Nucleic acid components
Recombinant DNA constructs with optimized expression cassettes and promoters improve RNA synthesis efficiency, addressing high-cost barriers and enabling widespread use in RNA applications.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- GREENLIGHT BIOSCIENCES INC
- Filing Date
- 2020-12-04
- Publication Date
- 2026-05-26
AI Technical Summary
High-cost RNA synthesis hinders the widespread use and development of RNA products in agricultural and biopharmaceutical applications.
Recombinant DNA nucleic acid constructs with specific expression cassettes and promoters, including initial transcription sequences and terminators, are designed to enhance the expression of RNA molecules, such as dsRNA, using plasmids, cosmids, and other vectors, optimizing transcription efficiency and yield.
The constructs enable cost-effective and high-yield production of RNA products, facilitating their broader application in agriculture and biomedicine.
Smart Images

Figure 0007865575000008 
Figure 0007865575000009 
Figure 0007865575000010
Abstract
Description
Technical Field
[0001] Related Applications This application claims the benefit of U.S. Provisional Application No. 62 / 944,824, filed on December 6, 2019, under 35 U.S.C. § 119(e), which is hereby incorporated by reference in its entirety.
Background Art
[0002] The availability of low-cost RNA products is essential for numerous applications across agricultural and biomedical sciences. In agriculture, RNA interference (RNAi) can be used for the targeted control of pests and insects increasingly resistant to conventional chemical pesticides, as well as for the achievement of specific desired phenotypes in crops (e.g., improved shelf life, color, freshness). In biopharmaceuticals, mRNA products can be used as vaccines and therapeutics for treating different diseases. However, high-cost RNA synthesis is a major hurdle in the widespread use and development of RNA products. The development of cost-effective synthesis processes for RNA products enables the widespread expansion and use of these and other technologies.
Summary of the Invention
[0003] Some aspects of the present disclosure provide recombinant DNA nucleic acid construct designs for promoting the expression of a RNA of interest. In some embodiments, the construct includes a first expression cassette comprising a promoter operably linked to an initial transcription sequence (ITS) upstream of a nucleotide sequence encoding the sense strand of double-stranded RNA (dsRNA); and a second expression cassette comprising a promoter operably linked to an initial transcription sequence (ITS) upstream of a nucleotide sequence encoding the antisense strand of dsRNA, wherein the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA.
[0004] In some embodiments, either or both of the first and second expression cassettes further include a terminator sequence downstream of the nucleotide sequence encoding the dsRNA strand. In some embodiments, either or both of the first and second expression cassettes further include a restriction endonuclease recognition site. In some embodiments, either or both of the first and second expression cassettes include a terminator sequence downstream of the nucleotide sequence encoding the dsRNA strand, and further include an endonuclease recognition site.
[0005] In some embodiments, the initial transcription sequence has a length of 1 to 15 nucleotides. In some embodiments, the initial transcription sequence includes any one nucleotide sequence from sequence numbers 1 to 8 or 38 to 41.
[0006] In some embodiments, the first and second expression cassettes are located within a single DNA molecule and oriented in the same direction; the same DNA strand is used as a template strand during transcription for each expression cassette. In other embodiments, the first and second expression cassettes are located within a single DNA molecule and oriented in opposite directions; different DNA strands are used as template strands during transcription for each expression cassette.
[0007] In some embodiments, the nucleotide sequence encoding the sense strand of the first expression cassette is adjacent to the ITS and its reverse complement, and the antisense strand of the second expression cassette is adjacent to the ITS and its reverse complement. In some embodiments, the first expression cassette further includes one or more terminator sequences downstream of the nucleotide sequence encoding the sense strand, and the second expression cassette further includes one or more terminator sequences downstream of the nucleotide sequence encoding the antisense strand. In some embodiments, the terminator sequences include the rrnBT1 terminator sequence, the rrnBT2 terminator sequence, the TT7 terminator sequence, the T7U terminator sequence, the TT3 terminator sequence, and / or the PTH terminator sequence. In some embodiments, the terminator sequence includes any one nucleotide sequence from SEQ ID NOs. 19 to 30.
[0008] In some embodiments, the construct further includes a selection marker, which is optionally located between a first expression cassette and a second expression cassette. In some embodiments, the selection marker is an antibiotic resistance selection marker or an antibiotic-free selection marker.
[0009] In some embodiments, the promoter of the first expression cassette, the promoter of the second expression cassette, or both of the promoters of the first and second expression cassettes is a bacteriophage T7 promoter.
[0010] In some embodiments, the construct is selected from plasmids, cosmids, bacterial artificial chromosomes, yeast artificial chromosomes, native chromosomes, bacteriophages, and viruses. In some embodiments, the construct is a high-copy-number, intermediate-copy-number, or low-copy-number plasmid. In some embodiments, the plasmid is a PUC-based plasmid.
[0011] In some embodiments, dsRNA targets the genome sequences of insects, plants, fungi, or viruses.
[0012] Some aspects of the present disclosure provide a construct comprising (a) a first expression cassette comprising a promoter operably ligated to an initial transcription sequence (ITS) comprising any one nucleotide sequence from sequence numbers 1-4 or 38-41, a nucleotide sequence encoding a sense strand of double-stranded RNA (dsRNA), and a terminator sequence; and (b) a second expression cassette comprising a promoter operably ligated to an ITS comprising any one nucleotide sequence from sequence numbers 1-4 or 38-41, a nucleotide sequence encoding an antisense strand of dsRNA, and a terminator sequence, wherein the sense strand of dsRNA is complementary to the antisense strand of dsRNA.
[0013] In some embodiments, the first and second expression cassettes are located within a single DNA molecule and oriented in the same direction; the same DNA strand is used as a template strand between transcriptions for each expression cassette. In other embodiments, the first and second expression cassettes are located within a single DNA molecule; different DNA strands are used as template strands between transcriptions for each expression cassette.
[0014] In some embodiments, the nucleotide sequence encoding the sense strand of the first expression cassette is adjacent to the ITS and its reverse complement, and the nucleotide sequence encoding the antisense strand of the second expression cassette is adjacent to the ITS and its reverse complement. In some embodiments, the first expression cassette further includes one or more terminator sequences downstream of the sense-encoding nucleotide sequence, and the second expression cassette further includes one or more terminator sequences downstream of the antisense-encoding nucleotide sequence. In some embodiments, the terminator sequence includes the rrnBT1 terminator sequence, the rrnBT2 terminator sequence, the TT7 terminator sequence, the T7U terminator sequence, the TT3 terminator sequence, and / or the PTH terminator sequence. In some embodiments, the terminator sequence includes any one nucleotide sequence from SEQ ID NOs. 19 to 30.
[0015] In some embodiments, the construct further comprises a restriction endonuclease recognition site downstream of the nucleotide sequence encoding the sense strand and / or the nucleotide sequence encoding the antisense strand, optionally downstream of the terminator sequence, or in constructs lacking the terminator sequence. In some embodiments, the construct further comprises a selection marker, optionally located between the first and second expression cassettes. In some embodiments, the selection marker is an antibiotic resistance selection marker or an antibiotic-free selection marker. In some embodiments, the promoter of the first expression cassette, the promoter of the second expression cassette, or both of the promoters of the first and second expression cassettes is a bacteriophage T7 promoter.
[0016] In some embodiments, the construct is selected from plasmids, cosmids, bacterial artificial chromosomes, yeast artificial chromosomes, native chromosomes, bacteriophages, and viruses. In some embodiments, the construct is a high-copy-number, intermediate-copy-number, or low-copy-number plasmid. In some embodiments, the plasmid is a PUC-based plasmid.
[0017] Some aspects of the present disclosure provide an expression cassette comprising a promoter operably ligated to a nucleotide sequence encoding a product of interest, wherein the nucleotide sequence is adjacent to an initial transcription sequence (ITS) and optionally to two tandem terminator sequences and / or restriction endonuclease sites, and the ITS comprises any one nucleotide sequence from SEQ ID NOs: 1-8 or 38-41.
[0018] Some aspects of this disclosure provide engineered nucleic acids comprising any one nucleotide sequence from SEQ ID NOs: 1-4 or 38-41.
[0019] Some aspects of this disclosure provide engineered nucleic acids comprising a promoter and an initial transcription sequence (ITS) comprising any one nucleotide sequence from SEQ ID NOs: 1-4 or 38-41. In some embodiments, the engineered nucleic acid comprises any one nucleotide sequence from SEQ ID NOs: 10-13 or 42-45.
[0020] Some aspects of the present disclosure provide a kit comprising an engineered nucleic acid comprising any one nucleotide sequence from SEQ ID NOs: 1-4 or 38-41; and a polymerase. In some embodiments, the kit further comprises a nucleoside triphosphate and / or a nucleoside monophosphate.
[0021] Some aspects of the present disclosure provide a vector or construct comprising a first expression cassette comprising a nucleotide sequence encoding a sense strand of a double-stranded RNA (dsRNA) operably ligated to a promoter, and a second expression cassette comprising a nucleotide sequence encoding an antisense strand of a dsRNA operably ligated to a promoter, wherein the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA.
[0022] Some aspects of the present disclosure provide a vector or construct comprising a first expression cassette comprising a promoter operably ligated to a first DNA initial transcription sequence (ITS) upstream of a nucleotide sequence encoding the sense strand of a double-stranded RNA (dsRNA), and a second expression cassette comprising a promoter operably ligated to a second DNA ITS upstream of a nucleotide sequence encoding the antisense strand of a dsRNA, wherein the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA.
[0023] Other aspects of the present disclosure provide vectors or constructs comprising: a first expression cassette comprising a promoter operably ligated to a first DNA initial transcription sequence (ITS) upstream of a nucleotide sequence encoding the sense strand of a double-stranded RNA (dsRNA), and a reverse complement (ITS-RC) of the DNA initial transcription sequence downstream of the nucleotide sequence encoding the sense strand of the dsRNA; and a second expression cassette comprising a promoter operably ligated to a second DNA ITS upstream of a nucleotide sequence encoding the antisense strand of the dsRNA, and a reverse complement (ITS-RC) of the DNA initial transcription sequence downstream of the nucleotide sequence encoding the antisense strand of the dsRNA. In some embodiments, the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA, and / or the ITS of each resulting RNA transcript corresponds to a DNA initial transcription sequence.
[0024] Other embodiments provide a vector or construct comprising: a first expression cassette comprising a promoter operably ligated to a first DNA initial transcription sequence (ITS) upstream of a nucleotide sequence encoding the sense strand of a double-stranded RNA (dsRNA), and at least one terminator sequence and / or restriction endonuclease site; and a second expression cassette comprising a promoter operably ligated to a second DNA initial transcription sequence (ITS) upstream of a nucleotide sequence encoding the antisense strand of a dsRNA, and at least one terminator sequence and / or restriction endonuclease site. In some embodiments, the first and second expression cassettes are oriented in the same direction, the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA, and the ITS of each resulting RNA transcript corresponds to a DNA initial transcription sequence.
[0025] Other embodiments provide a vector or construct comprising: a first expression cassette comprising a promoter operably ligated to a first DNA initial transcription sequence (ITS) upstream of a nucleotide sequence encoding the sense strand of a double-stranded RNA (dsRNA), a reverse complement (ITS-RC) of the DNA initial transcription sequence downstream of the nucleotide sequence encoding the sense strand of the dsRNA, and at least one terminator sequence and / or restriction endonuclease site; and a second expression cassette comprising a promoter operably ligated to a second DNA initial transcription sequence (ITS) upstream of a nucleotide sequence encoding the antisense strand of the dsRNA, a reverse complement (ITS-RC) of the DNA initial transcription sequence downstream of the nucleotide sequence encoding the antisense strand of the dsRNA, and at least one terminator sequence and / or restriction endonuclease site. In some embodiments, the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA, and / or the ITS of each RNA transcript corresponds to a DNA initial transcription sequence.
[0026] Some aspects of the present disclosure provide an expression cassette comprising a promoter operably linked to a DNA initial transcription sequence (ITS) upstream of a nucleotide sequence encoding a product of interest, and optionally at least one terminator sequence and / or restriction endonuclease site.
[0027] Other aspects of the present disclosure provide an expression cassette comprising a promoter operably linked to a DNA initial transcription sequence (ITS) upstream of a nucleotide sequence encoding a product of interest, and the reverse complement (ITS-RC) of the DNA initial transcription sequence downstream of the nucleotide sequence encoding the product of interest.
[0028] In yet another aspect, the present disclosure provides an expression cassette comprising a promoter operably linked to a DNA initial transcription sequence (ITS) upstream of a nucleotide sequence encoding a product of interest, the reverse complement (ITS-RC) of the DNA initial transcription sequence downstream of the nucleotide sequence encoding the product of interest, and at least one terminator sequence and / or restriction endonuclease site. In some embodiments, the ITS comprises the nucleotide sequence of SEQ ID NO: 1.
[0029] Further aspects of the present disclosure provide nucleic acid architectural configuration designs (e.g., nucleic acid vectors, nucleic acid constructs). In some embodiments, the nucleic acid design includes a plasmid, linearized template, or any other DNA construct configuration for enhancing the expression of a sequence of interest (e.g., RNA of interest) (e.g., enhancing the expression of the sequence of interest compared to a control construct). In some embodiments, the present disclosure provides an architectural design including a "complementary expression cassette" design involving two cassettes (e.g., for the expression of a dsRNA molecule of interest), wherein each cassette includes an ITS and optionally an ITS-RC for the expression of the dsRNA molecule of interest. In some embodiments, the architectural design includes a “complementary expression cassette” design involving two cassettes, each containing an ITS and optionally an ITS-RC for the expression of the dsRNA molecule of interest, the first expression cassette encoding the sense strand of the dsRNA, and the second expression cassette encoding the antisense strand, enabling the expression of both the sense and antisense strands, the first and second cassettes being encoded by two complementary strands of the same segment of double-stranded DNA, and the sense and antisense RNA strands produced by transcription from the two cassettes anneal to produce a dsRNA molecule containing r-ITS and optionally an r-ITC-RC. In some embodiments of this architecture, the sequence of interest (with or without DNA ITS) is operably ligated to two promoters at each end, one promoter driving the expression of the sense strand of the desired dsRNA product and the other promoter driving the expression of the antisense strand of the desired dsRNA product. During transcription of a "complementary expression cassette" design, RNA polymerase initiates transcription of the complementary strand from promoters at both ends, and the polymerase then moves toward each other, initially traversing the two complementary DNA strands (e.g., in a converging manner).
