Angelman syndrome antisense treatment

Abstract

To provide antisense oligonucleotides for use in the treatment of Angelman syndrome, capable of inducing expression of ubiquitin-protein ligase E3A (UBE3A) from the paternal allele in animal or human neurons.SOLUTION: The present invention provides a modified oligonucleotide comprising a contiguous nucleotide sequence of at least 18 ribonucleotides having nucleic acid complementarity to a contiguous portion of a specific nucleotide sequence, wherein the modified oligonucleotide is capable of targeting the 5'-end of a UBE3A-AS transcript.SELECTED DRAWING: Figure 1A

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to U.S. Provisional Application No. 62 / 593,431, filed on December 1, 2017 and Application Serial No. 62 / 676,034, filed on May 24, 2018, the entire contents of which are incorporated herein by reference.

[0002] Sequence Listing This application includes a sequence listing submitted in electronic form as an ASCII.txt file named "922001 - 2020 Sequ ence Listing_ST25", created on November 30, 2018. The entire contents of the sequence listing are incorporated herein.

Background Art

[0003] Angelman syndrome (AS) is a neurodevelopmental disorder associated with severe intellectual disability and movement disorders, epilepsy, sleep disorders, and an abnormal "happy - feeling" temperament. Individuals with AS are often diagnosed at 2 - 3 years of age and have a normal lifespan. They require care and medical attention throughout their lives. Currently, there are few treatment options for individuals with AS, and most of them include anti - epileptic drugs to treat epileptic seizures.

[0004] Angelman syndrome is caused by mutations that affect the expression or function of the maternally inherited ubiquitin - protein ligase E3A (UBE3A) gene. Unlike most genes, UBE3A undergoes genomic imprinting, and genomic imp ​​​​​​Printing is the process of turning on one allele of a gene while keeping the other allele turned off. This is a rare, naturally occurring phenomenon in neurons of the central nervous system (CNS). In this case, the paternal UBE3A allele is off, but in all other cell types in the body, UB Both alleles of E3A are activated. Therefore, AS is always inherited from the mother. It is caused by mutations that affect the UBE3A allele.

[0005] The paternal UBE3A allele undergoes several protein-coding and non-coding mutations. UBE3A antisense transcript (UBE3A) is a component of the long-chain RNA transcript that expresses the copy. It is turned off by 3A-AS). UBE3A-AS is from the paternal allele, and CN It is expressed only in S neurons, which turns off the expression of the paternal UBE3A allele. It is sufficient and essential for this to happen. Why UBE3A is imprinted in neurons It is unclear why, but there is an inactive but functional UBE3A on the paternal chromosome. Because copies exist, it creates a unique opportunity to treat individuals with AS. To date, research suggests that activating the paternal UBE3A allele can treat AS. This indicates that it is a viable treatment option. [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] This specification refers to the 5'-terminus of the UBE3A-AS transcript, which is important for its own stability. The region located in is disclosed. Based on these findings, antisense oligonucleotides ( ASO terminates the transcription of UBE3A-AS and reactivates the expression of the paternal UBE3A allele. To do this, it was designed to target this region. The 5'-terminus of UBE3A-AS These targeted ASOs terminate the transcription of UBE3A-AS and paternal UBE3A The REL can be turned on. SNHG14 includes several, including UBE3A-AS. It is a polycistronic transcript that encodes different RNAs. [Means for solving the problem]

[0007] Therefore, in this specification, the 5 UBE3A antisense transcript (UBE3A-AS) The 3'-end of SNORD115 and SNORD109B are thought to represent the '-end. At least 98% (i.e., 98%, 99%) of the target exon between the 5'-terminus and the target exon. 10 to 30 nucleotide lengths (i.e., 1 nucleotide) have complementarity of % or 100%). 0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 A sequence of consecutive nucleotides (24, 25, 26, 27, 28, 29, or 30) The contained ASOs are disclosed. In particular, the target exon is human chromosome 15 human genome ACE. UBE3 corresponds to ranks 25,511,577 to 25,516,681 on BRHG19. It may be in the 5'-terminus of A-AS. In some embodiments, the target nucleic acid is UBE3A -It is one of the five exons located in the 5'-terminus of AS, and this is 25,5 11,577~25,511,761 (Exxon-1), 25,512,059~25,5 12,191 (Exxon 2), 25,513,476~25,513,600 (Exxon 3) 25,514,752~25,514,880 (Exxon-4), and 25,51 This could correspond to positions 6,565 to 25,516,681 (exon 5). Therefore, the target nucleus... The acid can be a contiguous nucleic acid sequence of 10 to 30 nucleotides within SEQ ID NO: 1, 2, 3, 4, or 5. It can be an acid sequence.

[0008] In some embodiments, the target sequence is an exon boundary including UBE3A-AS exons 1 to 5, UBE3A-AS exon 5 and SNORD109B exon 1, and / or SNORD109B exons 1 to 2. It is an exon boundary including UBE3A-AS exon 5 and SNORD109B exon 1, and / or SNORD109B exons 1 to 2. It is an exon boundary including UBE3A-AS exon 5 and SNORD109B exon 1, and / or SNORD109B exons 1 to 2.

[0009] Methods and strategies for designing ASOs are known in the art. In some embodiments, the ASO is designed to target a sequence conserved among human subjects. In some embodiments, the ASO is designed to target a sequence conserved among primate subjects. Methods and strategies for designing ASOs are known in the art. In some embodiments, the ASO is designed to target a sequence conserved among human subjects. In some embodiments, the ASO is designed to target a sequence conserved among primate subjects. Methods and strategies for designing ASOs are known in the art. In some embodiments, the ASO is designed to target a sequence conserved among human subjects. In some embodiments, the ASO is designed to target a sequence conserved among primate subjects. Methods and strategies for designing ASOs are known in the art. In some embodiments, the ASO is designed to target a sequence conserved among human subjects. In some embodiments, the ASO is designed to target a sequence conserved among primate subjects.

[0010] The oligonucleotide can be, for example, an antisense oligonucleotide having a gapmer design (i.e., antisense to its target nucleic acid, as understood by those skilled in the art). The disclosed oligonucleotide can induce paternal UBE3A expression in neurons by degradation, reduction, or removal of the UBE3A-AS transcript. It does this by targeting the 5'-end of UBE3A-AS upstream of the SNORD109B snoRNA. Examples of ASOs designed to target exons 1 to 5 are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO includes a nucleic acid sequence, SEQ ID NO: 6, 7, 8, 9, 10, or 11. The oligonucleotide can be, for example, an antisense oligonucleotide having a gapmer design (i.e., antisense to its target nucleic acid, as understood by those skilled in the art). The disclosed oligonucleotide can induce paternal UBE3A expression in neurons by degradation, reduction, or removal of the UBE3A-AS transcript. It does this by targeting the 5'-end of UBE3A-AS upstream of the SNORD109B snoRNA. Examples of ASOs designed to target exons 1 to 5 are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO includes a nucleic acid sequence, SEQ ID NO: 6, 7, 8, 9, 10, or 11. The oligonucleotide can be, for example, an antisense oligonucleotide having a gapmer design (i.e., antisense to its target nucleic acid, as understood by those skilled in the art). The disclosed oligonucleotide can induce paternal UBE3A expression in neurons by degradation, reduction, or removal of the UBE3A-AS transcript. It does this by targeting the 5'-end of UBE3A-AS upstream of the SNORD109B snoRNA. Examples of ASOs designed to target exons 1 to 5 are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO includes a nucleic acid sequence, SEQ ID NO: 6, 7, 8, 9, 10, or 11. The oligonucleotide can be, for example, an antisense oligonucleotide having a gapmer design (i.e., antisense to its target nucleic acid, as understood by those skilled in the art). The disclosed oligonucleotide can induce paternal UBE3A expression in neurons by degradation, reduction, or removal of the UBE3A-AS transcript. It does this by targeting the 5'-end of UBE3A-AS upstream of the SNORD109B snoRNA. Examples of ASOs designed to target exons 1 to 5 are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO includes a nucleic acid sequence, SEQ ID NO: 6, 7, 8, 9, 10, or 11. The oligonucleotide can be, for example, an antisense oligonucleotide having a gapmer design (i.e., antisense to its target nucleic acid, as understood by those skilled in the art). The disclosed oligonucleotide can induce paternal UBE3A expression in neurons by degradation, reduction, or removal of the UBE3A-AS transcript. It does this by targeting the 5'-end of UBE3A-AS upstream of the SNORD109B snoRNA. Examples of ASOs designed to target exons 1 to 5 are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO includes a nucleic acid sequence, SEQ ID NO: 6, 7, 8, 9, 10, or 11. The oligonucleotide can be, for example, an antisense oligonucleotide having a gapmer design (i.e., antisense to its target nucleic acid, as understood by those skilled in the art). The disclosed oligonucleotide can induce paternal UBE3A expression in neurons by degradation, reduction, or removal of the UBE3A-AS transcript. It does this by targeting the 5'-end of UBE3A-AS upstream of the SNORD109B snoRNA. Examples of ASOs designed to target exons 1 to 5 are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO includes a nucleic acid sequence, SEQ ID NO: 6, 7, 8, 9, 10, or 11. The oligonucleotide can be, for example, an antisense oligonucleotide having a gapmer design (i.e., antisense to its target nucleic acid, as understood by those skilled in the art). The disclosed oligonucleotide can induce paternal UBE3A expression in neurons by degradation, reduction, or removal of the UBE3A-AS transcript. It does this by targeting the 5'-end of UBE3A-AS upstream of the SNORD109B snoRNA. Examples of ASOs designed to target exons 1 to 5 are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO includes a nucleic acid sequence, SEQ ID NO: 6, 7, 8, 9, 10, or 11. The oligonucleotide can be, for example, an antisense oligonucleotide having a gapmer design (i.e., antisense to its target nucleic acid, as understood by those skilled in the art). The disclosed oligonucleotide can induce paternal UBE3A expression in neurons by degradation, reduction, or removal of the UBE3A-AS transcript. It does this by targeting the / 5'-end of UBE3A-AS upstream of the SNORD109B snoRNA. Examples of ASOs designed to target exons 1 to 5 are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO includes a nucleic acid sequence, SEQ ID NO: 6, 7, 8, 9, 10, or 11. The oligonucleotide can be, for example, an antisense oligonucleotide having a gapmer design (i.e., antisense to its target nucleic acid, as understood by those skilled in the art). The disclosed oligonucleotide can induce paternal UBE3A expression in neurons by degradation, reduction, or removal of the UBE3A-AS transcript. It does this by targeting the 5'-end of UBE3A-AS upstream of the SNORD109B snoRNA. Examples of ASOs designed to target exons 1 to 5 are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO includes a nucleic acid sequence, SEQ ID NO: 6, 7, 8, 9, 10, or 11.

[0011] The disclosed ASO can also have improved stability, solubility, activity, cell distribution, and / or cellular uptake. It may have one or more modifications to improve the performance. For example, the disclosed ASO is , one or more sugar-modified nucleosides and / or modified internucleoside bonds It can contain. For example, in some embodiments, the oligonucleotide is natural From phosphodiesters, for example, the bond can be modified to be more resistant to nuclease attack. It contains one or more decorated nucleoside bonds. In some embodiments, ASO is heaven Although different from naturally occurring nucleic acid bases, one or more functional bases are formed during nucleic acid hybridization. It contains the modified nucleic acid bases shown above.

[0012] In some embodiments, ASO is a DNA oligonucleotide. In this embodiment, ASO is an RNA oligonucleotide. In yet another embodiment, ASO contains both deoxynucleotides and ribonucleotides. For example, A SO can be a gapmer, headmer, or tailmer oligonucleotide. In some embodiments, the central block of the gapmer is internally broken down from nuclease degradation. Adjacent to the block of modified ribonucleotides protecting the lock. For example, ASO These are 3, 4, and 4 at the 3'- and 5'-terminuses for protection against exonucleases. Or, along with five modified ribonucleotide monomers, RNase H cleavage of target RNA. To activate it, use 7, 8, 9, 10 or more natural DNA monomers It may contain stretch. In some cases, modified ribonucleotides , 2'-O-methyl(OMe)RNA nucleotide, 2'-O-methoxyethyl(MOE )-modified nucleotides, or 2'-locked nucleic acids (LNAs). Gapmer ASO Examples of the implementation are provided in Tables 7, 11, and 17. Therefore, several implementations Morphologically, the disclosed ASO has a nucleic acid sequence selected from sequence numbers 362-392. ru.

[0013] One or more ASOs disclosed herein, as well as pharmaceutically acceptable diluents, carriers, Pharmaceutical compositions comprising salts and / or adjuvants (excipients) are also disclosed.

[0014] In vivo UBE3A expression in target cells where paternal UBE3A expression is suppressed or a method for in vitro induction, relating to one or more disclosed ASOs or specified herein A method is also disclosed by administering the composition disclosed herein to the aforementioned cells in an effective amount.

[0015] To treat or prevent diseases, disorders, or dysfunctions related to the in vivo activity of UBE3A. A method for which one or more ASOs disclosed in therapeutic or prophylactic effective amounts are used You have or are suspected of having a disease, disorder, or dysfunction such as Angelman syndrome. Methods including administering to a target subject are also disclosed.

