IL2 Mutein
IL-2 muteins with altered receptor binding properties address the toxicity issues of IL-2 therapies by reducing CD132 affinity and enhancing CD25/CD122 binding, providing effective treatment for inflammatory and autoimmune conditions.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- SYNTHEKINE INC
- Filing Date
- 2021-01-14
- Publication Date
- 2026-06-17
Smart Images

Figure 0007875121000024 
Figure 0007875121000025 
Figure 0007875121000026
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 62 / 960,847, filed on 14 January 2020, the disclosure of which is incorporated herein by reference in its entirety for all purposes.
[0002] Statement regarding federal government funding No federal funds were used to conceive or implement the subject matter of this disclosure. [Background technology]
[0003] Background of the Invention Interleukin-2 (IL-2) is a pluripotent cytokine primarily produced by activated CD4+ T cells involved in the production of a normal immune response. IL-2 exerts a wide range of effects on the immune system, playing a crucial role in regulating immune activation, suppression, and homeostasis. IL-2 promotes the proliferation and expansion of activated T lymphocytes, enhances B cell growth, and activates monocytes and natural killer cells. The amino acid sequence of human IL-2 (SEQ ID NO:1) is found at Genbank accession locator NP_000577.2.
[0004] As an immune system stimulant, IL-2 has been used to treat cancer and chronic viral infections. However, the effects of IL-2 are also associated with mediating autoimmunity and graft rejection. IL-2 therapy, especially at high doses, is associated with significant toxicity in human subjects. Consequently, the therapeutic goal is to maintain the desired effects of IL-2 while minimizing associated autoimmune or immunosuppressive responses. Due to its role in immunomodulation and immune diseases, the search for novel IL-2 analogs and variants remains a thriving area of research.
[0005] IL-2 exerts its effects on mammalian immune cells through interactions with the following three different cell surface proteins: (1) CD25 (IL-2 receptor alpha, also known as IL-2Rα or p55), CD122 (interleukin-2 receptor beta, also known as IL2Rβ, IL15Rβ, or p70-75), and CD132 (interleukin-2 receptor gamma, also known as IL-2Rγ; or the common gamma chain, as it is a component of other multimeric receptors in this family).
[0006] CD25 is a 55kD polypeptide that is constitutively expressed in Treg cells and inductively expressed in other T cells in response to activation (e.g., by CD3). hIL-2 is approximately 10 -8 CD25 binds to the Kd of M. CD25 is also referred to in the literature as a “low affinity” IL-2 receptor. Human CD25 is expressed as a 272-amino acid preprotein containing a 21-amino acid signal sequence, and after translation, the signal sequence is removed to form a 251-amino acid mature protein. Amino acids 22-240 (amino acids 1-219 in the mature protein) correspond to the extracellular domain. Amino acids 241-259 (amino acids 220-238 in the mature protein) correspond to the transmembrane domain. Amino acids 260-272 (amino acids 239-251 in the mature protein) correspond to the intracellular domain. The intracellular domain of CD25 is relatively small (13 amino acids) and has not been associated with any independent signaling activity. The IL2 / CD25 complex has not been observed to produce a detectable intracellular signaling response. The nucleic acid and protein sequences of human CD25 can be found as GenBank accession numbers NM_000417 and NP_0004Q8, respectively.
[0007] CD122 is a single-pass type I transmembrane protein. Human CD122 (hCD122) is expressed as a 551-amino acid protein, the first 26 amino acids containing a signal sequence, which is cleaved post-translation to a 525-amino acid protein. Amino acids 27-240 (amino acids 1-214 in the mature protein) correspond to the extracellular domain, amino acids 241-265 (amino acids 225-239 in the mature protein) correspond to the transmembrane domain, and amino acids 266-551 (amino acids 240-525 in the mature protein) correspond to the intracellular domain. The term CD122 as used herein includes native variants of the CD122 protein, including S57F and D365E (when numbered according to the mature hCD122 protein). hCD122 is referenced as entry P14784 in the UniProtKB database. The nucleic acid sequence and protein sequence of human CD122 can be found as GenBank accession numbers NM_000878 and NP_000869, respectively.
[0008] CD132 is a type 1 cytokine receptor and refers to the "common" γ chain because it is shared by receptor complexes for IL-4, IL-7, IL-9, IL-15, and IL-21. Human CD132 (hCD132) is expressed as a 369-amino acid preprotein containing a 22-amino acid N-terminal signal sequence. Amino acids 23-262 (amino acids 1-240 in the mature protein) correspond to the extracellular domain, amino acids 263-283 (amino acids 241-262 in the mature protein) correspond to a 21-amino acid transmembrane domain, and amino acids 284-369 (amino acids 262-347 in the mature protein) correspond to the intracellular domain. hCD132 is referenced as entry P31785 in the UniProtKB database. The nucleic acid and protein sequences of human CD132 can be found as GenBank accession numbers: NM_000206 and NP_000197, respectively.
[0009] The IL2 receptor protein combines to produce two additional IL-2 receptor complexes: (a) a "medium affinity" IL2 receptor (also referred to as IL2Rβγ) containing CD122 and CD132, and (b) a "high affinity" IL2 receptor complex (also referred to as IL2Rαβγ) containing CD25, CD122, and CD132 proteins. hIL-2 has a Kd of approximately 10e-9M for the medium affinity CD122 / CD132 (IL2βγ) receptor complex. The medium affinity CD122 / CD132 (IL2βγ) receptor complex is expressed mainly on resting T cells and NK cells. hIL-2 has a Kd of approximately 10e-11M for the high affinity IL-2 receptor complex. Most cells, such as resting T cells, express only CD122 and CD132, which have a relatively low affinity for IL-2 compared to the CD25 / CD122 / CD132 high affinity receptor complex, and thus show a low responsiveness to IL-2. The high affinity receptor complex is mainly confirmed on activated lymphocytes that express CD25 inducibly and Treg cells that express CD25 constitutively.
[0010] In light of the pleiotropic effects of the IL2 molecule and its demonstrated ability to modulate the activities of diverse cell types in the context of human disease, IL-2 mutants that retain certain desirable features of the native molecule while minimizing undesirable features depending on the therapeutic situation would be useful for the treatment of human diseases.
[0011] Garcia et al. (International Application No. PCT / 2018 / 062122, PCT International Publication No. WO2019 / 104092A1, published on May 31, 2019 (Patent Document 1), hereinafter "Garcia '092") describe, among other things, specific IL2 mutants having modifications at positions 18, 22, and 126 that show a reduced binding to CD132 while retaining partial IL2 activity.
Prior Art Documents
Patent Documents
[0012]
Patent Document 1
[0013] This disclosure provides IL-2 mutaine, which functions as a partial agonist and antagonist of IL-2.
[0014] Summary of this disclosure This disclosure provides methods and compositions for treating and / or preventing inflammatory, infectious, or autoimmune diseases, disorders, or conditions by administering a therapeutically effective dose of human IL-2 mutein, which has reduced binding affinity to CD132 but still retains remarkable binding affinity to CD122 and / or CD25 equivalent to that of wild-type human IL-2 activity.
[0015] In some embodiments, the Disclosure provides methods and compositions for treating and / or preventing inflammatory, infectious, or autoimmune diseases, disorders, or conditions by administering a therapeutically effective dose of human IL-2 mutein, which functions as IL-2, having reduced binding affinity to CD132 but still retaining remarkable binding affinity to CD122 and / or CD25 equivalent to that of wild-type human, in combination with an adjunct agent, including but not limited to one or more physical intervention therapeutic methods such as chemotherapeutic agents, immune checkpoint modulators, radiotherapy, and / or surgery.
[0016] In some embodiments, the Disclosure provides methods and compositions for treating and / or preventing inflammatory, infectious, or autoimmune diseases, disorders, or conditions by administering a therapeutically effective dose of human IL-2 mutein, which has reduced binding affinity to CD132 but still retains a remarkable binding affinity to CD122 and / or CD25 equivalent to that of wild-type human IL-2, and functions as IL-2, wherein the serum concentration of the IL2 mutein is maintained for a period of time at a serum concentration above the effective concentration of IL2 mutein sufficient to promote the proliferation of primary human T cells activated by CD3 with respect to the IL2 mutein, but below the effective concentration of IL2 mutein sufficient to induce T cell activation with respect to the IL2 mutein.
[0017] In some embodiments, the disclosure provides human interleukin-2 (IL-2) muteins that provide modified binding properties to one or more IL-2 receptors for the treatment of inflammatory, infectious, or autoimmune diseases, disorders, or conditions. In some embodiments, the IL-2 muteins have reduced binding affinity to the extracellular domain of hCD132.
[0018] In some embodiments, IL-2 mutein exhibits reduced binding affinity to the extracellular domain of hCD132 while maintaining significant binding affinity to the hCD25 / hCD122 receptor complex and / or activation of the hCD25 / hCD122 / hCD132 receptor complex.
[0019] In some embodiments, IL-2 mutein has a reduced binding affinity to CD132 while retaining substantial binding affinity to hCD25.
[0020] In one aspect, the present disclosure provides an hIL-2 mutein exhibiting significantly or improved binding affinity to hCD25 and reduced binding affinity to the extracellular domain of the hCD132 receptor compared to wild-type human IL-2 (hIL-2). In some embodiments, the IL-2 mutein comprises one or more amino acid substitutions that reduce CD132 receptor binding affinity, selected from amino acid positions 18, 22, and 126, numbered according to mature wild-type hIL-2.
[0021] In another context, this disclosure is based on the formula: TIFF0007875121000001.tif59149[in formula: Each of a, b, c, d, e, f, g, h, and i is individually selected from 0 or 1; AA1 is either A (wild type, a=1) or deleted (a=0); AA2 is either P (wild type, b=1) or deleted (b=0); AA3 is either T (wild type, c=1), C, A, G, Q, E, N, D, R, K, P, or deleted (c=0); • AA4 is either S (wild type, d=1) or deleted (d=0); AA5 is either S (wild type, e=1) or deleted (e=0); • AA6 is either S (wild type, f=1) or deleted (f=0); • AA7 is either T (wild type, g=1) or deleted (g=0); • AA8 is either K (wild type, h=1) or deleted (h=0); AA9 is either K (wild type, i=1) or deleted (i=0); AA18 is L (wild type) or R, L, G, M, F, E, H, W, K, Q, S, V, I, Y, H, D, or T; AA22 is Q (wild type) or F, E, G, A, L, M, F, W, K, S, V, I, Y, H, R, N, D, T, or F; AA35 is either K (wild type) or E; AA38 is R (wild type), W, or G; AA39 is M (wild type), L, or V; AA55 is either H (wild type) or Y; AA69 is either V (wild type) or A; AA74 is Q (wild type), P, N, H, S; AA80 is L (wild type), F, or V; AA81 is R (wild type), I, D, or T; AA85 is either L (wild type) or V; AA86 is either I (wild type) or V; AA89 is either I (wild type) or V; AA91 is V (wild type), R, or K; AA92 is either I (wild type) or F; AA97 is either K (wild type) or Q; AA104 is either M (wild type) or A; AA109 is a non-natural amino acid with D (wild type), C, or activated side chains; AA113 is either T (wild type) or N; AA125 is C (wild type), A, or S; AA126 is Q (wild type) or H, M, K, C, D, E, G, I, R, S, or T; AA130 is S (wild type), T, G, or R; However, if AA18 is R and AA22 is E, then AA126 is not H, M, K, C, D, E, G, I, R, S, or T. amino acid sequence (SEQ ID NO: 97) Provides polypeptides containing the following:
[0022] In some aspects of this situation, AA18 is selected from the group consisting of L (wild type) or R, L, G, M, F, E, H, W, K, Q, S, V, I, Y, H, D, or T; AA22 is selected from the group consisting of Q (wild type) or F, E, G, A, L, M, F, W, K, S, V, I, Y, H, R, N, D, T, or F; AA126 is selected from the group consisting of Q (wild type) or H, M, K, C, D, E, G, I, R, S, or T.
[0023] In some embodiments, polypeptides are L18R, Q22E and Q126M; L18R, Q22E, Q126T; L18R; Q22E; Q126H; L18R and Q126H; Q22E and Q126H; L18G, Q22E and Q126H; L18A, Q22E and Q126H; L18M, Q22E and Q126H; L18F, Q22E and Q126H; L18W, Q 22E and Q126H;L18K, Q22E and Q126H;L18Q, Q22E and Q126H;L18E, Q22E and Q126H;L18S, Q22E and Q126H;L18V, Q22E and Q126H;L18I, Q22E and Q126H;L18Y, Q22E and Q126H;L18H, Q22E and Q126H;L18N, Q22E and Q126H; L18D, Q22E and Q126H;L18T, Q22E and Q126H;L18R, Q22G and Q126H;L18R, Q22A and Q126H;L18R, Q22L and Q126H;L18R, Q22M and Q126H;L18R, Q22F and Q126H;L18R, Q22W and Q126H;L18R, Q22K and Q126H;L18R, Q22S and This includes a set of mutations selected from the group consisting of Q126H;L18R, Q22V and Q126H;L18R, Q22I and Q126H;L18R, Q22Y and Q126H;L18R, Q22H and Q126H;L18R, Q22R and Q126H;L18R, Q22N and Q126H;L18R, Q22D and Q126H; and L18R, Q22T and Q126H.
[0024] In some embodiments, the polypeptide is PEGylated. In some embodiments, the polypeptide is PEGylated, and the PEG portion of such a PEGylated polypeptide has a molecular weight of approximately 10 kD to approximately 70 kD.
[0025] In some embodiments, the polypeptide is a fusion protein. In certain embodiments, the fusion protein contains an Fc domain.
[0026] In another aspect, this disclosure provides nucleic acids that encode polypeptides described herein. In some embodiments, the nucleic acid is DNA.
[0027] In another aspect, this disclosure provides recombinant expression vectors comprising nucleic acids described herein. In some embodiments, the vector is a viral vector. In certain embodiments, the vector is a nonviral vector.
[0028] In another aspect, this disclosure provides host cells transformed with the vectors described herein.
[0029] In another aspect, this disclosure provides pharmaceutical formulations comprising polypeptides, nucleic acids, or vectors described herein.
[0030] In another aspect, the Disclosure provides a method for treating a mammalian subject suffering from an autoimmune or inflammatory disease, disorder, or condition or viral infection, comprising the step of administering a therapeutically effective dose of one of the pharmaceutical formulations described herein.
