Genes that confer resistance to rhizobium nematodes

The MeR1 and NRC6 genes in Solanaceae plants address the lack of resistance to Meloidogyne enterolobii by enhancing immune responses, ensuring effective resistance and yield stability through nucleic acid introduction and breeding techniques.

JP7874559B2Active Publication Date: 2026-06-16RIJK ZWAAN ZAADTEELT & ZAADHANDEL BV

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
RIJK ZWAAN ZAADTEELT & ZAADHANDEL BV
Filing Date
2021-06-18
Publication Date
2026-06-16

AI Technical Summary

Technical Problem

Existing Solanaceae plants lack effective resistance to root-knot nematodes, particularly Meloidogyne enterolobii, which can cause root galls leading to plant death or yield reduction, despite existing resistance genes being overcome by new nematode strains.

Method used

Introduction of the MeR1 gene, encoding an NBS-LRR protein, and optionally NRC6 genes, into Solanaceae plants, particularly Solanum lycopersicum, confers resistance to Meloidogyne enterolobii through nucleic acid molecules with specific sequences or sequence identities, enhancing immune response mechanisms.

Benefits of technology

The MeR1 and NRC6 genes provide dominant resistance to Meloidogyne enterolobii, reducing nematode infection and maintaining plant health and yield, with methods including breeding, grafting, and genetic modification techniques.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007874559000049
    Figure 0007874559000049
  • Figure 0007874559000001
    Figure 0007874559000001
  • Figure 0007874559000002
    Figure 0007874559000002
Patent Text Reader

Abstract

The present invention relates to a nucleic acid molecule encoding an MeR1 protein that confers resistance to root-knot nematodes when present in a plant of the Solanaceae family, wherein the nucleic acid molecule has a nucleotide sequence comprising a coding sequence according to SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or 9, or a coding sequence having at least 90% sequence identity to a sequence according to SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or 9; or a nucleotide sequence that encodes a protein having an amino acid sequence according to SEQ ID NO: 10, 11, 12, 13, 14, 15, 16 or 17, or a protein having an amino acid sequence having at least 85% sequence identity to an amino acid sequence according to SEQ ID NO: 10, 11, 12, 13, 14, 15, 16 or 17. The present invention further relates to plants and seeds comprising the nucleic acid molecule, methods of producing and identifying such plants, and uses of the nucleic acid molecule.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a nucleic acid molecule providing resistance to root-knot nematodes, a Solanaceae root-knot nematode-resistant plant containing the nucleic acid molecule, and a method for identifying the presence of the nucleic acid molecule in a plant. The present invention further relates to a method for producing such a plant and a method for identifying and selecting such a plant. The present invention also relates to the seeds of Solanaceae root-knot nematode-resistant plants.

Background Art

[0002] One of the problems that occur when growing Solanaceae plants is the occurrence of various plant-parasitic nematodes. A number of resistance genes against some nematode species have been identified, and these resistance genes have been incorporated into appropriate varieties through breeding. Thereby, even when specific nematodes are present during production, producers can obtain good yields. However, periodically, new nematodes or strains of known nematodes are identified, which may in some cases break the available resistance. For example, in tomato (Solanum lycopersicum), the known Mi1-2 resistance gene confers resistance to some nematodes but does not confer resistance to root-knot nematode Meloidogyne enterolobii (M. enterolobii). The nematodes to which the present invention relates use the roots of plants for their life, and thus infection by root-knot nematodes such as M. enterolobii causes root galls that can lead to the death of infected plants or a reduction in yield.

[0003] Surprisingly, as a result of extensive research, it has been found that an NBS-LRR gene called MeR1 (Meloidogyne enterolobii resistance 1) herein is expressed in roots and is involved in the resistance of Solanaceae plants to root-knot nematodes.

Summary of the Invention

[0004] The present invention relates to a nucleic acid molecule encoding a MeR1 protein that, when present in plants of the Solanaceae family, particularly Solanum lycopersicum, confers resistance to root nodule nematodes, especially M. enterolobii, wherein the nucleic acid molecule is as follows: a) A coding sequence according to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, or 9, or a nucleotide sequence containing a coding sequence having sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% in order of priority with the sequence according to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, or 9; or b) Nucleotide sequences encoding a protein having the amino acid sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17, or amino acid sequences having sequence identity with the amino acid sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17 in the order of priority of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%. It has the following nucleotide sequence.

[0005] The present invention relates in particular to a nucleic acid molecule encoding a MeR1 protein that confers resistance to root nodule nematodes, particularly M. enterolobii, when present in plants of the Solanaceae family, especially Solanum lycopersicum plants, wherein the nucleic acid molecule has the following nucleotide sequence: a) A coding sequence according to SEQ ID NO: 2, or a nucleotide sequence containing a coding sequence having sequence identity with the sequence according to SEQ ID NO: 2 in the order of priority of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%; or b) A protein having the amino acid sequence specified by SEQ ID NO: 10, or a nucleotide sequence encoding a protein having an amino acid sequence having sequence identity with the amino acid sequence specified by SEQ ID NO: 10 in the following order of priority: 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%; or a) A coding sequence according to SEQ ID NO: 3, or a nucleotide sequence containing a coding sequence having sequence identity with the sequence according to SEQ ID NO: 3 in the order of priority of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%; or b) A protein having the amino acid sequence specified by SEQ ID NO: 11, or a nucleotide sequence encoding a protein having an amino acid sequence having sequence identity with the amino acid sequence specified by SEQ ID NO: 11 in the following order of priority: 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%; or a) A coding sequence according to SEQ ID NO: 4, or a nucleotide sequence containing a coding sequence having sequence identity with the sequence according to SEQ ID NO: 4 in the order of priority of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%; or b) A protein having the amino acid sequence of SEQ ID NO: 12, or a nucleotide sequence encoding a protein having an amino acid sequence having sequence identity with the amino acid sequence of SEQ ID NO: 12 in the order of priority of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%; or a) A coding sequence according to Sequence ID No. 5, or a nucleotide sequence containing a coding sequence having sequence identity with the sequence according to Sequence ID No. 5 in the order of priority of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%; or b) A protein having the amino acid sequence specified by SEQ ID NO: 13, or a nucleotide sequence encoding a protein having an amino acid sequence having sequence identity with the amino acid sequence specified by SEQ ID NO: 13 in the following order of priority: 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%; or a) A coding sequence according to SEQ ID NO: 6, or a nucleotide sequence containing a coding sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the sequence according to SEQ ID NO: 6 and the sequence according to SEQ ID NO: 7; or b) A protein having the amino acid sequence of SEQ ID NO: 14, or a nucleotide sequence encoding a protein having an amino acid sequence having sequence identity with the amino acid sequence of SEQ ID NO: 14 in the following order of priority: 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%; or a) A coding sequence according to SEQ ID NO: 7, or a nucleotide sequence containing a coding sequence having sequence identity with the sequence according to SEQ ID NO: 7 in the order of priority of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%; or b) A protein having the amino acid sequence specified by SEQ ID NO: 15, or a nucleotide sequence encoding a protein having an amino acid sequence having sequence identity with the amino acid sequence specified by SEQ ID NO: 15 in the following order of priority: 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%; or a) A coding sequence according to Sequence ID No. 8, or a nucleotide sequence containing a coding sequence having sequence identity with the sequence according to Sequence ID No. 8 in the order of priority of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%; or b) A protein having the amino acid sequence of SEQ ID NO: 16, or a nucleotide sequence encoding a protein having an amino acid sequence having sequence identity with the amino acid sequence of SEQ ID NO: 16 in the order of priority of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%; or a) A coding sequence by SEQ ID NO: 9, or a nucleotide sequence containing a coding sequence having sequence identity with the sequence by SEQ ID NO: 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% in order of priority; or b) A protein having the amino acid sequence specified by SEQ ID NO: 17, or a nucleotide sequence encoding a protein having an amino acid sequence having sequence identity with the amino acid sequence specified by SEQ ID NO: 17 in the following order of priority: 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%.

