Strong filopodia expression was observed on atelocollagen in 15M66 cells (Figure 5A). The number of hiPSC cells cultured on iMatrix-511 coated plates was used as a control. The results showed that the total number of cells and the number of viable cells cultured on atelocollagen and gelatin coated plates were significantly lower than those on the control plates. However, the levels of cell adhesion and proliferation of cells cultured on atelocollagen-coated plates were only about half that of cells cultured on iMatrix-511-coated plates (Figure 5B). This result indicates that iMatrix-511 is more active than atelocollagen in signaling pathways that promote cell proliferation.

[0119] 201B7 cells in 5 × 10 4When seeded at a concentration of cells / well, cells adhered well to plates coated with iMatrix-511 and plates coated with atelocollagen, but hardly adhered to plates coated with gelatin (Figure 6A). Cells that adhered to the atelocollagen-coated plates did not exhibit filopodia (Figure 6A, bottom middle). These results indicate that filopodia formation in response to atelocollagen differs depending on the characteristics of the cells. Cell counts of cells cultured on iMatrix-511-coated plates were performed on day 4 after seeding to serve as a control. As a result, the total number of cells and viable cells cultured on atelocollagen-coated plates were similar to those cultured on iMatrix-511-coated plates, but the total number of cells and viable cells cultured on gelatin-coated plates were lower than those cultured on iMatrix-511 (Figure 6B). It is thought that strain 201B7 suppresses filopodia expression without inducing cell death on atelocollagen (Figure 6B).

[0120] 15M66 cells were placed in 5 × 10⁶ iMatrix-511 coated plates (9.2 μl / well) and atelocollagen coated plates (1 ml (1 mg / ml) / well). 4Cells were seeded at a cell / well concentration, and after sampling on day 5, mRNA was extracted for mRNA expression analysis. mRNA expression levels were measured using the TaqMan Human Stem Cell Pluripotency Array (Applied Biosystems, Waltham, Massachusetts, USA) (Avilion, AA et al., Genes Dev 17, 126-140 (2003); Chambers, I. et al., Cell 113, 643-655 (2003); International Stem Cell et al., Nat Biotechnol 25, 803-816 (2007); Matin, MM et al., Stem Cells 22, 659-668 (2004); Mitsui, K. et al., Cell 113, 631-642 (2003)). The types of mRNA were selected from mRNA expression profiles of "expression in undifferentiated cells," "maintenance of a list classified by pluripotency," "correlation to stem cell chromosome," "differentiation markers," and "control." First, to analyze the undifferentiated state, "correlation with stem cells (Figure 5C)," "expression in undifferentiated cells (Figure 5D)," and "maintenance of pluripotency (Figure 5E)" were analyzed. mRNA expression was color-coded using cells cultured on plates coated with iMatrix-511 as a control. As a result, cells cultured on atelocollagen-coated plates showed higher expression of OCT3 / 4 (POU5F1) compared to the control (Figures 5D, 5E), indicating an overall undifferentiated state.

[0121] [Example 6: Verification of differentiation induction, epithelial-mesenchymal transition (EMT), and mesenchymal-epithelial transition (MET) in hiPSCs cultured on atelocollagen] To analyze the differentiation induction status, a heatmap was created from a list of "differentiation markers" (Figure 7A). mRNA expression levels were color-coded using cells cultured on plates coated with iMatrix-511 as a control. Cells cultured on atelocollagen-coated plates showed increased expression of the endodermal markers AFP, SOX17, and Collagen Type I Alpha 1 Chain (COL1A1). In addition, the expression of HBB (Joehanes, R. et al., Physiol Genomics 44, 59-75 (2012)), which is known to be expressed not only in hematopoietic stem cells but also in peripheral blood mononuclear cells (PBMCs) and whose expression has been reported to increase in human blood-derived iPSCs, also increased, as did the expression of the ectoderm marker KRT1 (Figure 7A).