[0031] In some embodiments, the method further comprises administering one or more adjuvants selected from the group consisting of corticosteroids, Janus kinase inhibitors, calcineurin inhibitors, mTor inhibitors, IMDH inhibitors, biologics, vaccines, and therapeutic antibodies. In certain embodiments, the therapeutic antibody is an antibody that conjugates to a protein selected from the group consisting of BLyS, CD11a, CD20, CD25, CD3, CD52, IgEIL-12 / IL-23, IL-17a, IL-1β, IL-4Rα, IL-5, IL-6R, integrin-α4β7, RANKL, TNFα, VEGF-A, and VLA-4.
[0032] In some aspects, a disease, disorder, or condition is a viral infection, such as Helicobacter pylori. Pylori infection, HTLV, organ rejection, graft-versus-host disease, autoimmune thyroid disease, multiple sclerosis, allergy, asthma, neurodegenerative diseases including Alzheimer's disease, systemic lupus erythematosus (SLE), autoinflammatory diseases, inflammatory bowel disease (IBD), Crohn's disease, diabetes, chondritis, arthritis, rheumatoid arthritis, juvenile arthritis, juvenile rheumatoid arthritis, juvenile rheumatoid arthritis, polyarticular juvenile rheumatoid arthritis, systemic juvenile rheumatoid arthritis, juvenile ankylosing spondylitis, juvenile enteroarthritis, juvenile reactive arthritis, juvenile Reiter's syndrome, SEA syndrome, juvenile dermatomyositis, juvenile psoriatic arthritis, juvenile scleroderma, juvenile systemic lupus erythematosus, juvenile vasculitis, oligoarticular rheumatoid arthritis, poly Articular rheumatoid arthritis, systemic rheumatoid arthritis, ankylosing spondylitis, enteritis-associated arthritis, reactive arthritis, Reiter's syndrome, SEA syndrome, psoriasis, psoriatic arthritis, dermatitis (eczema), exfoliative dermatitis or atopic dermatitis, pityriasis rubra pilaris, pityriasis rosea, parapsoriasis, pityriasis lichenoides, lichen planus, lichen styloides, ichthyosis-like skin diseases, keratosis, skin diseases, alopecia areata The following conditions are selected from alopecia, pyoderma gangrenosum, vitiligo, bullous pemphigoid, urticaria, porokeratosis, rheumatoid arthritis; seborrheic dermatitis, photodermatitis; seborrheic keratosis, senile keratosis, actinic keratosis, follicular keratosis; acne vulgaris; keloids; nevi; warts, including condyloma or genital warts, and human papillomavirus (HPV) infection. [Invention 1001] Polypeptide containing the amino acid sequence of the following formula: TIFF0007875121000002.tif73128 During the ceremony: Each of a, b, c, d, e, f, g, h, and i is individually selected from 0 or 1; AA1 is either A (wild type, a=1) or deleted (a=0); AA2 is either P (wild type, b=1) or deleted (b=0); AA3 is either T (wild type, c=1), C, A, G, Q, E, N, D, R, K, P, or deleted (c=0); • AA4 is either S (wild type, d=1) or deleted (d=0); AA5 is either S (wild type, e=1) or deleted (e=0); • AA6 is either S (wild type, f=1) or deleted (f=0); • AA7 is either T (wild type, g=1) or deleted (g=0); • AA8 is either K (wild type, h=1) or deleted (h=0); AA9 is either K (wild type, i=1) or deleted (i=0); AA18 is L (wild type) or R, L, G, M, F, E, H, W, K, Q, S, V, I, Y, H, D, or T; AA22 is Q (wild type) or F, E, G, A, L, M, F, W, K, S, V, I, Y, H, R, N, D, T, or F; AA35 is either K (wild type) or E; AA38 is R (wild type), W, or G; AA39 is M (wild type), L, or V; AA55 is either H (wild type) or Y; AA69 is either V (wild type) or A; AA74 is Q (wild type), P, N, H, S; AA80 is L (wild type), F, or V; AA81 is R (wild type), I, D, or T; AA85 is either L (wild type) or V; AA86 is either I (wild type) or V; AA89 is either I (wild type) or V; AA92 is either I (wild type) or F; AA97 is either K (wild type) or Q; AA104 is either M (wild type) or A; AA109 is a non-natural amino acid with D (wild type), C, or activated side chains; AA113 is either T (wild type) or N; AA125 is C (wild type), A, or S; AA126 is Q (wild type) or H, M, K, C, D, E, G, I, R, S, or T; AA130 is S (wild type), T, G, or R; However, if AA18 is R and AA22 is E, then AA126 is not H, M, K, C, D, E, G, I, R, S, or T. [Invention 1002] AA18 is selected from the group consisting of L (wild type) or R, L, G, M, F, E, H, W, K, Q, S, V, I, Y, H, D, or T; AA22 is selected from the group consisting of Q (wild type) or F, E, G, A, L, M, F, W, K, S, V, I, Y, H, R, N, D, T, or F; AA126 is selected from the group consisting of Q (wild type) or H, M, K, C, D, E, G, I, R, S, or T. Polypeptide according to the present invention 1001. [Invention 1003] A polypeptide of the present invention 1001 or 1002, wherein a=0. [Invention 1004] L18R, Q22E, and Q126M; L18R, Q22E, Q126T; L18R; Q22E; Q126H; L18R and Q126H; Q22E and Q126H; L18G, Q22E, and Q126H; L18A, Q22E, and Q126H; L18M, Q22E, and Q126H; L18F, Q22E, and Q126H; L18W, Q22E, and Q126H; L18K, Q22E, and Q126H;L18Q, Q22E, and Q126H;L18E, Q22E, and Q126H;L18S, Q22E, and Q126H;L18V, Q22E, and Q126H;L18I, Q22E, and Q126H;L18Y, Q22E, and Q126H;L18H, Q22E, and Q126H;L18N, Q22E, and Q126H;L18D, Q22E, and Q126H;L18T, Q22E, and Q126H;L18R, Q22G, and Q126H;L18R, Q22A, and Q126H;L18R, Q22L, and Q126H;L18R, Q22M, and Q126H;L18R, Q22F, and Q126H;L18R, Q22W, and Q126H;L18R, Q22K, and Q126H;L18R, Q22S, and Q126H;L18R, Q22V, and Q126H polypeptides of any of inventions 1001 to 1003, comprising a set of mutations selected from the group consisting of L18R, Q22I, and Q126H; L18R, Q22Y, and Q126H; L18R, Q22H, and Q126H; L18R, Q22N, and Q126H; L18R, Q22D, and Q126H; and L18R, Q22T, and Q126H. [Invention 1005] A polypeptide according to any of the invention 1001 to 1004, which is PEGylated. [Invention 1006] The polypeptide according to any of the invention 1001 to 1005, wherein the polypeptide is PEGylated, and the PEG portion of the PEGylated polypeptide has a molecular weight of approximately 10 kD to approximately 70 kD. [Invention 1007] A polypeptide according to any of the invention 1001 to 1006, which is a fusion protein. [Invention 1008] The polypeptide of the present invention 1007, wherein the fusion protein contains an Fc domain. [Invention 1009] A nucleic acid encoding any polypeptide according to invention 1001 to 1008. [Invention 1010] DNA, the nucleic acid of the present invention 1009. [Invention 1011] A recombinant expression vector comprising the nucleic acid of Invention 1009 or 1010. [Invention 1012] A viral vector, the vector of the present invention 1011. [Invention 1013] A non-viral vector, the vector of the present invention 1011. [Invention 1014] Host cells transformed with any of the vectors 1011 to 1013 of this invention. [Invention 1015] A pharmaceutical formulation comprising any polypeptide of Invention 1001 to 1008, nucleic acids of Invention 1009 and 1010, or vectors of Invention 1011 to 1013. [Invention 1016] A method for treating a mammalian subject suffering from an autoimmune or inflammatory disease, disorder, or condition, or a viral infection, comprising the step of administering a therapeutically effective amount of the pharmaceutical formulation of the present invention 1015. [Invention 1017] The method of the present invention 1016, further comprising the step of administering one or more adjuvants selected from the group consisting of corticosteroids, Janus kinase inhibitors, calcineurin inhibitors, mTor inhibitors, IMDH inhibitors, biologics, vaccines, and therapeutic antibodies. [Invention 1018] The method of the present invention 1017, wherein the therapeutic antibody is an antibody that binds to a protein selected from the group consisting of BLyS, CD11a, CD20, CD25, CD3, CD52, IgEIL-12 / IL-23, IL-17a, IL-1β, IL-4Rα, IL-5, IL-6R, integrin-α4β7, RANKL, TNFα, VEGF-A, and VLA-4. [Invention 1019] The aforementioned disease, disorder, or condition is a viral infection, such as Helicobacter pylori. Pylori infection, HTLV, organ rejection, graft-versus-host disease, autoimmune thyroid disease, multiple sclerosis, allergy, asthma, neurodegenerative diseases including Alzheimer's disease, systemic lupus erythematosus (SLE), autoinflammatory diseases, inflammatory bowel disease (IBD), Crohn's disease, diabetes, chondritis, arthritis, rheumatoid arthritis, juvenile arthritis, juvenile rheumatoid arthritis, juvenile rheumatoid arthritis, polyarticular juvenile rheumatoid arthritis, systemic juvenile rheumatoid arthritis, juvenile ankylosing spondylitis, juvenile enteroarthritis, juvenile reactive arthritis, juvenile Reiter's syndrome, SEA syndrome, juvenile dermatomyositis, juvenile psoriatic arthritis, juvenile scleroderma, juvenile systemic lupus erythematosus, juvenile vasculitis, oligoarticular rheumatoid arthritis, polyarticular rheumatoid arthritis, all Symptomatic rheumatoid arthritis, ankylosing spondylitis, enteritis arthritis, reactive arthritis, Reiter's syndrome, SEA syndrome, psoriasis, psoriatic arthritis, dermatitis (eczema), exfoliative dermatitis or atopic dermatitis, pityriasis rubra pilaris, pityriasis rosea, parapsoriasis, lichenoid pityriasis, lichen planus, lichen patella, ichthyosis-like skin diseases, keratosis, skin diseases, alopecia areata, pyoderma gangrenosum, vitiligo, phenothyroidism Any method of the present invention 1016 to 1018, selected from smallpox, urticaria, porokeratosis, rheumatoid arthritis; seborrheic dermatitis, photodermatitis; seborrheic keratosis, senile keratosis, actinic keratosis, actinic keratosis, follicular keratosis; acne vulgaris; keloids; nevi; warts, warts including condyloma or genital warts, and human papillomavirus (HPV) infection. [Brief explanation of the drawing]
[0033] This invention is best understood when the following detailed description is read in conjunction with the accompanying drawings. It is emphasized, as is customary, that various features in the drawings are not proportional to their actual size. Conversely, the dimensions of various features have been enlarged or reduced at the discretion of the author for clarity. The drawings include the following figures:
[0034] [Figure 1] This provides a graphical representation of pSTAT5 levels measured in NKL cells treated with 293T transfection supernatant containing the indicated IL2 mutein (and control) as described in the Examples. The vertical axis represents the level of IL2 activity measured according to the Examples, and each bar indicates the activity level of a specific IL2 peptide evaluated in relation to the construct identified by the three-letter abbreviation described in the Examples. [Figure 2] This provides a comparison of pSTAT5 activity in CD25-positive and CD25-negative YT cells treated with 293T transfection supernatant containing the indicated IL2 mutein (and control) as described in the Examples. The vertical axis is a measure of selectivity calculated as the ratio of the level of pSTAT5 activity observed on CD25-positive YT cells to the level of pSTAT5 activity measured on CD25-negative YT cells, and each bar represents the activity level of the specific IL2 peptide evaluated, identified by the three-letter abbreviation described in the Examples. [Figure 3A] Figures 3A-3F provide data on cell proliferation of 3F8 cells in contact with hIL2 mutein, as fully described in the specification and Example 8. [Figure 3B] Refer to the explanation in Figure 3A. [Figure 3C] Refer to the explanation in Figure 3A. [Figure 3D] Refer to the explanation in Figure 3A. [Figure 3E] Refer to the explanation in Figure 3A. [Figure 3F] Refer to the explanation in Figure 3A. [Modes for carrying out the invention]
[0035] Detailed explanation To facilitate understanding of this disclosure, certain terms and phrases are defined not only below but throughout this specification. The definitions provided herein are not limiting and should be read with consideration to the knowledge that a person skilled in the art would possess.
[0036] Before describing the methods and compositions described herein, it should be understood that the present invention is not limited to the specific methods or compositions described and can, of course, vary. It should also be understood that the terminology used herein is intended to describe only specific embodiments and is not intended to limit them.
[0037] Where a range of values is provided, unless the context explicitly indicates otherwise, it is understood that each intermediate value between the upper and lower limits of this range, up to one-tenth of the lower limit, is also specifically disclosed. Any smaller range between any indicated value or intermediate value within the indicated range and any other indicated value or intermediate value within the indicated range is each included in the present invention. The upper and lower limits of these smaller ranges may independently be included in or excluded from the smaller range, and if there are any limits that are specifically excluded in the indicated range, each range in which one or both of these limits are included in the smaller range, or in which neither is included, is also included in the present invention. If the indicated range includes one or both of these limits, the range that excludes one or both of the limits that they include is also included in the present invention.
[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present invention pertains. Any methods and substances similar to or equivalent to those described herein may be used in carrying out or testing the present invention, but several potentially preferred methods and substances are described herein. All publications referenced herein are incorporated herein by reference to disclose and describe the methods and / or substances to which the publications are cited in connection therewith.
[0039] It should be noted that, as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context otherwise explicitly indicates otherwise. For example, a reference to “cell” includes multiple such cells, and a reference to “peptide” includes one or more peptides and their equivalents, such as polypeptides known to those skilled in the art.
[0040] The publications discussed herein are provided only if their disclosures precede the filing date of this application. Nothing contained herein should be construed as acknowledging that the present invention is not granted prior rights to such publications by prior art. Furthermore, the publication dates presented may differ from the actual publication dates, which may need to be verified separately.
[0041] Unless otherwise specified, parts are parts by weight, molecular weight is weight-average molecular weight, temperature is degrees Celsius (°C), and pressure is atmospheric pressure or near atmospheric pressure. Standard abbreviations are used, including: bp = base pair; kb = kilobase; pl = picoliters; s or sec = seconds; min = minutes; h or hr = hours; AA or aa = amino acids; kb = kilobases; nt = nucleotides; pg = picograms; ng = nanograms; μg = micrograms; mg = milligrams; g = grams; kg = kilograms; dl or dL = deciliters; μl or μL = microliters; ml or mL = milliliters; l or L = liters; μM = micromolar concentration; mM = Millimole concentration; M = molar concentration; kDa = kilodalton; im = intramuscular; ip = intraperitoneal; SC or SQ = subcutaneous; QD = once daily; BID = twice daily; QW = once weekly; QM = once monthly; HPLC = high-performance liquid chromatography; BW = body weight; U = unit; ns = not statistically significant; PBS = phosphate-buffered saline; PCR = polymerase chain reaction; HSA = human serum albumin; MSA = mouse serum albumin; DMEM = Dulbecco's modified Eagle medium; EDTA = ethylenediaminetetraacetic acid.