[0016] Details of one or more embodiments of the present invention are shown in the accompanying drawings and the following detailed description. Other features, purposes, and advantages of the present invention are described in the description and drawings, as well as in the claims. This will become clear from the scope. For example, a person skilled in the art will see by reading this specification that this disclosure is UBE Demonstrates the usefulness of specific sequences, such as those described herein, for influencing 3A expression. They are such sequences, or they target them (for example, complementary ones). You will recognize that this further demonstrates the usefulness of the oligonucleotide format. Those skilled in the art will recognize that this disclosure is not limited to any particular mechanism of action, and that the provided information is not limited to any specific mechanism of action. Rigonucleotides are transmitted through antisense mechanisms, such as those involving RNase H activity. Whether or not they act, they can be useful, and whether they are such sequences or they Other therapeutic formats of the targeted oligonucleotide (e.g., siRNA, shR) NA, nuclease gRNA, etc. are also provided. Similarly, those skilled in the art will see described herein. By defining useful sequences that can be included, the present invention also provides for such sequences. Various formats of (for example, in vivo, in vitro, (or both, etc.) (as part of a nucleic acid vector such as a vector) Those skilled in the art will recognize this by reading this disclosure. The reference is illustrative, and the appropriate nucleic acid (e.g., oligonucleotide) is not related to the mechanism of action. It will be recognized that it can be used. Those skilled in the art will be able to make it through any of the various mechanisms. Appropriate format and structure of nucleic acids (e.g., oligonucleotides) to be used (e.g., I am familiar with a wide range of literature on siRNA, shRNA, nuclease gRNA, etc. In some embodiments, the nucleic acids provided are in one or more mechanistic contexts. Formats and / or structures that are known to be useful in the art Characteristics (e.g., including nucleic acid-directed nucleases such as RNase H, RISC, and Cas) Incorporate it. [Brief explanation of the drawing]

[0017] [Figure 1A-1D]Figure 1A shows the Prader-Willi / Angelman syndrome (PWS / AS) imprinting regions in humans and mice. Figure 1A shows the reference sequence annotation of the human PWS / AS imprinting region. Figure 1B shows the reference sequence annotation of the mouse PWS / AS imprinting orthologous region. Figure 1C shows the 3'-terminus of UBE3A-AS and UBE3A. Figure 1D shows the strand alignment of the orthologous region among humans, macaques (cynomolgus macaques), pigs, elephants, mice, and rats. The target region is conserved among non-human primates but not among rodents. Figure 1D also shows a genomic evolutionary rate profiling (GERP) plot of the region. Positive values ​​represent evolutionary constraints at specific DNA bases. [Figure 2A-2E]This shows the analysis of ASOs targeting mouse Ube3a-AS. Figure 2A is a diagram of the approximate locations of mouse Ube3a-AS transcripts and mouse-specific ASOs. Boxes and lines represent exons and introns, respectively. Arrows indicate the direction of transcription. Figure 2B is a diagram of the Ube3aYFP reporter allele used to measure paternal Ube3a protein levels. The Ube3aYFP mouse model was produced by targeting the 3'-terminus of the endogenous Ube3a locus with yellow fluorescent protein (YFP). Ube3a-AS expression inhibits transcription of the paternal Ube3aYFP allele, and loss of Ube3a-AS reactivates paternal Ube3aYFP expression, which can be detected by immunofluorescence imaging using an anti-YFP antibody. Figure 2C is a diagram of the experimental timeline for investigating ASOs in mouse primary hippocampal neurons. Mouse primary hippocampal neurons were produced from neonatal mice (0DIV) carrying the paternally inherited Ube3aYFP allele and treated in vitro after 7 days (7DIV). Three days after treatment (10DIV), Ube3aYFP protein levels were measured in individual cells. Figure 2D includes immunofluorescence images showing paternal Ube3aYFP protein in primary neurons treated with vehicle (veh), negative control ASO (ASO-C), topotecan (topo), ASO-B, and ASO1.1. Figure 2E shows the mean paternal Ube3aYFP intensity levels in individual neuronal cells treated with vehicle (veh, 1% DMSO; n=3), control ASO (ASO-C, 15 μM; n=3), topotecan (topo, 0.3 μM; n=3), ASO-B (1, 5, 15 μM; n=3), ASO-1.1 (1, 5, 15 μM), ASO-1.2 (1, 5, 15 μM), and ASO3.1 (1, 5, 15 μM). Abbreviations: YFP, yellow fluorescent protein; Tx, treatment; DIV, days in vitro; ns, not significant. Error bars represent the standard error of the mean. [Figure 3A-3D]This report presents an analysis of ASOs targeting human UBE3A-AS. Figure 3A shows the approximate locations of human UBE3A-AS and human-specific ASOs (ASO1-6). ASO-7 is located in the intron of UBE3A-AS. Boxes and lines represent exons and introns, respectively. Figure 3B is a diagram of the experimental timeline for investigating ASOs in human GABAergic-induced pluripotent stem cell (iPSC)-derived neurons from individuals with normal karyotype. Human iPSC-derived neurons were treated after 14 DIVs and then processed for RNA isolation at 20 DIVs. Figures 3C and 3D show the relative stationary RNA levels (normalized relative to ASO-C) of UBE3A-AS (Figure 3C) and UBE3A (Figure 3D) in iPSC-derived neurons treated with control ASO (ASO-C, 10 μM), ASO1-7 (10 μM), and topotecan (Topo, 1 μM). Abbreviations: Tx, Treatment; DIV, In Vitro Days. Error bars represent the mean standard error. [Figure 4A-4I] The analysis of human ASO-4 and topotecan in GABAergic iPSC-derived neurons is shown. Figures 4A–4F show the relative expression levels (normalized to 1nM) of UBE3A-AS (Figure 4A), SNORD116 (Figure 4B), IPW (Figure 4C), SNORD115 (Figure 4D), SNORD109A / B (Figure 4E), and UBE3A (Figure 4F) in iPSC-derived neurons treated with ASO-4 and topotecan (1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM, 3μM, 10μM, and 30μM) in 10-point 1 / 2 log dose curves. Figure 4G is a diagram of the experimental timeline for investigating ASO-4 in GABAergic iPSC-derived neurons treated with 59DIV. Figures 4H–4I show the relative expression levels (normalized to ASO-C) of UBE3A-AS (Figure 4H) and UBE3A (Figure 4I) steady-state RNA in iPSC-derived neurons treated with ASO-C (10 μM) and ASO-4 (1, 5, and 10 μM). Abbreviation: Tx, treatment. Error bars represent the standard error of the mean. [Figures 5A-5F]This report presents an analysis of optimized ASOs in human GABAergic and glutamatergic iPSC-derived neurons. Figure 5A is a diagram of the experimental timeline for investigating optimized ASOs in GABAergic iPSC-derived neurons. Figure 5B shows the relative expression levels (normalized to water control) of UBE3A-AS steady-state RNA in iPSC-derived neurons treated with five 1 / 2 log dose curves (30 nM, 100 nM, 300 nM, 1 μM, 3 μM; n=6) for ASO-3.1, ASO-3.2, ASO-4.1, ASO-4.2, ASO-4.3, ASO-4.4, ASO-6.1, ASO-4.I, and ASO-4.S. ASO-4.I and ASO-4.S represent ASO-4 manufactured by two companies (ASO-4.I, Integrated DNA Technologies; ASO-4.S, Sigma-Aldrich). Figure 5C is a diagram of the experimental timeline for investigating ASO-4 and ASO-6.1 in GABAergic iPSC-derived neurons. Figure 5D shows the relative expression (normalized to 1 nM) of UBE3A-AS and UBE3A steady-state RNA levels in iPSC-derived neurons treated with 10-point 1 / 2 log dose curves (1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM, and 30 μM; n=3) for ASO-4 (ASO-4.I and ASO-4.S) and ASO-6.1. Figure 5E is a diagram of the experimental timeline for investigating ASO-4 and ASO-6.1 in glutamatergic iPSC-derived neurons. Figure 5F shows the relative expression levels (normalized to water control) of UBE3A-AS and UBE3A stationary RNA in iPSC-derived neurons treated with 10-point 1 / 2 log dose curves (1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM, and 30 μM; n=3) of ASO-4 (ASO-4.I and ASO-4.S) and ASO-6.1. Error bars represent the standard error of the mean. [Figures 6A-6D]This document describes the identification of the ASO target region in the mouse PWS / AS imprinting region. Figure 6A shows annotations for the reference sequence of the orthologus PWS / AS imprinting region on mouse chromosome 7C. Figure 6B shows the transcript assembly produced from RNA sequencing (RNA-seq) data from mouse brain. Figure 6C shows the ASO target region indicating the Snord115 snoRNA retained in the 5'-terminal exon of the Snord115 host gene transcript / Ube3a-AS. The aligned RNA-seq reads are shown below the assembled transcript. Exons and introns are indicated by boxes and lines, respectively. Figure 6D shows sequence alignments of snoRNAs in the retained exons Snord115_ENSMUST00000101836 (SEQ ID NO: 490), Snord115_ENSMUST00000101936 (SEQ ID NO: 491), Snord115_ENSMUST00000104493 (SEQ ID NO: 492), Snord115_ENSMUST00000082443 (SEQ ID NO: 493), and Snord115_ENSMUST00000104427 (SEQ ID NO: 494), indicating that the retained snoRNAs possess the degenerate box required for functional snoRNA formation. [Figures 7A-7G]This shows the identification of ASO target regions in the human PWS / AS imprinting region. Figure 7A shows annotations of the reference sequence of the Prader-Willi / Angelman syndrome (PWS / AS) imprinting region. Figure 7B shows the RNA-seq assembly of the human PWS polycistronic transcript. Figure 7C shows SNORD115-45, which is retained in the exon at the 3'-terminus / 5'-terminus of the SNORD115 host gene transcript / UBE3A-AS. Aligned RNA-seq reads produced from adult human brain show that the L1 line is transcribed. Figure 7D shows annotations of the 3'-terminus reference sequence of the SNORD115 cluster (SNORD115-39-48 and SNORD109B). Figure 7E shows the location of the L1 line element between SNORD115-44 and SNORD115-45. Figure 7F shows the chain alignment of placental organisms representing the major clades showing conservation in the SNORD115-45-48 region, although this is reduced in rodents. Figure 7G shows the sequence alignment of snoRNAs in the target region for SNORD115-44 (functional snoRNA) (SEQ ID NO: 495), SNORD115-48 (SEQ ID NO: 496), SNORD115-45 (SEQ ID NO: 497), SNORD115-46 (SEQ ID NO: 498), and SNORD115-47 (SEQ ID NO: 499), showing that SNORD115-45 (retained), SNORD115-46 (partially retained), and SNORD116-47 have the degenerate box required for functional snoRNA formation. [Figures 8A-8C]The pharmacodynamic analysis of candidate ASOs is presented. Figure 8A shows approximate dose-response curves of normalized UBE3A-AS steady-state RNA levels in GABAergic iPSC-derived neurons treated with 10-point 1 / 2 log dose curves (1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM, and 30 μM; n=2) of ASO-4 and ASO-6.1 with different scaffolding and RNA modification designs. The dose-response curves are approximated using a 4-parameter logistic regression model (Hill). The graphs represent the approximated model and standard errors. The Y-axis represents relative UBE3A-AS RNA levels, and the X-axis represents the log molar (M) concentration of the ASO. Figures 8B and 8C are dendritic and star plots of hierarchical clustering of the approximate dose-response curves, showing the relationships between candidate ASOs and grouping them into three clusters. [Figure 9] This document presents pharmacodynamic analyses of ASO-6.1.PO-1.O and ASO-4.4.PS.L in Angelman syndrome iPSC-derived neurons. It shows a 4-parameter logistic regression model (Hill) of normalized UBE3A-AS steady-state RNA levels in Angelman syndrome iPSC-derived neurons treated with 10-point 1 / 2 log dose curves (1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM, 3μM, 10μM, and 30μM; n=3) of ASO-6.1.PO-1.O and ASO-4.4.PS.L. [Figure 10]This shows the expression analysis of RNA encoded by PWS polycistronic transcripts in Angelman syndrome iPSC neurons treated with ASO-6.1-PO-1.O and ASO-4.4.PS.L. Normalized steady-state RNA levels of SNURF, SNRPN, SNHG116, SNORD116 snoRNA, IPW, SNHG115, SNORD115 snoRNA, UBE3A-AS, and UBE3A in AS iPSC-derived neurons treated with vehicle (1% H2O; n=3), ASO-6.1.PO-1.O (30 μM; n=3), and ASO-4.4.PS.L (30 μM; n=3) are shown. Data represent the mean percentage of RNA relative to the vehicle. Error bars represent the standard error of the mean. An asterisk (*) indicates a statistically significant difference (p<0.05) for the vehicle, calculated using one-way ANOVA with Dunnett multiple comparison tests. [Figure 11] This report presents pharmacodynamic analyses of ASO-6.1.PO-1.O and ASO-4.4.PS.L in cynomolgus macaques. Steady-state UBE3A-AS RNA levels in the macaque CNS region treated with vehicle (0.9% saline; n=5), ASO-6.1.PO-1.O (10 mg; n=3), and ASO-4.4.PS.L (10 mg; n=3) are shown. Data represent the mean percentage of UBE3A-AS RNA relative to vehicle. Error bars represent the standard error of the mean. An asterisk (*) indicates a statistically significant difference (p < 0.05) relative to vehicle, using one-way ANOVA with Dunnett multiple comparison tests. [Modes for carrying out the invention]

[0018] Also known as ubiquitin-protein ligase E3A antisense transcript and UBE3A-A UBE3A-AS / Ube3a-AS transcription, also known as S / Ube3a-AS. The substance is the UBE3A-AS transcription on the antisense DNA strand of the UBE3A gene. This is the name for a transcript produced by the transcription of another substance. It is a gene name using all capital letters. indicates a human gene (e.g., UBE3A), and gene names using only the first letter capitalized are Please note that this shows a mouse gene (e.g., Ube3a). UBE3A-AS transcription The object is a large polycistronic transcription unit that codes for SNURF-SNRPN, Oof Clusters of C / D box nucleolar small RNAs (SNORDs), and several It is transcribed as a portion of uncharacterized long non-coding RNA. Mouse and In both humans, the UBE3A / Ube3a gene is used in neurons of the central nervous system. It is imported and is expressed only from the maternal allele. UBE3A-AS / Ub The e3a-AS transcript silences the transcription of the paternal UBE3A / Ube3a allele. It is essential and sufficient for this, and inhibition of UBE3A-AS / Ube3a-AS is paternal UBE3 Reactivates the transcription of the A / Ube3a allele. Mutations that affect ability or expression cause Angelman syndrome (AS). The paternal allele is functional but epigenetically silenced. When silencing is stopped, the paternal UBE3A allele becomes functional UB in neurons. It could be a source of E3A.

[0019] A polycistronic transcription unit encoding UBE3A-AS (hereinafter referred to as PT) A PTU (referred to as U) is approximately 450,000 base pairs long. The transcription of a PTU is SNURF. -Starts at the upstream exon (U-exon) of the SNRPN locus and begins at the 5'-end of UBE3A. It stops towards the end. The PTU is organized as follows (5'-3'): SNURF- SNRPN, SNORD107, SNORD64, SNORD109A, SNORD11 6 (29 copies), IPW, SNORD115 (48 copies), SNORD109B, UBE3A, for example, is oriented in the opposite direction to the upstream transcript. The polycistronic transcript is It undergoes alternative splicing and is subjected to alternative 3'-processing. SNURF-S NRPN encodes two polypeptides. SNORD encodes the host gene transcript (SN An exonucle of a spliced ​​intron located within an intron of HG14. It is produced by debranching of the -ase gene. UBE3A-AS is a transcript that duplicates the UBE3A gene. This represents the 3' end. Most C / D box snoRNAs are involved in ribosome biosynthesis. They play a role in leading to the 2'-O-methylation of ribosomal RNA (rRNA). However, snoRNAs located in the PWS / AS region are complementary to known rRNAs. It has a deletion in any sequence. However, SNORD115 snoRNA is serotonin It was found to alter the alternative splicing of receptor 2C pre-mRNA.