[0122] 15M66 cells, 5 × 10 4 Cells were seeded at a concentration of cells / well on iMatrix-511 coated plates (9.2 μl / well) and atelocollagen coated plates (250 μl / well) and cultured. On day 4, samples were taken, mRNA was extracted, and mRNA expression was analyzed. When examining the mRNA expression of MET markers, only E-cadherin expression was significantly increased in cells cultured on atelocollagen compared to cells cultured on iMatrix-511. COL4A1 expression was significantly decreased, and no significant differences were observed for other factors (Figure 7B). These results did not suggest that MET is induced in cells cultured on atelocollagen. Similar mRNA expression patterns for MET-related factors were observed in experiments using 201B7 cells (Figure 6C). mRNA expression of EMT markers such as vimentin, fibronectin, α5 integrin, and β1 integrin was significantly decreased (Figure 7C). These results suggest that EMT is not only not induced in cells cultured on atelocollagen, but that EMT is less likely to be induced under such culture conditions.

[0123] It is known that hiPSCs cannot maintain an undifferentiated state due to environmental degradation of culture conditions, and when they dedifferentiate, EMT-inducing cells that highly express vimentin tend to appear around the colony. Therefore, it is presumed that culture materials that are less prone to EMT are superior in their ability to maintain undifferentiated cells. However, in the 201B7 strain, only N-cadherin significantly increased in cells cultured on atelocollagen, while the expression of fibronectin, β1 integrin, and Snail significantly decreased (Figure 6D). These results also suggest that EMT was not induced in cells cultured on atelocollagen.

[0124] Recently, Kyoto Probe 1 (KP-1) (Noguchi, H. et al., Mol Ther Methods Clin Dev 13, 243-252 (2019)), a fluorescence immunostaining method for staining iPSC-like cells or tissue-specific progenitor cells that can be produced using iPSC production methods, was reported (Miyagi-Shiohira et al., Sci Rep 10, 18084 (2020)). 15M66 cells were placed in 5×10⁶ plates coated with iMatrix-511 (9.2 μl / well) or atelocollagen (250 μl / well). 4 Cells were seeded at a concentration of cells / well (12-well plate). Cells were fixed on day 4 after seeding. Cells on plates coated with iMatrix-511 and plates coated with atelocollagen showed both KP-1 positivity (the most representative staining marker for iPSCs) (Figure 7D, top panel) and Tra-1-60 positivity (the most representative specific antibody for iPSCs) (Figure 7D, bottom panel). These results indicate that cells cultured on atelocollagen are iPSCs.

[0125] [Example 7: Establishment of hiPSCs on atelocollagen beads] SRV TMiPSC-1, 2, 3, and 4 (Tokiwa Bio Co., Ltd., Tsukuba, Japan) and CytoTune 2.0 (ID Pharma, Tokyo, Japan) are commercially available cell reprogramming Sendai virus vectors intended for use in establishing clinical iPSCs. However, these cell reprogramming Sendai virus vectors were developed for cells growing on cell culture plates and are optimized for establishing hiPSCs under 2D conditions. The spherical surface of atelocollagen beads provides a 3D environment, and we investigated whether hiPSCs could be established in a 3D environment using the above-mentioned Sendai virus vectors.

[0126] Mononuclear cells (1 × 10⁶) isolated from human blood 5 (individual) vector (SRV TM iPSC-2 cells were infected at an infection factor (MOI) of 3, and the cells were seeded into 6 wells containing either atelocollagen beads (spherical atelocollagen with a purity of 95.5% or higher; the same applies below) (500 μl / well) or Cytodex 3 (500 μl / well). On day 15 of culture, the established hiPSC colonies were observed under a light microscope. The results showed that the hiPSCs extended filopodia and attached to the atelocollagen beads (white arrows) (Figure 8A, left). On the other hand, no colonies were formed on the surface of the Cytodex 3 beads, and only cell aggregates were observed to be released from the microcarriers (white arrows) (Figure 8A, right). These results suggest the possibility of establishing hiPSCs on atelocollagen beads.