[0042] Throughout this disclosure, amino acids will be referred to according to either a one-letter code or a three-letter code. For the convenience of the reader, one-letter and three-letter amino acid codes are provided in Table 1 below:
[0043] (Table 1) Abbreviations for amino acids TIFF0007875121000003.tif160128
[0044] Standard methods in molecular biology are described in the scientific literature (see, for example, Sambrook and Russell (2001) Molecular Cloning, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and Ausubel, et al. (2001) Current Protocols in Molecular Biology, Vols. 1-4, John Wiley and Sons, Inc. New York, NY, which describes cloning and DNA mutagenesis in bacterial cells (Vol. 1), cloning in mammalian cells and yeast (Vol. 2), expression of complex carbohydrates and proteins (Vol. 3), and bioinformatics (Vol. 4)). This scientific literature describes not only methods for protein purification, including immunoprecipitation, chromatography, electrophoresis, centrifugation, and crystallization, but also chemical analysis, chemical modification, post-translational modification, fusion protein production, and protein glycosylation (see, for example, Coligan, et al. (2000) Current Protocols in Protein Science, Vols. 1-2, John Wiley and Sons, Inc., NY).
[0045] Unless otherwise specified, the following terms are intended to have the meanings set forth below. Other terms are defined separately throughout this specification.
[0046] Definition: Activate As used herein, the term “activates” is used to refer to a receptor or receptor complex and to reflect the biological effect of binding an agonist ligand to a receptor. An activator is a molecule that increases, activates, promotes, enhances, sensitizes, or upregulates, for example, a gene, protein, ligand, receptor, or cell. For example, the binding of an IL2 agonist to an IL2 receptor (e.g., the high-affinity CD25 / CD122 / CD132 receptor complex) “activates” receptor signaling to produce one or more intracellular biological effects (e.g., phosphorylation of STAT5).
[0047] Activation As used herein, the term “activity” is used to describe the properties of a molecule with respect to a test system or biological function (e.g., the degree to which the molecule binds to another molecule). Examples of such biological functions include, but are not limited to, the catalytic activity of a biological agent, its ability to stimulate intracellular signaling, gene expression, cell proliferation, and its ability to modulate immune activity such as inflammatory responses. “Activity” is typically expressed as the biological activity per unit of administered agent, e.g., [catalytic activity] / [mg protein], [immune activity] / [mg protein], international units (IU) of activity, [STAT5 phosphorylation] / [mg protein], [T cell proliferation] / [mg protein], plaque-forming units (pfu), etc.
[0048] Administer / AdministerThe terms “administer” and “administer” are used interchangeably herein to refer to the act of contacting a subject, including bringing cells, tissues, organs, or biological fluids of the subject into contact with the active substance (e.g., IL-2 mutein or its pharmaceutical formulations) in vitro, in vivo, and / or ex vivo. The administration of the active substance may be achieved by any of the various methods approved in the art, including, but not limited to, topical application, intravascular injection (including intravenous or intra-arterial infusion), intradermal injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, intracranial injection, intratumoral injection, intralymph node injection, percutaneous, transmucosal, iontophoretic delivery, intralymphatic injection (Senti and Kundig (2009) Current Opinions in Allergy and Clinical Immunology 9(6):537-543), intragastric infusion, intraprostatic injection, intravesical infusion (e.g., bladder), inhaler including nebulizer, intraocular injection, intraabdominal injection, intrafocal injection, intraovarian injection, intracerebral infusion or injection, intraventricular injection (ICVI), etc. The term “administration” includes contact between the active substance and cells, tissues or organs, as well as contact between the active substance and fluids in contact with cells. The term “administration” includes ex vivo contact of cells (or cell populations) isolated from a subject and that may come into contact with an active substance, wherein such cells (or cell populations) are administered to the same subject (e.g., autologous cell transfer) or a different subject (e.g., allogeneic cell transfer).
[0049] Adverse events As used herein, the term “adverse event” refers to any undesirable experience associated with the use of a therapeutic or prophylactic agent in a subject. Adverse events do not necessarily have to be caused by the administration of a therapeutic or prophylactic agent (e.g., IL-2 mutein) and may arise from unrelated circumstances. Adverse events are typically classified as mild, moderate, or severe. As used herein, the classification of adverse events as used herein follows the Common Terminology Criteria for Adverse Events v5.0 (CTCAE), published November 27, 2017, by the U.S. Department of Health and Human Services, the National Institutes of Health, and the National Cancer Institute.
[0050] affinity As used herein, the term "affinity" refers to the degree of specific binding of a first molecule (e.g., ligand) to a second molecule (e.g., receptor), and the dissociation constant (K) between the molecule and its target. off ) and the association constant (K) between the molecule and its target. on K is the ratio of ) d It is measured by the binding dynamics expressed as follows:
[0051] AgonistAs used herein, the term “agonist” refers to an active substance that specifically binds to a second molecule (the “target”) and interacts with the target to cause or promote the enhancement of its activation. An agonist is an activator that modulates, enhances, sensitizes a cell to activation by the second active substance, or upregulates, for example, a biological pathway including genes, proteins, ligands, receptors, immune checkpoint pathways in cells, or cell proliferation. In some embodiments, an agonist is an active substance that binds to a receptor, alters the state of the receptor, and brings about a biological response. This response mimics the effect of the receptor’s endogenous activator. The term “agonist” includes partial agonists, full agonists, and superagonists. An agonist may be described as a “full agonist” or a partial agonist if the agonist brings about a full response induced by the receptor under study (i.e., a response associated with the innate ligand / receptor binding interaction). In contrast to agonists, antagonists can bind specifically to receptors but typically do not result in a signal cascade initiated by the receptor, and can modify the action of an agonist at that receptor. Inverse agonists are agents that produce a pharmacological response opposite to that of an agonist. A "superagonist" is a type of agonist capable of producing a greater maximal response to a target receptor than an endogenous agonist, and therefore has greater than 100% efficacy. The IL-2 superagonists of this disclosure may have activity greater than 110%, alternatively greater than 120%, alternatively greater than 130%, alternatively greater than 140%, alternatively greater than 150%, alternatively greater than 160%, or alternatively greater than 170% of the activity of WHO international standard (NIBSC code: 86 / 500) wild-type mature human IL-2 when evaluated at similar concentrations in equivalent assays.
[0052] AntagonistAs used herein, the terms “antagonist” or “inhibitor” refer to molecules that counteract the action of an agonist. Antagonists prevent, reduce, inhibit, or neutralize the activity of an agonist, and antagonists can also prevent, inhibit, or reduce the constitutive activity of a target, such as a target receptor, even in the absence of a specific agonist. Inhibitors are molecules that reduce, block, prevent, delay the activation of, inactivate, desensitize, or downregulate, for example, a gene, protein, ligand, receptor, biological pathway, or cell.
[0053] antibody As used herein, the term “antibody” collectively means: (a) glycosylated and nonglycosylated immunoglobulins (including, but not limited to, mammalian immunoglobulin classes IgG1, IgG2, IgG3, and IgG4) that specifically bind to a target molecule, and (b) IgG(1-4) delta C2 that competes for binding to the target molecule with the immunoglobulin from which it originates. H 2, F(ab')2, Fab, ScFv, V H , V LThe term refers to immunoglobulin derivatives, including but not limited to tetrabodies, triabodies, diabodies, dsFv, F(ab')3, scFv-Fc, and (scFv)2. The term antibody is not limited to immunoglobulins derived from any specific mammalian species, but includes mouse, human, horse, camelid, antibody, and human antibody. The term antibody typically includes so-called “heavy chain antibodies” or “VHH” or “Nanobodies®” such as those obtained from immunization of camelids (including camels, llamas, and alpacas) (see, e.g., Hamers-Casterman, et al. (1993) Nature 363:446–448). Antibodies with a given specificity may also originate from non-mammalian sources, such as VHHs obtained from immunization of cartilaginous fish, including but not limited to sharks. The term “antibody” encompasses not only antibodies that can be isolated from naturally occurring sources or from animals after immunization with antigens, but also engineered antibodies, including monoclonal antibodies, bispecific antibodies, trispecific antibodies, chimeric antibodies, humanized antibodies, human antibodies, CDR-transplanted, veneered, or deimmunized antibodies (e.g., for removing T cell epitopes). The term “human antibody” encompasses not only antibodies obtained from humans, but also antibodies obtained from transgenic mammals containing human immunoglobulin genes, such that when stimulated with an antigen, the transgenic animal produces antibodies that have the amino acid sequence characteristics of antibodies produced by humans. The term “antibody” encompasses both parental antibodies and their derivatives, e.g., affinity-matured, veneered, CDR-transplanted (including CDR-transplanted VHH), humanized, camelidized (in the case of non-camel-derived VHH), or binding molecules containing the antibody binding domain (e.g., CDR) in a non-immunoglobulin scaffold.The term “antibody” is not limited to any specific synthetic means, and includes not only naturally occurring antibodies that can be isolated from natural sources, but also antibodies isolated from transgenic animals that are transgenic with respect to human immunoglobulin genes or hybridomas prepared therefrom, antibodies isolated from host cells transformed with nucleic acid constructs resulting in antibody expression, antibodies isolated from combinatorial antibody libraries including phage display libraries, manipulated antibody molecules prepared by “recombination” means, or chemically synthesized (e.g., solid-phase protein synthesis). In one embodiment, “antibody” is a mammalian immunoglobulin. In some embodiments, an antibody is a “full-length antibody” that includes a variable domain and a constant domain that provide binding and effector functions. In most cases, a full-length antibody consists of two light chains and two heavy chains, each light chain containing a variable region and a constant region. In some embodiments, the term “full-length antibody” is used to refer to a conventional IgG immunoglobulin structure consisting of two light chains and two heavy chains, each light chain containing a variable region and a constant region that provide binding and effector functions. The term antibody includes antibody conjugates, which involve modifications to extend the duration of action, such as conjugation (e.g., PEGylation) with fusion proteins or polymers, as described in more detail below.
[0054] Biological samplesAs used herein, the terms “biological sample” or “sample” refer to a sample obtained from or derived from a subject. For example, a biological sample includes materials selected from the group consisting of body fluids, blood, whole blood, plasma, serum, mucus secretions, saliva, cerebrospinal fluid (CSF), bronchoalveolar lavage fluid (BALF), fluid of the eye (e.g., vitreous fluid, aqueous humor), lymph, lymph node tissue, spleen tissue, bone marrow, and immunoglobulin-enriched fractions derived from one or more of these tissues. In some embodiments, a sample is obtained from a subject that has undergone a therapeutic treatment regimen including a pharmaceutical formulation of IL2 mutein, such as repeated exposure to the same IL2 mutein. In other embodiments, a sample is obtained from a subject that has not recently been exposed to IL2 mutein, or from a subject prior to planned administration of IL2 mutein.
[0055] "CAR" or "Chimera Antigen Receptor"As used herein, the terms “chimeric antigen receptor” and “CAR” are used interchangeably to refer to a chimeric polypeptide comprising multiple functional domains arranged in an amino-terminal to carboxyl-terminal sequence: (a) an extracellular domain (ECD) containing an antigen-binding domain (ABD) and a “hinge” domain; (b) a transmembrane domain (TD); and (c) one or more cytoplasmic signaling domains (CSD), where the aforementioned domains may optionally be linked by one or more spacer domains. The CAR may also further comprise a signal peptide sequence, which is conventionally removed during posttranslational processing of the CAR and presentation of the CAR on the cell surface of cells transformed with an expression vector containing the nucleic acid sequence encoding the CAR. CARs can be prepared according to principles well known in the art. For example, Eshhar et al. (USA No. 7,741,465 B1, published June 22, 2010); Sadelain, et al. (2013) Cancer Discovery 3(4):388-398; Campana and Imai (USA No. 8,399,645, published March 19, 2013), Jensen and Riddell (2015) Current Opinions in Immunology 33:9-15; Gross, et al. (1989) PNAS(USA) 86(24): 10024-10028; Curran, et al. (2012) J Gene Med 14(6):405-15; Brogdon et al. (USA No. 10,174,095, published January 8, 2019), Guedan, et al. (2019) Engineering and Design of Chimeric Antigen See Receptors (2019) Molecular Therapy: Methods & Clinical Development Vol. 12: 145-156.
[0056] CAR-T cellsAs used herein, the terms “chimeric antigen receptor T cells” and “CAR-T cells” are used interchangeably to refer to T cells that have been recombinantly modified to express chimeric antigen receptors. Examples of commercially available CAR-T cell products include axicaptagen silolucel (marketed by Gilead Pharmaceuticals as Yescarta®) and tisagenlecleucel (marketed by Novartis as Kymriah®).
[0057] CD25 As used herein, the terms “CD25,” “IL2 receptor alpha,” “IL-2Rα,” “IL2Ra,” and “p55” refer to a 55 kD polypeptide constitutively expressed in Treg cells and are interchangeable with 55 kD polypeptides inductively expressed on other T cells in response to activation (e.g., by CD3). CD25 is also referred to in the literature as a “low affinity” IL-2 receptor. The nucleic acid and protein sequences of human CD25 can be found as GenBank accession numbers NM_000417 and NP_0004Q8, respectively. Human CD25 is expressed as a 272-amino acid preprotein containing a 21-amino acid signal sequence, which is post-translationally removed to form a 251-amino acid mature protein. Amino acids 22–240 (amino acids 1–219 of the mature protein) correspond to the extracellular domain. Amino acids 241–259 (amino acids 220–238 of the mature protein) correspond to the transmembrane domain. Amino acids 260-272 (compared to amino acids 239-251 in mature proteins) correspond to the intracellular domain. The amino acid sequence of the mature form of hCD25 is: The filename is TIFF0007875121000004.tif34132.