[0020] In this specification, the 5'-end of the UBE3A-AS transcript is important for its stability. Evidence to that effect is disclosed. As disclosed herein, the 5'-terminus of UBE3A-AS ASOs that target UBE3A likely terminate the transcription of UBE3A-AS, and paternal UBE3A By turning on the allergen, UBE3A-AS levels can be reduced.

[0021] As used herein, the term “olivone complex” is generally understood by those skilled in the art. As understood, it is defined as a molecule containing two or more covalently bonded nucleosides. Such covalently bonded nucleosides are also referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly synthesized in the laboratory by solid-phase chemical synthesis followed by purification. It is produced in [location]. When referencing an oligonucleotide sequence, the reference is a covalently bonded nucleus. The sequence or order of the nucleic acid base portion of an ocide or nucleoside, or modifications thereof. In contrast, the oligonucleotides disclosed herein are artificial, for example, chemical It is scientifically synthesized. The oligonucleotides disclosed herein are also one or more This may also include the modified nucleosides or nucleotides shown above.

[0022] As used herein, the term "antisense oligonucleotide" refers to a target nucleic acid, particularly By hybridizing to a continuous sequence on the target nucleic acid, it regulates the expression of the target gene. Defined as an oligonucleotide that can do so. In some embodiments, the present The antisense oligonucleotides disclosed in the detailed document are single-stranded.

[0023] The term "sequential nucleotide sequence" refers to an oligonucleotide sequence that is complementary to the target nucleic acid. Refers to a region. In this specification, this term is used in the terms "continuous nucleic acid base sequence" and "o It is used interchangeably with the "ligonucleotide motif sequence". In some embodiments, the original All nucleotides in a nucleotide exist within a continuous sequence of nucleotides. In some embodiments, the oligonucleotide comprises a sequence of nucleotides, in the case This can be used to attach functional groups to a continuous sequence of nucleotides. It may also include further nucleotides, such as a nucleotide linker region. The nucleotide linker region may or may not be complementary to the target nucleic acid.

[0024] Nucleotides make up blocks of nucleotides and polynucleotides, It can include both naturally occurring and unnaturally occurring nucleotides. In nature, D Nucleotides such as NA and RNA nucleotides consist of a ribose sugar portion, a nucleic acid base portion, and contains one or more phosphate groups (which are absent in nucleosides). Nucleoside And nucleotides are also interchangeably referred to as "units" or "monomers." good.

[0025] The terms "modified nucleoside" or "nucleoside modification" as used herein are: By introducing one or more modifications to the sugar moiety or (nucleic acid) base moiety, equivalent DNA can be created. Alternatively, it refers to a modified nucleoside compared to an RNA nucleoside. Several implementation forms In this state, a modified nucleoside contains a modified sugar moiety. Modified nucleoside The term also, in this specification, is used with the terms “nucleoside analog” or modified “u It may be used interchangeably with "knit" or the modified "monomer".

[0026] The term "modified nucleoside bond" refers to a bond that covalently connects two nucleosides. Commonly used by those skilled in the art as a bond other than a sphodiester (PO) bond or a natural phosphate bond. Defined as understood: A nucleotide having a modified nucleoside bond. These are also called "modified nucleotides." In some embodiments, modified nucleotides are used. The intercleoside bond is different from the oligonucleotide nuclea compared to the phosphodiester bond. It increases resistance to ze. For naturally occurring oligonucleotides, the nucleoside bond is It contains a phosphate group that creates a phosphodiester bond between adjacent nucleosides. The nucleoside-to-nucleoside bond stabilizes the oligonucleotide for in vivo use. It is particularly useful, for example, within the gap region of gapmer oligonucleotides, and D of oligonucleotides disclosed herein, such as in the region of a modified nucleoside. It works to protect the region of NA or RNA nucleoside from nuclease cleavage. It is possible.

[0027] In some embodiments, the oligonucleotide is derived from a natural phosphodiester, for example If, one or more nucleoses are modified to have a bond that is more resistant to nuclease attack, It includes intercellular bonds. Nuclease resistance is determined by incubating oligonucleotides in serum. By doing so, or nuclease resistance assays [e.g., snake venom phosphodiesterase] This can be determined by using (SVPD), and both are relevant to the technical field. It is well known in that it can enhance the nuclease resistance of oligonucleotides. The cleoside-nucleoside bond is referred to as a nuclease-resistant nucleoside bond.

[0028] In some embodiments, oligonucleotides or sequences thereof are used. At least 50% of the nucleoside bonds in the column are modified, and oligonucleotides or the internucleoside bonds in those consecutive nucleotide sequences, for example, at least 60%, for example, at least 70%, for example, at least 80%, or for example, less Both are 90% modified. In some embodiments, oligonucleotides or so All nucleoside bonds in the consecutive nucleotide sequences are modified.

[0029] In some embodiments, oligonucleotides are converted to non-nucleated forms, such as conjugates. It has been found that the nucleoside bond attached to the rheotide functional group can be a phosphodiester. In some embodiments, oligonucleotides are linked to non-nucleotide functional groups. The nucleoside bonds being joined are modified.

[0030] In some embodiments, oligonucleotides or sequences thereof are used. All nucleoside bonds in the column are nuclease-resistant nucleoside bonds.

[0031] Modified nucleoside bonds include, for example, phosphorothioates and diphosphorothioates. The group may be selected from the group including t and boranophosphate. In some embodiments, The decorated nucleoside-to-nucleoside bond is the RNase of the oligonucleotide disclosed herein. It is compatible with H recruitment, for example, phosphorothioates, diphosphorothioates. It is OET, or boranophosphate.

[0032] In some embodiments, the nucleoside bond contains sulfur (S), for example, phospho This is a rotioate nucleoside bond.

[0033] Phosphothioate nucleoside binding is beneficial for nuclease resistance, and for pharmacokinetics. Furthermore, it is particularly useful due to its ease of manufacture. In a preferred embodiment, oligonucleotides At least 50% of the internucleoside bonds in the nucleotide or their consecutive nucleotide sequences It is a phosphothioate, an oligonucleotide or a sequence of nucleotides thereof. For example, at least 60%, for example, at least 70% of the nucleoside bonds in the sequence For example, at least 80%, or for example, at least 90%, are phosphorothioates. Yes. In some embodiments, oligonucleotides or their sequential nucleotides All nucleoside-to-nucleoside bonds in the sequence are phosphorothioates.

[0034] In some embodiments, the oligonucleotide is composed of one or more neutral nucleoside interbonding groups. In particular, phosphotriesters, methylphosphonates, MMI, amide-3, formaldehyde Contains internucleoside bonds selected from tar or thioform acetal. Nucleoside bonds are incorporated herein by reference to WO2009 / 124238. This is disclosed in ( ). In one embodiment, the nucleoside bond is defined in WO2007 / 031 Selected from the linkers disclosed in 091 (incorporated herein by reference) .

[0035] Nuclease-resistant binding, such as phosphorothioate binding, is a region for gapmers. Target nuclei such as G, or the unmodified nucleoside regions of the headmer and tailmer. Oligonucleotides that can recruit nucleases when forming double chains with acids. It is particularly useful in the thio region. However, phosphorothioate bonds also have gaps. —Regions F and F', or modified nuclei of headmer and tailmer Non-nuclease recruitment regions and / or affinity-enhancing regions, such as osid regions. It can also be useful in that context.

[0036] However, each of the design domains is such that modified nucleosides such as LNAs are degraded by nucleases. In the region that protects the bond against, in particular, phosphodiester bonds and other phosphorothio It may contain internucleoside bonds other than eth. One or two bonds such as phosphates. The hodiester bond is a particularly modified nucleoside unit (typically non-nuclear) By including it between or adjacent to the (within the gelatinous region), oligonucleotides It can modify the bioavailability and / or biodistribution of phosphodi Instructions on oligonucleotides containing ester bonds, WO2008 / 113832 This is incorporated herein by reference.

[0037] In some embodiments, all nucleoside bonds in the oligonucleotide are The binding is sphorothioate and / or boranophosphate. In some embodiments, In oligonucleotides, all nucleoside bonds are phosphorothioate bonds. be.

[0038] The term nucleic acid base refers to a base that forms a hydrogen bond in nucleic acid hybridization. Purines present in creosides and nucleotides (e.g., adenine and guanine) ) and also include pyrimidine (e.g., uracil, thymine, and cytosine) moieties. Nucleic acids The term "base" may differ from naturally occurring nucleic acid bases, but in nucleic acid hybridization... This also includes functionally modified nucleic acid bases. In this context, "nucleic acid bases" These are naturally occurring nucleic acid bases, such as adenine, guanine, cytosine, thymidine, and uraci. This refers to both xanthine, hypoxanthine, and unnaturally occurring variants. vinegar.

[0039] In some embodiments, the nucleic acid base moiety is a modified purine or pyrimidine. Replace with phosphorus or pyrimidine, for example, a substituted purine or substituted pyrimidine. It is modified by, for example, isocytosine, pseudoisocytosine, 5-methyl Lucytosine, 5-thiozolocytosine, 5-propynylcytosine, 5-propynyl Uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2'thio -Thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6- These are nucleic acid bases selected from diaminopurines and 2-chloro-6-aminopurines.

[0040] The nucleic acid base portion is the letter code for each corresponding nucleic acid base, for example, A, T, G, C , or can be represented by U, where each character may be a modifier of equivalent function. It can contain nucleic acid bases. For example, in the example oligonucleotide, The base portion is selected from A, T, G, C, and 5-methylcytosine (5mC). Combinations of these modifications can also be used. For example, a 5mC LNA nucleoside can be used. It is possible to use 2'-hydroxymethyl(2'-OMe)5mC.

[0041] The term "complementarity" refers to the Watson-Crick base pairing of nucleosides / nucleotides. This explains the ability. The Watson-Crick base pair is guanine (G)-cytosine (C). and adenine(A)-thymine(T) / uracil(U). Oligonucleotides are Modified nucleic acid bases, such as 5-methylcytosine, are often used in place of cytosine. It can contain nucleosides with syns, and therefore the term complementarity is unmodified It is reasonable to include Watson-Crick base pairs between nucleic acid bases and modified nucleic acid bases. Let's understand.

[0042] As used herein, the term "complementarity %" refers to the identification of another nucleic acid molecule (e.g., target nucleic acid). The consecutive nucleotide sequences at the position are complementary at a specific position (i.e., Watson (forming click base pairs), consecutive in nucleic acid molecules (e.g., oligonucleotides) This refers to the number of nucleotides in a given nucleotide sequence as a percentage. Percentages are two types. The number of aligned bases that form pairs between sequences is counted, and the number of nuclei in the oligonucleotide It is calculated by dividing by the total number of rheotides and multiplying by 100. In this type of comparison, Nucleic acid bases / nucleotides that are not aligned (to form base pairs) are called mismatches. It'll be found out.

[0043] The terms "hybridized" or "to hybridize" as used herein It forms hydrogen bonds with base pairs on the opposite strand, thereby creating a double helix. It is understood as two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid). Yes, it exists. The affinity of the bond between two nucleic acid strands is the strength of hybridization. This is often the temperature at which half of the oligonucleotide forms a double helix with the target nucleic acid. This section describes the defined melting temperature (Tm). Under physiological conditions, Tm is strictly speaking... Not proportional to sex (Mergny and Lacroix, 2003, Olignonuc (Leotides 13:515-537). Standard-state Gibbs free energy ΔG ° is a more precise representation of binding affinity, and the dissociation constant (Kd) of the reaction is given by ΔG° = -RT The equation is related by ln(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° for the reaction between the oligonucleotide and the target nucleic acid is This reflects strong hybridization between ligonucleotides and target nucleic acids. ΔG ° is the energy associated with the reaction, where the aqueous solution concentration is 1M and the pH is The value is 7, and the temperature is 37°C. Hybridization of oligonucleotides against target nucleic acids. A spontaneous reaction is a spontaneous reaction, and for spontaneous reactions, ΔG° is less than zero. ° can be measured experimentally, for example, Hansen et al., 1965, Chem. omm.36-38 and Holdgate et al., 2005, Drug Discov T It can be measured using isothermal titration calorimetry (ITC) as described in the oday. Those skilled in the art will know that commercially available equipment is available for measuring ΔG°. Sugimoto et al., 1995, Biochemistry 34:11211-11 216 and McTigue et al., 2004, Biochemistry 43:5388 Using the appropriately derived thermodynamic parameters described in -5405, Sa ntaLucia, 1998, Proc Natl Acad Sci USA.95: By using the nearest neighbor model as described in 1460-1465, Δ G° can also be estimated numerically. Hybridization is used to determine the intended nucleus. Because they have the potential to modulate acid targets, the oligonucleotides disclosed herein For oligonucleotides with a nucleotide length of 10 to 30 nucleotides, the calorie content is less than -10 kcal. It hybridizes with the target nucleic acid, accompanied by an estimated ΔG° value. In some embodiments, The degree or intensity of hybridization is determined by the standard Gibbs free energy Δ Measured by G°. Oligonucleotides are in the range of less than -10kcal, for example, - Less than 15kcal, for example, - Less than 20kcal, for example, 8 to 30 nucleos For oligonucleotides with tide length, the estimated ΔG° value is less than -25kcal. With this, it can hybridize to the target nucleic acid. In some embodiments, 5 nucleotides have a calorific value of -10 to -60 kcal, for example, -12 to -40, for example, -15 -30kcal or -16~-27kcal, for example, -18~-25kcal It hybridizes to the target nucleic acid with a defined ΔG° value.

[0044] In some embodiments, the disclosed oligonucleotide is present in the target nucleic acid molecule. At least 8 nucleos that are complementary to or hybridize with the target sequence. Contains a continuous nucleotide sequence of nucleotides. Continuous nucleotide sequence (and therefore The target sequence is at least eight consecutive nucleotides, for example, 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides, for example, 12 to 25. For example, it consists of 14 to 18 consecutive nucleotides.

[0045] In some embodiments, the disclosed oligonucleotide inhibits or modifies the target nucleic acid sequence. Different or missing functional nucleic acids, such as siRNA, shRNA, or nucleases. It is a gRNA.