[0006] During research leading to the present invention, it was discovered that the MeR1 gene, containing a nucleic acid molecule having the genomic sequence of Sequence ID No. 1, is found in wild tomato species, particularly Solanum pimpinellifolium. When this nucleic acid molecule is transferred to Solanum lycopersicum plants susceptible to rhizobia, the Solanum lycopersicum plants become resistant to rhizobia, especially M. enterolobii. Therefore, the MeR1 gene can encode a protein that confers resistance to rhizobia in Solanaceae plants. In particular, the MeR1 gene can encode a protein that confers resistance to M. enterolobii in Solanum lycopersicum plants. The genomic sequence containing Sequence ID No. 1 leads to eight different isoforms containing coding sequences (CDS sequences) selected from the group consisting of Sequence ID Nos. 2, 3, 4, 5, 6, 7, 8, and 9. These isoforms are different splice variants of the gene. After splicing, the genomic sequence of the MeR1 gene of the present invention, including SEQ ID NO: 1, yields eight different isoforms, each containing a coding sequence (CDS sequence) of the MeR1 gene of the present invention selected from the group consisting of SEQ ID NO: 2. These CDS sequences encode proteins containing amino acid sequences selected from the group consisting of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, and 17; SEQ ID NO: 2 encodes a MeR1 protein having the amino acid sequence containing SEQ ID NO: 10; SEQ ID NO: 3 encodes a MeR1 protein having the amino acid sequence containing SEQ ID NO: 11; SEQ ID NO: 4 encodes a MeR1 protein having the amino acid sequence containing SEQ ID NO: 12; SEQ ID NO: 5 encodes a MeR1 protein having the amino acid sequence containing SEQ ID NO: 13; SEQ ID NO: 6 encodes a MeR1 protein having the amino acid sequence containing SEQ ID NO: 14; SEQ ID NO: 7 encodes a MeR1 protein having the amino acid sequence containing SEQ ID NO: 15; SEQ ID NO: 8 encodes a MeR1 protein having the amino acid sequence containing SEQ ID NO: 16; and SEQ ID NO: 9 encodes a MeR1 protein having the amino acid sequence containing SEQ ID NO: 17.

[0007] During research leading to the present invention, it was discovered that the MeR1 gene of the present invention is segregated with another resistance gene called NRC6. The genome of the Solanum lycopersicum plant may contain one or more NRC6 genes, referred to herein as NRC6-2a, NRC6-2b, and so on. The nucleic acid molecules NRC6-2a, NRC6-2c, NRC6-2b, NRC6-3, and NRC6-1a are alleles of the NRC6 gene that, when present with the MeR1 gene of the present invention, contribute to resistance to rhizobia in Solanaceae plants. The nucleic acid molecule NRC6-2a, comprising the genome sequence by SEQ ID NO 18, encodes a protein that, when present with the MeR1 gene of the present invention, contributes to resistance to rhizobia in Solanaceae plants. The CDS sequence of the NRC6-2a allele of the present invention comprises SEQ ID NO 19 and encodes the NRC6 protein having an amino acid sequence comprising SEQ ID NO 20. The nucleic acid molecule NRC6-2c, containing the genome sequence according to SEQ ID NO: 21, encodes a protein that, when present with the MeR1 gene of the present invention, contributes to resistance to rhizomatous nematodes in Solanaceae plants. The CDS sequence of the NRC6-2c allele of the present invention encodes an NRC6 protein having an amino acid sequence containing SEQ ID NO: 22 and SEQ ID NO: 23. The nucleic acid molecule NRC6-2b, containing the CDS sequence according to SEQ ID NO: 24, encodes an NRC6 protein having an amino acid sequence containing SEQ ID NO: 25, which, when present with the MeR1 gene of the present invention, contributes to resistance to rhizomatous nematodes in Solanaceae plants. The nucleic acid molecule NRC6-3, containing the CDS sequence according to SEQ ID NO: 26, encodes an NRC6 protein having an amino acid sequence containing SEQ ID NO: 27, which, when present with the MeR1 gene of the present invention, contributes to resistance to rhizomatous nematodes in Solanaceae plants. The nucleic acid molecule NRC6-1a, containing the CDS sequence according to SEQ ID NO: 28, encodes an NRC6 protein having an amino acid sequence containing SEQ ID NO: 29, which, when present with the MeR1 gene of the present invention, contributes to resistance to rhizomatous nematodes in Solanaceae plants.

[0008] The present invention further relates to a nucleic acid molecule encoding the NRC6 protein, which, when present in plants of the Solanaceae family, particularly Solanum lycopersicum, together with a nucleic acid molecule encoding the MeR1 protein as defined above, contributes to resistance to rhizomatous nematodes, especially M. enterolobii, wherein the nucleic acid molecule is as follows: a) A nucleotide sequence comprising the coding sequence according to SEQ ID NO: 19, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NO: 19; or b) A protein having the amino acid sequence according to SEQ ID NO: 20, or a nucleotide sequence encoding a protein having an amino acid sequence having 98%, preferably 99%, sequence identity with the amino acid sequence according to SEQ ID NO: 20. It has the following nucleic acid sequence.

[0009] In one embodiment, the present invention relates to a nucleic acid molecule encoding the NRC6 protein, which, when present in plants of the Solanaceae family, particularly Solanum lycopersicum, together with a nucleic acid molecule encoding the MeR1 protein as defined above, contributes to resistance to rhizomatous nematodes, particularly M. enterolobii, wherein the nucleic acid molecule is as follows: a) A nucleotide sequence comprising a coding sequence according to SEQ ID NO: 22, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NO: 22; or b) A protein having the amino acid sequence according to SEQ ID NO: 23, or a nucleotide sequence encoding a protein having an amino acid sequence having 98%, preferably 99%, sequence identity with the amino acid sequence according to SEQ ID NO: 23. It has the following nucleotide sequence.

[0010] In a further embodiment, the present invention relates to a nucleic acid molecule encoding the NRC6 protein, which, when present in plants of the Solanaceae family, particularly Solanum lycopersicum, together with a nucleic acid molecule encoding the MeR1 protein as defined above, contributes to resistance to rhizomatous nematodes, particularly M. enterolobii, wherein the nucleic acid molecule is as follows: a) A nucleotide sequence comprising the coding sequence according to SEQ ID NO: 24, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NO: 24; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to SEQ ID NO: 25, or a protein having an amino acid sequence having 98%, preferably 99%, sequence identity with the amino acid sequence according to SEQ ID NO: 25. It has the following nucleotide sequence.

[0011] In a further embodiment, the present invention relates to a nucleic acid molecule encoding the NRC6 protein, which, when present in plants of the Solanaceae family, particularly Solanum lycopersicum, together with a nucleic acid molecule encoding the MeR1 protein as defined above, contributes to resistance to rhizomatous nematodes, particularly M. enterolobii, wherein the nucleic acid molecule is as follows: a) A nucleotide sequence comprising the coding sequence according to SEQ ID NO: 26, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NO: 26; or b) A protein having the amino acid sequence according to SEQ ID NO: 27, or a nucleotide sequence encoding a protein having an amino acid sequence having 98%, preferably 99%, sequence identity with the amino acid sequence according to SEQ ID NO: 27. It has the following nucleotide sequence.

[0012] In a further embodiment, the present invention relates to a nucleic acid molecule encoding the NRC6 protein, which, when present in plants of the Solanaceae family, particularly Solanum lycopersicum, together with a nucleic acid molecule encoding the MeR1 protein as defined above, contributes to resistance to rhizomatous nematodes, particularly M. enterolobii, wherein the nucleic acid molecule is as follows: a) A nucleotide sequence comprising a coding sequence according to SEQ ID NO: 28, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NO: 28; b) A protein having the amino acid sequence according to SEQ ID NO: 29, or a nucleotide sequence encoding a protein having an amino acid sequence having 98%, preferably 99%, sequence identity with the amino acid sequence according to SEQ ID NO: 29. It has the following nucleotide sequence.