[0058] CD122As used herein, the terms “CD122,” “interleukin-2 receptor beta,” “IL2Rb,” “IL2Rβ,” “IL15Rβ,” and “p70-75” are used interchangeably to refer to the human CD122 transmembrane protein. Human CD122 (hCD122) is expressed as a 551-amino acid protein, the first 26 amino acids containing a signal sequence, which is post-translationally cleaved to form a mature 525-amino acid protein. Amino acids 27–240 (amino acids 1–214 in the mature protein) correspond to the extracellular domain, amino acids 241–265 (amino acids 225–239 in the mature protein) correspond to the transmembrane domain, and amino acids 266–551 (amino acids 240–525 in the mature protein) correspond to the intracellular domain. As used herein, the term CD122 includes native variants of the CD122 protein, including S57F and D365E (when numbered according to the mature hCD122 protein). hCD122 is referenced as entry P14784 in the UniProtKB database. The nucleic acid sequence and protein sequence of human CD122 can be found as GenBank accession numbers NM_000878 and NP_000869, respectively. The amino acid sequence of the mature hCD122 protein is: The amino acid sequence of the extracellular domain of hCD122 is: The filename is TIFF0007875121000006.tif30132.
[0059] CD132As used herein, the terms “CD132,” “IL2 receptor gamma,” “IL2Rg,” and “IL2Rγ” refer to the type 1 cytokine receptor and the “common” gamma chain, which is shared by the receptor complex for IL-4, IL-7, IL-9, IL-15, and IL-21. Human CD132 (hCD132) is expressed as a 369-amino acid preprotein containing a 22-amino acid N-terminal signal sequence. Amino acids 23–262 (amino acids 1–240 of the mature protein) correspond to the extracellular domain, amino acids 263–283 (amino acids 241–262 of the mature protein) correspond to a 21-amino acid transmembrane domain, and amino acids 284–369 (amino acids 262–347 of the mature protein) correspond to the intracellular domain. hCD132 is referenced as entry P31785 in the UniProtKB database. The nucleic acid sequence and protein sequence of human CD132 can be found as GenBank accession numbers: NM_000206 and NP_000197, respectively. The amino acid sequence of the mature hCD132 protein is: The filename is TIFF0007875121000007.tif52132.
[0060] CDRAs used herein, the term “CDR” or “complementarity-determining region” is intended to mean a discontinuous antigen-binding site (combining site) found within the variable region of both heavy-chain immunoglobulin polypeptides and light-chain immunoglobulin polypeptides (or the heavy chain in the case of VHH). CDRs are described by Kabat, et al. (1977) J. Biol. Chem. 252:6609-6616; Kabat, et al. (1991) US Dept, of Health and Human Services, “Sequences of proteins of immunological interest” (also referred to herein as “Kabat 1991”); Chothia et al. (1987) J. Mol Biol. 196:901-917; and MacCallum et al., J. Mol. Biol. 262:732-745 (1996), where these definitions include overlaps or subsets of amino acid residues when compared to one another. In connection with this disclosure, the numbering of CDR locations is provided in accordance with Kabat's numbering conventions.
[0061] equivalentAs used herein, the term “equivalent” is used to describe the degree of difference between two measurements of an evaluable quantitative or qualitative parameter. For example, two measurements would be considered “equivalent” if the difference between a first measurement of an evaluable quantitative parameter (e.g., CTLL-2 proliferation or IL-2 activity level as determined by a phospho-STAT5 assay) and a second measurement of the evaluable parameter does not exceed a range that a person skilled in the art would recognize as not actually producing a statistically significant difference between the two results in that context. In some cases, measurements may be considered “equivalent” if the difference between one measurement and another is less than 30%, alternatively less than 25%, alternatively less than 20%, alternatively less than 15%, alternatively less than 10%, alternatively less than 7%, alternatively less than 5%, alternatively less than 4%, alternatively less than 3%, alternatively less than 2%, or alternatively less than 1%. In certain embodiments, a measurement is equivalent to a reference standard if the difference between a measurement and a reference standard is less than 15%, alternatively less than 10%, or alternatively less than 5%.
[0062] originating from As used herein, the term “derived” means, in the context of an amino acid sequence or polynucleotide sequence (e.g., an amino acid sequence “derived” from an IL-2 polypeptide), that a polypeptide or nucleic acid has a sequence based on the sequence of a reference polypeptide or nucleic acid (e.g., a natural IL-2 polypeptide or an IL-2 coding nucleic acid), and is not intended to be limited to the origin or method by which the protein or nucleic acid is made. For example, the term “derived” includes homologs or variants of a reference amino acid sequence or DNA sequence.
[0063] ConcentratedAs used herein, the term “concentrated” means that the molecule of interest is present at a higher concentration than (a) the concentration of the molecule in the starting sample, e.g., a biological sample (e.g., a sample in which the molecule naturally exists or in which the molecule exists after administration) (e.g., at least 3 times higher, alternatively at least 5 times higher, alternatively at least 10 times higher, alternatively at least 50 times higher, alternatively at least 100 times higher, alternatively at least 1000 times higher); or (b) the sample has been unnaturally manipulated to be present at a higher concentration than the environment in which the molecule was created (e.g., in recombinant bacteria or mammalian cells).
[0064] Extracellular domain As used herein, the term “extracellular domain” or its abbreviation “ECD” refers to the portion of a cell surface protein (e.g., cell surface receptor) that is outside the cell's plasma membrane. The term “ECD” may include the extracellular portion of a transmembrane protein or the extracellular portion of a cell surface (or membrane-related protein).
[0065] identityAs used herein with reference to polypeptide sequences or DNA sequences, the term “identity” refers to subunit sequence identity between two molecules. These molecules are identical at a subunit position if that subunit position in both molecules is occupied by the same monomeric subunit (i.e., the same amino acid residue or nucleotide). The similarity between two amino acid or nucleotide sequences is a direct function of the number of identical positions. Generally, these sequences are aligned to obtain the highest level of match. If necessary, identity can be calculated using published techniques and widely available computer programs, such as the GCS program package (Devereux et al., Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, and FASTA (Atschul et al., J. Molecular Biol. 215:403, 1990). Sequence identity can be measured using sequence analysis software, such as the sequence analysis software package from the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705), with its default parameters.
[0066] IL-2 As used herein, the terms “interleukin-2” or “IL-2” refer to the natural IL-2 polypeptide possessing IL-2 activity. In some embodiments, IL-2 refers to mature wild-type human IL-2. Mature wild-type human IL-2 (hIL2) exists as a mature polypeptide of 133 amino acids (smaller only by a signal peptide consisting of an additional 20 N-terminal amino acids), as described in Fujita, et. al, PNAS USA, 80, 7437-7441 (1983). The amino acid sequence of the natural variant of mature wild-type human IL-2 (hIL2) is: The filename is TIFF0007875121000008.tif28128. The numbering of the residues of hIL2 mutein used herein is based on the hIL2 sequence UniProt ID P60568, which excludes the signal peptide that is the same as the sequence of SEQ ID NO:5.
[0067] IL2 activity The term "IL2 activity" refers to one or more biological effects on cells in response to contact with an effective amount of IL2 polypeptide. IL2 activity can be measured, for example, in a cell proliferation assay using CTLL-2 mouse cytotoxic T cells, substantially according to the instructions in Gearing, AJH and CB Bird (1987) in Lymphokines and Interferons, A Practical Approach. Clemens, MJ et al. (eds): IRL Press. 295. The specific activity of recombinant human IL-2 (rhIL2) is approximately 2.1 × 10⁻⁶. 4 The concentration is IU / μg, which is calibrated against the WHO international standard for recombinant human IL-2 (NIBSC code: 86 / 500). IL-2 activity can be expressed as the STAT5 phosphorylation level, which can be determined by flow cytometry methods known in the art (Bitar, et al (2019) Evaluating STAT5 Phosphorylation As A Mean to Assess T Cell Proliferation (2019) Frontiers In Immunology Volume 10, Article 722, pages 1-11).
[0068] IL-2 MuteinAs used herein, the term “IL-2 mutein” refers to muteins derived from the natural form of IL-2, including modifications to the amino acid sequence of the IL-2 molecule. IL-2 muteins are characterized by amino acid insertions, deletions, substitutions, and modifications at one or more sites or other residues of the natural parent IL-2 polypeptide chain. In some embodiments, the IL-2 muteins of the present invention retain CD122 binding activity equivalent to that of wild-type mature human IL-2 according to the WHO international standard (NIBSC code: 86 / 500) when evaluated at similar concentrations in equivalent assays. Exemplary muteins may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino acid substitutions.
[0069] In a quantity sufficient to cause change As used herein, the phrase “in an amount sufficient to cause a change” refers to an amount of test substance that, in response to administration of a certain amount of the test substance, produces a detectable difference between the level of an indicator, such as a biological function assessed by a cell-based assay, measured before (e.g., baseline level) and measured after application of the test substance to the system. “An amount sufficient to cause a change” may be sufficient to be a therapeutically effective dose, but “an amount sufficient to cause a change” may be greater than or less than a therapeutically effective dose.
[0070] Treatment is needed As used herein, the term “requiring treatment” refers to a judgment made by a physician or other caregiver regarding a subject that the subject requires treatment or would potentially benefit from treatment. This judgment is based on a variety of factors within the scope of the physician's or caregiver's professional knowledge.
[0071] Preventive measures are necessary As used herein, the term “requiring prevention” refers to a judgment made by a physician or other caregiver regarding a subject that the subject requires or would potentially benefit from preventive care. This judgment is based on a variety of factors within the scope of the physician's or caregiver's professional knowledge.
[0072] inhibitors As used herein, the term “inhibitor” refers to a molecule that reduces, blocks, prevents, delays, inactivates, desensitizes, or downregulates, for example, a gene, protein, ligand, receptor, or cell. An inhibitor may also be defined as a molecule that reduces, blocks, or inactivates the constitutive activity of a cell or organism.
[0073] Isolated As used herein, the term “isolated” refers to a polypeptide of interest that, if naturally occurring, is in an environment different from the environment in which it could naturally exist. “Isolated” means that the polypeptide of interest is substantially concentrated and / or is contained within a sample in which the polypeptide of interest is partially or substantially purified. If the polypeptide is non-natural, “isolated” indicates that the polypeptide has been separated from the environment in which it was produced, either by synthetic or recombinant means.
[0074] Kabat numbering As used herein, the term “Kabat numbering” is a recognized term in the field of antibody manipulation to refer to a numbering system for amino acid residues that are more variable than other amino acid residues (e.g., hypervariable residues) within the heavy and light chain regions of immunoglobulins (Kabat, el al., (1971) Ann. NY Acad. Sci 190:382-93; Kabat, et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, NIH Publication No. 91-3242). For the purposes of this disclosure, the positioning of CDRs within the variable region of antibodies disclosed herein follows Kabat numbering or simply “Kabat”.
[0075] Ligand As used herein, the term “ligand” refers to a molecule that exhibits specific binding affinity to a receptor and causes a change in the biological activity of the receptor to which it binds, thereby altering the activity of the receptor. In one embodiment, the term “ligand” refers to a molecule or complex thereof that can act as an agonist or antagonist of a receptor. As used herein, the term “ligand” encompasses both natural and synthetic ligands. “Ligands” also encompass small molecules, such as peptide mimetic molecules of cytokines and peptide mimetic molecules of antibodies. A ligand-receptor complex is named a “ligand-receptor complex.”
[0076] Modified IL-2 MuteinAs used herein, the term “modified IL-2 mutein” is used to refer to IL-2 mutein comprising one or more additional further modifications (i.e., modifications outside the core amino acid sequence of IL-2 mutein), such as PEGylation, glycosylation (N-linked and O-linked), acylation, or polysialylation, or IL-2 mutein by conjugation (as chemical conjugation or fusion protein) with other polypeptide carrier molecules, including but not limited to albumin fusion polypeptides and Fc-fusion proteins comprising serum albumin (e.g., human serum albumin (HSA) or bovine serum albumin (BSA)), or IL-2 mutein having a targeting moiety such as IgG, including IL-2 orthogonal polypeptide fusion proteins, targeted IL-2 mutein polypeptides, such as ScFv-IL-2 mutein polypeptide fusion protein and VHH-IL-2 mutein polypeptide fusion protein. Modified IL-2 muteins may be prepared to enhance one or more properties, for example, by modulating immunogenicity; by increasing water solubility, bioavailability, serum half-life, and / or therapeutic half-life; and / or by modulating biological activity. Certain modifications may also be useful, for example, for producing antibodies for use in detection assays (e.g., epitope tagging) and for providing ease of protein purification. In some embodiments, a modified IL-2 mutein is at least 95, 96, 97, 98, or 99% identical to SEQ ID NO: 5 and has one of three combinations of modifications relative to SEQ ID NO: 5 as shown in Table 2. Suitable algorithms for determining sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms described in Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and Altschul et al. (1977) Nucleic Acids Res. 25: 3389-3402, respectively.Software for performing BLAST analysis is publicly available through the website of the National Center for Biotechnology Information (NCBI). This algorithm first identifies high-scoring sequence pairs (HSPs) by identifying short words of length W within the query sequence that match when aligned with words of the same length in the database sequence or satisfy a certain positive threshold score T. T is referred to as the adjacent word score threshold (Altschul et al., hereafter). These initial adjacent word hits act as seeds to initiate a search for longer HSPs containing them. Word hits are then extended in both directions for each sequence as long as the sum of the alignment scores increases. For nucleotide sequences, the sum of scores is calculated using parameters M (reward score for matching residue pairs; always > 0) and N (penalty score for mismatched residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the sum of scores. Word hit extension in each direction stops when the sum of the alignment scores decreases by X from its maximum achieved value; when the sum of the scores becomes zero or less due to the accumulation of alignments of one or more negative-scoring residues; or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of alignment. The BLASTN program (for nucleotide sequences) uses a word size (W) of 28, an expected value (E) of 10, M=1, N=-2, and comparison of both strands as defaults. For amino acid sequences, the BLASTP program uses a word size (W) of 3, an expected value (E) of 10, and the BLOSUM62 scoring matrix as defaults (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).
[0077] ModulateAs used herein, terms such as “modulate” and “modulation” refer to the ability of a test substance to positively or negatively, directly or indirectly, influence a response in a system, including a biological system or a biochemical pathway.
[0078] Mutain As used herein, the term “mutein” is used to refer to a modified version of a wild-type polypeptide, including modifications to the primary structure (i.e., amino acid sequence) of such polypeptide. The term mutein may also refer to the polypeptide itself, a composition containing the polypeptide, or the nucleic acid sequence encoding it. In some embodiments, a mutein polypeptide may include about 1 to about 10 amino acid modifications compared to the parent polypeptide, alternatively about 1 to about 5 amino acid modifications compared to the parent, alternatively about 1 to about 3 amino acid modifications compared to the parent, alternatively 1 to 2 amino acid modifications compared to the parent, or alternatively a single amino acid modification compared to the parent. A mutein may be at least about 99% identical to the parent polypeptide, alternatively at least about 98% identical, alternatively at least about 97% identical, alternatively at least about 95% identical, or alternatively at least about 90% identical.