[0046] As used herein, the term "expression regulation" refers to UBE3 before administration of oligonucleotides. Oligonucleate that changes the amount of UBE3A RNA / protein when compared to the amount of A. It is understood as a comprehensive term for Otid's abilities. Alternatively, the expression of Adjustments are determined by referring to control experiments in which the disclosed oligonucleotides are not administered. It can be determined. The adjustments affected by oligonucleotides are, namely, SNORD11 By targeting the 5'-terminus of UBE3A-AS located downstream of 5-45 snoRNA, This reduces, eliminates, prevents, weakens, and decreases the inhibition of paternal UBE3A-AS transcripts. It relates to its ability to do or terminate. The adjustment is, for example, shadowed by UBE3A-AS. By removing or blocking the inhibitory mechanism that affects the expression of paternal UBE3A, This can also be visualized as the ability of oligonucleotides to enhance or amplify other effects.

[0047] The disclosed oligonucleotides are modified sugar moieties, i.e., DNA and RNA. One or more nuclei having modifications to the sugar moiety when compared to the ribose sugar moiety found within. It may contain osides. Numerous nucleosides with modifications to the ribose sugar moiety are mainly, To improve specific properties of oligonucleotides, such as affinity and / or nuclease resistance. They are manufactured for this purpose. Such modifications include, for example, hexose rings (HNAs) or biringles. The ribose ring structure is modified by substitution at, C2 on the ribose ring (LNA) and Typically, these have biradical bonds in the C4 carbon ring, or between the C2 and C3 carbon atoms. Includes unlinked ribose rings that typically lack bonding (e.g., UNA). Sugar-modified nucleosides include, for example, bicyclohexose nucleosides (WO2O1) Includes 1 / 017521) or a tricyclic nucleoside (WO2013 / 154798). Modified nucleosides are also, for example, peptide nucleic acids (PNAs) or morpholino nucleic acids. It contains a nucleoside in which the sugar portion is replaced by a non-sugar portion, as in the case of [example].

[0048] Sugar modification also involves substituents on the ribose ring, which are naturally found in DNA and RNA nucleosides. This also includes modifications made by changing the hydrogen atom or a group other than the 2'-OH group. The substitution may be introduced, for example, at the 2', 3', 4', or 5' position. Nucleosides that possess 2' modified nucleosides such as 2' substituted nucleosides This includes sides. In fact, there has been a great deal of interest in the development of 2'-substituted nucleosides. When numerous 2'-substituted nucleosides are incorporated into oligonucleotides, the amount increases. It was found to possess beneficial properties such as enhanced nucleoside resistance and increased affinity. It was done.

[0049] 2'-sugar-modified nucleosides are nucleosides that have substituents other than H or -OH at the 2' position. A cleoside (2'-substituted nucleoside) or a 2'-linked biradical Includes 2'-substituted nucleosides and LNA (2'-4' biradical-bound) nucleos Contains rheosides. For example, 2'-modified sugars enhance oligonucleotides. It can provide binding affinity and / or increased nuclease resistance. 2' substitution Examples of modified nucleosides include 2'-O-alkyl-RNA and 2'-O-methyl -RNA(O-Me), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-fluoro- This is ANA (F-ANA). For further examples, see Freier & Altman. n; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhl mann;Curr.Opinion in Drug Development, 20 00, 3(2), 293-213; and Deleavey and Damha, Che See Mistry and Biology 2012, 19, 937.

[0050] Loc nucleic acid (LNA) nucleosides are the C2' and C4' of the ribose sugar ring of a nucleotide. Modified nucleosides containing a linker group (also called a biradical or bond) between them These nucleosides are referred to in the literature as bridge nucleic acids or bicyclic nucleic acids (BNAs). It is also called ).

[0051] Nuclease-mediated degradation involves complementary nucleotides when forming double helixes with such sequences. This refers to oligonucleotides that can mediate the decomposition of a sequence.

[0052] In some embodiments, oligonucleotides perform nuclease-mediated degradation of target nucleic acids. They may function through, and the oligonucleotides disclosed herein are nucleases, in particular , endonuclease, preferably endoribonuclease (RNase), for example, It can recruit RNase H. It acts via a nuclease-mediated mechanism. Examples of liganonucleotide design typically involve regions of at least 5-6 DNA nucleosides. Oligonucleotides containing affinity-enhancing nucleosides adjacent to one or both sides, For example, gapmers, headmers, and tailmers.

[0053] As used herein, the term "gapmer" refers to one or more affinity-enhancing modified nucleosycetes. The do (Frank) is adjacent at 5' and 3', RNase H recruit oligonucleotide This refers to antisense oligonucleotides that include the ocidal region (gap). The headmer design is described herein. The headmer and tailmer use RNase H It is an oligonucleotide that can be recruited, and here, one of the flanks is missing. It is missing, meaning that only one of the oligonucleotide's terminals is modified for affinity enhancement. Includes Sid. For Headmar, the 3' flank is missing (i.e., the 5' flank). The nucleoside contains affinity-enhancing modified nucleosides, and the tailmer lacks a 5' flank. It is missing (i.e., the 3' flank contains an affinity-enhancing modified nucleoside).

[0054] Conjugate of disclosed oligonucleotides to one or more non-nucleotide moieties For example, the activity, cell distribution, cell uptake, or stability of oligonucleotides. By influencing this, the pharmacology of oligonucleotides can be improved. In one embodiment, the conjugate portion controls the cell distribution of oligonucleotides and bioavailability. By improving irritability, metabolism, excretion, osmosis, and / or cellular uptake, Modify or enhance the pharmacokinetic properties of ligonenucleotides. In particular, conjugates Oligonucleotides may be targeted to specific organs, tissues, or cell types, thereby This can enhance the effects of oligonucleotides in that organ, tissue, or cell type. It can. At the same time, the conjugate oligonucleotides in non-target cell types, tissues, or organs. Rheotide activity, e.g., off-target activity in non-target cell types, tissues, or organs. Alternatively, it can play a role in reducing activity. WO93 / 07883 and W O2013 / 033230 provides the appropriate conjugate parts, which are by reference. This specification incorporates WO2012 / 143379, which targets the transferrin receptor. By conjugating to antibody fragments with affinity, drugs can cross the blood-brain barrier. A method for delivering goods is provided, which is incorporated herein by reference.

[0055] In some embodiments, the non-nucleotide portion (conjugate portion) is a carbohydrate. Cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, Butides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsicum), Selected from the group consisting of (d), or combinations thereof. In some embodiments, The non-nucleotide portion facilitates the delivery of antibodies or antibody fragments, for example, across the blood-brain barrier. Antibodies or antibody fragments that target the transferrin receptor, particularly antibodies or antibody fragments that target the transferrin receptor. Piece.

[0056] The term "target" refers to any individual that is the target of administration or treatment. The target is a vertebrate. For example, it could be a mammal. Therefore, the subject could be a human or animal patient. Term "patient" " " refers to a clinician, for example, a patient receiving treatment from a doctor.

[0057] The term "therapeutic effectiveness" means that it is effective in improving one or more causes or symptoms of a disease or disorder. This refers to the amount of the composition used, in a moderate quantity. Such improvements only require reduction or modification. Therefore, exclusion is not necessarily required.

[0058] The term "pharmaceutically acceptable" means that it is within the bounds of sound medical judgment and does not involve reasonable benefit / risk. Depending on the risk level, excessive toxicity, inflammation, allergic reactions, or other problems or complications may occur. Compounds and materials suitable for use in contact with human and animal tissues without the need for other substances. This refers to compositions and / or dosage forms.

[0059] The term "treatment" means to cure, alleviate, or stabilize a disease, pathological condition, or disorder. This term refers to the medical management of a patient, intended to prevent or eliminate aggressive treatment. In other words, it includes treatment specifically managed to improve a disease, pathological condition, or disorder. Furthermore, symptomatic treatment, that is, treatment aimed at eliminating the cause of the disease, pathological condition, or disorder. This also includes managed treatment. In addition, this term refers to temporary palliative care, i.e., disease, pathology. Treatment designed to alleviate symptoms rather than cure a medical condition or disorder; preventive treatment. Treatment, that is, minimizing the onset of related diseases, pathological conditions, or disorders, This includes treatments that are managed to partially or completely inhibit the disease; and supportive treatments, i.e., Another specific treatment managed to improve the associated disease, pathological condition, or disorder. This includes treatments used to supplement the existing treatments.

[0060] The term "hinder" can be evaluated at a specific point in time, as a person skilled in the art would recognize. This refers to a decrease in activity, response, state, disease, or other physiological parameters, and that In some embodiments, the inhibition is a delay in initiation or a reduction in frequency. It may include or may include. In some embodiments, inhibition is activity, response, state This may include, but is not limited to, the complete elimination of the condition or disease. For example, when compared to natural or control levels, activity, response, condition, or disease This may include a 10% decrease. Therefore, the decrease, when compared to natural or control levels, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount It could decrease.

[0061] Antisense oligonucleotides (ASOs) are derived from the SNORD115 host gene transcript. Designed to target the exon at the 5' end of AF400500, this is S NORD115-46, SNORD115-47, SNORD115-48, and SN It contains ORD109B snoRNA and UBE3A antisense transcript (UBE3A- It is thought to represent the 5' end of AS. In particular, the target nucleic acid is human chromosome 15, human genome. U, corresponding to positions 25,511,577 to 25,516,681 on assembly hg19 It may be the 5'-terminus of BE3A-AS. In some embodiments, the target nucleic acid is UBE It is one of the five exons located in the 5'-terminus of 3A-AS, and this is 25 ,511,577~25,511,761 (Exxon 1), 25,512,059~25 ,512,191 (Exxon 2), 25,513,476~25,513,600 (Exxon 2) Exxon 3), 25,514,752~25,514,880 (Exxon 4), and 25, This can correspond to positions 516,565 to 25,516,681 (Exxon 5).

[0062] Therefore, in some embodiments, the target nucleic acid is ATGATGATATGGA AGAAAAGCACTCTTTGGCCTGTTGTGACTGGGACAGTTGA CAGCACCCAGGTGTCCTTTAATGAAAATGCTCTTGACACC AATGCATCCTAGCATCACAGCTTCAGGAAGCCTTCTCAAG TGTGCATGGGGAGTACTATGTCTTTCATCAATAATGAAAT This is CTTCTGATTTG (exon 1, sequence number 1).

[0063] In some embodiments, the target nucleic acid is TAAGACATGCTGCCAAGAGA TGTGCCATTCTATTATAAAAGATCAGTAGCTTCCTTTACC GACGTGTATATTCTATTCTAGAACATTGAGCTATGGAAGAC TCCCACCTAAGGGAATTAGTTTTACACCTTCAG (Exxon 2, This is sequence number 2).

[0064] In some embodiments, the target nucleic acid is ATAAAGACTGCTGAGAAGAG CACCCTCTGGTGTTGTCACAGAGGCAAGTGCTACCGCACA GGCATGCTGCAGTGAATTTAACTGATCCTCTGTCCCTGCA ACCGTTGTTTAAGGATGCTATTCTG (exon 3, sequence number 3) ru.

[0065] In some embodiments, the target nucleic acid is AAAAGACTGTGGAGGAAGAAA ACCCTTTACCCTGTTGTTCAGGGAGAAACTGACACCACTC AACTGCCTGGCACTGAAAATGTGGCATCCAGTCCACTTTA CCATCAGTGTTTAAGGAAACCATCTCTG(Exon-4, Sequence ID 4) )

[0066] In some embodiments, the target nucleic acid is ATAAGGATGACTGAGGAAGA GTACTCTTTGGCTTGTTGACACCAGCACAGCTGACACACC CAGATATCTGTTTGGTCTCCTGTGAACTTTCAACCAGGAT This is TTAAGGATGCCACTCTG (exon 5, sequence number 5).

[0067] In some embodiments, the disclosed ASO is the nucleic acid sequence TAGAGGTGAAGGC It contains CAGGCAC(ASO-1, Sequence ID 6).

[0068] In some embodiments, the ASO is the nucleic acid sequence GTACTCTTCCTCAGTCAT It contains CC (ASO-2, Sequence ID 7).

[0069] In some embodiments, the disclosed ASO is the nucleic acid sequence TGTCAGTTTCTCC It contains CTGAACA (ASO-3, Sequence ID No. 8).

[0070] In some embodiments, the disclosed ASO is the nucleic acid sequence TAGAATGGCACAT It contains CTCTTGG (ASO-4, Sequence ID 9).

[0071] In some embodiments, the disclosed ASO is the nucleic acid sequence GTTTCTTCCTCC It contains ACAGTCT (ASO-6, Sequence ID 10).

[0072] In some embodiments, the disclosed ASO is the nucleic acid sequence CTGGTGTCAACAA It contains GCCAAAG (ASO-7, Sequence ID No. 11).

[0073] Further ASOs that may be the 3'-terminal target exon 1 of the SNORD115 region are Provided in Table 1 below, an example of the 3'-terminal target exon 2 of SNORD115. The typical ASO is provided in Table 2 below. Target exon of the 3'-terminus of SNORD115 3. Exemplary ASOs that can be 3 are provided in Table 3 below. SNORD115 3'-end Exemplary ASOs that may be end target exon 4 are provided in Table 4 below. SNORD Exemplary ASOs that may be the 3'-terminal target exon 5 of 115 are provided in Table 5 below. It can be done. [Table 1] [Table 2] JPEG0007863362000003.jpg233127 [Table 3] [Table 4] JPEG0007863362000006.jpg233143JPEG0007863362000007.jpg23674 [Table 5] JPEG0007863362000009.jpg23362

[0074] The disclosed oligonucleotides enhance the expression of paternal UBE3A, particularly in neuronal cells. It is possible to regulate the induction or upregulation of paternally expressed UBE3A. The regulation is This is achieved by hybridizing to the 5'-terminus of UBE3A-AS. In embodiments, the oligonucleotides disclosed herein have a ΔG of less than -10 kcal. °, for example, -10 to -60 kcal, for example, -12 to -40, for example, -15 to -3 0 kcal or -16 to -27 kcal, for example, a ΔG° of -18 to -25 kcal Consequently, it hybridizes to a sub-sequence of the target nucleic acid of sequence number 1.

[0075] In some embodiments, the disclosed oligonucleotide is used in saline or non-target oligonucleotides. Compared to UBE3A expression levels in neuronal cells treated with gonucleotides Treatment with at least 20%, more preferably with saline or non-target oligonucleotides. Compared to the expression level of UBE3A in the neuronal cells, at least 30%, 3 5%, 40%, 45%, 50%, 55%, 60%, 80%, 100%, 120%, 150 %, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230 UBE3A expression can be increased by only %, 240%, or 250%. In the embodiments, the disclosed oligonucleotide is a saline solution or a non-target oligonucleotide. Downstream SNHG1 of SNORD1115-45 in neurons treated with cithin 4. At least 20% compared to the level of the transcript, more preferably saline or unmarked. SNORD1115-45 in neuronal cells treated with target oligonucleotides Compared to the levels of downstream SNHG14 transcripts, at least 30%, 40%, 50%, 60% %, 70%, 80%, 90%, or 95% only, downstream SN of SNORD115-45 The level of HG14 transfer material can be reduced.