[0030] In other embodiments, the nucleic acid architecture arrangement design (e.g., a vector or construct for dsRNA expression) includes an "independent expression cassette" design, where the expression cassettes for the sense and antisense strands of the dsRNA molecule are encoded by independent segments of DNA. The independent segments of DNA can be incorporated into the same plasmid, linearized template, or any other DNA construct. In some embodiments, the "independent expression cassette" design involves at least two expression cassettes that are part of the same vector or DNA molecule, and the first expression cassette and the second expression cassette are oriented in the same direction on a given vector or DNA molecule (the same DNA strand serves as the template strand during transcription from the respective promoters of both expression cassettes). In other embodiments, the "independent expression cassette" design involves at least two expression cassettes that are part of the same vector or DNA molecule, and the first expression cassette and the second expression cassette are oriented in opposite directions in a given vector or DNA molecule (e.g., two opposite strands in a given vector or DNA molecule serve as the template strands for the two expression cassettes). Depending on whether the two expression cassettes are oriented in the same or opposite directions on a given vector or other DNA molecule, RNA polymerase can transcribe or function in the same direction on the same strand of the dsDNA molecule or in opposite directions on two different DNA strands.
[0031] In other embodiments, the nucleic acid architecture design (e.g., vector or construct) includes an “independent expression cassette” design involving two expression cassettes, where the expression cassettes for the expression of the sense and antisense strands of a dsRNA molecule are encoded by independent segments of DNA, which may or may not be incorporated into the same plasmid, linearized template, or other DNA construct. In some embodiments, the “independent expression cassette” design involves at least two expression cassettes (including ITS and optionally ITS-RC) which are parts of the same vector or DNA molecule, where the first and second expression cassettes are oriented in the same direction on a given vector or DNA molecule (the same DNA strand is served as a template strand between transcriptions from the respective promoters of both expression cassettes). In some embodiments, the “independent expression cassette” design involves at least two expression cassettes (including ITS and optionally ITS-RC) that are parts of the same vector or DNA molecule, with the first and second expression cassettes oriented in opposite directions within a given vector or DNA molecule (e.g., two opposite strands within a given vector or DNA molecule are provided as template strands for the two expression cassettes). Depending on whether the two expression cassettes are oriented in the same or opposite directions within a given vector or DNA molecule, the RNA polymerases driving expression from two independent promoters may transcribe or function in the same direction on the same strand of the dsDNA molecule or in opposite directions on two different DNA strands.
[0032] In other embodiments, the nucleic acid architecture arrangement design (e.g., vector or construct) includes a “multi-expression cassette” design, where multiple expression cassettes encoded by independent segments of DNA, which are parts of the same DNA molecule or different DNA molecules, enable the expression of multiple single-stranded RNA (ssRNA) molecules. In some embodiments, multiple ssRNA molecules may encode sequences of the same interest (SOI) and / or may be incorporated into the same plasmid, linearized template, or any other DNA construct. In some embodiments, the “multi-expression cassette” design involves at least two expression cassettes, which are parts of the same vector or DNA molecule, and the first and second expression cassettes are oriented in the same direction on a given vector or DNA molecule (the same DNA strand is served as a template strand between transcriptions from the respective promoters of both expression cassettes). In other embodiments, a “multi-expression cassette” design involves at least two expression cassettes, which are parts of the same vector or DNA molecule, with the first and second expression cassettes oriented in opposite directions (e.g., different or opposite DNA strands of two strands in the vector or DNA molecule are served as template strands between transcriptions from the respective promoters of both expression cassettes). In some embodiments, a “multi-expression cassette” design results in increased ssRNA production. Depending on whether the two expression cassettes are oriented in the same or opposite directions on a given vector or DNA molecule, the RNA polymerases driving expression from two independent promoters may transcribe in the same direction on the same strand of the ssRNA molecule or in opposite directions on two different DNA strands.
[0033] In other embodiments, the nucleic acid arrangement architecture design (e.g., vector or construct) includes a “multi-expression cassette” design, where multiple expression cassettes are encoded by independent segments of DNA that are parts of the same DNA molecule or different DNA molecules, and each cassette includes an ITS and optionally an ITS-RC, enabling the expression of multiple ssRNA molecules. The multiple ssRNA molecules may have the same SOI and / or be incorporated into the same plasmid, linearized template, or any other DNA construct. In some embodiments, the “multi-expression cassette” design involves at least two expression cassettes that are parts of the same vector or DNA molecule, and the first and second expression cassettes are oriented in the same direction on a given vector or DNA molecule (the same DNA strand is served as a template strand between transcriptions from the respective promoters of both expression cassettes). In other embodiments, a “multi-expression cassette” design involves at least two expression cassettes, which are parts of the same vector or DNA molecule, with the first and second expression cassettes oriented in opposite directions (e.g., different or opposite DNA strands are used as template strands between transcriptions from the respective promoters of both expression cassettes). In some embodiments, a “multi-expression cassette” design leads to increased ssRNA production.
[0034] In some embodiments, methods are also provided herein that include combining any one of the vectors or constructs described herein with a polymerase in a transcription reaction and producing an RNA transcript. [Brief explanation of the drawing]
[0035] [Figure 1] This provides a schematic diagram of an exemplary plasmid DNA template with an expression cassette for in vitro or in vivo transcription of RNA products. [Figure 2]A schematic diagram of exemplary linear DNA templates for in vitro or in vivo transcription of RNA products is provided, each DNA template comprising an expression cassette containing a promoter operably ligated to an ITS upstream of a sequence of interest (SOI) encoding the sense or antisense strand of the dsRNA product. The resulting dsRNA product, when fully hybridized, contains a 5'r-ITS overhang corresponding to each ITS of the DNA template. [Figure 3] This document provides schematic diagrams of exemplary linear DNA templates for in vitro or in vivo transcription of RNA products containing 5'r-ITS and 3'r-ITS-RC in the resulting RNA transcript. Each of the two DNA templates shown comprises an expression cassette encoding the sense and antisense strands of the dsRNA product, respectively, and each expression cassette comprises a promoter operably ligated to an ITS upstream of a sequence of interest (SOI) encoding either the sense or antisense strand, and an ITS reverse complement (ITS-RC). The resulting dsRNA product, when fully hybridized, does not contain single-stranded overhangs. [Figure 4]This provides schematic diagrams of exemplary DNA templates for in vitro or in vivo transcription to produce dsRNA products. The top schematic diagram is a DNA template containing a “complementary expression cassette” architecture, where the expression cassette for the sense and antisense strands of the dsRNA product is encoded by two complementary DNA strands, and the DNA template contains two converging promoters with ITS_2 sequences operably ligated to two ends of the sequence of interest (SOI) to be transcribed. The center schematic diagram is a DNA template containing a “complementary expression cassette” architecture for dsRNA synthesis, where the expression cassette for the sense and antisense strands of the dsRNA product is encoded by two complementary DNA strands, and the DNA template contains two converging promoters with GL-hybrid-A9 ITS located on two ends of the sequence of interest (SOI) to be transcribed. The schematic diagram below shows a DNA template containing an "independent expression cassette" architecture for dsRNA synthesis, where the sense and antisense strands of the dsRNA product are encoded by isolated expression cassettes on isolated segments of DNA, each expression cassette consisting of a promoter and ITS located upstream of a sequence of interest (SOI) encoding either the sense or antisense strand to be transcribed. [Figure 5] This graph shows the expression levels (titer in ng / μL) of dsRNA products (GS1 dsRNA) obtained after in vitro transcription (IVT) reactions using DNA templates containing different ITS. [Figure 6A] This graph shows the expression levels (titer in ng / μL) of dsRNA products (GS1 dsRNA) obtained after cell-free reactions using DNA templates containing different ITS. The data were obtained using DNA templates that produce dsRNA products with a 5' single-strand overhang. [Figure 6B] This graph shows the expression levels (titer in ng / μL) of dsRNA products (GS1 dsRNA) obtained after cell-free reactions using DNA templates containing different ITS. The data were obtained using DNA templates that produce dsRNA products without a 5' single-strand overhang. [Figure 7A] This graph shows the doubling of expression levels for dsRNA products (GL Seq-A, GL Seq-B, GL Seq-C, GL Seq-D, GL Seq-E) using various DNA template architectures. It also shows surrogates of RNA titers using different DNA template architectures. [Figure 7B] This graph shows a doubling of dsRNA expression levels for dsRNA products (GL Seq-A, GL Seq-B, GL Seq-C, GL Seq-D, GL Seq-E) using various DNA template architectures. It shows a doubling of dsRNA expression levels for DNA templates using the "complementary expression cassette" design with GL-hybrid_A9 ITS compared to DNA templates using the same design but without GL-hybrid_A9 ITS. [Figure 7C] This graph shows a doubling of expression levels for dsRNA products (GL Seq-A, GL Seq-B, GL Seq-C, GL Seq-D, GL Seq-E) using various DNA template architectures. It shows a doubling of expression levels for DNA templates using an "independent expression cassette" design with GL-hybrid_A9 ITS compared to DNA templates using a "complementary expression cassette" design with the same GL-hybrid_A9 ITS. [Figure 7D] This graph shows a doubling of expression levels for dsRNA products (GL Seq-A, GL Seq-B, GL Seq-C, GL Seq-D, GL Seq-E) using various DNA template architectures. It shows a doubling of expression levels for DNA templates using the "independent expression cassette" design with GL-Hybrid_A9 ITS compared to DNA templates using the "complementary expression cassette" design without GL-Hybrid_A9 ITS. [Figure 8A] This study demonstrates the effectiveness of different terminator sequences in terminating the transcription of single-stranded RNA (ssRNA) products. Schematic diagrams of the DNA templates used for evaluating read-through and termination efficiency are provided. [Figure 8B]This study demonstrates the effectiveness of different terminator sequences in terminating the transcription of single-stranded RNA (ssRNA) products. Figure 8A provides reversed-phase ion-pair (RP-IP) high-performance liquid chromatography (HPLC) chromatograms of ssRNA products synthesized in an in vitro transcription reaction using the DNA template shown. [Figure 8C] This study demonstrates the effectiveness of different terminator sequences in terminating the transcription of single-stranded RNA (ssRNA) products. The graph shows the net termination efficiency of in vitro transcription reactions using the DNA template shown in Figure 8A, with varying levels of nucleoside triphosphates (NTPs) (2 mM, 4 mM, and 8 mM). [Figure 9] This is a schematic diagram of an exemplary DNA plasmid that employs an “independent expression cassette” design for the transcription of sense and antisense strands of dsRNA products from two separate expression cassettes. The transcription of the sense and antisense strands is driven independently of a T7 promoter operably ligated to the DNA initial transcription sequence (ITS), as described herein. [Figure 10] This graph shows the expression levels (titer in ng / μL) of dsRNA products (GS4 dsRNA) obtained after cell-free reactions using plasmids (pGLA583 and pGLA584) and linear DNA templates. [Figure 11] This graph shows the expression levels (titer in ng / μL) of dsRNA products (GS1 dsRNA) obtained after cell-free reactions (NTP and NMP reactions) using DNA templates with various ITSs. [Figure 12] This graph shows the expression of the dsRNA product (GLSeq-A dsRNA) from a plasmid DNA template containing two independent expression cassettes encoding the sense and antisense strands (plasmid construct-1), compared to the expression of the GLSeq-A dsRNA product as a "hairpin" product variant from a plasmid DNA template containing a single expression cassette (plasmid construct-2). [Figure 13A]This is a schematic diagram of an exemplary plasmid DNA template for dsRNA product expression. It shows an exemplary plasmid DNA template (plasmid construct-3) employing an "independent expression cassette" architecture for dsRNA production, where each of the two distinct expression cassettes in the plasmid enables the expression of the sense and antisense strands of the dsRNA product adjacent to the ITS and ITS-RC, respectively. The two expression cassettes are oriented in the same direction and separated by the ampicillin-resistant bla gene as a selection marker and origin of replication. [Figure 13B] This is a schematic diagram of an exemplary plasmid DNA template for dsRNA product expression. An exemplary plasmid DNA template (plasmid construct-4) is shown, employing a "complementary expression cassette" architecture for dsRNA expression, where two complementary DNA strands from the same segment of DNA enable the expression of the sense and antisense strands of the dsRNA product. The DNA segments encoding the two expression cassettes each contain a sequence of interest (SOI) adjacent to a T7 promoter operably ligated to a suitable ITS. [Figure 14] This graph shows the expression levels (titer in ng / μL) of two different dsRNA products (GS1 and GS4) obtained from cell-free reactions using plasmid DNA templates employing either an "independent expression cassette" architecture (plasmid construct-3) or a "complementary expression cassette" architecture (plasmid construct-4). [Figure 15] This graph shows the expression levels (titer in ng / μL) of GS1 dsRNA obtained from cell-free reactions using a plasmid DNA template employing an "independent expression cassette" architecture (plasmid construct-3) with different ITS variants used as parts of the expression cassette. [Figure 16]A is a graph showing the titer (in mg / ml) of uncapped RNA produced using an ITS starting at G and capped RNA produced by an ITS starting at A. B is an electrophoresis graph illustrating the size distribution of RNA species produced in a cell-free reaction, captured using a BioAnalyzer instrument. [Figure 17A] This graph shows the production titer (in mg / ml) of cap RNA using CleanCap AG, ITS starting with A, and various open reading frame sequences. [Figure 17B] This electrophoretic graph shows the size distribution of RNA species produced in a cell-free reaction, captured using a Fragment Analyzer instrument. [Modes for carrying out the invention]
[0036] In some embodiments, nucleic acids, nucleic acid compositions (e.g., DNA-based vectors or constructs), and associated methods of use and kits for the production of ribonucleic acid (RNA) (such as double-stranded RNA (dsRNA) and single-stranded RNA (ssRNA)) are provided herein. The compositions provided herein enable cost-effective and high-yield production of RNA using cell-free reactions and in vitro transcription reactions.