[0127] Next, we compared the efficiency of hiPSC establishment on a standard iMatrix-511 coated plate and on atelocollagen beads using five different hiPSC establishment vectors. TM Five types of vectors, iPSC-1, 2, 3, 4, and CytoTune 2.0, were used and compared on atelocollagen. The efficiency of hiPSC establishment was recorded by counting the number of colonies observed in the wells using light microscopy and fluorescence microscopy 14 days after Sendai virus infection. As a result, four out of the five vectors (SRV) showed the same efficiency. TMExcluding iPSC-2, no significant difference in hiPSC establishment efficiency was observed between plates coated with iMatrix-511 and atelocollagen beads (Figure 8B). The improvement in hiPSC establishment efficiency on iMatrix-511 coated plates was the reason for the significant difference in relative efficiency of hiPSC establishment on atelocollagen beads. As a result, we concluded that there is no significant difference in the establishment efficiency of hiPSCs on plates coated with iMatrix-511 and hiPSCs on atelocollagen beads.

[0128] hiPSCs established on atelocollagen beads were detached with trypsin according to a standard hiPSC culture protocol and then transferred to plates containing fresh atelocollagen beads (500 μl / well). To evaluate pluripotency after eight passages, mRNA was extracted from cardiomyocytes (Figure 8C), endodermal cells (Figure 8D), and neural progenitor cells (Figure 8E) 11 days after differentiation induction, and their differentiation potential into the three germ layers was assessed. Furthermore, using the 201B7 strain, cardiomyocyte maturation on atelocollagen beads was examined 8 days after cardiomyocyte differentiation induction (Figure 9). iMatrix-511 coated plates (Figure 9, left panel) and atelocollagen coated plates (Figure 9, center panel) were used as controls. As a result, the 201B7 strain was induced to differentiate into mature cardiomyocytes expressing troponin T on atelocollagen beads (Figure 9, right panel).

[0129] In conventional methods of producing clinical cells such as cardiomyocytes using microcarriers, the detachment of therapeutic cells from the microcarriers has been a major problem. Depending on the type of therapeutic cell (e.g., pancreatic islets), trypsin treatment is undesirable because it can disrupt cell-to-cell adhesion. Therefore, to secure differentiated cells as tissue, dissolution of atelocollagen beads using collagenase is suitable. After adding collagenase (1 g / 10 ml high-concentration solution, 50 μl per well [6-well plate]) for 30 minutes, the atelocollagen beads completely disappeared without damaging cell-to-cell adhesion at temperatures ranging from room temperature to 37°C (Figure 10).

[0130] [Example 8: Mechanism of cell adhesion of hiPSCs to atelocollagen by extension of filopodia] Observation of hiPSC cell adhesion to atelocollagen using a light microscope reveals that hiPSCs extend extremely long filopodia (white arrows) (Figure 11A). The behavior of proteins related to signaling of Rho family proteins strongly involved in filopodia formation was investigated (Bar-Sagi, D., and Hall, A. Cell 103, 227-238 (2000); Heasman, SJ, and Ridley, AJ Nat Rev Mol Cell Biol 9, 690-701. (2008)) (Figure 12A). The central factors in the formation of filopodia in cells are CDC42 and WASL; CDC42 is an important factor in inducing cytoskeletal rearrangement, and WASL is the coding gene for the Wiskott-Aldrich syndrome protein (WASP). WASP acts downstream of CDC42 to form cellular filopodia (Thrasher, AJ, and Burns, SO Nat Rev Immunol 10, 182-192 (2010)). Therefore, increased expression of CDC42 and WASL indicates activation of signaling pathways that lead to cytoskeletal rearrangement and filopodia formation.