[0076] The disclosed target modification using oligonucleotides involves sequential nucleotides of oligonucleotides. It is driven by hybridization between the rheotide sequence and the target nucleic acid. In this embodiment, the disclosed oligonucleotide is an oligonucleotide with a target nucleic acid. This includes mismatches between them. Despite the mismatches, hybridization to the target nucleic acid is performed. The expression may still be sufficient to show the desired adjustment of UBE3A expression. The reduced binding affinity is conveniently due to the presence of LNA within the oligonucleotide sequence. This can increase the binding affinity to target 2'-modified nucleosides, including those containing [specific compound]. It can increase the number of nucleotides in the oligonucleotide and / or increase the number of repairs It is filled with adorned nucleosides.

[0077] The disclosed antisense oligonucleotide is UBE3A-A disclosed herein. For one of the five exons located in the 5'-terminus of S, at least 90% of the phase Complementarity, for example, at least 91%, for example, at least 92%, for example, at least 93% %, for example, at least 94%, for example, at least 95%, for example, at least 96% For example, having at least 97%, for example, at least 98%, or 100% complementarity. It can have a continuous nucleotide sequence with a nucleotide length of 10 to 30 nucleotides. .

[0078] Oligonucleotide design involves patterns of nucleoside sugar modifications in oligonucleotide sequences. This refers to the disclosed antisense oligonucleotides, which are sugar-modified nucleosides. It may contain, and may also contain, DNA, RNA, or arabinonucleotide (ANA) nucleosides. In some embodiments, oligonucleotides are sugar-modified nucleosides and DNA. It contains a nucleoside. In some embodiments, the oligonucleotide is a sugar-modified nucleoside. It includes creosides and RNA nucleosides. In some embodiments, oligonucleotides Tide contains sugar-modified nucleosides and ANA nucleosides.

[0079] In some embodiments, the oligonucleotide has at least one modified nucleus Osids, for example, at least 2, at least 3, at least 4, at least 5, At least 6, at least 7, at least 8, at least 9, at least 10 , at least 11, at least 12, at least 13, at least 14, less Each contains 15 or at least 16 modified nucleosides. In one embodiment, Oligonucleotides consist of 1 to 10 modified nucleosides, for example, 2 to 9 modified nucleosides. Modified nucleosides, e.g., 3 to 8 modified nucleosides, e.g., 4 to 7 modified nucleosides A modified nucleoside, for example, containing 6 or 7 modified nucleosides.

[0080] In some embodiments, the oligonucleotide has at least one modified nucleus. Includes osidic bonds. In some embodiments, nucleos within a continuous nucleotide sequence. The interside bond is a phosphorothioate or boranophosphate nucleoside bond. .

[0081] In some embodiments, the disclosed antisense oligonucleotides are one or more It contains sugar-modified nucleosides, for example, 2'-sugar-modified nucleosides. Preferably The disclosed antisense oligonucleotides are one or more LNA nucleosides or It contains a 2'-sugar-modified nucleoside, where the 2' position is -F;-CF3,-CN,- N3, -NO, -NO2, -O-(C1-C10 alkyl), -S-(C1-C10 alkyl) Kill), -NH-(C1-C10 alkyl), or -N(C1-C10 alkyl)2; -O-(C2-C10 alkenyl), -S-(C2-C10 alkenyl), -NH-(C 2-C10 alkenyl), or -N(C2-C10 alkenyl)2;-O-(C2-C 10-alkynyl), -S-(C2-C10alkynyl), -NH-(C2-C10alkynyl) Nyl), -N(C2-C10 alkynyl)2, -O--(C1-C10 alkylene)-O --(C1-C10 alkyl), -O-(C1-C10 alkylene)-NH-(C1-C 10 alkyl), -O-(C1-C10 alkylene)-NH(C1-C10 alkyl)2 -NH-(C1-C10 alkylene)-O-(C1-C10 alkyl), and -N( C1-C10 alkyl)-(C1-C10 alkylene)-O-(C1-C10 alkyl) It is substituted by a substituent independently selected from the group consisting of the following.

[0082] In some embodiments, the disclosed oligonucleotide is at least one LNA A unit, for example, 1, 2, 3, 4, 5, 6, 7, or 8 LNA units, for example , 2 to 6 LNA units, for example, 3 to 7 LNA units, 4 to 8 LNA units Includes a nit, or 3, 4, 5, 6, or 7 LNA units. Several implementations In this state, all modified nucleosides are LNA nucleosides. In the application form, LNA contains a -L- 2'-4' biradical bond, where -L- is - In some embodiments, the structure is O-CH2-, where -CH2- is optionally substituted. LNA contains a -L- 2'-4' biradical bond, where -L- is -O-CH2 - In some embodiments, LNA contains a -L- 2'-4' biradical bond. In the formula, -L- is -O-CH(Et)-. In a further embodiment, oligonucleotides Cleotide is a beta-D-oxy-LNA and the following LNA unit: beta-D or thio-LNA, amino-LNA, oxy-LNA, which have either an alpha-L configuration. , and / or ENA, or one or more combinations thereof may include both. In a further embodiment, all LNA cytosine units are 5-methylcytosine. In some embodiments, oligonucleotides or sequential nucleotides are used. The column has at least one LNA unit at the 5' end of the nucleotide sequence, and at the 3' end It has at least two LNA units.

[0083] In some embodiments, the disclosed oligonucleotide recruits RNase H It can be done. In some embodiments, oligonucleotides are simply It has a gapmer design or structure, also known as a "gapmer." In terms of structure, the oligonucleotide has at least three distinct structural elements in the '5->3' direction. This includes the region, 5'-flank, gap, and 3'-flank, FG-F'. In the calculation, the flanking regions F and F' (also called the wing regions) are UBE3A- It contains a continuous stretch of modified nucleosides that are complementary to the AS target nucleic acid, while So, the gap region, G, is where the nucleic acid forms a double strand when the oligonucleotide forms a double strand with the target nucleic acid. Rease, preferably endonuclease, for example, RNase, for example, RNase A nucleate contains a continuous stretch of nucleotides that can recruit H. Nucleosides that can recruit RNase H, in particular, are DNA, ALF Selected from the group consisting of α-L-oxy-LNA, 2'-fluoro-ANA, and UNA Obtained. Regions F and F' adjacent to the 5' and 3' ends of region G are preferably non-nucleated. Rease-recruited nucleosides (nucleosides with a 3'-end structure), more preferably It comprises one or more affinity-enhancing modified nucleosides. In some embodiments, the 3' fur The nucleotide is at least one LNA nucleoside, preferably at least two LNA nucleotides. Contains a cleoside. In some embodiments, the 5' flank contains at least one LNA Contains a nucleoside. In some embodiments, both the 5' and 3' flanking regions. This includes an LNA nucleoside. In some embodiments, all of the flanking region The nucleoside is an LNA nucleoside. In other embodiments, the flanking region is Both LNA nucleosides and other nucleosides (mixed flanks), for example, DNA Nucleosides and / or non-LNA modified nucleosides, e.g., 2'-substituted nucleosides It may contain rheosides. In this case, the gap is an affinity-enhancing modified nucleoside, preferred For example, LNAs, such as beta-D-oxy-LNA, are adjacent at their 5' and 3' ends. At least 5 RNase H recruit nucleosides (nucleosides with a 2' end structure) Defined as a continuous sequence of osides (preferably DNA). As a result, gaps Nucleosides in the 5' flanking region and 3' flanking region adjacent to the region are modified. The decorated nucleoside, preferably a non-nucleaselic root nucleoside. In oligonucleotides with mixed flanks containing DNA, the 5' and 3' nuclei A leoside is a modified nucleoside.

[0084] Methods for producing the disclosed oligonucleotides are known. In some cases The method then uses phosphoramidite chemistry (for example, Caruthers et al., 19 87, Methods in Enzymology vol.154, pages 2 See 87-313). In a further embodiment, the method involves a series of nucleotides. This further includes reacting the sequence with a conjugate portion (ligand).

[0085] In some embodiments, one or more modified nucleoside bonds containing a chiral atom Oligonucleotide methodologies that provide stereochemical control are used. For example, these The methodology is incorporated by reference in WO2010 / 064146, WO2014. / 012081, WO2015 / 107425, WO2016 / 079183, WO20 16 / 079181, WO2016 / 096938, WO2017 / 194498, oyo Please refer to WO2018 / 177825.

[0086] One skilled in the art will recognize that the useful nucleic acids provided by the present disclosure include those that conserve and / or express the sequences of the oligonucleotides described herein. In some embodiments, such nucleic acids may be, or may include, a vector suitable for delivery to cells (e.g., microbial cells, e.g., for production, and / or mammalian cells, e.g., for therapy) and / or for replication and / or expression in cells. One skilled in the art is aware of various techniques (e.g., amplification such as by polymerase chain reaction, cleavage such as by restriction digestion, ligation such as by gap repair either in vitro or in vivo, etc.), and may utilize one or more of these recombinant nucleic acid techniques. One skilled in the art is aware of various techniques (e.g., amplification such as by polymerase chain reaction, cleavage such as by restriction digestion, ligation such as by gap repair either in vitro or in vivo, etc.), and may utilize one or more of these recombinant nucleic acid techniques. One skilled in the art is aware of various techniques (e.g., amplification such as by polymerase chain reaction,

[0087] cleavage such as by restriction digestion, ligation such as by gap repair either in vitro or in vivo, etc.), and may utilize one or more of these recombinant nucleic acid techniques. Pharmaceutical compositions are also disclosed that include any of the foregoing oligonucleotides and / or oligonucleotide conjugates, and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant (excipient). Pharmaceutically acceptable diluents include phosphate buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the diluent is artificial cerebrospinal fluid (aCSF).

[0088] The disclosed oligonucleotides may be mixed with pharmaceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on a number of criteria including, but not limited to, the route of administration, the extent of the disease, or the dose being administered. The disclosed oligonucleotides may be mixed with pharmaceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on a number of criteria including, but not limited to, the route of administration, the extent of the disease, or the dose being administered.

[0089] One skilled in the art is aware of storage and / or administration for nucleic acid therapies such as oligonucleotide therapies Recognize various useful formulation strategies. For example, see Pushpendra et al., " Nucleic Acids as Therapeutics", From Nucl eic Acid Sequences to Molecular Medicine s, ed. Erdmann and Barciszewski, Springer-Ve rlag, 2012; Juliano "Delivery of Therapeut ic Oligonucleotides" Nuc.Acids.Res.44:65 18, 2016, etc.

[0090] In some embodiments, the oligonucleotide is formulated as a prodrug. In particular, for oligonucleotide conjugates, when the prodrug is delivered to the site of action, e.g. , the target cell, the conjugate moiety can be cleaved from the oligonucleotide .

[0091] A method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition disclosed herein to a subject having or suspected of having the disease is also disclosed.

[0092] The use of the disclosed oligonucleotides for the manufacture of a medicament for treating a disorder as referred to herein or for a method of treating a disorder as referred to herein is also disclosed.

[0093] The disclosed pharmaceutical compositions are topical (e.g., to the skin, inhalation, eye, or ear), or Enteral (e.g., orally or via the gastrointestinal tract), or parenteral (e.g., intravenously) It may be administered by subcutaneous, intramuscular, intracerebral, intraventricular, or intrathecal administration. In the embodiments, the disclosed pharmaceutical composition is administered intravenously, intraarterially, subcutaneously, intraperitoneally, or intramuscularly. This includes intravenous injection or infusion, intrathecal or intracranial administration, such as into the brain or ventricles. It is administered via parenteral routes. In some embodiments, the oligonucleotide is delivered to the brain. Alternatively, it is administered by intracerebroventricular injection. In another embodiment, an active oligonucleotide is used. Alternatively, an oligonucleotide conjugate is administered intrathecally. Several embodiments So, the pharmaceutical composition is administered intracranial (intracerebral cisternae magna) It is administered by injection.

[0094] In some embodiments, AS therapy using the pharmaceutical compositions described herein is A It is administered to individuals(s) who have or are suspected of having S. Several implementations Morphologically, the subjects have genetic features associated with a deletion in the maternal UBE3A gene. It has been determined. In some embodiments, the AS-related genetic features are maternal deletions or , or including the same. In some embodiments, the AS-related genetic features are uniparental diso It is or includes me. In some embodiments, the AS-related genetic features are The UBE3A mutation, or a mutation containing it. In some embodiments, AS-related genes. The characteristic feature is either an imprinting defect or includes one.

[0095] In some embodiments, the subject is one or more developmental histories associated with AS and / or laboratory findings, for example, determined to have one or more of the following characteristics Present: (i) Normal prenatal and birth history with normal head circumference and no major congenital anomalies; History; (ii) Difficulty breastfeeding during the neonatal and / or infant period; (iii) Evidence of developmental delay by 6 - 12 months of age, sometimes associated with low tone of the trunk; State; (iv) Unstable limb movements and / or increased laughter; (v) Development is delayed but progresses (no loss of skills); (vi) Normal metabolic, blood, and chemical laboratory profiles; (vii) Structurally normal brain (may have mild cortical atrophy or myelin formation abnormalities) when evaluated using MRI or CT.

[0096] Alternatively or additionally, in some embodiments, the subject is determined to exhibit one or more clinical features consistently associated with AS, such as one or more of the following: As follows: (i) Delayed development, functionally significant; (ii) Motor or balance disorders, usually ataxia of gait and / or tremor movements of the limbs. In some embodiments, such motor disorders may be mild. In some embodiments, such motor disorders do not present as obvious ataxia but may be, for example,前倾, instability, clumsiness, or quick jerky movements, or include them; (iii) Unusual behavior: increased frequency of laughter / smiling; apparently happy appearance; easily excitable personality, often accompanied by movements of flapping or waving the hands in excitement; Any combination of hyperactive behaviors (iv) Speech disorders, such as absence or minimal use of words; alternatively or ​​​Additionally, sensitivity and nonverbal communication skills are more important than verbal skills. stomach.

[0097] Alternatively or additionally, in some embodiments, the subject is frequently (for example, at times) in AS. Approximately 80% of cases are associated with one or more clinical features, for example, one of the following: It has been decided that the above will be shown: (i) Head circumference growth is delayed and disproportionate, usually resulting in 2 years Cerebellar dysfunction occurs by this time (≤2S.D. of normal OFC). In some embodiments, the cerebellum The symptoms are more pronounced in individuals with 15q11.2-q13 deletion; (ii) Epileptic seizures, usually occurring by age 3. In some embodiments, The severity of seizures may decrease with age, but nevertheless, some implementations In this condition, epileptic seizure disorders can persist into adulthood. (iv) Abnormal EE with characteristic patterns known in the art G. In some embodiments, EEG abnormalities occur in the first two years of life and are clinically distinctive. It may precede other symptoms and may not correlate with clinical epileptic seizure events.