[0013] The nucleic acid molecules MeR1 and NRC6 of the present invention each encode an NBS-LRR protein, also called an NLR protein, and contain a nucleotide binding site and a leucine-rich repeat domain. Recent studies have shown that plant NBS-LRR proteins often communicate with each other to induce immune responses against pathogens, and therefore, in the plant genome there are NBS-LRR proteins called "sensors" that detect pathogens and require "helper" NBS-LRRs to induce an immune response after pathogen effectors bind to sensor NLRs. The genomes of Solanaceae plants are composed of a large number of NBS-LRR proteins, and their network is very complex. Therefore, it is difficult to predict whether an NBS-LRR protein is a helper or sensor protein, and which NBS-LRR helper proteins interact with which NBS-LRR sensor proteins. Recently, Adachi et al. ((2019) An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species; Elife. 27; 8) discovered that so-called helper NLR proteins contain a specific motif: the MADA motif (SEQ ID NO: 30). Analysis of the NRC6 sequence revealed that the encoded protein contains the MADA motif and can therefore be characterized as a helper NLR protein. The MeR1 protein does not contain the motif and can therefore be considered a candidate sensor NLR protein capable of communicating with helper NLR proteins.

[0014] The present invention also relates to a Solanaceae plant, particularly Solanum lycopersicum, comprising a nucleic acid molecule encoding a MeR1 protein that, when present in the Solanaceae plant, confers resistance to rhizobia, particularly M. enterolobii, wherein the nucleic acid molecule has the following nucleotide sequence: a) A coding sequence according to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, or 9, or a nucleotide sequence containing a coding sequence having sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% in order of priority with the sequence according to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, or 9; or b) A protein having the amino acid sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17, or a nucleotide sequence encoding a protein having the amino acid sequence having sequence identity with the sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17 in the order of priority of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%; and optionally at least one nucleic acid molecule encoding the NRC6-2a protein, wherein the nucleic acid molecule has the following nucleotide sequence: a) A nucleotide sequence comprising the coding sequence according to SEQ ID NO: 19, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NO: 19; or b) A nucleotide sequence encoding an NRC6-2a protein having the amino acid sequence according to SEQ ID NO: 20, or a protein having an amino acid sequence having 98%, preferably 99%, sequence identity with the amino acid sequence according to SEQ ID NO: 20; and / or a nucleic acid molecule encoding the NRC6-2c protein, wherein the nucleic acid molecule has the following nucleotide sequence: a) A nucleotide sequence comprising a coding sequence according to SEQ ID NO: 22, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NO: 22; or b) a nucleotide sequence encoding the NRC6-2c protein having the amino acid sequence according to SEQ ID NO: 23, or a protein having an amino acid sequence having 98%, preferably 99% sequence identity with the amino acid sequence according to SEQ ID NO: 23; and / or a nucleic acid molecule encoding the NRC6-2b protein, wherein the nucleic acid molecule has the following nucleotide sequence: a) a nucleotide sequence comprising the coding sequence according to SEQ ID NO: 24, or a coding sequence having 98%, preferably 99% sequence identity with the sequence according to SEQ ID NO: 24; or b) a nucleotide sequence encoding the NRC6-2b protein having the amino acid sequence according to SEQ ID NO: 25, or a protein having an amino acid sequence having 98%, preferably 99% sequence identity with the amino acid sequence according to SEQ ID NO: 25; and / or a nucleic acid molecule encoding the NRC6-3 protein, wherein the nucleic acid molecule has the following nucleotides: a) a nucleotide sequence comprising the coding sequence according to SEQ ID NO: 26, or a coding sequence having 98%, preferably 99% sequence identity with the sequence according to SEQ ID NO: 26; or b) a nucleotide sequence encoding the NRC6-3 protein having the amino acid sequence according to SEQ ID NO: 27, or a protein having an amino acid sequence having 98%, preferably 99% sequence identity with the amino acid sequence according to SEQ ID NO: 27; and / or a nucleic acid molecule encoding the NRC6-1a protein, wherein the nucleic acid molecule has the following nucleotide sequence: a) a nucleotide sequence comprising the coding sequence according to SEQ ID NO: 28, or a coding sequence having 98%, preferably 99% sequence identity with the sequence according to SEQ ID NO: 28; or b) a nucleotide sequence encoding the NRC6-1a protein having the amino acid sequence according to SEQ ID NO: 29, or a protein having an amino acid sequence having 98%, preferably 99% sequence identity with the amino acid sequence according to SEQ ID NO: 29.

[0015] In particular, the present invention relates to a Solanaceae plant, especially a Solanum lycopersicum plant, which contains a nucleic acid molecule encoding a MeR1 protein that, when present in the plant, confers resistance to rhizobia, particularly M. enterolobii, wherein the nucleic acid molecule has the following nucleotide sequence: a) A nucleotide sequence containing the coding sequence by SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, or 9, or a coding sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence by SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, or 9, in order of priority; or b) A protein having the amino acid sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17, or a nucleotide sequence encoding a protein having the amino acid sequence having sequence identity with the sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17 in the order of priority of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%; and a nucleic acid molecule encoding the NRC6-2a protein, wherein the nucleic acid molecule has the following nucleotide sequence: a) A nucleotide sequence comprising the coding sequence according to SEQ ID NO: 19, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NO: 19; or b) A nucleotide sequence encoding an NRC6-2a protein having the amino acid sequence according to SEQ ID NO: 20, or a protein having an amino acid sequence having 98%, preferably 99%, sequence identity with the amino acid sequence according to SEQ ID NO: 20; and a nucleic acid molecule encoding the NRC6-2c protein, wherein the nucleic acid molecule has the following nucleotide sequence: a) A nucleotide sequence comprising a coding sequence according to SEQ ID NO: 22, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NO: 22; or b) A nucleotide sequence encoding an NRC6-2c protein having the amino acid sequence according to SEQ ID NO: 23, or a protein having an amino acid sequence having 98%, preferably 99%, sequence identity with the amino acid sequence according to SEQ ID NO: 23.

[0016] The present invention also relates to a nucleic acid molecule encoding the MeR1 protein described herein, which, when present in Solanaceae plants, confers resistance to rhizobia, particularly M. enterolobii, and to Solanaceae plants, particularly Solanum lycopersicum plants, which contain one NRC6 gene described herein, selected from the group consisting of NRC6-2a, NRC6-2c, NRC6-2b, NRC6-3 and NRC6-1a.

[0017] The present invention also relates to a nucleic acid molecule encoding the MeR1 protein described herein that, when present in Solanaceae plants, confers resistance to rhizobia, particularly M. enterolobii, and to Solanaceae plants, particularly Solanum lycopersicum plants, comprising two NRC6 genes described herein, selected from the group consisting of NRC6-2a, NRC6-2c, NRC6-2b, NRC6-3 and NRC6-1a.

[0018] The present invention also relates to a nucleic acid molecule encoding the MeR1 protein described herein, which, when present in Solanaceae plants, confers resistance to rhizobia, particularly M. enterolobii, and to Solanaceae plants, particularly Solanum lycopersicum plants, which contain three NRC6 genes described herein, selected from the group consisting of NRC6-2a, NRC6-2c, NRC6-2b, NRC6-3 and NRC6-1a.

[0019] The present invention also relates to a nucleic acid molecule encoding the MeR1 protein described herein, which, when present in Solanaceae plants, confers resistance to rhizobia, particularly M. enterolobii, and to Solanaceae plants, particularly Solanum lycopersicum plants, comprising four NRC6 genes described herein, selected from the group consisting of NRC6-2a, NRC6-2c, NRC6-2b, NRC6-3 and NRC6-1a.

[0020] The present invention also relates to a nucleic acid molecule encoding the MeR1 protein described herein, which, when present in Solanaceae plants, confers resistance to rhizobia, particularly M. enterolobii, and to Solanaceae plants, particularly Solanum lycopersicum plants, comprising five NRC6 genes described herein, selected from the group consisting of NRC6-2a, NRC6-2c, NRC6-2b, NRC6-3 and NRC6-1a.

[0021] Plants belonging to the Solanaceae family may include species such as Solanum lycopersicum, Capsicum annuum, Solanum melongena, Solanum tuberosum, or Nicotiana tabacum.