[0131] 201B7 cells in 5 × 10 4Cells were seeded at a concentration of cells / well (12-well plate) and attached to iMatrix-511 coated and atelocollagen coated plates (Figure 12B). mRNA was extracted from the cells, and the expression of factors related to Rho family protein signaling was analyzed. As a result, the expression of CDC42 and DIAPH3 was significantly increased in cells cultured on atelocollagen compared to cells cultured on iMatrix-511. In addition, the expression of Rac1, DIAPH1, ROCK2, ROCK1P1, Profilin (PFN)1, PFN2, and PFN5 was significantly decreased. These results indicate that in 201B7 cells cultured on atelocollagen, the signaling pathway for pseudopod induction was activated up to CDC42-DIAPH3, inducing actin filament rearrangement. However, the expression of PFN43 and PFN44, which are necessary for pseudopod expression from the cell membrane via adhesion to actin filaments, was low (Lee, CW et al., Curr Biol 23, 1046-1056 (2013); Romero, S. et al., Cell 119, 419-429 (2004)). Conversely, it was thought that the low expression of DIAPH1 prevented the activation of signaling pathways for ROCK-related cell death induction, which is specific to iPS cells. These findings suggest that the 201B7 strain suppresses pseudopod expression on atelocollagen without inducing cell death (Figures 6A and 6B).

[0132] 15M66 cells in 5 × 10 4Cells were seeded at a concentration of cells / well (12-well plate) and attached to iMatrix-511 coated plates and atelocollagen coated plates (Figure 12C). mRNA was extracted from the cells, and the expression of factors involved in Rho family protein signaling was analyzed. As a result, the expression of WASL, which is induced by CDC42, was significantly increased in cells cultured on atelocollagen compared to cells cultured on iMatrix-511. In addition, PFN1 expression was significantly decreased. These results suggest that the signaling pathway for pseudopod induction in 15M66 cells cultured on atelocollagen is in the late or terminal stage of signaling activation for pseudopod formation, as CDC42 expression activation has already converged and WASL activation remains. Furthermore, these results suggest that atelocollagen promotes the activation of the CDC42-WASP pathway in hiPSCs, thereby inducing pseudopod formation. Since CDC42 is also a protein strongly involved in cell polarity (Iden, S., and Collard, JG Nat Rev Mol Cell Biol 9, 846-859 (2008)), it is possible that cell polarity-related signals influenced the mechanism by which hiPSCs on atelocollagen beads are immobilized and cultured under three-dimensional conditions.

[0133] To investigate the mechanism by which iPSC filopodia extend on atelocollagen, we first examined integrin α2β1, the receptor for collagen I, the main component of atelocollagen. We prepared 1 μg (dissolved in 0.1 μl of DMSO) or 10 μg (dissolved in 1 μl of DMSO) of TC-I 15, an integrin α2β1 inhibitor, as a reagent. For control, we prepared only DMSO (0.1 μl, 1 μl). 2.5 × 10 415M66 cells at a concentration of cells / well (6-well plate) were seeded with reagents on iMatrix-511 coated plates and atelocollagen coated plates (Figures 11B and 11C). In wells to which 1 μg or 10 μg of TC-I 15 was added, cells on atelocollagen were observed as EB-like cell aggregates on day 3 of culture (Figure 11B, bottom panel). In control wells to which the same volume of DMSO as the reagent dilution was added, partial cell death occurred, but filopodia formation was observed (white arrows) (Figure 11B, top panel). This result indicates that the induction of filopodia formation by hiPSCs on atelocollagen is activated only by a signal from integrin α2β1. On the other hand, cells on iMatrix-511 in all wells to which 0, 1, and 10 μg of TC-I 15 was added adhered and formed short filopodia on day 3 (Figure 11C, bottom panel). These results indicate that the induction of filopodia formation by hiPSCs on iMatrix-511 is not activated solely by signals from integrin α2β1.