[0098] Alternatively or additionally, in some embodiments, the subject is occasionally (for example, at time) in AS. Approximately 20% to 80% of cases are associated with one or more clinical features, such as the following: It has been decided to show one or more of the following: (i) Flat back of the head (ii) Occipital sulcus (iii) Sticking out the tongue (iv) Tongue protrusion; suction / swallowing difficulties (v) Problems with breastfeeding in infancy and / or hypotonia of the trunk (vi) Maxillary prognathism (vii) A wide-open mouth and widely spaced teeth (viii) Drooling frequently (ix) Excessive chewing / mouth movements (x) Strabismus (xi) Skin lacking pigment, light-colored hair and eye color, in some embodiments, home It is determined by comparison with the family and is typically only seen in cases of deletion. (xii) Excessive deep tendon reflexes of the lower limbs (xiii) The elevated, curved position of the arms, especially during walking. (xiv) A wide gait with pronated or everted ankles. (xv) Increased susceptibility to heat (xvi) Abnormal sleep-wake cycles and reduced need for sleep. (xvii) Interest in / fascination with water; certain types of paper and plastic, etc. Being fascinated by objects that make a rustling sound (xviii) Unusual behavior related to food (xix) Obesity (in older children) (xx) Scoliosis (xxi)Constipation

[0099] In some embodiments, nucleic acid therapies such as those described herein (e.g., ASOs) are used. Therapeutic regimens for the treatment of AS using oligonucleotide therapy are described herein. One of the pharmaceutical compositions containing and / or delivering oligonucleotides as described above. The above dosage, or including it.

[0100] In some embodiments, the subject to which the provided therapeutic regimen is implemented is, for example, one Other nucleic acid therapies (e.g., one or more other oligonucleotides targeting UBE3A-AS) You are currently receiving, or have previously received, one or more other AS therapies, including leotide. , WO2014004572A3, US9617539B2, US2017036259 See 2A1 and EP2864479B1.

[0101] In some embodiments, the subjects to whom the provided therapy regimen is administered are those who undergo one or more treatments. Have you previously suffered or are currently suffering from epileptic seizures and / or are receiving anti-epileptic seizure therapy? Currently receiving, or previously received. For example, in some embodiments, the subject is one or more. The above are valpric acid, clonazepam, phenobarbital, topiramate, carbamazepine, Lamotrigine, levetiracetam, phenytoin, zonisamide, ethosuximide, gabapentin Chin, felbatame, oxycarbazepine, tranxen (t ranxene, ACTS, nitrazepam, pregabalin, misolin, vigabatrin Have previously received, or may have received. In some specific embodiments, the subject is , one or more barpuric acid, clonazepam, phenobarbital, topiramate, carbamax Have you previously received or are currently receiving zepine, lamotrigine, and / or levetiracetam? It's okay to be there.

[0102] Alternatively or additionally, in some embodiments, the subject may be, for example, a ketogenic diet, low Have you previously received or may have received dietary therapy such as blood glucose index therapy?

[0103] Furthermore, alternatively or additionally, in some embodiments, the subject is a vagus nerve stimulator. Have you previously received, or may have received, treatment using this method?

[0104] As will be apparent to those skilled in the art who read this disclosure, the treatment methods provided are as described herein. Oligonucleotides and further therapies (e.g., alternative oligonucleotides) (one of the following: cytotoxic and / or antiepileptic therapy and / or one or more other therapeutic interventions) This includes performing both, and as a result the subject is a combination therapy (for example, the same as them) Sometimes exposure occurs (for example, through repeated administration). Intrathecal administration Use of oligonucleotides disclosed herein for the manufacture of pharmaceuticals in dosage forms It will also be disclosed.

[0105] Disclosed herein for the manufacture of pharmaceuticals in dosage forms for intracerebral or intraventricular administration The use of ligonenucleotides will also be disclosed.

[0106] Oligonucleates disclosed herein for the manufacture of pharmaceuticals in a dosage form for intraventricular administration The use of Ochido will also be disclosed.

[0107] In some embodiments, the oligonucleotides disclosed herein are used in conjunction with other therapeutic agents. It is used in combination therapy. The therapeutic agent may be, for example, an anticonvulsant.

[0108] Numerous embodiments of the present invention are described. Nevertheless, the spirit and scope of the invention are described. It will be understood that various modifications are permitted as long as they do not deviate from the established framework. Other embodiments are within the scope of the following claims. [Examples]

[0109] Example 1: result RNA sequencing analysis of mouse and human CNS revealed the stability of UBE3A-AS and / or identified regions considered important for transcription. Further analysis of the regions. This demonstrated low-level sequence conservation between mice and humans (Figures 1A-1D).

[0110] Based on these findings, to target specific regions in the Ube3a-AS transcript A mouse-specific ASO was designed (Table 6 and Figure 2A). AS targeting this region To test whether O reactivates the expression of the paternal Ube3a allele, primary hippocampal ni The culture medium of ureon was produced from the Ube3aYFP reporter mouse model (Ube3a+ / YFP;Figure 2B), on day 7 (DIV) in vitro, the control ASO[ASO-C( (10uM, n=3), three ASOs targeting Ube3a-AS [ASO-1.1, ASO-1.2, ASO-3.1 (1 μM, 5 μM, and 15 μM, n=3), Each patient was treated with ASO-B (1 μM, 5 μM, and 15 μM, n=3). The neurons were treated with topotecan [topo(300nM, n=3)], and the negative was bihik The control group was Veh (1%, n=3); Figure 2C. Three days after treatment (10DIV), immunity was reduced. Using fluorescence imaging, paternal Ube3aYFP protein levels in individual cells This was quantified. Compared to controls (ASO-C and Veh), each treatment was substantially paternal Ub Increased e3aYFP protein levels, ASO-1.1 (15 μM), ASO-3.1 (15 μM), and similar levels were achieved with topotecan treatment (Figures 2D and 2E). was

[0111] Next, a human-specific ASO was designed to target this region, which is a human ASO. Non-polymorphic regions and regions conserved in macaques (rhesus macaques and crab-eating macaques) It included four ASOs targeting 100% (Table 7 and Figure 3A). Human induced pluripotency stem Cellular progenitor cells (iPSCs) differentiate into GABAergic neurons during 14DIV. Next, control ASO [ASO-C (10 μM, n=3)], topotecan [Topo (1 μM)]. (n=2), as well as six ASOs targeting UBE3A-AS [ASO-1, AS O-2, ASO-3, ASO-4, ASO-5, and ASO-6 (10 μM, n=3) It was treated with ]. Furthermore, AS targeting the intron region downstream of SNORD109B O was included (ASO-7). Six days after treatment (20DIV), RNA was extracted from the neuron. By separating the steady-state RNA levels of UBE3A-AS and UBE3A, compared to the control treatment, the levels were significantly reduced. Determined (Figure 3B). Except for ASO-7, each ASO significantly increased the UBE3A-AS RNA level. By reducing the amount of ions, ASO-2 and ASO-4 had the greatest effect (Table 8 and Figure 3C). UBE3A RNA levels also increased after treatment for each ASO (Figure 3D).

[0112] Considering its effect on UBE3A-AS RNA levels, the potency of ASO-4 is also further It was investigated. GABAergic iPSC-derived neurons showed 10 points in 14DIV. The 1 / 2 log dose curve of ASO-4, and as a positive control, and for comparison between treatments. Patients treated with topotecan [1nM, 3nM, 10nM, 30nM, 100nM, 30 0 nM, 1 μM, 3 μM, 10 μM, and 30 μM (ASO-4, n=6; topotecan) (n=2). In 20DIV, the steady-state RNA level of UBE3A-AS was measured. The dose-response curve is approximated by the IC50 and E maxima (i.e., maximum UBE3A-AS inhibition). The following values ​​were estimated (Table 9 and Figure 4A). The dose-response curves for ASO-4 and topotecan were significant. Unlike (parallel test: F(3,145)=11.2, p<0.0001), therefore, relatively Efficacy was not estimated. Equivalence tests were performed on the IC50 and E of ASO-4 and topotecan. This showed that the maximum was not equivalent [ASO-4 / Topotecan IC50 ratio:=1.2 (reliable) Lower limit of confidence = 1.1; Upper limit of confidence = 1.3); Maximum ratio of E = -4.1 (Lower limit of confidence = -12.9; Trust (Upper limit = 4.8).

[0113] Next, SNORD116, IPW, and SNORD are located upstream of the ASO-4 target region. Regarding RNA 115 and SNORD109A, the efficacy of ASO-4 and topotecan The results were examined (see Figure 1A). Except for SNORD116, ASO-4 was IPW Significant effect on RNA levels of SNORD115 and SNORD109A / B. It had a dose-dependent mechanism, but it was not dose-dependent. In contrast, topotecan had SNORD11 6. For IPW, SNORD115, and SNORD109 A / B RNA levels A significant effect was observed, and this was dose-dependent (Table 10 and Figures 4B-4E). Except for the concentrations of topotecan (3 μM, 10 μM, and 30 μM; Figure 4F), ASO-4 Both and topotecan increased total UBE3A RNA levels in a dose-dependent manner.

[0114] At a later stage of iPSC-derived neuronal differentiation, the efficacy of ASO-4 is further It was investigated. GABAergic iPSC-derived neurons showed better control in 59DIV compared to AS. O[ASO-C, 10 μM (n=3)] and ASO-4[1 μM, 5 μM, and 10 μM] Treatment with μM (n=3) resulted in steady-state RNA levels of UBE3A-AS and UBE3A. The uric acid was measured as described above (Figure 4G). Treatment with ASO-4 at an earlier time point was performed. Unlike neurons, the RNA levels of UBE3A and UBE3A-AS are highly inverse. They were proportional (Figures 4H and 4I). For example, relative to UBE3A-AS RNA levels. The effect of ASO-4 (10 μM) was similar between neurons treated with 14 and 59 DIV. [20DIV:UBE3A-AS:↓87%(95% confidence interval (CI):80~ 95%); 65DIV:↓81% (95% CI:74~88%)], UBE3A R The effect of ASO-4 on NA levels was substantially increased in neurons treated with 59DIV. [20DIV: ↑30% (95%CI: 16~44%); 65DIV: ↑86%] (95% CI: 59%~113%).

[0115] Next, ASO-4 (ASO-4.1, ASO-4.2, ASO-4.3, and AS The target sequence of O-4.4) and two other target regions, ASO-3 (ASO-3.1 and To optimize ASO-3.2) and ASO-6 (ASO-6.1) (Table 11) Further ASOs targeting the 5'-terminus of UBE3A-AS were designed. For comparative purposes, ASO-4 was manufactured by two different distributors (ASO-4.S , Sigma;ASO-4.I, Integrated DNA Technologi es). Human iPSC-derived neurons (GABAergic) were 5 points in 14DIV. The 1 / 2 log dose curves of ASO-3.1, ASO-3.2, ASO-4.S, and AS O-4.I, ASO-4.1, ASO-4.2, ASO-4.3, ASO-4.4, and And treated with ASO-6.1 [30nM, 100nM, 300nM, 1μM (n=6)] In 20DIV, the IC50 and E maximum of each ASO were estimated as described above. (Figures 5A-B and Table 12). The dose-response curves were similar among ASOs (parallel study: F(16) (513) = 1.6, p = 0.06), ASO-4 and ASO-6.1 are the best relative It was effective (Table 13). A significant difference was observed between ASO-4.S and ASO-4.I. It wasn't there.

[0116] At a later point in the differentiation of iPSC-derived neurons, ASO-4 and ASO- The efficacy of 6.1 was further investigated. GABAergic iPSC-derived neurons showed 29D In IV, treatment was performed with ASO-4 and ASO-6 using a 10-point 1 / 2 log dose curve. [1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM, 3μM] , 10 μM, and 30 μM (n=3). IC50 and The maximum E was estimated as described above (Figures 5C-D and Table 14). AS of the dose-response curve. O-4 and ASO-6.1 were not similar (parallel testing: F(3,172)=22). 7. p<0.0001). Equivalence tests showed that ASO-4 and ASO-6.1 had equivalent efficacy. It was found to have different maximum E values ​​[ASO-6.1 / ASO-4 ratio: IC5 0 = 1.03 (Confidence lower limit = 1.0; Confidence upper limit = 1.1); E maximum = -1.3 (Confidence lower limit = (-2.6; confidence limit = -0.08), ASO-6.1 is the maximum level of UBE3A-AS. It had inhibition of UBE3A RNA levels. ASO-4 and ASO-6.1 The effects were similar, with each treatment increasing RNA levels in a dose-dependent manner (Figure 5D).

[0117] ASO-4 and ASO-6.1 are glutamatergic iPSC-derived neurons. It was also investigated. Glutamate-mediated iPSC-derived neurons were found in 14DIV. They were treated with ASO-4 and ASO-6.1 on a 10-point 1 / 2 log dose curve. [1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM, 3μM, 1 0 μM and 30 μM (n=3). IC50 and E50 of each ASO in 20DIV. The large was estimated as described above (Figures 5E-F and Table 15). ASO- of the dose-response curve 4 and ASO-6.1 were similar and not significantly different (parallel study: F(3,165) = 1.9, p=0.1), ASO-6.1 had the highest relative potency (Table 16). As described above, ASO-4 and ASO-6.1 cause UBE3A RN in a dose-dependent manner. Although A levels were increased (Figure 5F), the high levels at each concentration could not be attributed to treatment. A degree of variation existed (R² = 0.17).

[0118] conclusion Towards the development of therapies for AS, specific regions in mouse and human neurons The targeted ASO inhibits Ube3a-AS / UBE3A-AS, and paternal Ube3a / U Experiments were conducted to determine whether the BE3A allele expression was reactivated. The findings suggest that ASOs targeting this region in mouse and human neurons are potent. It exhibits antisense activity and demonstrates the ability to reverse Ube3a / UBE3A imprinting.

[0119] Two of the three ASOs that target Ube3a-AS (ASO-1.1 and ASO) -3.1) The expression of the paternal Ube3a allele in mouse neurons was reduced to an optimal concentration. It was reactivated to a level similar to that achieved with Potecan (300nM).