[0037] definition The following terms are expected to be readily understood by those skilled in the art, but their definitions are provided below to facilitate the explanation of the subject matter of this disclosure.
[0038] The terms “nucleic acid” or “nucleic acid molecule” as used herein generally refer to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Nucleic acids may be single-stranded or double-stranded. Nucleic acid monomers in a nucleic acid molecule may be naturally occurring nucleotides, modified nucleotides, or combinations thereof. Modified nucleotides, in some embodiments, include modifications of sugar moieties and / or pyrimidine or purine bases.
[0039] The terms "transcription" or "RNA transcription" generally refer to the process by which RNA transcripts are synthesized by RNA polymerases, which are capable of polymerizing ribonucleoside triphosphates either in vivo or in vitro, using nucleic acid molecules (DNA or RNA) as templates.
[0040] The terms “template,” “transcription template,” or “template for transcription” generally refer to a nucleic acid sequence (DNA or RNA) that is used as a template for RNA polymerase to produce an RNA transcript through the process of transcription. The template defines the sequence of the RNA transcript synthesized by RNA polymerase. RNA polymerase synthesizes the RNA transcript by moving along the template strand of the template nucleic acid molecule and adding ribonucleotide triphosphates complementary to the template (DNA or RNA) strand to the growing RNA transcript. The template can be DNA or RNA. In some embodiments, the template is single-stranded or double-stranded. In most organisms, transcription is performed by RNA polymerase in cells that synthesize mRNA, using a double-stranded DNA molecule (chromosomal DNA) as a template. In some embodiments, in vitro transcription utilizes a synthetic partially double-stranded DNA template that is transcribed by DNA-dependent RNA polymerase. In some embodiments, the template is a linear molecule. In some embodiments, the template is circular. The template may contain additional elements other than those necessary for the expression of the RNA transcript. Additionally, in vivo and / or in vitro transcription from single-stranded RNA by RNA-dependent RNA polymerase is also possible (for example, in the case of some RNA viruses). The terms “template,” “transcription template,” or “template for transcription” may, in some embodiments, refer to either a specific nucleic acid sequence of a segment of a double-stranded DNA molecule or an entire DNA molecule containing the nucleic acid sequence to be transcribed.
[0041] The terms “T7 promoter,” “T7 RNAP promoter,” or “T7 class III promoter” generally refer to a double-stranded DNA segment to which T7 RNA polymerase binds to initiate transcription. In some embodiments, the T7 promoter is a minimal T7 class III promoter. In some embodiments, the minimal T7 class III promoter is a naturally occurring 17 base pair (bp) long dsDNA segment upstream of the φ6.5, φ10, and φ13 genes in the T7 bacteriophage genome, whose non-template strand has the sequence TAATACGACTCACTATA (SEQ ID NO: 9). The minimal T7 class III promoter as defined herein does not contain a canonical “G” at its terminus, and if the expressed sequence does not possess a “G” at its beginning, it is not expected to initiate transcription on its own. In some embodiments, the T7 promoter comprises a 47 bp promoter, which comprises a) a naturally occurring 30 bp DNA segment (represented by the non-template sequence TCGATTCGAACTTCTGATAGACTTCGAAAT; SEQ ID NO: 37) upstream of a minimal T7 class III promoter in the region preceding the φ6.5, φ10, and φ13 genes in the T7 bacteriophage genome, and b) a 17 bp minimal T7 class III promoter of SEQ ID NO: 9, wherein a) is operably ligated to b).
[0042] The term “transcription start site (TSS)” generally refers to a specific nucleotide location on a template where RNA polymerase initiates transcription. The transcription start site is generally a nucleotide location immediately downstream of a promoter where RNA polymerase initiates RNA synthesis. In some embodiments, where the transcription template is a DNA molecule with a promoter operably linked to an ITS, the TSS is the first nucleotide of the ITS. In some embodiments, where the transcription template is a DNA molecule with a promoter operably linked to a sequence of interest (i.e., a template lacking an ITS), the TSS is the first nucleotide of the sequence of interest. As used herein, the TSS generally does not overlap with the minimum T7 class III promoter, but is included as the first nucleotide of an ITS, or, if no ITS is present, as the first nucleotide of the sequence of interest.
[0043] The term “Sequence of Interest (SOI)” generally refers to a specific nucleic acid sequence incorporated into an RNA transcript or RNA product produced via transcription. Therefore, in some embodiments, an SOI is a segment of a DNA template encoding a specific nucleic acid sequence of an RNA product. In some embodiments, an SOI is a nucleic acid sequence of a portion or the entirety of an RNA transcript or RNA product.
[0044] The term "initial transcription sequence (ITS)" generally refers to a sequence containing the first several nucleotides (e.g., 1–15 nucleotides) of the sequence to be transcribed on a DNA template immediately downstream of the promoter. In some embodiments, DNA ITS influence the overall yield of the full-length RNA transcript produced via transcription (e.g., increasing the overall yield compared to a control DNA template lacking an ITS sequence). After initial binding to the promoter, RNA polymerase is expected to circulate back and forth over the ITS, releasing short, unsuccessful RNA transcripts before promoter clearance and the transition to the transcription elongation phase, thereby enabling the synthesis of the full-length RNA transcript.
[0045] The term "initial RNA transcript sequence (r-ITS)" generally refers to a sequence at the beginning of an RNA transcript that contains the first several nucleotides (e.g., 1-15 nucleotides) corresponding to the ITS on the DNA template used for the transcription of that RNA transcript. The r-ITS may refer to a sequence present at the beginning of an RNA transcript upstream of a SOI. In some embodiments, the r-ITS corresponds to a naturally occurring ITS. In some embodiments, the r-ITS is a heterologous or synthetic sequence present between the promoter and the SOI.
[0046] The term "ITS" generally refers to the initial DNA transcription sequence (ITS). The term "ITS-RC" generally refers to the reverse complement of the initial DNA transcription sequence. The term "r-ITS" generally refers to the initial RNA transcription sequence transcribed from the corresponding ITS. The term "r-ITS-RC" generally refers to the reverse complement of the initial RNA transcription sequence transcribed from the corresponding ITS-RC.
[0047] As used herein, the terms “transcription terminator” or “terminator” generally refer to a specific sequence, typically at the end of a SOI, on a DNA template that terminates RNA transcription by polymerase. In some embodiments, the terminator is a nucleic acid sequence that causes RNA polymerase to release from the DNA template and stop transcription. The terminator may be unidirectional or bidirectional.
[0048] The terms “sense” and “antisense” generally refer to individual strands in a double-stranded DNA or RNA molecule. The term “sense strand,” as used herein, generally refers to the nucleic acid sequence of the coding strand of a double-stranded nucleic acid molecule. The term “antisense strand” may be used to refer to the nucleic acid sequence of the template strand or a segment of a double-stranded nucleic acid that is transcribed to produce mRNA. Alternatively, the term “antisense strand” may refer to the nucleic acid sequence of an RNA strand complementary to the mRNA transcript or a segment thereof.
[0049] The term “expression cassette” generally refers to a DNA sequence that serves as a DNA template for the expression of an RNA transcript of interest via transcription. In some embodiments, an expression cassette comprises at least a promoter operably ligated to a nucleic acid sequence encoding the RNA molecule to be expressed. The expression cassette may also optionally include one or more of the following elements: a specific initial transcription sequence (ITS) that promotes expression, a reverse complement of the specific ITS (ITS-RC), one or more restriction endonuclease sites (RES), and / or one or more terminators.
[0050] As used herein, the terms “construct,” “nucleic acid construct,” “expression construct,” “engineered nucleic acid,” or “vector” generally refer to a DNA molecule containing one or more expression cassettes for the expression of an RNA transcript or product of interest (e.g., an RNA product, or a protein of interest) via in vitro or in vivo transcription by RNA polymerase. “Construct” and “vector” are used interchangeably herein. A construct may contain additional elements that are not critical to the expression of the RNA transcript but are essential for ensuring its own replication, maintenance, stability, etc., in vivo or in vitro. For example, a construct may be a plasmid comprising one or more expression cassettes, each additionally having a replication origin and a selection marker, respectively, for replication and maintenance in a suitable host. Alternatively, a chromosome of an organism, modified by incorporating one or more expression cassettes to enable the expression of an RNA transcript, may constitute a construct. Therefore, non-limiting examples of constructs include vectors, viral vectors (e.g., adeno-associated virus vectors), plasmids, cosmids, plastomes, bacteriophages, artificial chromosomes, natural genomes with integrated expression cassettes, or linear DNA molecules.
[0051] When used herein, in some embodiments, two nucleic acid sequences or elements are determined to be “operably linked” if the two nucleic acid sequences or elements are functionally connected to each other. For example, in some embodiments, a promoter is operably linked to an initial transcription sequence (ITS) so as to be present in a proper functional location and orientation in relation to the ITS regulated by the promoter, and to control (“drive”) the initiation of transcription and / or the expression of its ITS sequence.
[0052] RNA production RNA transcription (e.g., RNA production) involves three main steps. During the first step (initiation), RNA polymerase binds to the promoter on the DNA template, fused the two DNA strands (non-template and template strands), and initiated transcription at the transcription start site (TSS) by incorporating and polymerizing complementary ribonucleotides into the template DNA strand. The polymerase may repeatedly release short, unsuccessful transcripts (3-8 nucleotides in length) while circulating back and forth over the initial few nucleotides until it successfully moves to the next step (extension). Following promoter clearance and the formation of a stable three-component extension complex, the polymerase continues to move along the DNA template, extending / constructing the RNA product by incorporating complementary ribonucleotides into the template DNA strand. Following the complete production of the RNA product, the third step (termination) involves the release of polymerase from the transcribed RNA product, either as a result of polymerase encountering a terminator sequence on the DNA template, or by reaching the end of a linear DNA template and falling off the template.
[0053] Nucleic acid compositions (e.g., DNA templates) for use in methods of RNA transcription are described herein. In some embodiments, the nucleic acid (e.g., DNA template) includes template elements (e.g., DNA initial transcription sequence (ITS)) that improve the efficiency of each step of transcription (e.g., initiation, extension, and / or termination) in order to maximize the yield of RNA product from a transcription reaction (e.g., cell-free reaction and / or in vitro or in vivo transcription reaction). In some embodiments, the nucleic acid (e.g., DNA template) includes an ITS of varying length and nucleotide sequence. In some embodiments, the nucleic acid (e.g., DNA template, e.g., DNA vector, DNA construct, or DNA plasmid) includes two expression cassettes, one expression cassette encoding the sense strand of a double-stranded RNA (dsRNA) and the other expression cassette encoding the antisense strand of the dsRNA. In some embodiments, the sense strand of the dsRNA is fully or partially complementary to the antisense strand of the dsRNA. In some embodiments, the nucleic acid (e.g., a DNA template, e.g., a DNA vector, a DNA construct, or a DNA plasmid) comprises at least two expression cassettes, each expression cassette encoding an SOI to produce an ssRNA molecule.
[0054] In some embodiments, the promoter region of a DNA template is operably ligated to an initial transcription sequence (ITS). The ITS is a short sequence of up to 15 nucleotides (e.g., 6–15 nucleotides) that influences the transition from the initiation phase to the elongation phase of transcription via promoter clearance, thereby affecting the transcription rate and net yield from a given promoter. In some embodiments, the ITS is initially and repeatedly transcribed to release short, unsuccessful transcripts during the transcription initiation step. Consequently, r-ITS are present at the 5' end of the full-length RNA transcript after transcription of the ITS on the DNA template. Therefore, the ITS (if present) plays a crucial role in the early stages of transcription (transition to the elongation phase via initiation and promoter clearance) and influences the overall rate and yield of transcription from a given promoter. In some embodiments, the ITS is a naturally occurring ITS (e.g., a consensus ITS found immediately after the T7 class III promoter in the bacteriophage T7 genome). In some embodiments, the consensus ITS precedes the φ6.5, φ10, and φ13 genes and includes the first six nucleotides immediately downstream of the T7 class III promoter (GGGAGA (SEQ ID NO: 8)). In some embodiments, the ITS is a synthetic ITS (e.g., GGGAGACCAGGAATT (SEQ ID NO: 1)).
[0055] Promoters can bind naturally to a gene or sequence (e.g., endogenous promoters). In some embodiments, endogenous promoters are located upstream of the coding segment of a given gene or sequence. In some embodiments, coding nucleic acid sequences (e.g., SOIs) may be under the control of recombinant or heterologous promoters (referring to promoters that do not normally bind to the encoded sequence in their natural environment). Such promoters may include promoters of other genes; promoters isolated from other species; and synthetic promoters or enhancers that do not "occur naturally" (e.g., those containing different elements of different transcriptional regulatory regions and / or mutations that alter expression via genetic engineering methods known in the art).
[0056] In some embodiments, RNA is produced using nucleic acids and cell-free reactions described herein (such as those described in International Publication No. WO 2019 / 075167). In some embodiments, the cell-free transcription reaction involves three main processes: (1) decomposition of intracellular polymer RNA into nucleotide monomers (combinations of nucleotide monophosphate (NMP) and nucleotide diphosphate (NDP)); (2) conversion of NMP and NDP into nucleotide triphosphates (NTP) (which serve as "building blocks" for the formation of polymer RNA); and (3) polymerization of NTPs using a nucleic acid composition (e.g., a DNA-based vector) to produce RNA.
[0057] In some embodiments, RNA is produced using nucleic acid compositions and in vitro transcription (IVT) reactions described herein. In some embodiments, the IVT reaction comprises recombinant RNA polymerase, NTPs, salts, metals, cofactors, and / or buffers. In some embodiments, any IVT reaction described in the Art may be used with nucleic acid compositions described herein.
[0058] The RNA production method can be carried out at temperatures of 4°C to 80°C or higher. For example, the RNA production method can be carried out at 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C. The process can be carried out at temperatures of 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, or 80°C. The RNA production method can be carried out for a period of 5 minutes (min) to 48 hours (hr) or longer. For example, the method for producing RNA can be carried out over a period of 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, 42 hours, or 48 hours.