[0022] Preferably, the present invention also relates to a Solanum lycopersicum plant comprising one or more of the NRC6 alleles defined above, which confers resistance to M. enterolobii when those alleles are present in the plant together with the MeR1 nucleic acid molecule of the present invention. In this application, the terms tomato and Solanum lycopersicum are used interchangeably.

[0023] The phenotype of the present invention is dominant. As used herein, dominance means that when the nucleic acid molecule of the present invention is heterozygous in the plant, the level of resistance of the plant to rhizobia nematodes is the same as when the nucleic acid molecule of the present invention is homozygous in the plant. Solanum lycopersicum plants homozygous with the nucleic acid molecule of the present invention can be grown from seeds deposited as NCIMB 43515. Such plants exhibit resistance to M. enterolobii.

[0024] The Solanum lycopersicum plant containing the MeR1 gene and two NRC6 alleles (NRC6-2a and NRC6-2c) of the present invention can be grown from seeds deposited with NCIMB under deposit number NCIMB 43515, with a representative sample being NCIMB 43515.

[0025] The presence of resistance to rhizobia can be determined by the bioassay described in Example 1. Resistance of Solanum lycopersicum plants to M. enterolobii is determined by counting egg masses. Sow the Solanum lycopersicum plants to be tested in trays in a greenhouse, and after two weeks, transfer the plants to 660cc pots filled with a sandy soil mixture. Dometica RZ is introduced as a susceptible control plant, and plants grown from deposited NCIMB 43515 seeds are introduced as a positive control. A hole is made next to the roots with a 1ml pipette tip and filled with a 1ml suspension containing 500 second-stage juvenile (J2) M. enterolobii inoculum per plant. After inoculation, the plants are grown in a growth chamber (23°C, 14 hours of light) and watered three times a week. Six weeks after inoculation, remove the plants from the soil and wash the roots with tap water. Count the egg masses and score them according to the symptoms shown in Table 2. When using the scoring system in Table 2, M. enteroloby-resistant tomato plants will have a score of 0, 1, or 2, preferably 0 or 1.

[0026] If desired, the plant of the present invention is a cultivated plant having improved agricultural properties that make it suitable for commercial cultivation. Thus, it is an agriculturally superior plant. The present invention also relates to the fruit of a Solanaceae plant harvested from the plant of the present invention, wherein the fruit contains in its genome the nucleic acid molecule of the present invention that confers resistance in the plant to rhizobia, particularly M. enterolobii. This fruit is also referred to herein as "the fruit of the present invention."

[0027] Preferably, the fruit is the tomato fruit of the Solanum lycopersicum plant.

[0028] The present invention relates to rootstocks or scions of Solanaceae plants containing the nucleic acid molecules of the present invention. The rootstocks or scions can be used in a grafting process to develop grafted Solanaceae plants that exhibit the phenotype of the present invention, and the grafted plants are also part of the present invention. In one embodiment, the present invention further relates to rootstocks resulting from interspecific hybridization between plants belonging to different species of the Solanaceae family, where one parent plant of the interspecific hybridization is preferably a plant of the Solanum lycopersicum species containing the nucleic acid molecule of the present invention, and the other parent is Solanum Arcanum, Solanum cheesmaniae, Solanum chilense, Solanum chmielewskii, Solanum corneliomulleri, Solanum galapagense, Solanum habrochaites, Solanum huaylasense, Solanum juglandifolium The group is selected from the following species: juglandifolium, Solanum lycopersicum cerasiforme, Solanum lycopersicoides, Solanum neorickii, Solanum ochrantum, Solanum pennellii, Solanum peruvianum, Solanum pimpinellifolium, and Solanum sitiens.

[0029] The present invention further relates to the use of the plant of the present invention in a grafting process, wherein the plant of the present invention can be used as a scion or, preferably, as a rootstock in the grafting process. Other plants used in the grafting process may be any plant of the Solanaceae family, preferably belonging to the genus Solanum.

[0030] The present invention relates to a method for producing Solanaceae plants resistant to root nodule nematodes, particularly M. enterolobii, comprising introducing the nucleic acid molecule of the present invention into the plant.

[0031] The nucleic acid molecules of the present invention can be introduced from another plant containing nucleic acid molecules through commonly used breeding techniques such as crossbreeding and selection, provided that the plant is sexually compatible. Such introduction can usually be carried out from plants of the same species that can be easily crossbred, or from plants of closely related species.

[0032] The difficulties in crossbreeding can be overcome by techniques known in this field, such as embryo rescue or cisgenesis. Appropriately, methods for identifying nucleic acid molecules are used to track the incorporation of nucleic acid molecules into another plant.

[0033] Alternatively, the nucleic acid molecules of the present invention can be introduced or transferred from another sexually incompatible plant, for example, by using a transgenic approach. Appropriately applicable techniques include common plant transformation techniques known to those skilled in the art, such as the use of Agrobacterium-mediated transformation. Genome editing methods, such as the use of CRISPR / Cas systems, may also be used to obtain the plants of the present invention. The CRISPR / Cas system may include, for example, Cas9, Cpf1, Cms1, MAD7, C2c2, CasX, and / or CasY proteins.

[0034] The present invention further relates to a plant comprising the nucleic acid molecule of the present invention, either homozygous or heterozygous, which confers resistance to rhizobia, particularly M. enterolobii, wherein the plant is an inbred, hybrid, doubling haploid, or segregated population. Preferably, the plant is a non-transgenic plant.

[0035] The present invention also relates to seeds of Solanaceae plants containing the nucleic acid molecule of the present invention, wherein the Solanaceae plants grown from these seeds are the plants of the present invention that are resistant to rhizobia, particularly M. enterolobii. Preferably, the plants are Solanum lycopersicum plants. The present invention also relates to seeds produced by the plants of the present invention whose seeds possess the nucleic acid molecule of the present invention, and therefore the plants grown from these seeds are the plants of the present invention.

[0036] Furthermore, the present invention also relates to a food or processed food containing the fruit of the present invention or a portion thereof. The food may undergo one or more processing steps. Such processing steps may include, but are not limited to, any one or a combination thereof: peeling, cutting, washing, juicing, cooking, and cooling. The processed food may also be a salad mixture containing the fruit of the present invention. The fruit is the fruit of a plant of the Solanaceae family, particularly pepper, eggplant, potato, and tomato. Preferably, the fruit is the tomato fruit of the present invention. The resulting processed form is also part of the present invention.

[0037] The present invention also relates to a reproductive material suitable for producing the plant of the present invention, the reproductive material being suitable for sexual reproduction and particularly selected from microspores, pollen, ovaries, ovules, embryo sacs, and egg cells; or suitable for vegetative reproduction and particularly selected from cuttings, roots, stems, cells, and protoplasts; or suitable for tissue culture of regenerative cells and particularly selected from leaves, pollen, embryos, cotyledons, hypocotyls, dividing cells, roots, root tips, anthers, flowers, seeds, rootstocks, and stems; wherein the plant produced from the reproductive material contains the nucleic acid molecule of the present invention that confers resistance to rhizobia, preferably resistance to M. enterolobii. The plant of the present invention may be used as a source of reproductive material.

[0038] The present invention further relates to cells comprising the nucleic acid molecules of the present invention as defined herein. Cells of the present invention can be obtained from or present in the plants of the present invention. Such cells may be in isolated form, as part of a whole plant, or from a part thereof, and such cells still constitute cells of the present invention because they contain nucleic acid molecules encoding proteins that confer resistance to rhizobia, particularly M. enterolobii, to the cultivated plants of the present invention. Each cell of the plants of the present invention possesses nucleic acid molecules encoding proteins that confer resistance to rhizobia, particularly M. enterolobii, to the plant. Cells of the present invention may also be regenerative cells that can be regenerated into new plants of the present invention.

[0039] The present invention further relates to plant tissue of the present invention comprising the nucleic acid molecule of the present invention. The tissue may be undifferentiated or already differentiated. Undifferentiated tissues include, for example, stem tips, anthers, petals, and pollen, and can be used in micropropagation to obtain new seedlings that will grow into the new plant of the present invention. The tissue may also be grown from the cells of the present invention.