[0134] As mentioned above, hiPSCs cultured with atelocollagen do not induce EMT or MET (Figures 6C and 6D, 7B and 7C). Type I collagen has been reported to induce EMT through activation by two receptors: integrin α2β1 and Discoid-in-domain receptor family, members (DDR) 1 and 2. This mechanism is explained by the fact that DDR receptors strongly enhance integrin α2β1 signaling, leading to cell invasion (Xu, H. et al, PLoS One 7, e52209 (2012)). Three DDR receptor inhibitors (VU6015929, Merestinib, DDR1-IN-1) were used. 2.5 × 10 415M66 cells at a cell / well concentration (6-well plate) were seeded with DDR receptor inhibitors (VU6015929, Merestinib, or DDR1-IN-1) on iMatrix-511 coated plates and atelocollagen coated plates (Figure 13). All DDR receptor inhibitors weakly inhibited cell proliferation at a reagent concentration of 1 μg / well and very strongly inhibited proliferation at 10 μg / well on both iMatrix-511 coated and atelocollagen coated plates. However, none of the DDR receptor inhibitors suppressed filopodia expression on iMatrix-511 coated or atelocollagen coated plates, nor did they inhibit cell morphological changes or cell adhesion (Figure 13). These results indicate that the mechanisms of filopodia formation in hiPSCs by DDR receptor signaling and atelocollagen are unrelated. However, even when cultured on plates coated with iMatrix-511 or atelocollagen, hiPSCs clearly expressed the DDR receptor, and its inhibition suppressed cell proliferation.

[0135] From the above, it was found that the formation of filopodia induced by atelocollagen in hiPSCs is unrelated to the DDR receptor and is therefore an independent mechanism from EMT induction. Furthermore, it was revealed that the formation of filopodia induced by atelocollagen in hiPSCs is triggered by the signaling activity of integrin α2β1 alone. Type I collagen has been reported to activate self-renewal in mouse ES cells via integrin α2β1 and DDR1-dependent Bmi-1. From this experimental result in which the DDR receptor inhibitor also inhibited hiPSC proliferation, it is inferred that not only iMatrix-511 but also atelocollagen may affect DDR receptor activity. The effect of atelocollagen on hiPSCs is shown in Figure 11. It was confirmed that integrin α2β1 extends filopodia not only under two-dimensional conditions (Figure 11, left) but also under three-dimensional conditions (Figure 11, right), fixing hiPSCs to atelocollagen like a tent rope. Furthermore, self-renewal of hiPSCs attached to atelocollagen is promoted.

[0136] The Rho family of GTPases is a family of small (approximately 21 kDa) signaling G proteins (El Masri, R., and Delon, J. Nat Rev Immunol 21, 499-513 (2021)). 15M66 cells were used in 2.5 × 10⁶ 4 Cells were seeded with the G protein inhibitor (NF023) at a concentration of cells / well on plates coated with iMatrix-511 and plates coated with atelocollagen (6-well plates) (Figure 12A). When the viable cells attached to the plates were counted, NF023 did not alter cell adhesion, cell proliferation, or cell morphology of cells cultured on plates coated with iMatrix-511 or atelocollagen (light microscopy images shown in Figure 13). This result indicates that G proteins have relatively little influence as a factor in the elongation of hiPSC filopodia on atelocollagen.

[0137] [Example 9: Potential application to automated culture systems] Currently, automated clinical cell culture systems are evolving from conventional swivel bioreactors to hollow fiber membrane bioreactors, which are becoming the mainstream for culturing mesenchymal stem cells for clinical use (Figure 14B). The advantage of hollow fiber membrane bioreactors over previous modalities is that they utilize the properties of hollow fiber membranes to have an intracapillary (IC) space for cell culture and an extracapillary (EC) space for oxygen supply and removal of cellular metabolites such as lactate. This allows for precise control of culture conditions.