[0120] Similarly, each of the human-specific ASOs is related to UBE3 in human iPSC-derived neurons. Significantly reduced the steady-state RNA levels of A-AS and increased the concentration of ASO-4 and AS O-6.1 almost completely eliminated UBE3A-AS expression. ASO-4 and ASO- 6.1 Considering that the target region is 100% conserved between humans and macaques, The efficacy of ASO is observed in either cynomolgus monkeys or rhesus monkeys / macacas in vivo. This can be investigated. Unlike Topotecan, ASO-4 is upstream SNORD116, For IPW, SNORD115, or SNORD109 A / B RNA, if However, it has only a small effect, which is because ASO terminates transcription in or downstream of the target region. This aligns with that idea.

[0121] Low concentrations (3nM) of ASO-4 and ASO-6.1 are UBE3A-AS RNA receptors. While it significantly reduces bell, higher concentrations (≧100 nM) of ASO reduce UBE3A RNA It is not essential for increasing the level. This is because UBE3A-AS transcribs UBE3A A specific threshold required for inhibition, or inactivation of UBE3A-AS, is paternal UB To quantify the time lag leading to E3A reactivation, or UBE3A RNA levels The sensitivity of the assay being used may also be reflected.

[0122] In summary, the findings suggest that ASOs targeting candidate regions in UBE3A-AS are new To almost completely eliminate UBE3A imprinting in ¹¹ and for future clinical development This suggests that at least two ASOs have been identified.

[0123] Different RNA modifications [2'-hydroxymethyl (2'-OMe), 2'-methoxy-ethyl Lu 2'-MOE, and LAC nucleic acid (LNA), and skeleton [phosphorothioate ( ASO-4 and ASO-6 are composed of PS and phosphodiester (PO). Derivatives of compound 1 were also designed (Table 17). [Table 6] [Table 7] [Table 8] JPEG0007863362000013.jpg235146JPEG0007863362000014.jpg237146JPEG0007863362000015.jpg23351 [Table 9] [Table 10] [Table 11] [Table 12] [Table 13] [Table 14] [Table 15] [Table 16] [Table 17]

[0124] material and method Antisense oligonucleotide design Antisense oligonucleotides (ASOs) are derived from Solignos (statistical folding of nucleic acids). It was designed using software for the study of regulatory RNA. , candidate ASO(20~) with the lowest binding site cleavage energy and free binding energy 18mers were identified for each target sequence, followed by motifs with amplified effects. The following was examined: The lowest free energy predicted for the target sequence generated by Soligo. Based on accessibility within the energy center of mass secondary structure, ASO is further filtered. It was subjected to [a certain process]. In some cases, it was constructed using RNAfold and Mfold. The secondary structure models were compared using the lowest free energy structure.

[0125] Human ASOs were filtered using the following criteria: 1) The target sequence was polymorphic. It was sex [dbSNP138, dbSNP150, and 1000 genomes phase 3 line Synthetic variant cells (SNV, INDEL, and SV); 2) Target sequences are found in rhesus monkeys. and was not 100% conserved in cynomolgus macaques;3) The target sequence was retained Located upstream of Snord115 / SNORD115 snoRNA (per exon). Next, the remaining ASO was subjected to a free energy (<=-8kcal / mol) target. Mean unpairing probability for site nucleotides, binding site cleavage energy (low > high), secondary The position within the structure (Ensembl center of mass), and the sequence motif related to high / low effect. The ranking was determined by the presence / absence of "Fu".

[0126] Primary mouse hippocampal neurons Primary culture medium of hippocampal neurons contains male Ube3am+ / pYFP and wild-type C57BL / P0-P1 offspring mice (Ube3am+ / p+ and Ube3) produced by mating with 6J females It was produced from am+ / pYFP. The genotype was determined using the previously described method. In short, hippocampal neurons are poly-D-lysine (152028, Ther (Fischer Scientific) and laminin (23017-01, Th 96-well optoelectronic coating (Fisher Scientific) At the ichthyological bottom plate, B27 (Invitrogen) and penicillin / stratum corneum Neurobasic medium A supplemented with ptomycin (Invitrogen) The cultures were incubated in San Diego, CA. The culture medium was kept in 5% CO2 until use. The temperature was maintained at 7°C.

[0127] Mouse neuron imaging Mouse primary hippocampal neurons were 4% paraformaldehyde at 10 DIV (3 days after treatment). The culture medium was then fixed using dehyde. The culture medium was then washed twice with 1XPBS and in PBS The specimens were fixed in 4% paraformaldehyde for 15 minutes, then washed three times in 1XPBS. The cells were in PBS (T-PBS) with 5% goat or donkey serum added, containing 0.3% of the serum. The mixture was blocked in Riton-X100 for 1-2 hours at room temperature with gentle stirring. The cells were anti-GFP [Novus Biologicals, NB 600-308 (U Heron) and anti-NeuN(Millipore, 05-557(mouse)) antibodies The cells were incubated together for 24 hours at 4°C with gentle agitation. The Tween 20 was washed three times in 1XPBS for 15 minutes each, and then treated with anti-rabbit treatment. 488 (Jackson ImmunoResearch, 111-545-144) and anti-mouse Cy3 (Jackson ImmunoResearch, 115-165) -166) The cells were incubated with the secondary antibody at 4°C in the dark for 24 hours. The samples were washed four times in 0.1% Tween20 1XPBS for 15 minutes each. In eye washing, use Hoechst stain (Thermo Fishe) at a dilution of 1:1000. The nuclei were labeled using (r Scientific).

[0128] Cytation 5 and Gen5 Image+ software (BioTek, W The plate was imaged using inooski (VT). In short, 4X vs. Using inverted orientation, 5x4 autofocus images with overlapping tiles are used for automatic image stitching. By acquiring the data, a montage image of each well was created. The filters used were: , DAPI(377,477), GFP(469,525), and RFP(531,5 93) The exposure time and gain were set for each plate using negative and positive controls. It was adjusted using the same focal height as used for the GFP and RFP filters. Then, autofocus was performed on the nucleus (Hoechst stain, DAPI) for each well. The images were stitched together using Gen5 Image+ software.

[0129] IN Cell Developer 6.0(GE Healthcare Lif Single-cell image analysis using e Sciences (Pittsburgh, PA) This was performed. In short, it involved the nucleus (Hoechst staining, DAPI) or mature neurons. For either (NeuN, RFP), randomly selected cells in the acquired image. By optimizing inclusion and exclusion parameters based on size and intensity, individual A track mask was created. Then, the mean and median intensity values ​​of GFP were taken from the selected mass. The data was acquired within the boundary of the cell and intensity values ​​for Ube3aYFP within each cell were produced.

[0130] Human-induced pluripotent stem cell-derived neurons GABAergic and glutamatergic-induced pluripotent stem cell (iPSC)-derived neural progenitors Cells (NRC-100-010-001 and GNC-301-030-001, Cel lular Dynamics International, Madison WI) These were then differentiated into neurons according to the manufacturer's protocol. In short, neural progenitor cells. It is thawed and resuspended in a chemically defined medium, and poly-D-lysine and laminin It was added to a sterile culture plate coated with [a specific substance]. 24 hours after plating, it was cultured. The soil was replaced, and then half of the culture medium was replaced every 3-5 days thereafter.

[0131] RNA isolation Regarding cultured iPSC-derived neurons, the Cell-to-CT kit (The RMO (Fire Scientific) was used in a lysate volume of 55 μl. RNA isolation and cDNA synthesis were then performed.

[0132] RNA-level analysis The stationary RNA level of the target transcript is determined by TaqMan quantitative reverse transcription PCR (q Measurement was performed using an RT-PCR assay. The total reaction volume was 10 μL, and 2 μL cDNA, 1X gene expression master mix (4369016, Thermo Fi Sher Scientific (Waltham, MA), and 1X TaqMan Includes primer assay (Thermo Fisher Scientific). The cycling conditions were 2 minutes at 50°C, 10 minutes at 95°C, and 15 seconds at 95°C. The process consists of 40 cycles of 1 minute at 60°C, and the readings are taken during the 60°C process in each cycle. The test was conducted. The reaction was with a BIO-RAD T1000 CFX96 thermocycler (B io-Rad Laboratories (Hercules, CA) , internal control (PPIA, Hs99999904_m1, Thermo Fisher S scientific) and target [UBE3A-AS, Hs01372957_m1;S NORD116-11, Hs04275268_gH;SNORD115, Hs0427 5288_gH;IPW, Hs03455409_s1;SNORD109A / B, AP 47WVR (Thermo Fisher Scientific); UBE3A: Word ATATGTGGAAGCCGGAATCT (Sequence ID 500); Reverse: CC CAGAACTCCCTAATCAGAA (Sequence ID 501); and probe: ATG The reaction ACGGTGGCTATACCAGG (SEQ ID NO: 502) was performed together. Data Take it out and use the BIORAD CFX Maestro software (Bio-Rad L The analysis was performed using aboratories. Samples with an internal control Cq value of ≥30 were filtered. We divided it. We visually inspected the data quality and the technical and / or plate replication. The discrepancies between the two were identified. Measures for inferential and descriptive statistics were the ΔΔCq value (2- ΔΔCq = 2 - (Cq[target] - Cq[internal control]) - (Cq[target] - Cq[internal control]) It consists of ])).

[0133] Example 2: Identification of ASO target regions Analysis of RNA sequencing data produced from mouse tissues and cells is performed using Snord1. 15 clusters' 3'-terminus and 5 Ube3a antisense (Ube3a-AS) transcripts '- We identified the region located between the terminals, which is the Snord115 host gene transcription. It is considered important for the processing of substances and the transcription of Ube3a-AS. It contains the gene (Figures 6A-6D). RNA-sequencing data produced from human tissue. The analysis of the ta is located between the 3' end of the SNORD115 cluster and SNORD109B. The region in question was identified (Figures 7A-7G), which is similar to that observed in mice. It includes elements of; however, comparative analysis of this area shows that sequence conservation is not observed between humans and rodents. This indicated that there was little to no presence, or that it was completely absent.

[0134] material and method RNA sequencing RNA is Qiagen RNAeasy Plus (74136, Qiagen, H Isolated using Ilden (Germany). RNA concentration was determined by Qubit fluorescence chromatography. Determined using the amount (Thermo Fisher Scientific), RNA The quality is 4200 Agilent TapeStation (Agilent, San The RNA sequencing library was evaluated using ta Clara (CA). Ilumina TruSeq Stranded Total RNA Kit (200) Manufactured by Illumina, Inc. (20597, San Diego, CA) It was produced using the following method. 75-base pair end sequencing was performed using Texas Instruments. s A&M Institute for Genome Sciences and In the Society Genomics score, NextSeq 500(Il The procedure was performed using Lumina (San Diego, CA). Raw sequencing reads The data was processed using CASAVA. The resulting FASTQ sequences were then processed using FASTQC. It was used and investigated.

[0135] The FASTQ sequence was created using Hisat2 (version 2.1.0) with the following settings. Aligned to the reference assembly (hg19): --fr. Then aligned Convert the SAM sequence to a binary BAM sequence and assign an index. The samples were sorted using Samtools. BAM files from individual samples were combined. Then, I used Samtools to index it. The aligned array is Sa Filtered using mtools view commands and non-uniquely aligned Excluding reads with quality > 1.

[0136] The transfer assembly is created using Stringtie (version 1.3.4) with the following options. .d) produced from a sample synthesized using: (stranded)--rf-f0- j2. gffread (GFF utilities, Johns Hopkins University, Center for Computational Biol. Using ogy), a single exon transcript was excluded from the assembled transcript. .

[0137] Example 3: Identification of Lead ASO Targeting ASO-4 and ASO-6.1 target sequences, with different scaffold designs and RN Eighteen ASOs consisting of A modifications were designed to identify potential read ASOs. Table 17). Normal iPSC-derived neurons (GABAergic) are 1 / 2 of 10 points. Each ASO was treated with a log dose curve, and IC50 and E maximum values ​​were compared. (Neurological progenitor) The cells differentiate into neurons at 18 DIV, followed by a 1 / 2 log dose response of 10 points. ASO[1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM, 3μ Treatment was performed with M, 10 μM, and 30 μM (n=2). UBE3A was treated with 24DIV. -The steady-state RNA level of AS was measured, and the dose-response curve was approximated as described above. (Figure 8A and Table 18). Dose-response curves differed significantly (parallel study: F(51,606)). (=7.86; p<0.0001; R²=0.90), therefore, relative efficacy was not estimated. The hierarchical clustering of the approximation curves revealed three clusters of ASO, and the cluster Cluster 1 represented the nine strongest ASOs (Figures 8B and 8C). Analysis of cluster 1 was performed. SO has a similar curve (parallel test: F(24,299)=1.01; p=0.5; R2 =0.93), ASO-4.4.PS.L is at least three times more potent than other ASOs. This was shown (Table 19). However, further analysis showed that ASO-4.4.PS.L, AS O-6.1.PS.M and ASO-6.1.PO-1.M have equivalent IC50 values. However, other ASOs showed slightly less potency (Table 20). Relative potency and internal selection Based on the selection criteria, ASO-4.4.PS.L and ASO-6.1.PO-1.O are They were investigated. [Table 18] [Table 19] [Table 20]

[0138] material and method The method was the same as that described in Example 2, unless otherwise specified.

[0139] Example 4: ASO-6.1-PO-1 in iPSC neurons of Angelman syndrome Pharmacodynamic analysis of .O and ASO-4.4.PS.L Next, the efficacy of ASO-6.1.PS.O and ASO-4.4.PS.L was 15q iPSCs originating from an Angelman syndrome patient with maternal deletion in the 11-q13 region. This was investigated in neurons. Induced pluripotent stem cells differentiate into neurons, and then 1 ASO-6, 1, PO-1, 0 and ASO-4 1 / 2 log dose curves at 0 point. 4.PS.L[1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM They were treated with 3 μM, 10 μM, and 30 μM (n=3). Six days after treatment, UB The steady-state RNA level of E3A-AS was measured, and the dose-response curve was approximated as described above. (Figure 9A). The dose-response curves were similar among ASOs (parallel study: F(3,13). 2)=1.07, p=0.4, R2=0.82), ASO-4.4.PS.L(437n M) is approximately 2.7 times stronger than ASO-6.1.PO-1.O (1.22uM). It was a force. The IC50 values ​​were equivalent [ASO-6.1.PO-1.O / ASO-4. 4. PS.L IC50 ratio: = 0.96 (lower confidence limit = 0.9; upper confidence limit = 1.0). E The maximum value was similar (30 μM: ASO-4.4.PS.L = 0.01 ± 0.0007). ;ASO-6.1.PO-1.O=0.05±0.004) has a confidence interval [ASO-6. 1.PO-1.O / ASO-4.4.PS.LE Maximum ratio: = -9.1 (Lower confidence limit = -2) 24; confidence upper limit = 205) was the reason they were not considered equivalent.