[0040] The present invention further relates to a tissue culture of the plant of the present invention, which is also a reproductive material and contains the nucleic acid molecules of the present invention in its genome. The tissue culture comprises regenerative cells. Such a tissue culture can be selected or induced from any part of a plant, particularly from leaves, pollen, embryo, cotyledon, hypocotyl, dividing cell, root, root tip, anther, flower, leaf, seed, stem, or rootstock. The tissue culture can be regenerated into the plant of the present invention containing the nucleic acid molecules of the present invention, and the regenerated plant expresses resistance to rhizobia, particularly M. enterolobii, and is also part of the present invention.

[0041] The present invention further relates to the use of the plant of the present invention in plant breeding. Thus, the present invention also relates to a breeding method for developing a cultivated plant of the present invention that is resistant to rhizobia, particularly M. enterolobii, wherein a plant comprising the nucleic acid molecule of the present invention for conferring said resistance to another plant is used. Preferably, the plant of the present invention used in plant breeding is the plant Solanum lycopersium. Seeds of Solanum lycopersium, a representative plant that can be used in plant breeding to develop another plant resistant to rhizobia, particularly M. enterolobii, have been deposited with NCIMB under accession number NCIMB 43515.

[0042] The present invention also relates to the use of the nucleic acid molecules of the present invention for the development of plants resistant to rhizobia. Preferably, the developed plants are Solanum lycopersium plants resistant to M. enterolobii.

[0043] The present invention also relates to a method for testing a plant for the presence of a nucleic acid molecule in the genome, which includes detecting the presence of the nucleic acid molecule in the plant genome.

[0044] A method for testing plants for the presence in the genome of the nucleic acid molecule of the present invention, which encodes a protein conferring resistance to rhizobia, particularly M. enterolobii, optionally further comprises selecting plants containing the nucleic acid molecule as plants resistant to rhizobia.

[0045] The present invention relates to a method for selecting rhizomatous nematode-resistant plants of the Solanaceae family, particularly Solanum lycopersicum plants, the selection comprising determining the presence of the nucleic acid molecule of the present invention in the genome of the nucleic acid molecule of the present invention. A plant of the Solanaceae family is selected, and if the plant contains the nucleic acid molecule of the present invention, that plant is selected. Subsequently, the plant in which the nucleic acid molecule has been identified is selected as a rhizomatous nematode-resistant plant. In one embodiment, the rhizomatous nematode is M. enterolobii, which can be detected by performing the bioassay described in Example 1. The selected plants obtained by such a method are also part of the present invention. The present invention further relates to a method for selecting a Solanaceae plant, particularly a Solanum lycopersicum plant, that possesses the nucleic acid molecule of the present invention, comprising determining the presence of the nucleic acid molecule of the present invention by determining its genomic nucleotide sequence or a functional portion thereof in the genome of the plant, wherein the sequence has sequence identity in the order of priority of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% with respect to a sequence number selected from the group consisting of sequence numbers 1, 18, and 21.

[0046] The present invention further relates to a method for selecting a Solanaceae plant, particularly a Solanum lycopersicum plant, that possesses the nucleic acid molecule of the present invention, comprising determining the presence of the nucleic acid molecule of the present invention. By determining its coding sequence or a portion thereof in the plant, the sequence has sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% in order of priority with respect to a sequence number selected from the group consisting of sequence numbers 2, 3, 4, 5, 6, 7, 8, 9, 19, 22, 24, 26, and 28.

[0047] The present invention further relates to a method for selecting a Solanaceae plant, particularly a Solanum lycopersicum plant, that possesses the nucleic acid molecule of the present invention, comprising determining the presence of the nucleic acid molecule of the present invention by determining the amino acid sequence of the encoded protein, wherein the sequence has sequence identity in the order of priority of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% with respect to a sequence number selected from the group consisting of sequence numbers 10, 11, 12, 13, 14, 14, 16, 17, 20, 23, 25, 27, and 29.

[0048] The present invention also relates to a method for producing plants resistant to rhizobia, particularly M. enterolobii, the method comprising: a) Crossing a plant containing the nucleic acid molecule of the present invention with another plant; b) If desired, perform one or more self-pollinations and / or crosses of the plants obtained from the cross to obtain a further generation population; c) Selecting plants from crosses or from a further generation population that contain the nucleic acid molecule of the present invention and are resistant to rhizobia, particularly M. enterolobii.

[0049] The selection of plants containing the nucleic acid molecule of the present invention is appropriately carried out by comparing the sequence with any one of the sequences selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 18, 19, 21, 22, 24, 26, and 28. Alternatively, plants can be further selected phenotypically for resistance to rhizophore nematodes, particularly M. enteroloby resistance, by performing a bioassay.

[0050] In one embodiment of the present invention, the plant used in a method for producing a plant resistant to rhizophore nematodes is a Solanum lycopersicum plant. In a further embodiment of the present invention, the plant used in a method for producing a Solanum lycopersicum plant resistant to M. enterolobii is a plant grown from a seed deposited under NCIMB accession number NCIMB 43515, or a descendant plant which is a direct or further offspring obtained by crossing the plant grown from said deposited seed with itself or another plant in one or more subsequent generations.

[0051] The present invention further provides a method for introducing other desired traits into plants, including resistance to rhizobia, particularly M. enterolobii, the method comprising: a) Producing F1 offspring by crossing a plant containing the nucleic acid molecule of the present invention with a second plant containing other desired traits; b) Selecting plants in the F1 generation that have resistance to rhizobia and other desired traits, if desired; c) To produce backcross offspring by crossing a selected F1 offspring with any of the parents; d) Selecting backcross offspring that possess resistance to rhizobia and other desired traits; and e) If desired, repeat steps c) and d) consecutively one or more times to produce selected fourth-generation and later backcross offspring that possess other desired traits and are resistant to rhizophore nematodes. If desired, backcrossing may be continued until the backcross offspring become stable and usable as parent lines, which can be achieved after up to 10 backcrosses. We will implement this.

[0052] In one embodiment of the present invention, the plant used in a method for introducing another desired trait to a plant containing resistance to rhizophore nematodes is a Solanum lycopersicum plant containing resistance to M. enterolobii. In a further embodiment of the present invention, the Solanum lycopersicum plant used in a method for introducing another desired trait to a plant containing resistance to M. enterolobii is a plant grown from seeds deposited under NCIMB accession number NCIMB 43515, or a descendant plant which is a direct or further offspring obtained by crossing the plant grown from said deposited seeds with itself or another plant.

[0053] If desired, a self-pollination step may be performed after either the crossing or backcrossing step. Alternatively, the selection of plants containing the nucleic acid molecules of the present invention that confer resistance to rhizophore nematodes and other desired traits may be performed after any crossing or self-pollination step of the method. Other desired traits may be selected from, but are not limited to, the following groups: resistance to bacterial, fungal, or viral diseases; insect or pest resistance; improved germination; plant size; plant type; improved shelf life; resistance to water stress and heat stress; and male sterility. The present invention includes plants produced by this method and fruits obtained therefrom.

[0054] The present invention further relates to a method for producing a plant containing the nucleic acid molecule of the present invention, wherein the presence of the nucleic acid molecule results in resistance to rhizobia, particularly M. enterolobii, by using vegetative propagation, by using tissue culture of plant material containing the nucleic acid molecule of the present invention, or by using doubled haploid production techniques to produce doubled haploid lines, and the method comprises growing seeds containing the nucleic acid molecule in the plant.

[0055] The present invention further relates to a method for producing seeds, comprising growing a plant from the seeds of the present invention, enabling the plant to produce a fruit having seeds, harvesting the fruit, and extracting the seeds. Seed production is appropriately carried out by crossing with itself or, optionally, with another plant which is also the plant of the present invention. Seeds thus produced are capable of growing into plants containing the nucleic acid molecules of the present invention and are resistant to rhizobia, particularly M. enterolobii.

[0056] The present invention further relates to a method for producing hybrid seeds and said hybrid seeds, comprising crossing a first parent plant with a second parent plant and harvesting the resulting hybrid seeds, wherein the first parent plant and / or the second parent plant are plants of the present invention containing the nucleic acid molecules of the present invention. A hybrid plant that can grow from the said hybrid seeds containing the nucleic acid molecules and which is resistant to rhizobia, particularly M. enterolobii, is also a plant of the present invention.