[0059] In some embodiments, the method for producing RNA may be catalyzed by a highly processive DNA-dependent T7 RNA polymerase, such as one encoded by gene 1 from the T7 bacteriophage genome. In some embodiments, the RNA polymerase is a T7 RNA polymerase from a T7 phage. In some embodiments, the RNA polymerase is an RNA-dependent RNA polymerase (e.g., a Φ6 RNA polymerase from phage Φ6). Other DNA-dependent polymerases or RNA-dependent RNA polymerases may be used in accordance with this disclosure.
[0060] In some embodiments, transcription of the nucleic acids of the Disclosure produces RNA products (e.g., dsRNA, messenger RNA, shRNA, siRNA, ssRNA, gRNA, antisense oligonucleotide, or sense or antisense strands of gapmers). In some embodiments, transcription of the nucleic acids of the Disclosure produces RNA products adjacent to ITS (r-ITS) and the reverse complement of ITS (r-ITS-RC).
[0061] In some embodiments, methods for producing RNA using compositions described herein produce at least 5% more RNA, at least 10% more RNA, at least 20% more RNA, at least 30% more RNA, at least 40% more RNA, at least 50% more RNA, at least 60% more RNA, at least 70% more RNA, or more than a control. For example, a method using a vector or construct containing a promoter operably linked to an ITS (e.g., an ITS containing the nucleotide sequence of SEQ ID NO: 1) produces at least 5% more RNA, at least 10% more RNA, at least 20% more RNA, at least 30% more RNA, at least 40% more RNA, at least 50% more RNA, at least 60% more RNA, at least 70% more RNA, or more than a control (e.g., a method using a vector or construct without a promoter operably linked to an ITS).
[0062] In some embodiments, RNA is produced via transcription using a composition of the nucleic acid construct or engineered nucleic acid described herein, for example, in microbial cells containing the nucleic acid construct or engineered nucleic acid described herein. In some embodiments, the nucleic acid construct or engineered nucleic acid is incorporated into the chromosome of the microbial cell. In some embodiments, the nucleic acid construct or engineered nucleic acid is a plasmid, or any other nucleic acid construct or engineered nucleic acid contained within the microbial cell. In some embodiments, RNA is produced in prokaryotic or eukaryotic cells containing the nucleic acid construct described herein, grown under conditions optimal for RNA production. In some embodiments, cells containing the nucleic acid construct or engineered nucleic acid described herein are grown in a fermentation chamber or reactor to produce RNA as the product of interest. In other embodiments, cells containing the nucleic acid construct or engineered nucleic acid described herein are grown in a fermentation chamber or reactor for the production of a protein or peptide of interest, and the nucleic acid construct or engineered nucleic acid enables the expression of RNA encoding the protein or peptide product of interest within the cell.
[0063] Initial transcription sequence The ITS for use in nucleic acid compositions described herein may include lengths of 1 to 15 nucleotides (e.g., lengths of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides). In some embodiments, the ITS is 1 to 6, 1 to 9, 1 to 12, 1 to 15, 3 to 6, 6 to 9, 6 to 12, 6 to 15, 9 to 15, 9 to 12, 10 to 15, 10 to 12, 12 to 15, or greater than 15 nucleotides. In some embodiments, the ITS is located immediately downstream of the promoter (e.g., a T7 class III minimal promoter). In some embodiments, the ITS covers the transcription start site.
[0064] In some embodiments, the ITS is as described in Table 1. In some embodiments, the ITS is any one of SEQ ID NOs: 1-8 or 38-41. In some embodiments, the ITS is any one of SEQ ID NOs: 1-4 or 38-41. In some embodiments, the ITS is a variant of any one of SEQ ID NOs: 1-8 or 38-41, the variant containing at least 1, 2, 3, 4, 5, or more mutations. In some embodiments, a promoter operably ligated to the ITS is located upstream of the Sequence of Interest (SOI), the SOI encoding a desired RNA product (e.g., the sense or antisense strand of dsRNA). In some embodiments, the T7 class III minimal promoter includes TAATACGACTCACTATA (SEQ ID NO: 9). In some embodiments, the T7 class III minimal promoter is preceded by a naturally occurring 30-base pair sequence upstream of the promoter in the T7 bacteriophage genome region, such as TCGATTCGAACTTCTGATAGACTTCGAAATTAATACGACTCACTATA (SEQ ID NO: 18). TIFF0007865575000001.tif155170
[0065] In some embodiments, the promoter is a minimal class III T7 promoter comprising the sequence:TAATACGACTCACTATA (SEQ ID NO: 9). In some embodiments, the promoter is an extended class III T7 promoter comprising the sequence:TCGATTCGAACTTCTGATAGACTTCGAAATTAATACGACTCACTATA (SEQ ID NO: 18).
[0066] The ITS_6 variant corresponds to a conserved region of ITS preceding the φ6.5, φ10, and φ13 genes from the T7 genome. The pT7-g10, pT7-g5, and pT7-5_LIT_AI variants correspond to previously reported synthetic or naturally occurring ITS. GL-hybrid variants (GL-hybrid_A9, GL-hybrid_A9G, GL-hybrid_A9C, GL-hybrid_A9T) have been identified by the inventors of this disclosure and are surprisingly effective in enhancing the RNA transcription process. As described by the examples, DNA templates containing promoters operably linked to GL-hybrid ITS variants produced higher levels of transcribed RNA products compared to control DNA templates (e.g., DNA templates containing ITS_6).
[0067] Arrangement of interests The nucleic acid compositions described herein (e.g., DNA templates) comprise a sequence of interest (SOI), which is any sequence encoding an RNA product. In some embodiments, the SOI is operably linked to a promoter (optionally a promoter containing an ITS). The promoter drives the expression or transcription of the SOI it regulates.
[0068] In some embodiments, the RNA product is the sense strand of double-stranded RNA (dsRNA). In some embodiments, the RNA product is the antisense strand of dsRNA. In some embodiments, the sense strand of dsRNA is complementary to the antisense strand of dsRNA. In some embodiments, the RNA product is single-stranded RNA (e.g., messenger RNA). In some embodiments, the RNA product is shRNA, siRNA, antisense oligonucleotide, gapmer, or other conceivable RNA product.
[0069] In some embodiments, the RNA product (e.g., dsRNA) targets a genomic sequence of interest from, for example, an insect, plant, fungus, animal, or virus (e.g., via RNA interference). In some embodiments, the RNA product (e.g., mRNA) encodes a protein of interest.
[0070] In some embodiments, the SOI encoding the RNA product may have any length sufficient to induce biological activity. Non-limiting examples include SOIs encoding RNA products of lengths of 4-10, 4-20, 4-30, 4-50, 4-60, 4-70, 4-80, 4-90, 4-100, 4-200, 4-300, 4-400, 4-500, 4-1000, 500-2000 nucleotides, 500-4000 nucleotides, 500-6000 nucleotides, 500-8000 nucleotides, or 4-10000 nucleotides. In some embodiments, the SOI encoding the RNA product may have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the SOI encoding the RNA product has a nucleotide length of 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 500, 1000, or more.
[0071] If two nucleic acids (e.g., the sense and antisense strands of dsRNA) base-pair or bind to each other to form a double-stranded nucleic acid molecule via Watson-Crick interactions (also referred to as hybridization), then the nucleic acids are complementary to each other (e.g., completely or partially). As used herein, binding refers to the association between at least two molecules or two regions of the same molecule resulting from interactions such as electrostatic, hydrophobic, ionic, and / or hydrogen bonding under physiological conditions. In some embodiments, the two nucleic acids are 100% complementary (i.e., completely complementary along a segment or the whole of the nucleic acid). In some embodiments, the two nucleic acids are at least 75%, 80%, 85%, 90%, or 95% complementary along a segment or the whole of the nucleic acid (e.g., partially complementary). The optimal alignment may be determined by using any suitable algorithm for aligning the sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler transformation (e.g., the Burrows-Wheeler aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies), ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, two complementary nucleic acids contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mismatched base pairs.
[0072] In some embodiments, double-stranded RNA or dsRNA is a completely double-stranded molecule and does not contain single-stranded regions (e.g., loops or overhangs). In some embodiments, double-stranded RNA or dsRNA is a partially double-stranded molecule and contains both double-stranded and single-stranded regions (e.g., loops or overhangs).
[0073] Terminator array In some embodiments, a nucleic acid composition (e.g., a DNA template) includes a transcription terminator sequence. The sequence encoding the transcription terminator is typically located immediately downstream of the coding sequence. It consists of a DNA sequence involved in the specific termination of the RNA transcript by RNA polymerase. The terminator sequence prevents transcriptional activation of the downstream nucleic acid sequence by the upstream promoter. Therefore, in some embodiments, a DNA template containing a terminator that terminates the production of an RNA transcript is intended. The most commonly used type of terminator is the forward terminator. When placed downstream of the nucleic acid sequence that is normally transcribed, a forward transcription terminator will cause a transcription interruption. In some embodiments, a bidirectional transcription terminator is provided, which typically causes transcription termination on both the forward and reverse strands. In some embodiments, a reverse transcription terminator is provided, which typically causes transcription termination on the reverse strand only. In prokaryotic cells, terminators are typically classified into two categories: (1) Rho-independent terminators and (2) Rho-dependent terminators. Rho-independent terminators generally consist of a palindrome sequence that forms a series of uracil bases following a GC base-pair-rich stem-loop.
[0074] Terminators for use in accordance with this disclosure include any transcriptional terminators described herein or known to those skilled in the art. Non-limiting examples of terminators include, for example, bovine growth hormone terminators, E. coli ribosomal RNA T1 and T2 terminators (rrnBT1 and rrnBT2), human prepro parathyroid PTH terminators, and viral termination sequences and their derivatives (e.g., T0 terminators, TE terminators, lambda T1, T7, TT7, T7U, TT3 terminators, etc.), as well as gene termination sequences such as other terminator sequences found or used in bacterial systems. In some embodiments, the termination signal may be a sequence that cannot be transcribed or translated (e.g., resulting from sequence shortening).
[0075] In some embodiments, the terminator comprises two or more individual and / or separate terminator sequences, or a combination thereof. In some embodiments, the terminator comprises an rrnBT1 terminator sequence, an rrnBT2 terminator sequence, a TT7 terminator sequence, a T7U terminator sequence, a TT3 terminator sequence, and / or a PTH terminator sequence. In some embodiments, the terminator is as described in Table 2. In some embodiments, the terminator comprises any one of sequence numbers 19-30. TIFF0007865575000002.tif196170TIFF0007865575000003.tif119170
[0076] Nucleic acid architecture Nucleic acids described herein may include any conceivable architecture. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the circular nucleic acid includes an endonuclease recognition site which may allow the circular nucleic acid to be linearized if a suitable endonuclease cleaves the nucleic acid at the endonuclease recognition site. In some embodiments, the nucleic acid is a DNA template containing a sequence of interest (SOI), where the SOI encodes an RNA product. In some embodiments, the DNA template or vector is a plasmid or DNA construct. In some embodiments, the DNA template or vector is a plasmid, expression cassette, cosmid, bacterial artificial chromosome, yeast artificial chromosome, bacteriophage, adeno-associated virus vector (AAV vector), or virus.
[0077] This disclosure describes a nucleic acid architecture that demonstrates better efficacy in the production of RNA of interest (e.g., dsRNA) than conventional architectures (e.g., hairpin). The use of a nucleic acid construct comprising two separate expression cassettes ("independent expression cassette" architecture) capable of expressing the sense and antisense strands of a dsRNA product respectively offers advantages over other construct architectures that enable the synthesis of a given dsRNA product.
[0078] In some embodiments, the nucleic acid (e.g., a vector or construct as described herein) comprises two expression cassettes, as described above, which enable the expression of a sense strand and an antisense strand of the dsRNA product, resulting in a dsRNA product formed from the hybridization of the sense and antisense strands to a higher degree than that from a vector having a single expression cassette capable of expressing a hairpin dsRNA product having a sense strand and an antisense strand connected by a loop sequence.
[0079] For example, such a construct that allows the expression of sense and antisense strands independently from two separate expression cassettes results in a higher dsRNA product titer than a construct that has a single expression cassette capable of expressing a transcript (where the two complementary strands of the dsRNA product are linked via a single-stranded linker or loop region to form a dsRNA hairpin structure, as observed in Example 4 below).
[0080] For a dsRNA product of length "x" base pairs in the case of a dsRNA expressed from a single expression cassette, successful synthesis of the hairpin requires a polymerase that can successfully transcribe a region of DNA that is (2x+l) base pairs long (where "l" is the length of the "loop" connecting the sense and antisense strands). In contrast, in constructs where the sense and antisense strands are expressed independently from two separate expression cassettes, each polymerase molecule only needs to transcribe DNA of length "x" base pairs and successfully produce a full-length transcript capable of hybridizing to form the dsRNA product. When polymerase is in excess and efficient promoter clearance is ensured through appropriate ITS selection (as described herein), multiple polymerase molecules can simultaneously and independently bind to the promoters of two expression cassettes, allowing for the transcription of multiple copies of sense and antisense transcripts from the two separate expression cassettes, generating a large amount of dsRNA product upon hybridization of the simultaneously expressed sense and antisense transcripts in the reaction. In contrast, under similar reaction conditions, constructs with a single expression cassette for dsRNA hairpin expression are expected to yield a lower relative yield due to the availability of only a single promoter for transcription of a single RNA molecule containing both sense and antisense transcripts linked via the hairpin loop. Additionally, for RNA reactions resulting in a high rate of unsuccessful transcription, an increase in the length of the DNA template transcribed to obtain a full-length transcript ("2x+l" compared to "x") is expected to further affect the yield.