[0138] However, the hollow fiber membrane material used in cell bioreactors is mainly polyethersulfone (PES), making cell adhesion with existing hiPSC biomaterials difficult. The inventors discovered that the surface of PES has liquid-permeable irregularities similar to a hybrid layer like tooth dentin. Atelocollagen is a liquid with good fluidity at an acid concentration of pH 3, but solidifies into a jelly-like substance when the pH is neutralized. Therefore, by injecting pH 3 atelocollagen as a liquid into the irregularities of the PES membrane and neutralizing the PES membrane surface with phosphate-buffered saline (PBS) or culture medium, it is possible to create an atelocollagen hybrid layer on the PES membrane. In fact, when the PES membrane was coated with atelocollagen using this method, the 15M66 cell line did not adhere to the PES membrane (Figure 14A, left), but it did adhere to the atelocollagen-coated PES membrane (Figure 14A, right). The hollow fiber membrane of the bioreactor was coated with atelocollagen. 5×10 515M66 cells were seeded at a concentration of 1, and the cells were detached with collagenase after 4 days. Light micrographs of the harvested cells are shown (Figure 14C). IC and EC sections on day 7 of culture were stained with hematoxylin-eosin (HE). hiPSC colonies are shown (black arrows) (Figure 15). On day 7 of culture, the hollow fiber membrane in the bioreactor was removed and the tissue was embedded in paraffin to prepare tissue sections for microscopic examination. Because the cells were detached with collagenase, cell adhesion was maintained, and the cells could be sampled as a cell aggregate (cell viability: 80%).

[0139] mRNA was extracted for mRNA expression analysis. The types of mRNA measured using the TaqMan Human Stem Cell Pluripotency Array (Applied Biosystems) were selected from mRNA expression profiles of "expression in undifferentiated cells," "maintenance of pluripotency," "correlation with stem cell characteristics," "differentiation markers," and "control." To analyze the undifferentiated state, "correlation with stem cells (Figure 14F)," "expression in undifferentiated cells (Figure 14D)," "maintenance of pluripotency (Figure 14E)," and "differentiation markers (Figure 14G)" were analyzed. mRNA expression was color-coded using cells cultured on plates coated with iMatrix-511 as a control. As a result, it was found that cells cultured on a PES hollow fiber membrane bioreactor coated with atelocollagen had high expression levels of OCT3 / 4 (POU5F1) (Figures 14D, 14E) and generally tended to be in a higher undifferentiated state. 15M66 cell lines cultured in atelocollagen-coated PES hollow fiber membrane bioreactors showed increased expression of LEFTY2 (Figure 14F), which is involved in left-right asymmetry of developmental organs, and HBB (Figure 14G), which is highly expressed in hematopoietic stem cells. The characteristic mRNA expression patterns of these cells cultured in atelocollagen-coated PES hollow fiber membrane bioreactors were similar in many respects to those of cells cultured on atelocollagen-coated plates (Figures 5C, 5D, 5E, and 7A). [Industrial applicability]

[0140] According to the present invention, stem cells can be efficiently produced and efficiently proliferated. This method includes a step of culturing cells in suspension, which facilitates the automation and large-scale cultivation of cells. Therefore, the present invention is extremely useful as a research tool using stem cells or for producing safe stem cell-derived transplant cells that can be used in regenerative medicine.

Claims

1. A method for producing induced pluripotent stem cells, comprising the step of suspension-culturing cells in a medium containing atelocollagen and microcarriers released from a culture vessel, wherein the cells are somatic cells into which reprogramming factors have been introduced.

2. The method according to Claim 1, wherein the somatic cells are floating cells.

3. The method according to Claim 1, wherein the mass percentage concentration of atelocollagen in the microcarriers is 10% or more.

4. The method according to Claim 1, wherein the mass percentage concentration of atelocollagen in the microcarriers is 95% or more.

5. The method according to Claim 1, wherein the step of suspension-culturing the cells is performed using a culture apparatus.

6. A step of preparing pluripotent stem cells produced by the method according to any one of Claims 1 to 5, A step of culturing the prepared cells in a differentiation induction medium, and A step of suspension-culturing the cultured cells in a medium containing atelocollagen and microcarriers released from a culture vessel A method for producing differentiated cells, comprising the above steps.

Images