[0057] The parent providing resistance to rhizophore nematodes, particularly M. enterolobii, may be a plant grown directly from deposited seeds. The parent may be a descendant plant from deposited seeds, which is a direct or further offspring obtained by crossing itself or another plant once or multiple times, or a descendant plant from seeds identified as having obtained resistance to rhizophore nematodes, particularly M. enterolobii, by other means, along with the nucleic acid molecule of the present invention.

[0058] As used herein, gene transfer of the nucleic acid molecule of the present invention means the introduction of the nucleic acid molecule of the present invention from a donor plant containing the nucleic acid molecule to a recipient plant not possessing the nucleic acid molecule by standard breeding techniques, wherein the selection of plants containing the nucleic acid molecule of the present invention may be carried out phenotypically by observing resistance to rhizobia, particularly M. enterolobii, or the selection may be carried out by comparing the sequence with any one of the sequences selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 18, 19, 21, 22, 24, 26 and 26 described herein.

[0059] The nucleic acid molecule of the present invention is transferred from another plant of the Solanaceae family to another plant of the Solanaceae family. In one embodiment, the nucleic acid molecule of the present invention is transferred from a plant of the species Solanum pimpinellifolium to Solanum lycopersicum. In another embodiment, the nucleic acid molecule is transferred from a Solanum lycopersicum plant containing the nucleic acid molecule of the present invention to a Solanum lycopersicum plant lacking the nucleic acid molecule of the present invention. In a further embodiment of the present invention, the nucleic acid molecule is genetically transferred from a Solanum lycopersicum plant or Solanum pimpinellifolium containing the nucleic acid molecule of the present invention to a plant lacking the nucleic acid molecule, where the plant of the present invention is selected from the group consisting of Solanum arcanum, Solanum cheesemaniae, Solanum chilense, Solanum cimilevskyi, Solanum corneliomreli, Solanum galapagense, Solanum habrokaites, Solanum huairacens, Solanum juglandifolium, Solanum lycopersicum cerasiform, Solanum lycopersicoides, Solanum neoricii, Solanum oclantum, Solanum penneri, Solanum peruvianum, Solanum pimpinellifolium, and Solanum sitiens. In particular, the MeR1 gene of the present invention is transferred from one Solanaceae plant to another Solanaceae plant. In one specific embodiment, the MeR1 gene of the present invention is transferred from a Solanum pimpinellifolium plant to a Solanum lycopersicum plant.

[0060] As used herein, “phenotype of the present invention” and “resistance of the present invention” refer to resistance to Rhizophore nematodes. Preferably, resistance to Rhizophore nematodes refers to resistance to Rhizophore nematode meloidogyne enterolobii (Yang & Eisenback, 1983). Synonyms for M. enterolobii are meloidogyne mayaguensis or M. mayaguensis.

[0061] As used herein, the term “nucleic acid molecule” is used to refer to a nucleotide sequence of a gene or allele of a gene, which is a specific sequence of the gene linked as a particular phenotype, i.e., the phenotype of the present invention. The nucleic acid molecule may be isolated if desired. As used herein, “MeR1 gene of the present invention” or “MeR1 nucleic acid molecule of the present invention” is used to refer to the MeR1 gene that gives rise to the phenotype of the present invention. The present invention relates to a gene or allele that encodes a functional protein that confers resistance. More specifically, “MeR1 gene of the present invention” or “MeR1 nucleic acid molecule of the present invention” is used to specify a nucleic acid molecule that encodes a MeR1 protein that, when present in Solanaceae plants, particularly Solanum lycopersicum plants, confers resistance to rhizobia, particularly M. enterolobii, where the nucleic acid molecule is as follows: a) A nucleotide sequence containing a coding sequence with sequence numbers 1, 2, 3, 4, 5, 6, 7, 8, or 9, or a coding sequence with sequence numbers 2, 3, 4, 5, 6, 7, 8, or 9 having sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% in order of priority; or b) Nucleotide sequences encoding a protein having the amino acid sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17, or a protein having an amino acid sequence with sequence identity of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% in order of priority with the sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17. It has the following nucleotide sequence.

[0062] As used herein, the term “NRC6 allele” is used to specify the NRC6 allele that, when present in plants together with the MeR1 gene of the present invention, confers resistance to rhizomatous nematodes, particularly M. enterolobii. More specifically, “NRC6 allele” is used to specify a nucleic acid molecule that, when present in plants of the Solanaceae family, particularly Solanum lycopersicum, together with the MeR1 nucleic acid molecule of the present invention, contributes to resistance to rhizomatous nematodes, particularly M. enterolobii, wherein the nucleic acid molecule is as follows: a) A nucleotide sequence comprising a coding sequence according to SEQ ID NOs. 19, 22, 24, 26, or 28, or a coding sequence having 98%, preferably 99%, sequence identity with the sequence according to SEQ ID NOs. 19, 22, 24, 26, or 28; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to SEQ ID NOs: 20, 23, 25, 27, or 29, or a protein having an amino acid sequence having 98%, preferably 99%, sequence identity with the amino acid sequence according to SEQ ID NOs: 20, 23, 25, 27, or 29. It has the following nucleotide sequence.

[0063] In general, plants of the genus Solanum, and especially Solanum lycopersicum, contain the NRC6 allele of the NRC6 gene. Examples of alleles are described herein. The presence of the NRC6 gene alone in plants does not result in resistance to M. enterolobii. In order to make plants of the Solanaceae family, especially Solanum lycopersicum, resistant to rhizophore nematodes, especially M. enterolobii, at least the MeR1 gene of the present invention must be present in the plants, preferably in combination with the NRC6 gene.

[0064] As used herein, sequence identity is the percentage of nucleotides or amino acids that are identical between two sequences after proper alignment of those sequences. Those skilled in the art know how to align sequences, for example, by using sequence alignment tools such as BLAST®, which can be used for both nucleotide and protein sequences. To obtain the most significant results, it is necessary to obtain the best possible alignment that gives the highest sequence identity score. The percentage of sequence identity is calculated through a comparison of the lengths of the shortest sequences in the evaluation, in which case a sequence represents a gene or allele containing at least a start codon and a stop codon, or a complete protein encoded by such a gene or allele.

[0065] In the context of the present invention, “the nucleic acid molecule of the present invention” is used to refer to the nucleic acid molecule defined as “the MeR1 gene of the present invention” as defined above, and at least one nucleic acid molecule defined as “the NRC6 allele” as defined above, which may be the NRC6-2a, NRC6-2c, NRC6-2b, NRC6-3 or NRC6-1a alleles as defined herein, or any combination thereof.

[0066] As used herein, “nucleic acid molecule of the present invention” means the MeR1 gene of the present invention or the MeR1 gene of the present invention combined with at least one NRC6 allele, which may optionally be the NRC6-2a, NRC6-2c, NRC6-2b, NRC6-3, or NRC6-1a alleles as defined herein, or any combination thereof.

[0067] As used herein, “the plant of the present invention” is a Solanaceae plant containing the nucleic acid molecule of the present invention and resistant to rhizophore nematodes, preferably belonging to the genus Solanum, and more preferably a Solanum lycopersicum plant resistant to M. enterolobii.

[0068] Where used herein, “offspring” is intended to mean the first offspring and all subsequent offspring from a cross with the plant of the present invention, where cross includes crossing with itself or with another plant, and the offspring determined to be offspring contain the nucleic acid molecule of the present invention as defined herein, which results in resistance to rhizobia, particularly M. enterolobii. “Offspring” also includes plants that possess the nucleic acid molecule of the present invention, are resistant to rhizobia, particularly M. enterolobii, and are obtained by vegetative propagation or other forms of propagation from another plant or offspring of a plant of the present invention.

[0069] The present invention is further demonstrated in the following examples, which are for demonstration purposes only. The examples are not intended to limit the present invention in any way.

[0070] Deposit Seeds of Tomato Solanum Lycopersicum, homozygously containing the nucleic acid molecule of the present invention, resulting in M. enterolobii-resistant plants, were deposited on November 18, 2019, under depositary number NCIMB 43515 with NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, UK.