[0081] As described herein, a nucleic acid (e.g., a vector or construct) comprises a promoter, optionally an ITS, a sequence of interest (SOI), and a promoter operably ligated to a terminator sequence. In some embodiments, the nucleic acid comprises a T7 minimal promoter (e.g., a sequence like the one in SEQ ID NO: 17) operably ligated to an ITS_6 consensus ITS. In some embodiments, the SOI to be transcribed is placed or located immediately downstream of the promoter (e.g., a class III T7 promoter). In some embodiments, the nucleic acid (e.g., a vector or construct) further comprises one or more terminators or terminator sequences placed downstream of the SOI to prevent read-through transcription beyond the SOI, for example, resulting in an RNA product with additional undesirable nucleotides. In some embodiments, the nucleic acid (e.g., a vector or construct) further comprises a restriction endonuclease recognition site. In some embodiments, the restriction endonuclease recognition site is located downstream of the SOI (e.g., immediately downstream of the SOI) to allow linearization of the plasmid template by the corresponding restriction endonuclease before the DNA template is used in the transcription reaction. In some embodiments, the restriction endonuclease recognition site is located between the SOI and the terminator. In some embodiments, the restriction endonuclease recognition site is located downstream of both the SOI and the terminator.
[0082] In some embodiments, the nucleic acid (e.g., a vector or construct) comprises a promoter operably linked to the ITS; a sequence of interest (SOI); a restriction endonuclease recognition site; and a terminator. In some embodiments, the nucleic acid (e.g., a vector or construct) further comprises a sequence that is a reverse complement of the ITS, located downstream of the SOI (optionally between the SOI and the terminator). In some embodiments, the nucleic acid (e.g., a vector or construct) comprises one expression cassette, the expression cassette comprising at least a promoter and an SOI. In some embodiments, the nucleic acid (e.g., a vector or construct) comprises two expression cassettes, each expression cassette comprising at least a promoter and an SOI, and optionally each expression cassette comprising a separate SOI. In some embodiments, the nucleic acid (e.g., a vector or construct) comprises two expression cassettes, the first expression cassette comprising an SOI encoding the sense strand of the dsRNA, and the second expression cassette comprising an SOI encoding the antisense strand of the dsRNA. In some embodiments, the nucleic acid (e.g., vector or construct) comprises more than two expression cassettes (e.g., three, four, or five expression cassettes).
[0083] In some embodiments, the nucleic acid (e.g., a vector or construct) comprises two expression cassettes, the first expression cassette comprising a promoter operably ligated to an ITS upstream of a nucleotide sequence (e.g., SOI) encoding the sense strand of a double-stranded RNA (dsRNA), and the second expression cassette comprising a promoter operably ligated to an ITS upstream of a nucleotide sequence (e.g., SOI) encoding the antisense strand of the dsRNA. In some embodiments, the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA. In some embodiments, the ITS is 1 to 15 nucleotides long. In some embodiments, the ITS is any one of sequence numbers 1 to 8 or 38 to 41.
[0084] In some embodiments, the nucleic acid (e.g., a vector or construct) comprises two expression cassettes, the first expression cassette comprising a promoter operably ligated to an ITS, such as one provided in any one of sequence numbers 1-8 or 38-41 upstream of a nucleotide sequence (e.g., SOI) encoding the sense strand of the double-stranded RNA (dsRNA), and the second expression cassette comprising a promoter operably ligated to an ITS, such as one provided in any one of sequence numbers 1-8 or 38-41 upstream of a nucleotide sequence (e.g., SOI) encoding the antisense strand of the dsRNA. In some embodiments, the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA.
[0085] In some embodiments, the nucleic acid (e.g., a vector or construct) comprises two expression cassettes, the first expression cassette comprising a promoter operably ligated to a nucleotide sequence (e.g., SOI) encoding the sense strand of a double-stranded RNA (dsRNA), and the second expression cassette comprising a promoter operably ligated to a nucleotide sequence (e.g., SOI) encoding the antisense strand of the dsRNA. In some embodiments, the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA.
[0086] In some embodiments, the nucleic acid (e.g., a vector or construct) comprises two expression cassettes, the first expression cassette comprising a promoter operably linked to an ITS containing any one nucleotide sequence from SEQ ID NOs: 1-8 or 38-41, a nucleotide sequence encoding the sense strand of the dsRNA (e.g., SOI), and a terminator; the second expression cassette comprising a promoter operably linked to an ITS containing any one nucleotide sequence from SEQ ID NOs: 1-8 or 38-41, a nucleotide sequence encoding the antisense strand of the dsRNA (e.g., SOI), and a terminator; the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA. In some embodiments, the two expression cassettes are encoded by two complementary strands of the same segment of double-stranded DNA and anneal to produce a dsRNA molecule. In some embodiments, during RNA transcription, a polymerase molecule initiates transcription of the complementary strands from the promoters at both ends, and the polymerase moves toward each other (e.g., in a convergent manner) while first traversing the two complementary DNA strands.
[0087] In some embodiments, the nucleic acid (e.g., a vector or construct) comprises two expression cassettes, the first expression cassette comprising a promoter operably linked to an ITS containing the nucleotide sequence of SEQ ID NO: 1, a nucleotide sequence encoding a first RNA product (e.g., SOI), and a terminator; the second expression cassette comprising a promoter operably linked to an ITS containing the nucleotide sequence of SEQ ID NO: 1, a nucleotide sequence encoding a second RNA product (e.g., SOI), and a terminator; the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA. In some embodiments, the first and second expression cassettes are oriented in the same direction on a given vector or DNA molecule (the same DNA strand is used as a template strand between transcriptions from the respective promoters of both expression cassettes). In some embodiments, the first and second expression cassettes are oriented in opposite directions on a given vector or DNA molecule (e.g., the opposite strands are used as template strands between transcriptions from the respective promoters of both expression cassettes). Depending on whether the two expression cassettes are oriented in the same or opposite directions on a given vector or DNA molecule, the RNA polymerases driving expression from two independent promoters can move (e.g., transcribe) in the same direction on the same strand of the dsDNA molecule or in opposite directions on two different DNA strands.
[0088] In some embodiments, the RNA product produced using the expression cassette is flanked by an r-ITS and a reverse complement of the r-ITS (r-ITC-RC), for example, the r-ITS being the 5' end of the RNA product and the reverse complement of the r-ITS (r-ITS-RC) being the 3' end of the RNA product.
[0089] In some embodiments, the nucleic acid (e.g., vector or construct) provides a design comprising a "complementary expression cassette" design, each cassette comprising an ITS and optionally an ITS-RC for the expression of a dsRNA molecule of interest. In some embodiments, the architectural design comprises a "complementary expression cassette," each comprising an ITS and optionally an ITS-RC for the expression of a dsRNA molecule of interest, with a first expression cassette (encoding the sense strand) and a second expression cassette (encoding the antisense strand) expressing the sense and antisense strands of the dsRNA molecule, respectively. The sense and antisense strands are encoded by two complementary strands of the same segment of double-stranded DNA, which anneal to produce a dsRNA molecule comprising an r-ITS (which is complementary to the ITS) and optionally an r-ITC-RC (which is complementary to the ITC-RC). In some embodiments, in this architecture, the sequence of interest (SOI) (with or without DNA ITS) is operably ligated to two promoters at each of its ends, one promoter driving the expression of the sense strand of the desired dsRNA product and the other promoter driving the expression of the antisense strand of the desired dsRNA product. During transcription of the “complementary expression cassette” design, RNA polymerase molecules initiate transcription of the complementary strands from the promoters at the two ends, and the polymerases move toward each other (e.g., in a converging manner), initially traversing the two complementary DNA strands.
[0090] In other embodiments, the nucleic acid (e.g., vector or construct) architecture design includes an “independent expression cassette” design, where the expression cassettes for the expression of the sense and antisense strands of a dsRNA molecule are encoded by completely independent segments of DNA, which may or may not be incorporated into the same plasmid, linearized template, or other DNA construct. In some embodiments, the “independent expression cassette” design involves at least two expression cassettes that are parts of the same vector or DNA molecule, with the first and second expression cassettes oriented in the same direction on a given vector or DNA molecule (e.g., the same DNA strand is served as a template strand during transcription from each promoter of each expression cassette). In other embodiments, the “independent expression cassette” design involves at least two expression cassettes that are parts of the same vector or DNA molecule, with the first and second expression cassettes oriented in opposite directions on a given vector or DNA molecule (e.g., during transcription, two opposite strands in a given vector or DNA molecule are served as template strands for the two expression cassettes). Depending on whether the two expression cassettes are oriented in the same or opposite directions on a given vector or DNA molecule, the RNA polymerases driving expression from two independent promoters can move (e.g., transcribe) in the same direction on the same strand of the dsDNA molecule or in opposite directions on two different DNA strands.
[0091] In some embodiments, the nucleic acid (e.g., vector or construct) comprises a single expression cassette comprising a promoter operably linked to an ITS containing one of the nucleotide sequences from SEQ ID NOs: 1-4 (or each alternative version in which the first G is mutated to A, as described in SEQ ID NOs: 38-41), a nucleotide sequence encoding an RNA product (e.g., mRNA) (e.g., SOI), and a terminator and / or restriction endonuclease recognition site. In other embodiments, the first GG is similarly mutated to AU.
[0092] In some embodiments, the nucleic acids described herein are vectors or plasmids. In some embodiments, the vector or plasmid requires an origin of replication for replication of the vector or plasmid, for example, in a host. The origin of replication defines the plasmid copy number. A plasmid possessing an origin of replication from pUC18 or pUC19 is maintained at a high copy number (500–1000 copies / cell) in host cells under specific growth conditions. In some embodiments, the origin of replication is an intermediate copy number origin (e.g., ColE1 from pETDuet), a high copy number origin (e.g., an origin from pUC18), or a low copy number origin (e.g., P15A). In some embodiments, bacterial cells possessing such plasmids (e.g., E. coli cells) are grown to a high cell density in fermentation to yield a significant amount of plasmid DNA, which can then be isolated and purified.
[0093] In some embodiments, the nucleic acid (e.g., a vector or plasmid) further includes a selection marker to ensure its maintenance during growth on a selective medium. In some embodiments, the selection marker is a positive selection marker (e.g., a protein or gene that confers a competitive advantage to bacteria containing the selection marker). In some embodiments, the selection marker is a negative selection marker (e.g., a protein or gene that inhibits the growth and / or division of bacteria containing the selection marker). In some embodiments, the selection marker is a mixed positive / negative selection marker (e.g., a protein or gene that can provide a competitive advantage under certain circumstances and inhibit growth and / or division under other circumstances). Examples of selection markers include, but are not limited to, genes encoding proteins that increase or decrease either resistance or sensitivity to antibiotics or other compounds (e.g., ampicillin resistance genes, kanamycin resistance genes, neomycin resistance genes, tetracycline resistance genes, and chloramphenicol resistance genes). In some embodiments, the selection marker is an antibiotic-free selection marker. Other selection markers may be used in accordance with this disclosure.
[0094] In some embodiments, the vector or plasmid for the expression of a dsRNA product (the sense and antisense strands are expressed from two separate expression cassettes) includes an origin of replication and a selection marker. In some embodiments, the vector or plasmid for the expression of a dsRNA product (the sense and antisense strands are expressed from two separate expression cassettes) includes multiple copies of both expression cassettes encoding the sense and antisense strands (e.g., 2, 3, 4, or 5 copies of each expression cassette). In some embodiments, the vector or plasmid for the expression of an ssRNA product (the ssRNA product is expressed from a single expression cassette) includes an origin of replication and a selection marker. In some embodiments, the vector or plasmid for the expression of an ssRNA product includes multiple copies of the same expression cassette encoding the ssRNA product (e.g., 2, 3, 4, or 5 copies of the same expression cassette).
[0095] In some embodiments, the restriction enzyme recognition site is recognized and / or cleaved by a restriction endonuclease. In some embodiments, the restriction endonuclease is I-SceI. Other restriction endonucleases are known and may be used in accordance with this disclosure. Non-limiting examples include EcoRI, EcoRII, BamHI, HindIII, TaqI, NotI, HinFI, Sau3AI, PvuII, SmaI, HaeIII, HgaI, AluI, EcoRV, EcoP15I, KpnI, PstI, SacI, SalI, ScaI, SpeI, SphI, StuI, and XbaI, FokI, AscI, AsiAI, NotI, FseI, PacI, SdaI, SgfL, SfiI, PmeI, BspQI, Esp3I, BsmBI, and SapI.
[0096] In some embodiments, the nucleic acid (e.g., vector or construct) further comprises a sequence that is a reverse complement of the ITS located downstream of the SOI (optionally between the SOI and the terminator). In some embodiments, the reverse complement of the ITS is 100% complementary. In some embodiments, the reverse complement of the ITS is at least 75%, 80%, 85%, 90%, or 95% complementary.
[0097] In some embodiments, a nucleic acid construct (e.g., a plasmid construct) includes a replicon, defined as the smallest unit or element that enables replication of the nucleic acid construct (e.g., plasmid DNA) in a host microbial cell. In some embodiments, the replicon includes an origin of replication (ori) from which replication of the nucleic acid construct (e.g., plasmid DNA) is initiated, as well as additional elements that control replication and copy number of the nucleic acid construct (e.g., plasmid) in the host cell. In embodiments where the nucleic acid construct is a plasmid DNA construct, replication of plasmid DNA is initiated at the ori by the host's DNA replication machinery. Some non-limiting examples of replicons include those that enable replication of plasmids in a bacterial host (e.g., E. coli), such as replicons found in the ColE1 plasmid, pBR322 plasmid (pMB1 origin of replication), pUC18 and pUC19 plasmids (containing the pUC replicon, a derivative of the pMB1 replicon), R6K plasmid, p15A plasmid, pSC101 plasmid, etc. Different replicons result in different copy numbers and yields for a plasmid in a given host. For example, ColE1 and pMB1 origins typically allow for the maintenance of about 15–20 copies of the plasmid molecule in each cell, while deletion of the rop gene and two point mutations in the pMB1 origin result in temperature-inducible amplification of 500–1000 copies per cell in plasmids possessing pUC replicons, such as those found in pUC18 or pUC19-derived plasmids. Additionally, plasmids used in eukaryotic microbial cells (e.g., yeast) possess an "autonomous replication sequence (ARS)" from which replication is initiated, acting as replicons. In some embodiments, a replicon consists of at least an origin of replication.