[0079] N-terminus As used herein in the context of polypeptide structure, “N-terminus” (or “amino-terminus”) and “C-terminus” (or “carboxyl-terminus”) refer to the amino-terminus and carboxyl-terminus of the polypeptide, respectively, while “N-terminal side” and “C-terminal side” refer to the relative positions in the amino acid sequence of the polypeptide in the N-terminal and C-terminal directions, respectively, and may include the N-terminal and C-terminal residues, respectively. “Directly N-terminal side” or “directly C-terminal side” refers to the position of a first amino acid residue relative to a second amino acid residue, where the first and second amino acid residues are covalently bonded to provide a continuous amino acid sequence.
[0080] nucleic acidThe terms “nucleic acid,” “nucleic acid molecule,” and “polynucleotide” are used interchangeably herein to refer to polymeric forms of nucleotides of any length, which are deoxyribonucleotides or ribonucleotides or analogs thereof. Non-exclusive examples of polynucleotides include linear or cyclic nucleic acids, messenger RNA (mRNA), complementary DNA (cDNA), recombinant polynucleotides, vectors, probes, primers, and the like.
[0081] Numbered according to IL-2 As used herein, the term “numbered according to IL-2” refers to the identification of the location of a particular amino acid relative to its usual position in the mature sequence of mature wild-type hIL-2. For example, R81 refers to the 81st amino acid, arginine, located at SEQ ID NO:5.
[0082] Functionally connected The term “functionally linked” is used herein to refer to the relationship between nucleic acid sequences when they are combined to form a single nucleic acid sequence that, when introduced into a cell, provides a nucleic acid capable of inducing the transcription and / or translation of a particular nucleic acid sequence within the cell. For example, if DNA for a signal sequence is expressed as a preprotein involved in the secretion of a polypeptide, the signal sequence is functionally linked to the DNA for that polypeptide; a promoter or enhancer is functionally linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is functionally linked to a coding sequence if it is located to facilitate translation. Generally, “functionally linked” means that the linked DNA sequences are contiguous, and in the case of a secretion leader, contiguous and in the reading phase. However, certain genetic elements, such as enhancers, do not need to be contiguous with respect to the sequence in which they provide their effect.
[0083] Parent polypeptideAs used herein, the terms “parent polypeptide,” “parent protein,” “precursor polypeptide,” or “precursor protein” are used interchangeably to refer to an unmodified polypeptide that has subsequently been modified to produce a variant polypeptide or mutain. The parent polypeptide may be a wild-type (or native) polypeptide.
[0084] Partial agonist As used herein, the term “partial agonist” refers to a molecule that specifically binds to and activates a given receptor, but exhibits only partial activation of the receptor compared to a full agonist. Partial agonists may exhibit both agonist and antagonist effects. For example, in the presence of both a full agonist and a partial agonist, the partial agonist acts as a competitive antagonist by competing with the full agonist for binding to the receptor, resulting in a net reduction in receptor activation compared to contact between the receptor and the full agonist in the absence of the partial agonist. Clinically, partial agonists can be used to activate a receptor in the presence of an insufficient amount of endogenous ligand to produce a desired submaximal response, or they can reduce receptor overstimulation in the presence of an excess amount of endogenous ligand. The maximal response (Emax) produced by a partial agonist is called its endogenous activity and may be expressed on a percentage scale compared to when a full agonist produced a 100% response. The IL-2 partial agonists of this disclosure may have more than 10%, alternatively more than 20%, alternatively more than 30%, alternatively more than 40%, alternatively more than 50%, alternatively more than 60%, or alternatively more than 70% of the activity of WHO international standard (NIBSC code: 86 / 500) wild-type mature human IL-2 when evaluated at similar concentrations in equivalent assays.
[0085] PEG-IL2 MuteinAs used herein, the term “PEG-IL2 mutein” refers to IL2 mutein covalently bonded to at least one polyethylene glycol (PEG) molecule, the at least one PEG molecule covalently bonded to at least one amino acid residue of IL-2 mutein. PEGylated polypeptides may further be referred to as monoPEGylated, diPEGylated, triPEGylated (and others) to represent PEG-IL2 mutein containing one, two, three (or more) PEG moieties bonded to IL-2 mutein, respectively. In some embodiments, PEG may be directly covalently bonded to IL-2 mutein (e.g., via a lysine side chain, a cysteine sulfhydryl group, or an N-terminal amine), or a linker may be employed between PEG and IL-2 mutein. In some embodiments, PEG-IL2 mutein contains multiple PEG molecules, each bonded to a different amino acid residue. In some embodiments, PEG-IL2 mutein is derived from SEQ ID NO:2 (natural hIL2). The PEGylated forms of IL2 and methodologies for PEGylation of IL2 polypeptides are well known in the art (see, for example, Katre et al., U.S. Patent No. 4,931,544, published June 5, 1990; Katre et al., U.S. Patent No. 5,206,344, published April 27, 1993; and Bossard et al., U.S. Patent No. 9,861,705, published January 9, 2018). In some embodiments, IL2 muteins may be modified by incorporating unnatural amino acids having amino acid side chains that do not exist in nature, to facilitate site-directed PEGylation, as described by Ptacin et al., U.S. Patent Application Publication US20170369871A1, published December 28, 2017. In other embodiments, as described in Greve et al., PCT International Patent Application No. PCT / US2015 / 044462, published on February 18, 2016 as WO2016 / 025385, cysteine residues may be incorporated at various positions within the IL2 molecule to promote site-specific PEGylation via cysteine side chains.
[0086] polypeptideAs used herein, the terms “polypeptide,” “peptide,” and “protein” are used interchangeably to refer to polymeric forms of amino acids of any length, including genetically encoded and non-genetically encoded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having a modified polypeptide backbone. These terms include, but are not limited to, fusion proteins having heterologous amino acid sequences; fusion proteins having heterologous and homologous leader sequences; fusion proteins having or not having an N-terminal methionine residue; fusion proteins with immunotagged proteins; and fusion proteins with immunoactive proteins (e.g., antigenic diphtheria toxin fragments or tetanus toxin fragments).
[0087] Prevent As used herein, terms such as “prevent,” “prevent,” and “prevention” generally refer to actions initiated with respect to an object predisposed to a particular disease, disorder, or condition due to genetic, empirical, or environmental factors, in order to temporarily or permanently prevent, suppress, inhibit, or reduce the risk of the object developing the disease, disorder, condition, or other (determined, for example, by the absence of clinical symptoms), or to delay their onset. In specific cases, the terms “prevent,” “prevent,” and “prevention” may also be used to refer to delaying the progression of a disease, disorder, or condition from its current state to a more harmful state.
[0088] receptorAs used herein, the term “receptor” refers to a polypeptide having a ligand-specific binding domain, the binding of which results in a change in at least one biological property of the polypeptide. In some embodiments, the receptor is a “soluble” receptor that is not associated with the cell surface. The soluble form of hCD25 is an example of a soluble receptor that specifically binds to hIL2. In some embodiments, the receptor is a cell surface receptor comprising an extracellular domain (ECD) and a membrane-associated domain that acts to fix the ECD to the cell surface. In some embodiments of cell surface receptors, the receptor is a transmembrane polypeptide comprising an intracellular domain (ICD) and an extracellular domain (ECD) linked by a transmembrane domain typically referred to as a transmembrane domain (TM). The binding of a ligand to a receptor results in a conformational change in the receptor, resulting in a measurable biological effect. In some cases, where the receptor is a transmembrane polypeptide comprising an ECD, TM, and ICD, the binding of the ligand to the ECD results in a measurable intracellular biological effect mediated by one or more domains of the ICD in response to the binding of the ligand to the ECD. In some embodiments, receptors are components of multicomponent complexes that facilitate intracellular signaling. For example, ligands may bind to cell surface molecules that are not associated with any intracellular signaling on their own, but upon binding, ligands promote the formation of heteromultimers, including heterodimeric (e.g., medium-affinity CD122 / CD132 IL2 receptor), heterotrimeric (e.g., high-affinity CD25 / CD122 / CD132 hIL2 receptor), or homomultimeric (e.g., homodimeric, homotrimeric, homotetrameric) complexes that result in activation of intracellular signaling cascades (e.g., the Jak / STAT pathway).
[0089] Recombination As used herein, the term "recombinant" refers to polypeptides produced using recombinant DNA technology. Techniques and protocols for recombinant DNA technology are well known in the art.
[0090] response: As used herein, the term "response" refers to, for example, a cell, tissue, organ, or organism and encompasses biochemical or physiological behaviors such as changes in concentration, density, adhesion, or migration within a biological compartment, gene expression rate, or differentiation state, where the changes are correlated with activation, stimulation, or treatment and / or internal mechanisms such as genetic programming. In certain contexts, terms such as "activation" and "stimulation" refer to the activation of cells not only regulated by internal mechanisms but also by external or environmental factors; while terms such as "inhibition" and "downregulation" refer to the opposite effects.
[0091] Selective : As used herein, the term "selective" is used to refer to the property of an agent to preferentially bind to and / or activate a particular cell type based on a particular property of such a cell population. In some embodiments, the present disclosure provides CD25 - selective muteins in that such muteins exhibit preferential activation of cells expressing CD25 and / or CD25 / CD122 receptors compared to cells expressing the CD132 receptor. Selectivity is typically evaluated by the activity measured as an assay property of the activity induced in response to ligand / receptor binding. In some embodiments, the selective IL2 muteins exhibit significantly reduced binding. In some embodiments, the selectivity is based on the activation of cells expressing CD25 (e.g., YTCD25POS or YT CD25- cells) compared to the activation of cells presenting a significantly lower (preferably undetectable) level of CD25 (e.g., YTCD25NEG or YT CD25+It is measured by the activation of CD25-expressing T cells (e.g., Tregs) compared to T cells expressing low levels of CD25 (e.g., unstimulated CD8+ T cells or CD4+ T cells). In some embodiments, the IL2 mutein of the present disclosure has an EC50 difference of at least 3 times, alternatively at least 5 times, alternatively at least 10 times, alternatively at least 20 times, alternatively at least 30 times, alternatively at least 40 times, alternatively at least 50 times, alternatively at least 100 times, and alternatively at least 200 times on CD25+ cells compared to CD25- cells when measured in the same assay.
[0092] Significantly reduced binding As used herein, the term “significantly reduced binding affinity” is used with respect to the affinity of a modified ligand (e.g., IL2 mutein or modified IL2 mutein) to a receptor, compared to the binding affinity of the native form of the ligand to the corresponding receptor. IL2 mutein exhibits significantly reduced binding affinity if it binds to the receptor of the native form at less than 40%, alternatively less than 30%, alternatively less than 20%, alternatively less than 10%, alternatively less than 5%, alternatively less than 2%, and alternatively less than 1% of the native form.
[0093] Specific bindingAs used herein, the term “specifically binds” refers to the degree of selectivity or affinity one molecule has for binding to another molecule. In relation to binding pairs (e.g., ligand / receptor, antibody / antigen, antibody / ligand, antibody / receptor binding pairs), if the first molecule of a binding pair does not bind in significant amounts to other components present in the sample, then the first molecule of a binding pair is said to bind specifically to the second molecule of the binding pair. The first molecule of a binding pair is said to bind specifically to the second molecule of the binding pair if its affinity for the second molecule is at least twice, alternatively at least five times, alternatively at least ten times, alternatively at least twenty times, or alternatively at least one hundred times greater than the affinity of the first molecule for other components present in the sample. In a specific embodiment where the first molecule of the binding pair is an antibody, for example, the equilibrium dissociation constant between the antibody and the second molecule of the binding pair is approximately 10, as determined by Scatchard analysis (Munsen, et al. 1980 Analyt. Biochem. 107:220-239). 6 Larger than M, alternatively about 10 8 Larger than M, alternatively about 10 10 Larger than M, alternatively about 10 11 Larger than M, alternatively about 10 10 Larger than M, approximately 10 12 If M is greater than the antibody, the antibody specifically binds to the second molecule of the binding pair (e.g., a protein, antigen, ligand, or receptor). In one embodiment, the ligand is IL2 mutein and the receptor is orthogonal CD122 ECD, the equilibrium dissociation constant of IL2 mutein / orthogonal CD122 ECD is approximately 10 5 Larger than M, alternatively about 10 6 Larger than M, alternatively about 10 7 Larger than M, alternatively about 10 8 Larger than M, alternatively about 10 9 Larger than M, alternatively about 10 10 Larger than M, or alternatively about 10 11If M is greater than the value of IL2 mutein, then IL2 mutein specifically binds to it. Specific binding may be evaluated using techniques known in the art, including, but not limited to, competitive ELISA, radioactive ligand binding assays (e.g., saturated binding, scatchard plots, nonlinear curve fitting programs, and competitive binding assays); non-radioactive ligand binding assays (e.g., fluorescence polarization (FP), fluorescence resonance energy transfer (FRET), and surface plasmon resonance assays (e.g., see Drescher et al., Methods Mol Biol 493:323-343 (2009), instrumentation such as Biacore 8+, Biacore S200, and Biacore T200 (GE Healthcare Bio-Sciences, 100 Results Way, Marlborough MA 01752) is commercially available from GE Healthcare Bio-Sciences); liquid-phase ligand binding assays (e.g., real-time polymerase chain reaction (RT-qPCR), and immunoprecipitation); and solid-phase ligand binding assays (e.g., multi-well plate assays, on-bead ligand binding assays, on-column ligand binding assays, and filter assays).
[0094] subject The terms “recipient,” “individual,” “subject,” and “patient” are used interchangeably herein and refer to any mammalian subject, in particular human, for whom diagnosis, treatment, or therapy is desired. “Mammal” for treatment refers to any animal classified as a mammal, including humans, livestock and farm animals, and exhibition animals, competition animals, or pets, such as dogs, horses, cats, cattle, sheep, goats, and pigs. In some embodiments, mammal is human.
[0095] I am sufferingAs used herein, the term “suffering” refers to a determination made by a physician with respect to a subject, based on available information accepted in the art, including but not limited to X-ray, CT scan, conventional clinical diagnostic tests (e.g., blood count), genomic data, protein expression data, and immunohistochemistry, that the subject requires or would benefit from treatment for the identification of a disease, disorder, or condition. Typically used with a specific medical condition, such as “suffering from an inflammatory, infectious, or autoimmune disease, disorder, or condition,” the term “suffering” refers to a subject diagnosed with having an inflammatory, infectious, or autoimmune disease, disorder, or condition.
[0096] In essence pure As used herein, the term “substantially pure” indicates that a component (e.g., polypeptide) constitutes more than about 50% of the total contents of the composition, typically more than about 60% of the total polypeptide content. More typically, “substantially pure” refers to a composition in which at least 75%, at least 85%, at least 90%, or more of the component of interest constitutes the total contents of the composition. In some cases, polypeptides may constitute more than about 90%, or more than about 95%, of the total contents of the composition.