[0071] Sequence information [Table 1] TIFF0007874559000002.tif186122 TIFF0007874559000003.tif186123 TIFF0007874559000004.tif186123 TIFF0007874559000005.tif186123 TIFF0007874559000006.tif186122 TIFF0007874559000007.tif185122 TIFF0007874559000008.tif186122 TIFF0007874559000009.tif186123 TIFF0007874559000010.tif186122 TIFF0007874559000011.tif185122 TIFF0007874559000012.tif186123 TIFF0007874559000013.tif185122 TIFF0007874559000014.tif186123 TIFF0007874559000015.tif186123 TIFF0007874559000016.tif186122 TIFF0007874559000017.tif181123 TIFF0007874559000018.tif185123 TIFF0007874559000019.tif186123 TIFF0007874559000020.tif186123 TIFF0007874559000021.tif186123 TIFF0007874559000022.tif185122 TIFF0007874559000023.tif185122 TIFF0007874559000024.tif185122 TIFF0007874559000025.tif180122 TIFF0007874559000026.tif182122 JPEG0007874559000027.jpg185121 TIFF0007874559000028.tif186122 TIFF0007874559000029.tif186123 TIFF0007874559000030.tif185121 TIFF0007874559000031.tif184121 JPEG0007874559000032.jpg185121 TIFF0007874559000033.tif185122 JPEG0007874559000034.jpg181122 TIFF0007874559000035.tif186122 TIFF0007874559000036.tif186123 TIFF0007874559000037.tif186122 TIFF0007874559000038.tif186123 JPEG0007874559000039.jpg185122 TIFF0007874559000040.tif185122 JPEG0007874559000041.jpg180121 TIFF0007874559000042.tif186122 JPEG0007874559000043.jpg180122 TIFF0007874559000044.tif185122 JPEG0007874559000045.jpg180122 TIFF0007874559000046.tif185122 JPEG0007874559000047.jpg185122 [Brief explanation of the drawing]

[0072] drawing The present invention is further demonstrated in the following embodiments, which are given for demonstration purposes only and are not intended to limit the scope of the invention. The following figures are referenced in the embodiments: [Figure 1]Results of M. enteroloby disease tests on plants having the modified MeR1 gene of the present invention; amount of root nodules on the source, susceptible lines 1 and 2, and mutant lines (Δ) with a deletion resulting in a non-functional MeR1 gene and mutant lines (+) without a deletion and with a functional MeR1 gene.

[0073] Examples Example 1 M. enterolobili disease trial The resistance of tomato plants was determined by counting egg masses. Tomato plants to be tested were sown in trays in a greenhouse, and after two weeks, the plants were transferred to 660cc pots filled with a sandy soil mixture. Dometica RZ was introduced as a susceptible control plant, and plants grown from deposited NCIMB 43515 were introduced as a positive control. A hole was made next to the roots using a 1ml pipette tip and filled with a 1ml suspension containing 500J2 M. enterolobii inoculum. After inoculation, the plants were grown in a growth chamber (23°C, 14 hours of light) and watered three times a week. Six weeks after inoculation, the plants were removed from the soil, and the roots were washed with tap water to remove the soil. Egg masses were counted and scored according to the symptoms shown in Table 2. When using the scoring system in Table 2, M. enterolobii-resistant tomato plants have a score of 0, 1, or 2, preferably 0 or 1. [Table 2]

[0074] Example 2 Identification of nucleic acid molecules that can confer resistance to M. enterolobii. For M. enterolobii resistance, various in-house developed Solanum lycopersicum populations were precisely mapped to a small region on chromosome 4 containing only 10 potential genes likely to contribute to M. enterolobii resistance. Whole genome sequences were available in-house for the background of resistant and susceptible lines used in the development of these populations. Several genes had immature stop codons and therefore did not express functional proteins. Only genes present in the region of interest and expressing functional proteins were considered candidate genes. Among the remaining genes in the region of interest was the MeR1 gene of the present invention, which exhibited various polymorphisms between susceptible and resistant substances. The isolation material showed that the MeR1 gene of the present invention was segregated with resistance. Through correlation analysis of phenotypic and genotypic segregation, it was determined that a specific MeR1 gene is responsible for M. enterolobii resistance in resistant Solanum lycopersicum plants. During the analysis, NRC6 was also found to be isolated along with the MeR1 gene of the present invention for resistance to M. enterolobii. As described in Adachi et al. ((2019) An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species; Elife. 27;8), NRC6 was thought to contain a MADA motif and therefore be an NLR helper protein.

[0075] The expression of the MeR1 protein encoded by the MeR1 gene of the present invention was determined by RNA sequencing of leaf and root material from infected plants, as well as from Solanum lycopersicum plants susceptible to M. enterolobii and from non-infected plants of the present invention. This leads to the conclusion that the MeR1 protein is expressed in the roots of the plants but absent in the leaves.

[0076] Example 3 Modification of the MeR1 gene according to the present invention Functional MeR1 protein in plants is necessary for resistance to nematodes, particularly M. enterolobii. Therefore, inhibiting the expression of MeR1 protein by mutating the MeR1 gene of the present invention in resistant plants results in plants that are susceptible to M. enterolobii.

[0077] CRISPR / Cas experiments were performed to inhibit MeR1 protein expression. Two designed guide RNAs were incorporated into the plasmid. The two guide RNAs were designed to target two different positions in the coding sequence of the MeR1 gene. Agrobacterium tumefaciens-mediated transformation using the CRISPR / Cas construct was performed on young tomato (Solanum lycopersicum) seedlings that had been grown in a sterile environment for 6 days. Transformation was performed on resistant seedlings obtained by crossing a Solanum pimpinellifolium source with a susceptible Solanum lycopersicum line to obtain the F1 generation. Subsequently, the F1 plants were backcrossed three times to obtain a BC3 population, and finally, two self-pollinations were performed to obtain an F3BC3 population.

[0078] In resistant seedlings, one mutant plant with a 236 bp deletion in the coding sequence of the MeR1 gene was identified and selected. This deletion resulted in the expression of a non-functional MeR1 protein, thereby inhibiting its expression. The selected plant was self-pollinated to obtain an isolated population. The deletion was confirmed using a simple PCR experiment. In the PCR experiment, isolated genomic DNA was used with the forward primer AGGAATGTATAAATACTCTGACA (SEQ ID NO: 31) and the reverse primer GCCTAGCAACTAATGTATCT (SEQ ID NO: 32). The primer pair was designed to amplify MeR1 amplicons with and without the mutation. The conditions were as follows: Primer pair having SEQ ID NO: 31 and SEQ ID NO: 32 -95°C for 3 minutes (initial modification step) -40 amplification cycles, each cycle consisting of 30 seconds of denaturation at 95°C, 30 seconds of annealing at 60°C, and 75 seconds of extension at 75°C. -72°C for 10 minutes (final stretching step).

[0079] PCR products were visualized on an agarose gel. Plants with the mutation showed an amplicon size of 820 bp, while plants without the mutation showed an amplicon size of 1100 bp.

[0080] This PCR experiment selected nine plants that were homozygous for the mutation and sixteen plants that had the wild-type version of the MeR1 gene for the experiment.

[0081] Mutant plants containing a homozygous deletion of the MeR1 gene and plants containing a functional MeR1 gene in the same genetic background were tested for resistance by counting the number of root nodules. Counting the number of root nodules differs from counting egg masses as described in Example 1, as it is performed at different times after inoculation. Tomato plants to be tested were sown in trays in a greenhouse, and after two weeks, the plants were transferred to 900cc square pots filled with a sandy soil mixture. A hole was made next to the roots with a 1ml pipette tip and filled with a 1ml suspension containing 500J2 M. enterolobii inoculum. After inoculation, the plants were grown in a controlled greenhouse (23°C, minimum 14 hours of lighting) and watered three times a week. 28 days after inoculation, the plants were removed from the soil, and the roots were tapped to remove as much soil as possible. Plants with the deletion showed a significant increase in susceptibility to M. enterolovii, specifically an increase in the number of root nodules compared to plants with the same background but without the MeR1 gene deletion. The results shown in Figure 1 demonstrate that inhibition of functional MeR1 gene expression in resistant plants results in more susceptible plants. Therefore, the MeR1 gene of the present invention confers resistance to M. enterolovii in tomato plants. Resistant tomato plants can be grown, for example, from deposit NCIMB 43515.