[0098] kit Some aspects of this disclosure provide kits. The kits may include, for example, engineered nucleic acids or constructs, polymerases, nucleoside triphosphates, and / or nucleoside monophosphates as described herein.
[0099] The kits described herein may include one or more containers for holding the components and, optionally, instructions for use. Kits for research purposes may contain the components in appropriate concentrations or amounts for performing a variety of experiments. Any of the kits described herein may further include components required to perform any of the methods described herein.
[0100] Each component of the kit may be provided in liquid form (e.g., in solution) or solid form (e.g., dry powder), where applicable. In certain cases, some of the components may be lyophilized, reconstituted, or processed (e.g., into an active form) by adding a suitable solvent or other type (e.g., water or certain organic solvents), which may or may not be provided with the kit.
[0101] In some embodiments, the kit includes instructions and / or promotions for the use of the provided components. Instructions may define the components of the instructions and / or promotions and may typically be included in written instructions on the packaging of the disclosure or accompanying the packaging of the disclosure. Instructions may also include any oral or electronic instructions provided in any format, such as audiovisual (e.g., videotapes and DVDs), the Internet, and / or web-based communications, provided so that the user clearly recognizes that the instructions accompany the kit.
[0102] The kit may contain any one or more of the components described herein in one or more containers. The components may be prepared under sterile conditions, packaged in syringes, and transported under refrigeration. Alternatively, the components may be contained in vials or other containers for storage. The second container may contain other components prepared under sterile conditions. Alternatively, the kit may contain a premix activator and be transported in vials, tubes, or other containers.
[0103] Depending on the specific application, the kit may also include other components (e.g., containers, cell culture media, salts, buffers, reagents, syringes, needles, disposable gloves, etc.). [Examples]
[0104] Example 1: Production of dsRNA from linear DNA templates with different ITS variants using in vitro transcription (IVT) reaction. GS1 (601 base pair dsRNA) was produced in an in vitro transcription (IVT) reaction in buffer using a linear DNA template containing an expression cassette with a promoter operably ligated to a different ITS variant (as shown in Table 3) placed immediately upstream of the sequence of interest to be expressed (GS1 sense and GS1 antisense strands). Each GS1 strand synthesized in the IVT reaction contained a 5' single-stranded r-ITS overhang corresponding to a different ITS variant. A DNA template lacking a specific ITS (ITS_none) was used as a control in the experiment. Note that for each ITS variant and control, two DNA templates were used, one containing the sequence of interest (SOI) encoding the GS1 sense strand, and the other containing the SOI encoding the GS1 antisense strand. Figure 2 shows the general architecture of the linear DNA template with the expression cassette and the expected dsRNA product (with a 5' single-stranded r-ITS overhang). [Table 3]
[0105] Each IVT reaction contained 45 mM magnesium sulfate, 2 mM spermidine, 4 mM each of the four canonical NTPs (New England Biolabs, Ipswich, MA), 0.1 mg / mL recombinant thermostable mutant T7 RNA polymerase, 0.04 U / μL thermostable inorganic pyrophosphatase (TIPP) (New England Biolabs, Ipswich, MA), and 20 ng / μL each of the two DNA templates (encoding the sense and antisense strands of GS1, respectively). The reaction was carried out at 48°C for 2 hours. After 2 hours, the RNA product was isolated and quantified using reversed-phase ion-pair (RP-IP) chromatography as described below.
[0106] For RP-IP HPLC analysis, samples were collected from each reactant, and total RNA was extracted from the samples using solid-phase extraction. The extracted dsRNA samples were analyzed by RP-IP-HPLC on an Agilent 1100 series HPLC system. HPLC analysis was performed using a DNASep® cartridge (4.6 × 50 mm, ADS Biotec, PN: DNA-99-3501) held at 50°C with gradient separation (flow rate of 0.85 mL / min) as shown in Table 4. The signal was measured as absorbance at 260 nm. TIFF0007865575000005.tif67170
[0107] As shown in Figure 5, all templates containing one of the ITSs from Table 3 (ITS_6; pT7-g10; pT7-g5; and GL-hybrid_A9) provided high yields of dsRNA products in the IVT reaction, with expression levels of 2000–2800 ng / μL. The GL-hybrid_A9 ITS yielded the highest expression level of GS1 dsRNA, with approximately 2800 ng / μL of synthesized GS1. As expected, DNA templates lacking a specific ITS (ITS_none) did not produce detectable expression of the dsRNA product, and this DNA template lacked the terminal "G" at the end of the minimal class III T7 promoter, which is known to be important for transcription.
[0108] Example 2: Production of dsRNA from linear DNA templates with different ITS variants using a cell-free RNA synthesis reaction. GS1 dsRNA products (with 5' overhangs) were produced in a cell-free reaction using a linear DNA template containing an expression cassette with a nucleotide sequence containing a promoter operably ligated to different ITS variants (as shown in Table 3) placed upstream of the expressed SOI (GS1 sense strand and GS1 antisense strand). An ITS-deficient DNA template (ITS-free) was used as a control in the experiment. As in Example 1, two DNA templates were used for each ITS variant and control, as shown in Figure 2, one containing an SOI encoding the GS1 sense strand and the other containing an SOI encoding the GS1 antisense strand. In addition, single-stranded GS1 dsRNA products without overhangs were also produced using a DNA template according to Figure 3, further including reverse complements of their corresponding ITS downstream of the SOI, as shown in Figure 3.
[0109] Yeast RNA powder obtained from a commercial source was dissolved in water at 56 g / L and depolymerized using 1.2 g / L P1 nuclease at 70°C for 1 hour at pH 5.5 in the presence of 0.05 mM zinc chloride. The resulting depolymerized material was clarified by centrifugation and filtered using a 10 kDa MWCO filter. The resulting stream contained 5' nucleotide monophosphates (NMPs) at a total concentration of approximately 90–100 mM (approximately 20–25 mM each of AMP, CMP, GMP, and UMP).
[0110] E. coli BL21(DE3) derivatives containing pBAD24-derived vectors encoding individual kinase enzymes (TthCmk, PfPyrH, TmGmk, AaNdk, and DgPPK2) were cultured in fermentation on Korz medium supplemented with 50 mg / L carbenicillin, using standard and simple fed-batch techniques for high-cell density culture of Escherichia coli. Protein expression was then induced by the addition of L-arabinose. After bacterial collection, lysates were prepared in 60 mM phosphate buffer using high-pressure homogenization, yielding a mixture of approximately 40 g / L of total protein.
[0111] E. coli BL21(DE3) derivatives containing a pBAD24-derived vector encoding a heat-stable T7 RNA polymerase enzyme were cultured, protein expression was induced using L-arabinose, and lysates were prepared as described above. The polymerase enzyme was partially purified using a two-step ammonium sulfate fractionation.
[0112] To construct the cell-free reaction, kinase enzyme-containing lysates were combined in equal proportions, diluted to a final total protein concentration of 2 g / L, and mixed with reaction additives (45 mM magnesium sulfate and 13 mM sodium hexametaphosphate). The lysates were incubated at 70°C for 15 minutes to inactivate other enzyme activity while maintaining the activity of the overexpressed kinase. Additionally, yeast-derived NMP (at approximately 4 mM concentration each) and 0.1 mg / mL recombinant thermostable mutant T7 RNA polymerase were added, along with 10 ng / μL of each of two linear DNA templates (expressing the sense and antisense strands of the dsRNA product, respectively). The cell-free reaction was incubated at 48°C for 2 hours, and the RNA product was isolated and quantified using RP-IP HPLC as described in Example 1.
[0113] As shown in Figure 6A, all templates containing ITS produced RNA at a level of at least approximately 1800 ng / μL, with the GL-hybrid_A9 ITS yielding the highest expression level (approximately 2500 ng / μL) of GS1 dsRNA (with a 5'r-ITS overhang). The ITS-free variant, as expected, did not show product synthesis, but the ITS_6 variant (naturally found preceding the φ6.5, φ10, and φ13 genes in the T7 genome) yielded a titer of approximately 1800 ng / μL.
[0114] As shown in Figure 6B, the template encoding the reverse complement of the ITS downstream of the SOI performed comparably to that of the ITS without the reverse complement. The template containing the GL-hybrid_A9 ITS showed approximately 2500 ng / μL of dsRNA.
[0115] In summary, these results suggest that the GL-hybrid_A9 ITS variant produces higher levels of RNA product than the naturally occurring consensus ITS_6 variant (found prior to the φ6.5, φ10, and φ13 genes in the T7 genome).
[0116] Example 3: Production of dsRNA from a linear DNA template containing GL-hybrid_A9 ITS for five different SOIs The production of five different dsRNA products (GLSeq-A, GLSeq-B, GLSeq-C, GLSeq-D, and GLSeq-E) was assessed to demonstrate the benefits in RNA synthesis achieved by using GL-hybrid_A9 ITS in DNA templates. As a control in this study, a template containing ITS_2 ITS (introducing two Gs at the end of a minimal class III T7 promoter known to be important for transcription) was used. The T7 class III minimal promoter operably ligated to ITS_2 contains the sequence:TAATACGACTCACTATAGG (SEQ ID NO: 36). Additionally, the expression of sense and antisense strands of dsRNA products from two independent expression cassettes encoded on separate segments of double-stranded DNA ("independent expression cassette" architecture design) was determined for all five SOIs using three different DNA template architectures as shown in Figure 4: (a) a "complementary expression cassette" design with ITS_2; (b) a "complementary expression cassette" design with GL-hybrid_A9 ITS; and (c) an "independent expression cassette" design with GL-hybrid_A9 ITS.
[0117] Note that in the two “complementary expression cassette” designs (a) and (b), two expression cassettes encoding the sense and antisense strands of the dsRNA product are located on two complementary strands of a double-stranded DNA template with promoters directed toward each other, and as a result, the sense and antisense strands of the dsRNA product are transcribed by a T7RNAP that transcribes the two complementary strands in opposite directions. The “independent expression cassette” design (c) is similar to the templates described in Examples 1 and 2 and involves the expression of the sense and antisense strands from two expression cassettes from two independent linear DNA templates. The template for architecture (a) uses the minimal class III T7 promoter of T7 (SEQ ID NO: 9), while the templates for architectures (b) and (c) use the extended 47-base pair T7 promoter (SEQ ID NO: 18). Therefore, for a given product, a comparison of dsRNA production with template structures (a) and (b) demonstrates the effect of using GL-hybrid_A9 ITS with an extended T7 promoter compared to an ITS_2 variant with a minimal class III T7 promoter. A comparison of (b) and (c) demonstrates the effect of using an "independent expression cassette" architecture compared to a "complementary expression cassette" architecture.
[0118] Each nucleic acid architecture, combined with different SOIs (up to 600 bp in length) encoding each dsRNA product (GLSeq-A, GLSeq-B, GLSeq-C, GLSeq-D, and GLSeq-E), was evaluated in a transcription reaction using NTPs. The cell-free reaction was similar to that described in Example 2 and included a mixture of lysates containing 15 mM magnesium sulfate, 2 mM spermidine, 3.5 mM sodium hexametaphosphate, and five kinases at a total protein concentration of 10 mg / mL. However, unlike in Example 2, NTPs with a concentration of 4 mM were used instead of yeast-derived NMPs. For each SOI, either 50 ng / μL of the "Complementary Expression Cassette Design with ITS_2" DNA template or the "Complementary Expression Cassette Design with GL_Hybrid_A9 ITS" DNA template was added to the reaction mixture. For each SOI in the design of the "GL-Hybrid_A9 ITS Independent Expression Cassette Design," two DNA templates (one containing the sense strand-coding SOI; the other containing the antisense strand-coding SOI) were added to the reaction at a concentration of 50 ng / μL each. Finally, a recombinant heat-stable T7 RNA polymerase mutant was added at a concentration of 0.3 mg / mL to initiate transcription. The reaction was incubated at 48°C for 2 hours, after which the RNA product was isolated and analyzed via RP-IP HPLC as described in Example 1.
[0119] Compared to templates containing a complementary expression cassette of ITS_2, transcription from DNA templates containing a complementary expression cassette design of GL-hybrid_A9 resulted in increased production of dsRNA products for each SOI (Figure 7B). As demonstrated by GS1 (Examples 1-3), incorporation of GL-hybrid_A9 ITS into the DNA template consistently resulted in increased dsRNA product titers for each SOI. Notably, the degree of improvement was SOI-specific (ranging from approximately 2 to 36 times). Expression from DNA templates with the complementary expression cassette design of ITS_2 resulted in significant variation in dsRNA titers achieved for five different SOIs (Figure 7A). Conversely, incorporation of GL-hybrid_A9 resulted in consistently similar dsRNA titers for all five SOIs in either the complementary expression cassette or independent expression cassette designs.
[0120] Compared to templates containing a complementary expression cassette with GL-hybrid A9, transcription from DNA templates containing an independent expression cassette design with GL-hybrid A9 resulted in increased production of each RNA product (Figure 7C). For templates using GL-hybrid A9 ITS, transcription from the independent expression cassette design resulted in higher expression levels for all five dsRNA SOI products (1.2–2.3 times increase in relative RNA titer) compared to the complementary expression cassette design.
[0121] Figure 7D shows the overall effect of incorporating GL-hybrid_A9 ITS into the upstream DNA template of SOI and expressing both the sense and antisense strands of dsRNA from an "independent expression cassette" design. When transitioning from a complementary expression cassette design with ITS_2 to an independent expression cassette design with GL-hybrid_A9 ITS, the overall improvement in RNA titer ranges from approximately 2 to 70 times.
[0122] Example 4: Comparison of GLSeq-A dsRNA variant production from plasmid DNA templates using "independent expression cassette" architecture and hairpin architecture. The production of GLSeq-A dsRNA using two different plasmid DNA templates was compared using cell-free and IVT reactions.
[0123] Plasmid construct-1 contained two separate expression cassettes for the expression of two strands of the GLSeq-A dsRNA molecule, each expression cassette containing an extended 47 bp T7 promoter (SEQ ID NO: 18) located upstream of a DNA template (SOI) encoding either the sense or antisense strand of GLSeq-A, and a downstream terminator containing terminator 18 (SEQ ID NO: 20).