[0140] material and method The method was the same as that described in Example 2, unless otherwise specified.

[0141] Angelman syndrome-induced pluripotent stem cell-derived neurons Angelman syndrome iPS cells (AG1-0 iPSCs) (ECN001, Ker afast, Boston, MA) is a human embryonic stem cell medium [DMEM / F12(113 30-057, Gibco Biosciences, Dublin, Ireland) , 20% knockout serum replacement (10828-028, Thermo F (Isher Scientific), 1X Non-Essential Amino Acids, 2 mM L-Glutamine 7 μl / mL of 2-mercaptoethanol and 4 μg / mL of basal fibroblast growth In the factor, it was co-cultured with irradiated mouse embryonic fibroblasts. In the first passage, PluriST EM Human ES / iPS Medium (SCM130, Millipore Sigma, Burl According to the product manual for ington, MA, AG1-0 cells were passaged. This culture medium is feeder-free and uses Dispase II (SC) to dissociate cells. Utilizes M133 (Millipore Sigma). Matrigel® trademark ESC Eligibility Matrix (354277, Corning BD Biosciences) (es, Corning, NY) was used as the extracellular matrix. In the second passage, The matrix is ​​transformed into biclonectin (CC130, Millipore Sigma). The differentiation continued until, during subsequent passages, differentiated cells comprised approximately <5% of the colony. The area was manually removed. After four successive passages, the AG1-0 cells had extracellular matrix and Millipore ES / iPS neurogenesis kit (S) lacking biclonectin They were separated using CR603, SCM110, and SCM111). The first passage was The procedure was performed using EZ-LiFT (SCM139, Millipore Sigma). High-quality iPS cells were obtained. Neural progenitor cells were frozen at stage zero (P0), and then... Thawed for differentiation. Differentiation was performed using poly-D-lysine (10 μg / mL) and laminin [1 Sterile culture plates coated with 0 μg / mL (23017-015, Gibco) The procedure was performed in differentiation medium (SCM111) during the first 10 days of differentiation. In some cases, cells are in cellular dynamics maintenance medium (NRM-100-121-001, Cellular Dynamics International, Madison; It was separated within WI.

[0142] Example 5: Processed with ASO-6.1-PO-1.O and ASO-4.4.PS.L Expression of PWS polycistronic transcripts in Angelman syndrome iPSC neurons Analysis ASO-4.4.PS.L and ASO-6.1.PO-1.O are PWS polycistrophores. To determine whether it affects the level of RNA transcripts encoded by the nucleotide transcript RNA sequencing was performed on AS iPS cells treated with each ASO, and SN URF, SNRPN, SNORD116 host gene transcript (SNHG116), SNOR D116 snoRNA, IPW, SNORD115 host gene transcript (SNHG115) ), SNORD115 snoRNA, and stationary RNA levels of UBE3A-AS The following was quantified. UBE3A steady-state RNA levels were also measured. Angelman syndrome iPS cells differentiate into neurons as described above, and then into a vehicle (1% H2O, n=3), ASO-4.4.PS.L (30uμM, n=3) and ASO-6.1.P The cells were treated with O-1.O (30 μM, n=3). Six days after treatment, the total cells isolated from the culture medium were... RNA sequencing was performed on RNA (rRNA depleted). To create annotations for G116, SNHG115, and UBE3A-AS transcripts, The ranscriptome is assembled from vehicle RNA-seq data, and then referenced. It was incorporated into the retinogene annotation. For the vehicle, SNURF, SNRPN, and SNHG were used. Determination of 116, SNORD116 snoRNA, and SNORD115 snoRNA Normal RNA levels were similar and did not differ significantly. ASO-6.1.PO-1. ASO-4.4.PS.L, rather than O, reduced IPW levels (1.5 times), but was effective. The results were not statistically significant. ASO-6.1.PO-1.O and ASO-4.4.PS.L This significantly reduced SNHG115 and UBE3A-AS RNA levels. ASO- 6.1.PO-1.O and ASO-4.4.PS.L are compared to SNHG115 levels. It had a similar effect; however, ASO-4.4.PS.L had a different effect than ASO-6.1.PO- 1.O(ASO-4.4.PS.L: -6.1 times change; ASO-6.1.PO-1.O: (A much greater effect on UBE3A-AS RNA levels than a -2.8x change) ASO treatment increased UBE3A RNA levels by approximately 1.2 times, but the effect was The difference was not statistically significant (Figure 10 and Table 21). [Table 21]

[0143] material and method The method was the same as that described in Example 4, unless otherwise specified.

[0144] Differential expression analysis of PWS RNA Normalized FPKM of RefSeq gene annotation (per 1,000 per million) (Single) The value is obtained using Cuffnorm with default settings and the following options. Estimated: -u. The FPKM value for each gene annotation is output file for each sample. It was determined from and used for descriptive and inferential statistics.

[0145] Example 6: ASO-6,1-PO-1.O and ASO-4 in cynomolgus macaques 4. Pharmacodynamic analysis of PSL The ASO-4 and ASO-6 target regions are found across several non-human primate (NHP) species. It is preserved in this way, and therefore, both safety and efficiency studies in large animal models are This becomes possible. ASO-4, 4, P, L and ASO-6 in the central nervous system (CNS) 1. To investigate the efficacy of PO-1.O, ASO performed intrathecal lumbar puncture to detect cynoquiza The sample was delivered to lumacaques. The animals were fed a vehicle (0.9% saline solution, n=5) and ASO-6. 1.PO-1.O (10 mg, n=3), and ASO.4.4.PS.L (10 mg, A single bolus injection (n=3) was administered. 28 days after treatment, central nervous system (CNS) tissue showed The samples were collected and the steady-state RNA levels of UBE3A-AS were measured. Overall, ASO-4 .4.PS.L is UBE3A-AS RNA-based than ASO-6.1.PO-1.O. It had a greater effect on Bell (Table 22). ASO-4.4.PS.L was mostly It reduces UBE3A-AS RNA in the CNS region, affecting the temporal lobe, primary motor cortex, and pons. It has a significant effect in the spinal cord, hippocampus, globus pallidus, frontal cortex (coronary radiata), prefrontal cortex, and lumbar spinal cord. It had the effect. Similarly, ASO-6.1.PO-1.O was U in most CNS regions. It reduces BE3A-AS RNA levels, and the significant effect is observed in the pons, oculomotor nucleus, and spinal cord. It was observed in the lumbar region (Figure 11 and Table 23). [Table 22] [Table 23] JPEG0007863362000031.jpg23494

[0146] material and method ASO administration NHP research is conducted by Northern Biomedical Research and At Charles River Laboratories, Institutio According to the various systems of the National Animal Care and Use Committees The experiment was conducted using an authorized protocol. Male and female crabeaters weighing 2-4 kg were used. Anesthetically treat the macaque (Macaca fascicularis) and administer a single 1 mL dose of A SO or vehicle was administered via intrathecal lumbar puncture. Vehicle control product (0.9% salt) The administration solution is prepared by dissolving freeze-dried ASO in sodium hydroxide (sodium hydroxide). The samples were filtered through a 0.2 μm filter. The CNS and spinal cord samples were collected, and the CNS was 4 The tissue samples were sectioned into mm-thick coronal slices. The tissue samples were immediately frozen and stored at -80°C until RNA isolation. Stored it.

[0147] RNA isolation 4mm tissue punches were taken from each target region, and approximately half of them were used for RNA isolation. I used the following: RNA isolation was performed using the Qiagen RNeasy Plus Mini Kit (74136). This procedure is performed using Qiagen, and tissue breakdown and lysis are carried out by TissueLyser. The procedure was performed using 5 mm stainless steel beads in II. RNA was divided into 2 volumes of 3 It was eluted into 0 μl of water, and the total elution volume was 60 μl. RNA was quebit and RNA XR assay (Q33224, Thermo Fisher Scientific) Quantification was performed using (ic). cDNA was analyzed using the High Performance RNA-to-cDNA Kit (43 87406, Thermo Fisher Scientific) Total reaction volume 50 μl It was used in 1 and synthesized from 2 μg of input RNA.

[0148] Analysis of UBE3A-AS RNA levels in tissues UBE3A-AS RNA levels in cynomolgus macaques were measured using SYBR Green Quantitative River. The result was estimated using qRT-PCR (qRT-PCR). The total reaction volume was 10 μl. 2 μl of cDNA, 1X PowerUp SYBR Green Master Mix (A 25741, Thermo Fisher Scientific), and 500nM Each primer (forward and reverse) was included. Cycling conditions were 50°C. 40 cycles of 2 minutes at 95°C, 2 minutes at 95°C, and 15 seconds at 95°C and 1 minute at 60°C. The data was read during the 60°C process in each cycle. The reaction was BIO- RAD T1000 CFX96 thermocycler, internal control (PPIA, F Forward:GTCTCCTTCGAGCTGTTTGC (Sequence ID 503); Reverse :CCTTTCTCTCCAGTGCTCAGA (Sequence ID 504)) and target (U BE3A-AS, Forward: CCTGTGAACTTTCAACCAGGA (Sequence number) Code 505); Reverse: GGATCAGACTCCAGGCCTTC (Sequence ID 506) The reactions were performed separately. Data were collected and initial analysis was performed using BIORAD CFX Ma The analysis was performed using estro software, and deep statistical analysis was conducted using Excel and JMP. It was implemented using this method.

[0149] Example 7: ASO targeting the exon boundaries of spliced ​​UBE3A-AS transcripts In some embodiments, the target sequence is UBE3A-AS exons 1-5 and SNO The target sequence is the exon boundary containing exons 1 and 2 of RD109B. The exon boundary of the 19 nucleotides representing the 5' and 3' ends of the exon. It consists of 38 nucleotides arranged as (19 nucleotides in each exon). Includes segments 1-2, 2-3, 3-4, 5-6, 7-8, 9-10, and 11-12. There were 12 segments with exon boundaries. Chromosome coordination is shown in Table 2. Provided in 4. Spliced ​​exons (|, junctions of exons) and intervening. A single synthesized junction sequence showing the input exon sequence ([]) was constructed. ASOs (20-, 19-, and 18-mer) targeting the junctions of Xon are: Provided in Table 25.

[0150] Synthesized junction array AATGAAATCTTCTGATTTG|TAAGACATGCTGCCAAGAG[ ]ATTAGTTTTACACCTTCAG|GATAAAGACTGCTGAGAAG []GTTTAAGGATGCTATTCTG|AAAAGACTGTGGAGGAAG A[]TTAAGGAAACCATCTCTGG|GATAAGGATGACTGAGG AA[]ATTTAAGGATGCCACTCTG|GTTAAAAGCTGAAACA ACT[]GAAACTTCAGGGAAAAGAG|AAGGCCTGGAATCTG ATCC (Sequence ID 489). |=3'-5' Exon junction [] = Arrangement of intervention exons [Table 24] [Table 25] JPEG0007863362000034.jpg236100

[0151] Example 8: siRNA, shRNA, and CRISPR Guide As described above, in some embodiments, the disclosed oligonucleotide is the target nucleus Functional nucleic acids that inhibit, mutate, or delete acid sequences, such as siRNA, shRNA, and These are nuclease gRNAs.

[0152] Examples of siRNAs targeting UBE3a-AS exons 1-5 are shown in Table 26. Examples of shRNAs targeting UBE3a-AS exons 1-5 are provided. Table 2 Examples of gRNAs targeting UBE3a-AS exons 1-5 are provided in 7. This is provided in Table 28. [Table 26] JPEG0007863362000036.jpg23419 [Table 27] [Table 28]

[0153] Unless otherwise defined, all technical and scientific terms used herein are open The meaning is the same as that generally understood by those skilled in the art in the field to which the present invention pertains. It has a taste. Publications cited herein and the materials they cite are referenced in this document. It will be specifically incorporated into the specification.

[0154] Those skilled in the art can achieve the specifics described herein simply by using conventional experimental methods. Many equivalents to the embodiments can be recognized or confirmed. Such equivalents are intended to be covered by the following claims.

Claims

1. A modified oligonucleotide comprising a sequence of 17 to 20 ribonucleotides that is nucleic acid complementary to the contiguous portion of the nucleotide sequence defined in Sequence ID No. 2, The modified oligonucleotide can target the 5'-terminus of the UBE3A-AS transcript. Modified oligonucleotide.

2. The modified oligonucleotide according to claim 1, wherein the modified oligonucleotide is siRNA, shRNA, or gRNA.

3. The modified oligonucleotide according to claim 2, wherein the modified oligonucleotide is siRNA.

4. The modified oligonucleotide according to claim 3, wherein the modified oligonucleotide comprises the nucleotide sequence of sequence number 543, 544, 545, 546, 547, 548, 549, or 550.

5. The modified oligonucleotide according to claim 2, wherein the modified oligonucleotide is shRNA.

6. The modified oligonucleotide according to claim 5, wherein the modified oligonucleotide comprises the nucleotide sequence of SEQ ID NO: 569, 576, 583, or 585.

7. The modified oligonucleotide according to claim 2, wherein the modified oligonucleotide is a guide RNA (gRNA) of CRISPR.

8. The modified oligonucleotide according to claim 7, wherein the modified oligonucleotide comprises the nucleotide sequence of SEQ ID NO: 590, 592, 593, 596, 598, 599, or 601.

9. The modified oligonucleotide according to claim 1, wherein the modified oligonucleotide comprises one or more modified nucleosides.

10. The modified oligonucleotide according to claim 9, wherein one or more of the modified nucleosides are 2'-saccharide modified nucleosides.

11. The modified oligonucleotide according to claim 10, wherein one or more of the 2'-saccharide-modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-RNA, arabino nucleic acid (ANA), 2'-fluoro-ANA, and roch nucleic acid (LNA) nucleosides.

12. The modified oligonucleotide according to claim 1, wherein the modified oligonucleotide comprises one or more modified nucleoside bonds.

13. The modified oligonucleotide according to claim 12, wherein one or more of the modified nucleoside bonds are phosphorothioate nucleoside bonds.

14. The modified oligonucleotide according to claim 1, wherein the modified oligonucleotide is bound to a non-nucleotide portion selected from the group consisting of carbohydrates, cell surface receptor ligands, and pharmaceutical substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins, vitamins, and viral proteins.

15. The modified oligonucleotide according to claim 14, wherein the modified oligonucleotide is an antibody or antibody fragment whose non-nucleotide portion targets a transferrin receptor.

16. A pharmaceutical composition for use in subjects requiring treatment or prevention of Angelman syndrome, comprising one or more modified oligonucleotides as described in any one of claims 1 to 15, and comprising a pharmaceutically acceptable diluent, solvent, carrier, salt, or adjuvant.

Images