Claims

1. A nucleic acid molecule encoding the MeR1 protein, which, when present in plants of the Solanaceae family, confers resistance to rhizobia nematodes, is as follows: a) A nucleotide sequence comprising a coding sequence according to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, or 9, or a coding sequence having at least 95% sequence identity with the sequence according to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, or 9; or b) A nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17, or a protein having an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17 A nucleic acid molecule having a nucleotide sequence.

2. The nucleic acid molecule according to claim 1, wherein the sequence identity with the sequence specified by sequence numbers 2, 3, 4, 5, 6, 7, 8, or 9 is at least 96%.

3. A nucleic acid molecule according to claim 1 or claim 2, wherein the sequence identity with the amino acid sequence according to SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, or 17 is at least 96%.

4. A nucleic acid molecule according to any one of claims 1 to 3, which confers resistance to rhizobia nematodes when present in the plant Solanum lycopersicum.

5. A plant of the Solanaceae family containing a nucleic acid molecule according to any one of claims 1 to 4, wherein the plant is resistant to rhizophore nematodes.

6. A plant of the Solanaceae family comprising a nucleic acid molecule according to any one of claims 1 to 4, and at least one nucleic acid molecule encoding the NRC6 protein, wherein the nucleic acid molecule encoding the NRC6 protein is as follows: a) A nucleotide sequence including the coding sequence according to Sequence ID No. 19; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to Sequence ID No.

20. Having a nucleotide sequence, Here, the plant is resistant to rhizophore nematodes.

7. A plant of the Solanaceae family comprising a nucleic acid molecule according to any one of claims 1 to 4, and two nucleic acid molecules encoding the NRC6 protein, wherein the nucleic acid molecules encoding the NRC6 protein are as follows: a) A nucleotide sequence including the coding sequence according to Sequence ID No. 19; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to Sequence ID No.

20. Having a nucleotide sequence, Here, the plant is resistant to rhizophore nematodes.

8. A plant according to any one of claims 5 to 7, which is resistant to Meloidogene enterolobii.

9. A plant according to any one of claims 5 to 8, which is a Solanum lycopersicum plant.

10. The plant according to claim 7 or 8, wherein the nucleic acid molecule is contained in the genome of the Solanum lycopersicum plant, and a representative seed of the Solanum lycopersicum plant is deposited with the NCIMB under deposit number NCIMB 43515.

11. A rootstock for a plant of the Solanaceae family, comprising the nucleic acid molecule described in any one of claims 1 to 4.

12. The present invention further comprises a nucleic acid molecule encoding the NRC6 protein, wherein the nucleic acid molecule encoding the NRC6 protein is as follows: a) A nucleotide sequence including the coding sequence according to Sequence ID No. 19; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to Sequence ID No.

20. A rootstock according to claim 11, having the nucleotide sequence.

13. A seed wherein a plant of the Solanaceae family grown from the seed contains the nucleic acid molecule described in any one of claims 1 to 4.

14. The present invention further comprises a nucleic acid molecule encoding the NRC6 protein, wherein the nucleic acid molecule encoding the NRC6 protein is as follows: a) A nucleotide sequence including the coding sequence according to Sequence ID No. 19; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to Sequence ID No.

20. The seed according to claim 13, having the nucleotide sequence.

15. The seed according to claim 13 or 14, wherein the Solanaceae plant grown from the seed is resistant to meroidin enteroloby.

16. The seed according to any one of claims 13 to 15, wherein the plant is a Solanum lycopersicum plant.

17. A method for selecting a Solanaceae plant possessing a nucleic acid molecule according to any one of claims 1 to 4, comprising: determining the presence of the nucleic acid molecule according to any one of claims 1 to 4 in the Solanaceae plant; and selecting the Solanaceae plant if it contains the nucleic acid molecule according to any one of claims 1 to 4.

18. The method according to claim 17, wherein the plant further comprises a nucleic acid molecule encoding the NRC6 protein, wherein the nucleic acid molecule encoding the NRC6 protein is as follows: a) A nucleotide sequence including the coding sequence according to Sequence ID No. 19; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to Sequence ID No.

20. Having a nucleotide sequence, The method further comprises determining the presence of a nucleic acid molecule encoding the NRC6 protein, and selecting the plant if the plant contains a nucleic acid molecule encoding the NRC6 protein.

19. The method according to claim 17 or 18, further comprising the step of determining whether the plant exhibits resistance to rhizobia.

20. The method according to any one of claims 17 to 19, wherein the plant is a Solanum lycopersicum plant.

21. The method according to any one of claims 17 to 20, wherein the rhizobia is meloidine enterolobyi.

22. A method for producing plants of the Solanaceae family that are resistant to rhizobia nematodes, the following: (a) Crossing a plant containing a nucleic acid molecule as described in any one of claims 1 to 4 with another plant; (b) Selecting a plant containing the nucleic acid molecule described in any one of claims 1 to 4 after one or more self-pollinations and / or crosses. Methods that include...

23. The method according to claim 22, further comprising the step of performing self-pollination once or more times before the selection step.

24. The plant further comprises a nucleic acid molecule encoding the NRC6 protein, wherein the nucleic acid molecule encoding the NRC6 protein is as follows: a) A nucleotide sequence including the coding sequence according to Sequence ID No. 19; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to Sequence ID No.

20. Having a nucleotide sequence, The method according to claim 22 or 23.

25. The selection of a Solanaceae plant that is resistant to rhizobia and contains a nucleic acid molecule according to any one of claims 1 to 4, or a nucleic acid molecule according to any one of claims 1 to 4 and a nucleic acid molecule encoding the NRC6 protein, further comprises determining the presence of a nucleic acid molecule according to any one of claims 1 to 4, or a nucleic acid molecule according to any one of claims 1 to 4 and a nucleic acid molecule encoding the NRC6 protein, according to the method of claim 17 or 18, wherein the nucleic acid molecule encoding the NRC6 protein is as follows: a) A nucleotide sequence including the coding sequence according to Sequence ID No. 19; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to Sequence ID No.

20. Having a nucleotide sequence, The method according to any one of claims 22 to 24.

26. The method according to any one of claims 22 to 25, wherein the rhizophore nematode is meloidine enterolobyi.

27. The method according to any one of claims 22 to 26, wherein the plant is a Solanum lycopersicum plant.

28. Use of a nucleic acid molecule according to any one of claims 1 to 4 for producing Solanaceae plants that are resistant to rhizobia.

29. A nucleic acid molecule encoding the NRC6 protein is used together with the nucleic acid molecule described in any one of claims 1 to 4, wherein the nucleic acid molecule encoding the NRC6 protein is as follows: a) A nucleotide sequence including the coding sequence according to Sequence ID No. 19; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to Sequence ID No.

20. The use according to claim 28, having a nucleotide sequence.

30. The use according to claim 28 or 29, wherein the plant is a Solanum lycopersicum plant.

31. By introducing a nucleic acid molecule according to any one of claims 1 to 4, or a nucleic acid molecule according to any one of claims 1 to 4 and a nucleic acid molecule encoding the NRC6 protein, into the genome, a resistant plant is produced, wherein the nucleic acid molecule encoding the NRC6 protein is as follows: a) A nucleotide sequence including the coding sequence according to Sequence ID No. 19; or b) A nucleotide sequence encoding a protein having the amino acid sequence according to Sequence ID No.

20. The use according to any one of claims 28 to 30, having a nucleotide sequence.

32. The use according to claim 31, wherein the nucleic acid molecule according to any one of claims 1 to 4, or the nucleic acid molecule according to any one of claims 1 to 4 and a nucleic acid molecule encoding the NRC6 protein, is introduced by gene transfer.

33. The use according to any one of claims 28 to 32, wherein the rhizophore nematode is meloidine enterolobyi.