[0124] Plasmid construct-2 contained a single expression cassette for the expression of a hairpin variant of the GLSeq-A dsRNA molecule, with the sense and antisense strands linked by a single-stranded linker loop. The single expression cassette was operably linked to a GL-hybrid_A9 ITS and contained an extended 47 bp T7 promoter located upstream of the DNA template (SOI) encoding the antisense strand of GLSeq-A, a DNA sequence encoding the single-stranded loop region of the hairpin, the DNA template (SOI) encoding the sense strand of GLSeq-A, and a downstream terminator including terminator 18 (sequence number 20).
[0125] Each plasmid construct was evaluated in a cell-free reaction similar to that described in Example 3, using either NTP or yeast-derived NMP as a substrate. In comparing dsRNA production using each of the two plasmid constructs, the plasmid concentration in each reaction was adjusted to achieve roughly the same number of transcription-driving promoters. Therefore, plasmid construct-1 was used at a concentration of approximately 60 ng / μL, while plasmid construct-2 was used at a concentration of approximately 100 ng / μL.
[0126] As shown in Figure 12, expression of the GLSeq-A dsRNA product from two independent expression cassettes encoding the sense and antisense strands resulted in approximately a twofold improvement in dsRNA titer in both IVT and cell-free responses compared to expression as a hairpin GLSeq-A dsRNA product from a single expression cassette.
[0127] Example 5: Evaluation of read-through and termination efficiency with different terminator constructs The terminator combinations described in Table 2 were evaluated in in vitro transcription reactions for the synthesis of ssRNA products driven by a T7 promoter operably ligated to a GL-hybrid_A9 ITS. The terminator(s) were placed downstream of a 115 bp SOI (the transcription of the SOI was driven by a 47 bp extended T7 promoter operably ligated to a 15 bp GL-hybrid_A9 ITS). Therefore, termination by the first terminator in the terminator combinations tested would result in a product approximately 115 nucleotides long. Readthroughs are expected to result in a distribution of products ranging in length from 115 to 912 nucleotides, depending on the specific terminator combination and termination location used. The exact construct used in this example is shown in Figure 8A.
[0128] These different variants were evaluated in an in vitro transcription reaction using 5' nucleotide triphosphate as a substrate. The reaction mixture consisted of 45 mM magnesium sulfate, 2 mM spermidine, 0.5, 2, 4, or 8 mM of each of the four NTPs (New England Biolabs, Ipswich, MA), and 0.3 mg / mL of a heat-stable T7 RNA polymerase mutant. 50 ng / μL of DNA template (containing a specific terminator or terminator combination) was added to each reaction. The reaction was run at 48°C for 2 hours, and the subsequent RNA product was isolated and quantified using RP-IP HPLC.
[0129] For each terminator or combination of terminators, the different ssRNA products synthesized in the IVT reaction were separated using RP-IP HPLC as described in Example 1. Figure 8B shows chromatograms for different terminator constructs. Percentage read-through (RT%) was calculated as the peak area for the read-through product peak (the final peak in the chromatogram was observed as a result of polymerase reading through the entire terminator) and expressed as a percentage of the total peak area under the curve (Table 5). Term 26, Term 34, and Term-Quad show the highest degree of termination and the lowest RT% values. Notably, all terminators performed at comparable levels in reactions containing 2 mM, 4 mM, or 8 mM NTP (Figure 8C). TIFF0007865575000006.tif97170
[0130] A 100% efficient termination was expected to result in an ssRNA product approximately 115 nucleotides long. Readthroughs were expected to result in a distribution of products between 115 and 912 nucleotides long, depending on the termination site and the specific combination of terminators used. For example, with a dual terminator (Term 18) possessing a combination of a PTH terminator and a T7 terminator, termination at or within the PTH terminator was expected to result in a product approximately 115–125 nucleotides long (assuming the PTH terminator is placed immediately downstream of the SOI and is itself approximately 10 nucleotides long). However, if termination at the PTH terminator fails and termination is observed to occur at the T7 terminator, this would result in an ssRNA product of some size between 137 and 221 nucleotides (depending on where the termination occurs within the 84 bp long T7 terminator). Ultimately, if T7 RNA polymerase reads through both the PTH terminator and the T7 terminator, the resulting ssRNA product is expected to be 721 nucleotides long.
[0131] The ssRNA products obtained from the DNA template reaction all showed RT% of less than 50% for Term 18, Term 26, Term 34, and Term-Quad, demonstrating an overall termination efficiency of over 50%. In particular, Term 26, Term 34, and Term-Quad provided high termination efficiencies (65-70%).
[0132] Example 6: Production of dsRNA from plasmid constructs (pGLA583 and pGLA584) and linear DNA templates containing GL-hybrid_A9 ITS. Plasmid DNA templates were designed for the expression of the GS4 dsRNA product. GS4 is a 554 bp long dsRNA molecule containing a 524 base pair RNA product of interest encoding a portion of the green fluorescent protein (GFP) gene, flanked by GL-hybrid_A9 r-ITS and the reverse complement of GL-hybrid_A9 (r-ITS-RC). Plasmid DNA templates (pGLA583 and pGLA584) in an "independent expression cassette" architecture were designed to express the sense and antisense strands of GS4 from two separate expression cassettes (see Figure 4). Each of these expression cassettes contained an extended T7 promoter (SEQ ID NO: 18) operably ligated to the GL-hybrid_A9 ITS, a GS4 SOI (either sense or antisense strand), the reverse complement of the GL-hybrid_A9 ITS (ITS-RC), and two terminators (Term 18 (SEQ ID NO: 20)). Both the pGLA583 and pGLA584 plasmids further contained antibiotic resistance markers (bla genes preceded by a constitutive promoter conferring resistance to ampicillin / carbenicillin) and origins of replication. pGLA583 is an intermediate copy number plasmid with a pBR322 origin of replication derived from the pETDuet vector; pGLA584 is a high copy number plasmid with a mutated pBR322 origin of replication (Figure 9).
[0133] Additionally, we designed two linear DNA templates encoding expression cassettes for the sense and antisense strands of GS4 adjacent to sequences corresponding to GL-hybrid_A9 r-ITS and its reverse complement.
[0134] The ability of two plasmids and linear templates to produce GS4 dsRNA in a cell-free reaction was tested. Kinase enzyme-containing cell lysates (prepared as described in Example 2) were combined in equal proportions, diluted to a final total protein concentration of 1.75 g / L, and mixed with reaction additives (45 mM magnesium sulfate and 13 mM sodium hexametaphosphate). The lysates were incubated at 70°C for 15 minutes to inactivate other enzyme activity while maintaining the activity of the overexpressed kinase. Finally, NMP (derived from cellular yeast RNA depolymerization) at concentrations of approximately 7–8 mM each and 0.1 mg / mL of heat-stable T7 mutant RNA polymerase were added with either (A) 10 ng / μL of each of the two linear DNA templates (expressing the sense and antisense strands of the dsRNA product, respectively) or (B) 120 ng / μL of plasmid DNA template (pGLA583 or pGLA584). The cell-free reaction was incubated at 48°C for 2 hours, and the subsequent RNA product was isolated and quantified using RP-IP HPLC.
[0135] High levels of dsRNA product expression were observed from each DNA template (Figure 10). The linear DNA template produced approximately 2100 ng / μL; the two plasmid templates (pGLA583 and pGLA584) produced even higher levels, with pGLA583 producing approximately 2500 ng / μL.
[0136] Example 7: Comparison of dsRNA product production using plasmid templates employing an "independent expression cassette" architecture and a "complementary expression cassette" architecture. The production of two different dsRNA products (GS1 and GS4) in a cell-free reaction was compared using two types of plasmid templates employing two different architectures for dsRNA product production (plasmid construct-3: plasmid DNA template using an "independent expression cassette" architecture for dsRNA expression, and plasmid construct-4: plasmid template using a "complementary expression cassette" design for dsRNA expression). The plasmid template using the "independent expression cassette" architecture contained two separate expression cassettes, each encoded within the same plasmid by two separate segments of DNA for the expression of the sense and antisense strands of the dsRNA product, separated by an origin of replication and a selection marker as shown in Figure 13A. On the other hand, the plasmid template using the "complementary expression cassette" architecture contained a DNA segment, the complementary strand of which encoded an expression cassette for the expression of the sense and antisense strands of a given dsRNA product, as shown in Figure 13B. In both architectures, the extended T7 promoter (SEQ ID NO: 18) was used in conjunction with the GL-hybrid_A9 ITS to express each strand of the desired dsRNA product.
[0137] Cell-free reactions for dsRNA production were prepared using 60–100 ng / μL plasmid DNA templates employing either an "independent expression cassette" architecture or a "complementary expression cassette" architecture, as described in Example 2. As observed in Figure 14, independent expression of the sense and antisense strands of the dsRNA product from two isolated expression cassettes (plasmid construct-3) from a plasmid using the "independent expression cassette" architecture resulted in 4–20 times higher dsRNA production compared to expression of the same dsRNA product from a DNA template (plasmid construct-4) using the "complementary expression cassette" architecture.
[0138] Example 8: Production of dsRNA products using plasmid templates with an "independent expression cassette" architecture featuring expression cassettes possessing different ITSs. The production of GS1 dsRNA products in cell-free reactions from five different plasmid DNA templates was compared. All five plasmids used an "independent expression cassette" architecture, as shown in Figure 13A, with different ITSs used in the expression cassettes for the sense and antisense strands of each plasmid. In each expression cassette for sense and antisense strand expression, a 47 bp extended T7 promoter (SEQ ID NO: 18) was operably ligated to one of the five different ITSs shown in Table 6. TIFF0007865575000007.tif93170
[0139] As shown in Figure 15, the GL-hybrid A9 ITS resulted in a 1.9-fold improvement in dsRNA synthesis compared to the naturally occurring consensus ITS 6 and other shorter ITS in the T7 bacteriophage genome.
[0140] Example 9. ITS, including initiation at A, produces cap RNA with high titer and purity using a co-transcription capping reagent. A pair of mRNA molecules were designed and produced in a cell-free reaction. Both molecules had a similar sequence architecture incorporating the 5'ITS GL-hybrid_A9(start at A)(AGGAGACCAGGAATT(SEQ ID NO: 38)). The mRNA sequences, along with the T7 promoter and restriction endonuclease recognition site at the 5' end, were encoded on a pUC-19-derived plasmid template. The plasmids were grown in E. coli strain DH10b, purified by Plasmid Giga Kits (Qiagen), linearized by digestion with Esp3I restriction endonuclease (New England Biolabs), and further purified by phenol-chloroform extraction. The RNA synthesis reaction was carried out using a cell-free production platform as described in PCT / US2020 / 025824. The reaction to produce cap RNA also included CleanCap AG reagent (TriLink Biotechnologies). Template DNA was removed by treatment with DNase I, and then RNA was recovered by lithium chloride precipitation. The recovered RNA was quantified by UV absorbance at 260 nm, and its size and quality were analyzed using a 2100 BioAnalyzer instrument (Agilent Technologies).
[0141] As shown in Figure 16, cell-free reactions producing capped RNA using CleanCap AG and AG ITS (GL-hybrid A9 (start at A), SEQ ID NO: 38) achieved similar titers to reactions producing uncapped RNA using GG ITS (GL-hybrid A9, SEQ ID NO: 1) (Figure 16A). Analysis using BioAnalyzer demonstrated that the RNA products from both reactions were of the expected size and similar purity (Figure 16B).
[0142] Example 10. ITS in mRNA encoding different proteins results in consistent production potency and molecular quality. A family of mRNA molecules was designed and produced in a cell-free reaction. As in Example 9, the sequence incorporated 5'ITS GL-Hybrid_A9(start at A)(AGGAGACCAGGAATT(SEQ ID NO: 38)). The RNA synthesis reaction was carried out using a cell-free production platform as described in PCT / US2020 / 025824. The reaction to produce cap RNA also included 5 mM CleanCap AG reagent (TriLink Biotechnologies). Plasmids were grown in E. coli strain DH10b, purified with Plasmid Giga Kits (Qiagen), linearized by digestion with Esp3I restriction endonuclease or BspQI restriction endonuclease (New England Biolabs), and further purified by phenol-chloroform extraction. Template DNA was removed by treatment with DNase I, and then RNA was recovered by lithium chloride precipitation. The recovered RNA was quantified by UV absorbance at 260 nm, and its size and quality were analyzed using a Fragment Analyzer instrument (Agilent Technologies).
[0143] As shown in Figure 17, cell-free reactions using CleanCap AG and AG ITS to produce cap RNA produced consistent titers across multiple open reading frame sequences (Figure 17A). The RNA products from these reactions moved to the expected size. All molecules were produced with similarly high purity (Figure 17B).
[0144] All references, patents, and patent applications disclosed herein are invoked by reference with respect to the subject matter cited, and in some cases they may encompass the entirety of the document.
[0145] The indefinite articles "a" and "an," when used herein in the specification and claims, should be understood to mean "at least one," unless it is clearly pointed out that they are contradictory.
[0146] Unless it is clearly pointed out that this is in conflict, it should be understood that in any method claimed herein that includes two or more steps or actions, the order of the steps or actions of the method is not necessarily limited to the order in which the steps or actions of the method are enumerated.
[0147] In the claims and in addition in the above specification, all transitional clauses (such as “including,” “possessing,” “having,” “containing,” “involving,” “holding,” “composed of,” and similar clauses) are understood to be non-restrictive (i.e., encompassing but not limited to). Only the transitional clauses “consisting of” and “essentially consisting of” are limited or semi-restrictive transitional clauses, respectively, as described in the United States Patent Office Manual of Patent Examining Procedures (Section 2111.03).
[0148] The terms "approximately" and "effectively" preceding numerical values mean ±10% of the listed values.