[0097] T cells As used herein, the terms “T-cell” or “T cell” are used in their conventional sense to refer to lymphocytes that differentiate in the thymus, possess specific cell surface antigen receptors, and control the initiation or suppression of cell-mediated and humoral immunity, as well as those that lyse antigen-carrying cells. In some embodiments, T cells include naive CD8 + T cells, cytotoxic CD8 + T cells, naive CD4 + T cells, helper T cells, for example T H 1. T H 2, T H 9, T H 11, T H 22, T FH ;regulatory T cells, e.g. T R1. Tregs, inducible Tregs; memory T cells, including but not limited to central memory T cells, effector memory T cells, NKT cells, tumor-infiltrating lymphocytes (TILs), and CAR-T cells, recombinant modified TILs, and TCR-manipulated cells; and manipulative variants of such T cells.
[0098] Therapeutic effective doseThe term "therapeutic dose" is used herein in reference to the administration of an active substance to a subject, as a single dose that, when administered to the subject, can have any detectable positive effect on any symptom, aspect, or feature of a disease, disorder, or condition, either alone, as part of a series of doses, or as part of a pharmaceutical composition or therapeutic regimen. The therapeutic dose can be determined by measuring the relevant physiological effect, which may be adjusted in accordance with the drug regimen and according to diagnostic analysis, such as the condition of the subject. Parameters for evaluation to determine the therapeutic dose of an active substance are determined by a physician using diagnostic criteria approved in the art, including but not limited to age, weight, sex, overall health status, ECOG score, observable physiological parameters, blood levels, blood pressure, electrocardiogram, computed tomography, radiography, and other indicators. Alternatively or additionally, other parameters typically evaluated in the clinical context, such as body temperature, heart rate, normalization of blood chemistry, normalization of blood pressure, normalization of cholesterol levels, or any symptoms, phases, or characteristics of the disease, disorder, or condition, biomarkers (e.g., inflammatory cytokines, IFN-γ, granzymes, etc.), reduction of serum tumor markers, improvement of criteria for response to solid tumors (RECIST), improvement of immune-related response criteria (irRC), extension of overall survival, extension of progression-free survival, extension of progression-free time, extension of treatment success, extension of event-free survival, extension of time to next treatment, improvement in response rate, improvement in duration of response, reduction of tumor burden, complete response, partial response, condition stabilization, etc., may be monitored to determine whether an effective dose of the active agent was administered to the subject, and these parameters are relied upon by clinicians in the art to assess improvement in the subject's condition in response to administration of the active agent. The terms “complete response (CR),” “partial response (PR),” “stable disease (SD),” and “progression (PD)” used herein in relation to target lesions, as well as the terms “complete response (CR),” “incomplete response / stable disease (SD),” and “progression (PD)” in relation to non-target lesions, are understood to be as defined in the RECIST criteria.As used herein, the terms “irCR” (ir immune-related complete response), “irPR” (ir immune-related partial response), “irPD” (ir immune-related disease progression), and “irSD” (ir immune-related disease stability) are defined according to the Immune-Related Response Criteria (irRC). As used herein, the Immune-Related Response Criteria (irRC) refers to a system for evaluating the response to immunotherapy, as described in Wolchok, et al. (2009) Guidelines for the Evaluation of Immune Therapy Activity in Solid Tumors: Immune-Related Response Criteria, Clinical Cancer Research 15(23): 7412-7420. The effective dose may be adjusted over the course of treatment of the subject in relation to the drug regimen and / or the subject’s condition and changes in the aforementioned factors. In one embodiment, the effective dose is the amount of an active agent, when used alone or in combination with another active agent, that does not cause an irreversible serious adverse event during administration to a mammalian subject.
[0099] transmembrane domainThe term “transmembrane domain” or “TM” refers to a domain of a transmembrane polypeptide (e.g., CD122 or CD132 or CAR) that is embedded within the cell membrane and peptide-bonded to the extracellular domain (ECD) and intracellular domain (ICD) of the transmembrane polypeptide when the transmembrane polypeptide is associated with the cell membrane. The transmembrane domain may be homologous (naturally associated) or heterologous (not naturally associated) with one or both of the extracellular domain and / or intracellular domain. In some embodiments, the transmembrane domain is a transmembrane domain originally associated with the ECD domain of a congener receptor from which the orthogonal receptor derives. In some embodiments, the transmembrane domain is a transmembrane domain originally associated with the ICD domain of a congener receptor from which the orthogonal receptor derives. In some embodiments, the transmembrane domain is a transmembrane domain originally associated with a proliferation signaling domain. In some embodiments, the transmembrane domain is a transmembrane domain originally associated with a different protein. Alternatively, the transmembrane domain of a receptor may be an artificial amino acid sequence that spans the plasma membrane. In some embodiments where the receptor is a chimeric receptor comprising an intracellular domain derived from a first parent receptor and a second extracellular domain derived from a second different parent receptor, the transmembrane domain of the chimeric receptor is the transmembrane domain that is typically associated with either the ICD or ECD of the parent receptor from which the chimeric receptor derives.
[0100] TreatThe terms “to treat,” “to treat,” and “treatment” refer to any action initiated with respect to a subject after a disease, disorder, or condition, or its symptoms, has been diagnosed, observed, or otherwise caused by the disease, disorder, or condition, or at least one of the symptoms associated with the disease, disorder, or condition, either temporarily or permanently, or to eliminate, reduce, suppress, alleviate, or restore such disease, disorder, or condition, or symptoms associated with the disease, disorder, or condition, in the subject. (For example, administering IL-2 mutein or a pharmaceutical composition containing it.) Treatment includes any action taken with respect to a subject suffering from a disease, such action resulting in an inhibition of the disease in the subject (for example, halting the progression of the disease, disorder, or condition, or restoring one or more of the symptoms associated with it).
[0101] Treg cells or regulatory T cells The terms “regulatory T cells” or “Treg cells” as used herein refer to EFFECTIONS. CD4 can suppress the response of other T cells, including but not limited to Teff cells. + This refers to a type of T cell. Treg cells are characterized by the expression of CD4, IL-2 receptor α subunit (CD25), and the transcription factor forkheadbox P3 (FOXP3) (Sakaguchi, Annu Rev Immunol 22, 531-62 (2004)). "Conventional CD4 + CD4 cells other than regulatory T cells are affected by T cells. + This refers to T cells.
[0102] variant The terms “protein variant,” “variant protein,” or “variant polypeptide” are used interchangeably herein to refer to a polypeptide that differs from the parent polypeptide by at least one amino acid modification. The parent polypeptide may be a natural or wild-type (WT) polypeptide, or a modified version of a WT polypeptide (i.e., a mutaine).
[0103] Wild typeIn this specification, "wild-type," "WT," or "natural-type" refers to amino acid or nucleotide sequences found in nature, including allele mutations. Wild-type proteins, polypeptides, antibodies, immunoglobulins, IgG, etc., have amino acid or nucleotide sequences that have not been modified by humans.
[0104] In some embodiments, the IL2 muteins of the present disclosure provide modifications that alter the binding affinity of IL2 muteins to other proteins, particularly CD25, CD122, and CD132, as well as combinations thereof, such as CD122 / CD132 ("medium affinity IL2 receptor"), CD25 ("low affinity IL2 receptor"), and CD25 / CD122 / CD132 ("high affinity IL2 receptor").
[0105] This disclosure provides methods and compositions for treating and / or preventing inflammatory, infectious, or autoimmune diseases, disorders, or conditions by administering a therapeutically effective dose of human IL-2 mutein, which has reduced binding affinity to CD132 but still retains a remarkable binding affinity to CD122 and / or CD25 comparable to that of wild-type human IL-2.
[0106] In some embodiments, IL-2 mutein has reduced binding affinity to the extracellular domain of hCD132 (e.g., <50% of the affinity for wild-type hIL2, alternatively <45% of the affinity for wild-type hIL2, alternatively <40% of the affinity for wild-type IL2, alternatively <35% of the affinity for wild-type hIL2, alternatively <25% of the affinity for wild-type hIL2, alternatively <20% of the affinity for wild-type hIL2, alternatively <15% of the affinity for wild-type IL2, alternatively <10% of the affinity for wild-type IL2, or alternatively <5% of the affinity for wild-type IL2), while having substantial affinity to the extracellular domain of the wild-type human CD122 receptor (e.g., 20% of the affinity for wild-type hIL2, alternatively >30% of the affinity for wild-type hIL2, alternatively >40%, alternatively > It maintains binding affinity of >50% of the affinity of wild-type hIL2, alternatively >60% of the affinity of wild-type hIL2, alternatively >65% of the affinity of wild-type hIL2, alternatively >70% of the affinity of wild-type hIL2, alternatively >75% of the affinity of wild-type hIL2, alternatively >80% of the affinity of wild-type hIL2, alternatively >85% of the affinity of wild-type hIL2, alternatively >90% of the affinity of wild-type IL2, alternatively >90% of the affinity of wild-type IL2, alternatively >95% of the affinity of wild-type IL2, alternatively >100% of the affinity of wild-type IL2, alternatively >105% of the affinity of wild-type hIL2, alternatively >110% of the affinity of wild-type IL2, alternatively >115% of the affinity of wild-type hIL2, alternatively >125% of the affinity of wild-type IL2, or alternatively >150% of the affinity of wild-type hIL2).
[0107] In some embodiments, an IL-2 mutein useful for carrying out the methods of the present disclosure, which has reduced binding affinity to the CD132 receptor, further comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more mutations that improve CD122 binding affinity. In certain embodiments, a target IL-2 mutein useful for carrying out the methods of the present disclosure comprises at least one mutation (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid residue deletions, additions, or substitutions) compared to wild-type IL-2 (e.g., SEQ ID NO: 5), and binds to CD122 with higher affinity than wild-type IL-2. In certain embodiments, IL-2 mutein binds to CD122 with an affinity at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% greater than that of wild-type IL-2. The binding affinity of IL-2 mutein can also be expressed as an affinity 1.2 times, 1.4 times, 1.5 times, 2 times, 5 times, 10 times, 15 times, 20 times, 25 times, 50 times, 100 times, 200 times, 250 times greater than that of wild-type hIL-2 to CD122.
[0108] In some embodiments, IL-2 mutein has reduced binding affinity to the extracellular domain of hCD132 (e.g., <50% of the affinity for wild-type hIL2, alternatively <45%, <40%, <35%, <25%, <20%, <15%, <10%, or <5%) compared to the hCD25 / hCD122 receptor complex, while having substantial affinity to the hCD25 / hCD122 receptor complex (e.g., >50% of the affinity for wild-type hIL2, alternatively <5%) It retains >60% of the affinity of wild-type hIL2, alternatively >65% of the affinity of wild-type hIL2, alternatively >70% of the affinity of wild-type hIL2, alternatively >75% of the affinity of wild-type hIL2, alternatively >80% of the affinity of wild-type hIL2, alternatively >85% of the affinity of wild-type hIL2, alternatively >90% of the affinity of wild-type hIL2, alternatively >90% of the affinity of wild-type hIL2, alternatively >95% of the affinity of wild-type hIL2, alternatively >100% of the affinity of wild-type hIL2, alternatively >105% of the affinity of wild-type hIL2, alternatively >110% of the affinity of wild-type hIL2, alternatively >115% of the affinity of wild-type hIL2, alternatively >125% of the affinity of wild-type hIL2, or alternatively >150% of the affinity of wild-type IL2. In certain embodiments, the IL2 mutaines of the present disclosure have reduced affinity for CD132. In some embodiments, such IL2 mutaines incorporate modifications to the primary structure of wild-type IL2, incorporating one or more modifications at positions 18, 22, and 126, which are numbered according to wild-type hIL-2.
[0109] In some embodiments, IL-2 mutein has reduced binding affinity to CD132, while having substantial affinity to hCD25 (e.g., >50% of the affinity to wild-type hIL2, alternatively >60% of the affinity to wild-type hIL2, alternatively >65% of the affinity to wild-type hIL2, alternatively >70% of the affinity to wild-type hIL2, alternatively >75% of the affinity to wild-type hIL2, alternatively >80% of the affinity to wild-type hIL2, alternatively >85% of the affinity to wild-type hIL2, alternatively >90% of the affinity to wild-type IL2). It maintains binding affinity equivalent to >95% of wild-type hIL2 affinity, >100% of wild-type IL2 affinity, >105% of wild-type hIL2 affinity, >110% of wild-type hIL2 affinity, >115% of wild-type hIL2 affinity, >125% of wild-type hIL2 affinity, >150% of wild-type hIL2 affinity, >200% of wild-type hIL2 affinity, >300% of wild-type IL2 affinity, >400% of wild-type hIL2 affinity, and >500% of wild-type IL2 affinity.
[0110] In one aspect, this disclosure provides an hIL-2 mutein that exhibits significantly or improved binding affinity to hCD25 and decreased binding affinity to the extracellular domain of the hCD132 receptor compared to wild-type human IL-2 (hIL-2).
[0111] In some embodiments, IL-2 mutein comprises one or more amino acid substitutions that reduce the binding affinity to the CD132 receptor, selected from amino acid positions 18, 22, and 126, numbered according to mature wild-type hIL-2.
[0112] In some embodiments, a target IL-2 mutein useful for carrying out the method of the present disclosure, which is a partial agonist, has one or more reduced functions compared to wild-type IL-2.
[0113] In certain embodiments, the IL-2 mutein useful for carrying out the methods of the present disclosure disrupts the association between CD122 and CD132, resulting in a reduction of this CD122 / CD132 interaction by approximately 2%, 5%, 10%, 15%, 20%, 50%, 75%, 90%, 95%, or more compared to wild-type hIL-2. In some embodiments, one or more mutations that reduce the binding affinity of IL-2 mutein to CD132 are amino acid substitutions. In some embodiments, the target hIL-2 mutein consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acid substitutions compared to wild-type IL-2 (SEQ ID NO: 5).
[0114] In certain embodiments, the IL2 mutein useful for carrying out the methods of the present disclosure is an inhibitor of IL-2 and / or IL-15 phosphorylation in CD8+ T cells. In some embodiments, the mutein is an inhibitor of IL-2 and / or IL-15-induced proliferation of CD8+ T cells. In some embodiments, the mutein is an inhibitor of IL-2-dependent TCR-induced cell proliferation.