[0149] Where a range of values is provided, each value between the upper and lower limits of that range is specifically intended and described herein. The present invention encompasses embodiments described in the following sections. [Section 1] A manipulated nucleic acid containing an initial transcription sequence (ITS) that includes any one nucleotide sequence from sequence numbers 1-4 or 38-41. [Section 2] The manipulated nucleic acid according to item 1, comprising a promoter operably coupled to the ITS. [Section 3] A manipulated nucleic acid as described in item 1 or 2, comprising any one nucleotide sequence from sequence numbers 10-13 or 42-45. [Section 4] The manipulated nucleic acid according to any one of claims 1 to 3, further comprising a sequence of interest downstream of the nucleotide sequence of the ITS. [Section 5] The engineered nucleic acid according to any one of claims 1 to 4, further comprising one or more terminator sequences downstream of the sequence of interest. [Section 6] The manipulated nucleic acid according to claim 5, wherein the terminator sequence comprises an rrnBT1 terminator sequence, an rrnBT2 terminator sequence, a TT7 terminator sequence, a pET-T7 terminator sequence, a T7U terminator sequence, a TT3 terminator sequence, and / or a PTH terminator sequence. [Section 7] The manipulated nucleic acid according to claim 5 or 6, wherein the terminator sequence comprises any one nucleotide sequence from sequence numbers 19 to 30. [Section 8] The manipulated nucleic acid according to any one of items 1 to 7, wherein the promoter is the bacteriophage T7 promoter. [Section 9] The manipulated nucleic acid according to any one of items 1 to 8, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 9 or 18. [Section 10] The manipulated nucleic acid according to any one of items 1 to 9, wherein the manipulated nucleic acid is double-stranded. [Section 11] The manipulated nucleic acid according to any one of claims 1 to 10, wherein the manipulated nucleic acid is circular. [Section 12] A first expression cassette comprising a promoter operably ligated to an initial transcription sequence (ITS) upstream of a nucleotide sequence encoding the sense strand of double-stranded RNA (dsRNA); and A second expression cassette comprising a promoter operably ligated to an initial transcription sequence (ITS) upstream of the nucleotide sequence encoding the antisense strand of the dsRNA, A construct that includes, The sense strand of the dsRNA is complementary to the antisense strand of the dsRNA. The aforementioned construct. [Section 13] The construct according to claim 12, wherein either or both of the first expression cassette and the second expression cassette further comprise a terminator sequence downstream of the nucleotide sequence encoding the dsRNA strand. [Section 14] The construct according to claim 12 or 13, wherein either or both of the first expression cassette and the second expression cassette further comprise a restriction endonuclease recognition site. [Section 15] The construct according to any one of items 12 to 14, wherein the initial transcription sequence has a length of 1 to 15 nucleotides. [Section 16] The construct according to any one of items 12 to 15, wherein the initial transcription sequence includes any one nucleotide sequence from sequence numbers 1 to 8 or 38 to 41. [Section 17] The construct of item 16, wherein the initial transcription sequence includes any one nucleotide sequence from sequence numbers 1-4 or 38-41. [Section 18] The construct according to any one of items 12 to 17, wherein the first expression cassette and the second expression cassette are located within a single DNA molecule and are oriented in the same direction. [Section 19] The construct according to any one of items 12 to 17, wherein the first expression cassette and the second expression cassette are located within a single DNA molecule and oriented in opposite directions. [Section 20] The construct according to any one of claims 12 to 19, wherein the nucleotide sequence encoding the sense strand of the first expression cassette is adjacent to the ITS and the reverse complement of the ITS, and the antisense strand of the second expression cassette is adjacent to the ITS and the reverse complement of the ITS. [Section 21] The construct according to any one of claims 12 to 20, wherein the first expression cassette further comprises one or more terminator sequences downstream of the nucleotide sequence encoding the sense strand, and the second expression cassette further comprises one or more terminator sequences downstream of the nucleotide sequence encoding the antisense strand. [Section 22] The construct according to any one of items 13 to 21, wherein the terminator sequence includes an rrnBT1 terminator sequence, an rrnBT2 terminator sequence, a TT7 terminator sequence, a pET-T7 terminator sequence, a T7U terminator sequence, a TT3 terminator sequence, and / or a PTH terminator sequence. [Section 23] The construct according to any one of items 13 to 21, wherein the terminator sequence includes any one nucleotide sequence from sequence numbers 19 to 30. [Section 24] A construct described in any one of sections 11-22, further including a selection marker. [Section 25] The construct according to item 24, wherein the selection marker is located between the first expression cassette and the second expression cassette. [Section 26] The construct according to claim 24 or 25, wherein the selection marker is an antibiotic resistance selection marker or an antibiotic-free selection marker. [Section 27] The construct according to any one of claims 12 to 26, wherein the promoter of the first expression cassette, the promoter of the second expression cassette, or both the promoter of the first expression cassette and the promoter of the second expression cassette is a bacteriophage T7 promoter. [Section 28] The construct according to any one of items 12 to 27, wherein the promoter of the first expression cassette or the promoter of the second expression cassette, or both the promoter of the first expression cassette and the promoter of the second expression cassette, comprises the nucleotide sequence of SEQ ID NO: 9 or 18. [Section 29] The construct according to any one of claims 12 to 28, wherein the construct is selected from plasmids, cosmids, bacterial artificial chromosomes, yeast artificial chromosomes, native chromosomes, bacteriophages, and viruses. [Section 30] The plasmid according to item 29, wherein the construct is a high-copy-number, intermediate-copy-number, or low-copy-number plasmid. [Section 31] The construct according to claim 30, wherein the plasmid comprises a ColE1 replicon or a pUC replicon, or a replicon derived from ColE1, pBR322, pUC, R6K, p15a, or pSC101 replicons. [Section 32] The construct according to any one of items 12 to 31, wherein the dsRNA targets the genome sequence of an insect, plant, fungus, or virus. [Section 33] (a) comprising a promoter operably ligated to an initial transcription sequence (ITS) containing any one nucleotide sequence from sequence numbers 1-4 or 38-41, a nucleotide sequence encoding the sense strand of double-stranded RNA (dsRNA), and a terminator sequence, First expression cassette; and (b) A promoter operably ligated to an ITS containing any one nucleotide sequence from sequence numbers 1-4 or 38-41, a nucleotide sequence encoding the antisense strand of the dsRNA, and a terminator sequence, Second expression cassette, A construct that includes, The construct wherein the sense strand of the dsRNA is complementary to the antisense strand of the dsRNA. [Section 34] The construct according to item 33, wherein the first expression cassette and the second expression cassette are located within a single DNA molecule and are oriented in the same direction. [Section 35] The construct according to item 33, wherein the first expression cassette and the second expression cassette are located within a single DNA molecule; and optionally, the first expression cassette and the second expression cassette are oriented in opposite directions. [Section 36] The construct according to any one of claims 33 to 35, wherein the first expression cassette comprises a reverse complement of the ITS downstream of the nucleotide sequence encoding the sense strand, and the second expression cassette comprises a reverse complement of the ITS downstream of the nucleotide sequence encoding the antisense strand of the dsRNA product. [Section 37] The construct according to any one of claims 33 to 36, wherein the first expression cassette further comprises one or more terminator sequences downstream of the nucleotide sequence encoding the sense strand, and the second expression cassette further comprises one or more terminator sequences downstream of the nucleotide sequence encoding the antisense strand. [Section 38] The construct according to any one of claims 33 to 37, wherein the first expression cassette is downstream of the reverse complement of the ITS, and / or the second expression cassette is downstream of the reverse complement of the ITS. [Section 39] The construct according to any one of the clauses 33 to 38, wherein the terminator sequence includes an rrnBT1 terminator sequence, an rrnBT2 terminator sequence, a TT7 terminator sequence, a pET-T7 terminator sequence, a T7U terminator sequence, a TT3 terminator sequence, and / or a PTH terminator sequence. [Section 40] The construct according to any one of items 33 to 39, wherein the terminator sequence includes any one nucleotide sequence from sequence numbers 19 to 30. [Section 41] The construct according to any one of claims 33 to 30, further comprising a restriction endonuclease recognition site downstream of the nucleotide sequence encoding the sense strand and / or the nucleotide sequence encoding the antisense strand, optionally downstream of any of the reverse complements of the ITS, and / or downstream of any of the terminator sequences. [Section 42] A construct described in any one of sections 33-41, further including a selection marker. [Section 43] The construct according to item 42, wherein the selection marker is located between the first expression cassette and the second expression cassette. [Section 44] The construct according to claim 42 or 43, wherein the selection marker is an antibiotic resistance selection marker or an antibiotic-free selection marker. [Section 45] The construct according to any one of claims 33 to 44, wherein either or both of the promoter of the first expression cassette and the promoter of the second expression cassette are bacteriophage T7 promoters. [Section 46] The construct according to any one of claims 33 to 45, wherein either or both of the promoter of the first expression cassette and the promoter of the second expression cassette include the nucleotide sequence of SEQ ID NO: 9 or 18. [Section 47] The construct according to any one of claims 33 to 46, wherein the construct is selected from plasmids, cosmids, bacterial artificial chromosomes, yeast artificial chromosomes, native chromosomes, bacteriophages, and viruses. [Section 48] The plasmid according to item 47, wherein the construct is a high-copy-number, intermediate-copy-number, or low-copy-number plasmid. [Section 49] The construct according to item 48, wherein the plasmid comprises a ColE1 replicon or a pUC replicon, or a replicon derived from ColE1, pBR322, pUC, R6K, p15a, or pSC101 replicons. [Section 50] The construct according to any one of sections 33 to 49, wherein the dsRNA targets the genome sequence of an insect, plant, fungus, or virus. [Section 51] A method comprising combining an engineered nucleic acid described in any one of items 1 to 11 or a construct and polymerase described in any one of items 12 to 50 in a transcription reaction, and producing an RNA transcript. [Section 52] The method according to claim 50, wherein the transcript is produced in an amount at least 20%, at least 30%, or at least 40% greater than that of the control. [Section 53] An expression cassette comprising a promoter operably ligated to an initial transcription sequence (ITS) upstream of a nucleotide sequence encoding a product of interest, and optionally subsequently an ITS-RC and / or restriction endonuclease site and / or two tandem terminator sequences, wherein the ITS comprises any one nucleotide sequence from SEQ ID NOs: 1-8 or 38-41. [Section 54] A first expression cassette comprising a promoter and terminator sequence operably ligated to a nucleotide sequence encoding the sense strand of double-stranded RNA (dsRNA); and A second expression cassette comprising a promoter operably ligated to a nucleotide sequence encoding the antisense strand of the aforementioned dsRNA (dsRNA), and a terminator sequence, A construct that includes; The first expression cassette and the second expression cassette are oriented in the same direction or in opposite directions within the same DNA molecule. The sense strand of the dsRNA is complementary to the antisense strand of the dsRNA. The aforementioned construct. [Section 55] A manipulated nucleic acid containing any one nucleotide sequence from sequence numbers 1-4 or 38-41; and polymerase A kit that includes this. [Section 56] The kit according to item 55, further comprising nucleoside triphosphate and / or nucleoside monophosphate.
Claims
1. A manipulated nucleic acid comprising an initial transcription sequence (ITS) containing the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO:
38.
2. Includes a promoter operably connected to the ITS, The manipulated nucleic acid according to claim 1, wherein the promoter is a bacteriophage T7 promoter.
3. The manipulated nucleic acid according to claim 2, wherein the promoter comprises the nucleotide sequence of sequence number 9 or 18.
4. The manipulated nucleic acid according to any one of claims 1 to 3, comprising the nucleotide sequence of sequence number 10 or 42.
5. The engineered nucleic acid according to any one of claims 1 to 4, further comprising a sequence of interest downstream of the nucleotide sequence of the ITS, wherein the sequence of interest encodes a protein or RNA product of interest.
6. The manipulated nucleic acid according to claim 5, further comprising one or more terminator sequences downstream of the sequence of interest.
7. The manipulated nucleic acid according to claim 6, wherein the terminator sequence comprises one nucleotide sequence from sequence numbers 19 to 30.
8. The manipulated nucleic acid according to any one of claims 1 to 7, wherein the manipulated nucleic acid is double-stranded.
9. The manipulated nucleic acid according to any one of claims 1 to 8, wherein the manipulated nucleic acid is circular.
10. (a) comprising a promoter operably ligated to an initial transcription sequence (ITS) containing the nucleotide sequence of SEQ ID NO: 1 or 38, a nucleotide sequence encoding the sense strand of double-stranded RNA (dsRNA), and a terminator sequence, First expression cassette; and (b) A promoter operably linked to an ITS containing the nucleotide sequence of Sequence ID No. 1 or 38, a nucleotide sequence encoding the antisense strand of the dsRNA, and a terminator sequence, Second expression cassette, A construct that includes, The sense strand of the dsRNA is complementary to the antisense strand of the dsRNA. Either or both of the promoters of the first expression cassette and the second expression cassette are bacteriophage T7 promoters. The aforementioned construct.
11. The construct according to claim 10, wherein the first expression cassette and the second expression cassette are located within a single DNA molecule, and the first expression cassette and the second expression cassette are oriented in the same direction.
12. The construct according to claim 10 or 11, wherein the terminator sequence includes one nucleotide sequence from sequence numbers 19 to 30.
13. The construct according to any one of claims 10 to 12, further comprising a restriction endonuclease recognition site downstream of the nucleotide sequence encoding the sense strand and / or the nucleotide sequence encoding the antisense strand.
14. The construct according to any one of claims 10 to 13, further comprising a selection marker.
15. The construct according to claim 14, wherein the selection marker is located between the first expression cassette and the second expression cassette, and / or the selection marker is an antibiotic resistance selection marker or an antibiotic-free selection marker.
16. The construct according to any one of claims 10 to 15, wherein either or both of the promoter of the first expression cassette and the promoter of the second expression cassette include the nucleotide sequence of SEQ ID NO: 9 or 18.
17. The construct according to any one of claims 10 to 16, wherein the construct is a plasmid.
18. The construct according to any one of claims 10 to 17, wherein the dsRNA targets the genome sequence of an insect, plant, fungus, or virus.
19. A method comprising combining an engineered nucleic acid according to any one of claims 1 to 9 or a construct according to any one of claims 10 to 18 with RNA polymerase and nucleotide triphosphates in an in vitro transcription reaction, and producing an RNA transcript.