[0115] In certain embodiments, IL2 muteins useful for carrying out the methods of this disclosure are inhibitors of IL-2-dependent activation of natural killer (NK) cells. IL-2 activation of NK cells can be measured by any suitable method known in the art, for example, by measuring IL-2-induced CD69 expression and / or cytotoxicity as described herein.
[0116] In some aspects of this disclosure, IL-2 mutein is a partial agonist. In certain aspects, the IL-2 mutein useful for carrying out the methods of this disclosure is a partial agonist with reduced ability to stimulate one or more signaling pathways dependent on CD122 / CD132 heterodimerization. In some aspects, the subject IL-2 mutein has reduced ability to stimulate phosphorylation in CD122+ cells compared to wild-type hIL-2. In some aspects, IL-2 mutein stimulates STAT5 phosphorylation in IL-2RP+ cells at levels of 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or less than the levels at which wild-type IL-2 stimulates STAT5 phosphorylation in the same cells. In some embodiments, IL-2Rp+ cells are T cells. In certain embodiments, T cells are CD8+ T cells. In some embodiments, CD8+ T cells are freshly isolated CD8+ T cells. In other embodiments, CD8+ T cells are activated CD8+ T cells. In other embodiments, CD122+ cells are natural killer (NK) cells.
[0117] In some embodiments, the IL-2 mutein useful for carrying out the methods of the present disclosure is a partial agonist with reduced ability to stimulate signaling in CD122+ cells compared to wild-type hIL-2. In some embodiments, the IL-2 mutein stimulates pERK1 / ERK2 signaling in CD122+ cells at levels of 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or less than the levels at which wild-type IL-2 stimulates pERK1 / ERK2 signaling in the same cells. In some embodiments, the CD122+ cells are T cells. In certain embodiments, the CD122+ T cells are CD8+ T cells. In some embodiments, CD122+ CD8+ T cells are CD122+ CD8+ T cells isolated from a subject. In other embodiments, CD8+ T cells are activated CD122+ CD8+ T cells. In other embodiments, CD122+ cells are natural killer (NK) cells. STAT5 and ERK1 / 2 signaling can be measured, for example, by phosphorylation of STAT5 and ERK1 / 2 using any suitable method known in the art. For example, STAT5 and ERK1 / 2 phosphorylation can be measured using antibodies specific to the phosphorylated versions of these molecules.
[0118] In certain embodiments, the mutein useful for carrying out the methods of the present disclosure is a partial agonist with reduced ability to induce lymphocyte proliferation compared to wild-type hIL-2. In some embodiments, the lymphocytes are T cells. In certain embodiments, the lymphocytes are primary CD8+ T cells. In other embodiments, the lymphocytes are activated CD8+ T cells. Cell proliferation can be measured using any suitable method known in the art. For example, lymphocyte proliferation can be measured using the carboxyfluorescein diacetate succinimidyl diester (CFSE) dilution assay described herein, or by [31-1]-thymidine uptake. In some embodiments, the IL-2 mutein of the present disclosure induces lymphocyte proliferation at levels of 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or less than the levels at which wild-type hIL-2 induces lymphocyte proliferation.
[0119] In some embodiments, the IL-2 mutein of this disclosure is a partial agonist with reduced ability to activate CD25 expression in lymphocytes compared to wild-type IL-2. In some embodiments, the IL-2 mutein activates IL-2Ra expression in lymphocytes at levels of 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or less than the levels at which wild-type IL-2 activates CD25 expression in the same cells. In some embodiments, the lymphocytes are CD8+ T cells. In some embodiments, the CD8+ T cells are freshly isolated CD8+ T cells. In other embodiments, the CD8+ T cells are activated CD8+ T cells.
[0120] In some aspects of this disclosure, IL-2 mutaine is a complete agonist.
[0121] In some aspects of this disclosure, IL-2 mutaine is a superagonist.
[0122] In some embodiments, the Disclosure provides methods and compositions for treating and / or preventing inflammatory, infectious, or autoimmune diseases, disorders, or conditions by administration in combination with one or more adjunct agents, including but not limited to chemotherapeutic agents, immune checkpoint modulators, radiotherapy, and / or surgery, in combination with adjunct agents, although human IL-2 mutein has reduced binding affinity to CD132 but still maintains a remarkable binding affinity to CD122 and / or CD25 comparable to that of wild-type hIL2.
[0123] In some embodiments, the Disclosure provides human interleukin-2 (IL-2) muteins that provide modified binding properties to one or more IL-2 receptors for the treatment of inflammatory, infectious, or autoimmune diseases, disorders, or conditions.
[0124] In various embodiments, this disclosure relates to the following formula 1: TIFF0007875121000009.tif99128[in formula: Each of a, b, c, d, e, f, g, h, and i is individually selected from 0 or 1; AA1 is either A (wild type, a=1) or deleted (a=0); AA2 is either P (wild type, b=1) or deleted (b=0); AA3 is either T (wild type, c=1), C, A, G, Q, E, N, D, R, K, P, or deleted (c=0); • AA4 is either S (wild type, d=1) or deleted (d=0); AA5 is either S (wild type, e=1) or deleted (e=0); • AA6 is either S (wild type, f=1) or deleted (f=0); • AA7 is either T (wild type, g=1) or deleted (g=0); • AA8 is either K (wild type, h=1) or deleted (h=0); AA9 is either K (wild type, i=1) or deleted (i=0); AA18 is L (wild type) or R, L, G, M, F, E, H, W, K, Q, S, V, I, Y, H, D, or T; AA22 is Q (wild type) or F, E, G, A, L, M, F, W, K, S, V, I, Y, H, R, N, D, T, or F; AA35 is either K (wild type) or E; AA38 is R (wild type), W, or G; AA39 is M (wild type), L, or V; AA55 is either H (wild type) or Y; AA69 is either V (wild type) or A; AA74 is Q (wild type), P, N, H, S; AA80 is L (wild type), F, or V; AA81 is R (wild type), I, D, or T; AA85 is either L (wild type) or V; AA86 is either I (wild type) or V; AA89 is either I (wild type) or V; AA91 is V (wild type), R, or K; AA92 is either I (wild type) or F; AA97 is either K (wild type) or Q; AA104 is either M (wild type) or A; AA109 is a non-natural amino acid with D (wild type), C, or activated side chains; AA113 is either T (wild type) or N; AA125 is C (wild type), A, or S; AA126 is Q (wild type) or H, M, K, C, D, E, G, I, R, S, or T; AA130 is S (wild type), T, G, or R; However, if AA18 is R and AA22 is E, then AA126 is not H, M, K, C, D, E, G, I, R, S, or T. The present invention provides a polypeptide containing an amino acid sequence that follows the specified pattern.
[0125] In certain embodiments, this disclosure may be modified as follows: AA18 is selected from the group consisting of L (wild type) or R, L, G, M, F, E, H, W, K, Q, S, V, I, Y, H, D, or T; AA22 is selected from the group consisting of Q (wild type) or F, E, G, A, L, M, F, W, K, S, V, I, Y, H, R, N, D, T, or F; AA126 is selected from the group consisting of Q (wild type) or H, M, K, C, D, E, G, I, R, S, or T. [However, if AA18 is R and AA22 is E, then AA126 is not H, M, K, C, D, E, G, I, R, S, or T.] We provide IL2 mutain, which includes this.
[0126] In certain embodiments, this disclosure may be modified as follows: a=0; AA18 is selected from the group consisting of L (wild type) or R, L, G, M, F, E, H, W, K, Q, S, V, I, Y, H, D, or T; AA22 is selected from the group consisting of Q (wild type) or F, E, G, A, L, M, F, W, K, S, V, I, Y, H, R, N, D, T, or F; AA126 is selected from the group consisting of Q (wild type) or H, M, K, C, D, E, G, I, R, S, or T. [However, if AA18 is R and AA22 is F or V, then AA126 is not H, M, K, C, D, E, G, I, R, S, or T.] We provide IL2 mutain, which includes this.
[0127] In some embodiments, the present disclosure provides IL-2 mutaines containing amino acid substitutions at amino acid positions 18, 22, and 126, numbered according to wild-type hIL-2 as listed in Table 2 below. It should be noted that the three-letter abbreviations for specific IL-2 mutaines reflect IL-2 mutaines having mutations at positions 18, 22, and 126; for example, "FEH" is a shortened nomenclature for IL-2 mutaines containing substitutions L18F, Q22E, and Q126H. In particular, the IL-2 mutaines of the present disclosure contain amino acid substitutions at positions 18 and / or 22, and 126, as listed in Table 2 below:
[0128] (Table 2) IL2 mutaine TIFF0007875121000010.tif110131TIFF0007875121000011.tif203131
[0129] The IL2 muteins listed in Table 2 were prepared and tested substantially in accordance with the examples provided herein. The experimental results are provided in Figures 1 and 2 of the accompanying drawings. As shown in Figure 1, the IL2 muteins of the present invention retained significant IL2 activity. As shown in Figure 2, the IL2 muteins of this disclosure showed significantly preferential activity against CD25-expressing cells compared to wild-type IL2.
[0130] IL2 mutain may also contain one or more substitutions, deletions, or insertions within the amino acid sequence of wild-type IL-2. The following nomenclature is used herein to refer to substitutions, deletions, or insertions. Residues may be named herein by the amino acid position of IL-2 following a one- or three-letter amino acid code, for example, "Cys125" or "C125" refers to the cysteine residue at position 125 of SEQ ID NO:5. Substitutions are named herein by the substituted one-letter amino acid code following the amino acid position of IL-2 following a one-letter amino acid code, for example, "K35A" refers to the substitution of the lysine (K) residue at position 35 of SEQ ID NO:5 with an alanine (A) residue. Deletions are referred to by "des" following the deleted amino acid residue and its position in SEQ ID NO:5. For example, the terms "des-Ala1" or "desA1" refer to the deletion of alanine at position 1 of the polypeptide in SEQ ID NO:5.
[0131] Mutations to improve CD122 affinity In some embodiments of the present invention, IL2 mutein may include amino acid substitutions that improve the binding affinity of CD122. Examples of amino acid substitutions that improve the binding affinity of CD122 include, but are not limited to, Q74N, Q74H, Q74S, L80F, L80V, R81D, R81T, L85V, I86V, I89V, and / or I92F or combinations thereof. In certain embodiments, amino acid substitutions that improve the binding affinity of CD122 include L80F, R81D, L85V, I86V, and I92F. In some embodiments, amino acid substitutions that improve the binding affinity of CD122 include N74Q, L80F, R81D, L85V, I86V, I89V, and I92F. In some embodiments, amino acid substitutions that improve the binding affinity of CD122 include Q74N, L80V, R81T, L85V, I86V, and I92F. In certain embodiments, amino acid substitutions that improve the binding affinity of CD122 include Q74H, L80F, R81D, L85V, I86V, and I92F. In some embodiments, amino acid substitutions that improve the binding affinity of CD122 include Q74S, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, amino acid substitutions that improve the binding affinity of CD122 include Q74N, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, amino acid substitutions that improve the binding affinity of CD122 include Q74S, R81T, L85V, and I92F.
[0132] In some embodiments, IL2 muteins may be affinity-matured to improve their affinity for CD25 and / or CD122. An “affinity-matured” polypeptide is a polypeptide having one or more modifications to one or more residues, the resulting modification being an improvement in the affinity of the orthogonal polypeptide to its homologous orthogonal receptor compared to the parent polypeptide without those modifications, or vice versa. Affinity maturation can be performed to increase the binding affinity of IL2 muteins by at least about 10%, alternatively at least about 50%, alternatively at least about 100%, alternatively at least about 150%, or 1 to 5 times compared to the “parent” polypeptide.
[0133] Mutations to improve CD25 affinity: In some embodiments, the IL-2 mutein contains one or more mutations at the position of the IL-2 sequence that contact CD25 or alter the orientation of other positions that contact CD25, resulting in an IL2 mutein having improved affinity for CD25. In some embodiments, the IL2 mutein of the present disclosure contains one or more substitutions V69A and Q74P that are described as improving the binding affinity of IL2 to CD25.
[0134] Removal of Thr3 glycosylation site The IL2 muteins of this disclosure may further or optionally provide the removal of the O-glycosylation site at the Thr3 position to promote the production of non-glycosylated IL2 muteins when expressed in mammalian cells such as CHO cells or HEK cells. Thus, in certain embodiments, the IL2 muteins further include a modification that removes the O-glycosylation site of IL-2 at a position corresponding to residue 3 of human IL-2. In one embodiment, the modification that removes the O-glycosylation site of IL-2 at a position corresponding to residue 3 of human IL-2 is an amino acid substitution. Exemplary amino acid substitutions include T3A, T3G, T3Q, T3E, T3N, T3D, T3R, T3K, T3S, T3C, and T3P, which remove the glycosylation site at position 3 without loss of biological activity (see U.S. Patent No. 5,116,943; Weiger et al., (1989) Eur. J. Biochem., 180:295-300). In certain embodiments, the modification is the amino acid substitution T3A.
[0135] Minimizing vascular leak syndrome In some aspects of this disclosure, IL2 muteins may include amino acid substitutions to avoid substantially negative dose-limiting side effects of IL2 therapy use in humans, such as vasoleap syndrome, without substantial loss of efficacy. See Epstein et al., U.S. Patent No. 7,514,073B2, issued April 7, 2009. Examples of such modifications included in IL2 muteins of this disclosure include one or more of R38W, R38G, R39L, R39V, F42K, and H55Y.
[0136] Oxidation resistant M104A IL2 mutein may also include further modifications at the M104 position, in one embodiment, substitution of methionine 104 with an alanine residue (M104A) provides IL2 mutein with higher oxidation resistance (see Koths et al., U.S. Patent No. 4,752,585, issued June 21, 1988).
[0137] Cys125 In some embodiments, the cysteine at position 125 is substituted with alanine or serine (C125A or C125S) to minimize potential misfolding of the protein when recombinantly expressed in bacteria and isolated from inclusion bodies as described.
[0138] Deletion of the N-terminus When directly recombinantly produced in a bacterial expression system in the absence of a leader sequence, the endogenous protease results in a deletion of the N-terminal Met-Ala1 residue, providing a "desAla1" IL2 mutein. In some embodiments, the present disclosure provides an hIL2 mutein, which is an hIL2 polypeptide comprising one of the following sets of amino acid modifications.
[0139] IL2 muteins may involve not only the deletion of the first two amino acids (desAla1-desPro2) but also substitution with cysteine residues in Thr3 glycosylation to promote selective N-terminal modification, particularly PEGylation of the sulfhydryl group of cysteine (see, for example, Katre et al., U.S. Patent No. 5,206,344, issued April 27, 1993).
[0140] IL2 muteins may further involve the elimination of an N-terminal amino acid at one or more of the following positions while retaining IL2 activity: positions 1-9 (compounds of the above formula where a, b, c, d, e, f, g, h, and i are all zero), alternatively positions 1-8 (compounds of the above formula where a, b, c, d, e, f, g, and h are all zero), alternatively positions 1-7 (compounds of the above formula where a, b, c, d, e, f, and g are all zero), alternatively positions 1-6 (compounds of the above formula where a, b, c, d, e, and f are all zero), alternatively positions 1-5 (compounds of the above formula where a, b, c, d, and e are all zero), alternatively positions 1-4 (compounds of the above formula where a, b, c, and d are all zero), alternatively positions des1-3 (compounds of the above formula where a, b, and c are all zero), or alternatively positions 1-2 (compounds of the above formula where a and b are all zero).
[0141] Conservative amino acid substitutions In some embodiments, the IL2 muteins of this disclosure may further include one or more conserved amino acid substitutions within the wild-type IL-2 amino acid sequence. Such conserved substitutions include those described by Dayhoff in The Atlas of Protein Sequence and Structure 5 (1978) and by Argos in EMBO J., 8:779-785 (1989). Conservative substitutions are generally made according to the chart shown in Table 3 below.
[0142] (Table 3) Exemplary Conservative Amino Acid Substitutions TIFF0007875121000012.tif135134
[0143] Substantial changes in functional or immunological identity may be achieved by selecting non-conservative amino acid substitutions rather than those shown in Table 3. For example, substitutions that significantly affect the structure of the polypeptide backbone or disrupt secondary or tertiary elements may be made, including substitution of an amino acid with a small, uncharged side chain (e.g., glycine) with a large, charged, bulky side chain (asparagine). In particular, substitutions of IL2 residues involving amino acids that interact with one or more of CD25, CD122, and / or CD123 may be made, as can be seen from the crystal structure of IL2 associated with its receptor as described.
[0144] Modification to extend in vivo persistence As described above, the compositions of this disclosure include IL2 mutaine, which has been modified to provide in vivo extension of duration of action and / or duration of action in the subject.
[0145] Modification of the primary sequence In some embodiments, IL2 muteins may include specific amino acid substitutions that result in an extension of in vivo survival time. For example, Dakshinamurthi, et al. (International Journal of Bioinformatics Research (2009) 1(2):4-13) state that one or more substitutions in the IL2 polypeptide, V91R, K97E, and T113N, would result in IL2 variants having enhanced stability and activity. In some embodiments, the IL2 muteins of the present disclosure include one, two, or all three of the V91R, K97E, and T113N modifications.
[0146] Conjugate and carrier molecule In some embodiments, IL-2 mutein is modified to provide an extended duration of action in a subject, and the extension of duration may be achieved by conjugation to a carrier molecule to provide desired pharmacological properties such as an extended half-life. In some embodiments, IL-2 mutein can be covalently linked to the Fc domain of IgG, albumin, or other molecules by, for example, PEGylation, glycosylation, fatty acid acylation, and others known in the art, in order to extend its half-life. In some embodiments, the IL-2 conjugate includes plasma half-lives longer than 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 14 days, or 30 days in a human subject.
[0147] Albumin fusion In some embodiments, IL2 mutein is expressed as a fusion protein with an albumin molecule (e.g., human serum albumin), which is known in the art to promote in vivo exposure extension.
[0148] In one aspect of the present invention, an hIL2 analog is conjugated with albumin and is referred to herein as an "IL2 mutein albumin fusion." The term "albumin" as used in relation to the hIL2 analog albumin fusion includes albumins such as human serum albumin (HSA), canine serum albumin, and bovine serum albumin (BSA). In some aspects, the HSA contains a C34S or K573P amino acid substitution compared to the wild-type HSA sequence. In accordance with this disclosure, albumin can be conjugated with hIL2 mutein at the carboxyl terminus, at the amino terminus, at both the carboxyl and amino terminus, and internally (see, for example, U.S. Patent Nos. 5,876,969 and 7,056,701). Various forms of albumin can be used in the HSA-hIL2 mutein polypeptide conjugates considered herein, such as albumin secretory presequences and their variants, fragments and their variants, and HSA variants. Such forms generally possess one or more desired albumin activities. In further embodiments, the disclosure involves fusion proteins comprising hIL2 analog polypeptides directly or indirectly fused with albumin, albumin fragments, and albumin variants, etc., where the fusion protein has higher plasma stability than the unfused drug molecule and / or the fusion protein retains the therapeutic activity of the unfused drug molecule. In some embodiments, indirect fusion is achieved by a linker such as a peptide linker or a modified version thereof, which will be described more thoroughly later.
[0149] Alternatively, the hIL2 analog albumin fusion comprises IL2 mutein, which is a fusion protein containing an albumin-binding domain (ABD) polypeptide sequence and an IL2 mutein polypeptide. As mentioned above, a fusion protein containing an albumin-binding domain (ABD) polypeptide sequence and an hIL2 analog polypeptide can be achieved, for example, by genetic engineering such that a nucleic acid or fragment thereof encoding an HSA is linked to a sequence encoding one or more IL2 mutein sequences. In some embodiments, the albumin-binding peptide comprises the amino acid sequence DICLPRWGCLW (SEQ ID NO: 6).
[0150] IL2 mutein polypeptide can also be conjugated with proteins; polysaccharides, e.g., Sepharose, agarose, cellulose, or cellulose beads; polymeric amino acids, e.g., polyglutamic acid, or polylysine; amino acid copolymers; inactivated viral particles; inactivated bacterial toxins, e.g., diphtheria, tetanus, cholera-derived toxoids, or leucotoxin molecules; inactivated bacteria, dendritic cells, thyroglobulin; tetanus toxoid; diphtheria toxoid; polyamino acids, e.g., poly(D-lysine:D-glutamic acid); rotavirus VP6 polypeptide; influenza virus hemagglutinin, influenza virus nucleoprotein; keyhole limpet hemocyanin (KLH); and large, slowly metabolized macromolecules such as hepatitis B virus core protein and surface antigens. Such conjugated forms can be used, if desired, to produce antibodies against the polypeptides of this disclosure.
[0151] In some embodiments, IL2 mutein is conjugated (chemically or as a fusion protein) with XTEN, which provides a duration extension similar to PEGylation, and which can be produced as a recombinant fusion protein in Escherichia coli (E. coli). XTEN polymers suitable for use in conjugation with IL2 mutein as described herein are provided in Podust, et al. (2016) "Extension of in vivo half-life of biologically active molecules by XTEN protein polymers", J. Controlled Release 240:52-66 and Haeckel et al. (2016) "XTEN as Biological Alternative to PEGylation Allows Complete Expression of a Protease-Activatable Killin-Based Cytostatic" PLOS ONE | DOI:10.1371 / journal.pone.0157193 June 13, 2016. XTEN polymers may be fusion proteins that incorporate protease-sensitive cleavage sites, such as MMP-2 cleavage sites, between the XTEN polypeptide and IL2 mutein.
[0152] Further candidate components and molecules for conjugation include those suitable for isolation or purification. Certain non-limiting examples include conjugation molecules such as biotin (biotin-avidin specific binding pair), antibodies, receptors, ligands, lectins, or molecules containing solid supports, such as plastic or polystyrene beads, plates or beads, magnetic beads, test strips, and membranes.
[0153] PEGylation: In some embodiments, IL2 mutein is conjugated with one or more water-soluble polymers. Examples of water-soluble polymers useful for carrying out the present invention include polyethylene glycol (PEG), polypropylene glycol (PPG), polysaccharides (polyvinylpyrrolidone, copolymer of ethylene glycol and propylene glycol, poly(oxyethylated polyol), polyolefin alcohol, polysaccharide, poly-alpha-hydroxy acid, polyvinyl alcohol (PVA), polyphosphazene, polyoxazoline (POZ), poly(N-acryloylmorpholine), or combinations thereof.
[0154] In some embodiments, IL2 mutein is conjugated, or "PEGylated," with one or more polyethylene glycol molecules. Although the method or site of PEG attachment to IL2 mutein can vary, in certain embodiments, PEGylation does not alter, or only minimally alters, the activity of IL2 mutein.
[0155] In some embodiments, cysteine may be substituted for threonine at position 3 (3TC) to facilitate N-terminal PEGylation using a specific chemical reaction.
[0156] In some embodiments, selective PEGylation of IL2 muteins by incorporating non-natural amino acids having side chains to facilitate a selective PEG conjugation reaction, as described by Ptacin et al. (PCT International Application Publication No. PCT / US2018 / 045257, filed on 3 August 2018 and published on 7 February 2019 as International Publication No. WO2019 / 028419A1), may be employed to produce IL2 muteins with reduced affinity to one or more subunits of the IL2 receptor complex (e.g., CD25, CD132). For example, hIL2 muteins incorporating non-natural amino acids having a specific moiety that can be PEGylated to a sequence or residue of IL2 identified to interact with CD25, such as amino acids 34-45, 61-72, and 105-109, typically provide IL2 muteins with reduced binding affinity to CD25. Similarly, hIL2 muteins incorporating non-natural amino acids having a specific PEGylated portion in the sequence or residues of IL2 identified to interact with hCD132, including amino acids 18, 22, 109, 126, or 119-133, provide IL2 muteins with reduced binding affinity to hCD132.
[0157] In certain embodiments, an increase in half-life is greater than any decrease in biological activity. PEGs suitable for conjugation into polypeptide sequences are generally water-soluble at room temperature and have the general formula R(O-CH2-CH2) n The molecule has an OR [wherein R is a protecting group such as a hydrogen atom, an alkyl group, or an alkanol group, and n is an integer from 1 to 1000]. If R is a protecting group, it generally has 1 to 8 carbon atoms. The PEG conjugated with the polypeptide sequence can be linear or branched. Branched PEG derivatives, "star PEGs," and multi-armed PEGs are considered in this disclosure.
[0158] The molecular weight of PEG used in this disclosure is not limited to any particular range. The PEG portion of PEG-IL2 mutein may have a molecular weight greater than about 5 kDa, greater than about 10 kDa, greater than about 15 kDa, greater than about 20 kDa, greater than about 30 kDa, greater than about 40 kDa, or greater than about 50 kDa. In some embodiments, the molecular weight is about 5 kDa to about 10 kDa, about 5 kDa to about 15 kDa, about 5 kDa to about 20 kDa, about 10 kDa to about 15 kDa, about 10 kDa to about 20 kDa, about 10 kDa to about 25 kDa, or about 10 kDa to about 30 kDa. Linear or branched PEG molecules have molecular weights of approximately 2,000 to 80,000 daltons, alternatively approximately 2,000 to 70,000 daltons, alternatively approximately 5,000 to 50,000 daltons, alternatively approximately 10,000 to 50,000 daltons, alternatively approximately 20,000 to 50,000 daltons, alternatively approximately 30,000 to 50,000 daltons, alternatively approximately 20,000 to 40,000 daltons, and alternatively approximately 30,000 to 40,000 daltons. In one aspect of the present invention, PEG is a 40kD branched PEG containing two 20kD arms.
[0159] This disclosure also considers compositions of conjugates in which PEG has different n values and therefore various different PEGs are present in specific ratios. For example, some compositions contain mixtures of conjugates where n=1, 2, 3, and 4. In some compositions, the proportion of conjugates with n=1 is 18-25%, the proportion of conjugates with n=2 is 50-66%, the proportion of conjugates with n=3 is 12-16%, and the proportion of conjugates with n=4 is up to 5%. Such compositions can be produced by reaction conditions and purification methods known in the art. Chromatography may be used to separate the conjugate fractions, which are then identified, for example, containing conjugates with a desired number of PEGs and purified to be free of unmodified protein sequences and conjugates with other numbers of PEGs.
[0160] PEGs suitable for conjugation into polypeptide sequences are generally water-soluble at room temperature and have the general formula R(O-CH2-CH2). n The formula has OR [wherein R is a protecting group such as a hydrogen atom, an alkyl group, or an alkanol group, and n is an integer from 1 to 1000]. If R is a protecting group, it generally has 1 to 8 carbon atoms.
[0161] Two widely used first-generation activated monomethoxyPEGs (mPEGs) are succinimidylcarbonate PEG (SC-PEG; see, e.g., Zalipsky, et al. (1992) Biotehnol. Appl. Biochem 15:100-114) and benzotriazole carbonate PEG (BTC-PEG; see, e.g., Dolence et al., U.S. Patent No. 5,650,234), which preferentially react with lysine residues to form carbamate bonds, but are also known to react with histidine and tyrosine residues. The use of PEG aldehyde linkers targets a single site at the N-terminus of a polypeptide via reductive amination.
[0162] PEGylation most commonly occurs at the α-amino group at the N-terminus of a polypeptide, the epsilon-amino group at the side chain of a lysine residue, and the imidazole group at the side chain of a histidine residue. Since most recombinant polypeptides have a single α-amino group as well as several ε-amino and imidazole groups, numerous positional isomers can be generated depending on the chemical properties of the linker. General PEGylation strategies known in the art can be applied herein.
[0163] PEG can be conjugated to the IL2 mutants of the present disclosure via a terminal reactive group ("spacer") that mediates the bond between the free amino or carboxyl groups of one or more polypeptide sequences and polyethylene glycol. PEG having a spacer that can be conjugated to a free amino group can include N-hydroxysuccinimide polyethylene glycol, which can be prepared by activating a succinic acid ester of polyethylene glycol with N-hydroxysuccinimide.
[0164] In some embodiments, PEGylation of the IL2 mutants is facilitated by incorporating non-natural amino acids bearing unique side chains to promote site-specific PEGylation. Incorporating non-natural amino acids into a polypeptide to provide a functional moiety for achieving site-specific PEGylation of such polypeptides is known in the art. See, for example, Ptacin et al., PCT International Application No. PCT / US2018 / 045257, filed Aug. 3, 2018 and published as International Publication No. WO2019 / 028419A1 on Feb. 7, 2019. In one embodiment, the IL2 mutants of the present invention incorporate a non-natural amino acid at position D109 of the IL2 mutant. In one embodiment of the present invention, the IL2 mutant is PEGylated to a PEG molecule having a molecular weight of about 20 kD, alternatively about 30 kD, alternatively about 40 kD at position 109 of the IL2 mutant.
[0165] PEG conjugated with a polypeptide sequence can be linear or branched. Branched PEG derivatives, "star PEGs," and multi-armed PEGs are considered in this disclosure.In certain embodiments, PEGs useful for carrying out the present invention include 10kDa linear PEG-aldehydes (e.g., Sunbright® ME-100AL, NOF America Corporation, One North Broadway, White Plains, NY 10601 USA), 10kDa linear PEG-NHS esters (e.g., Sunbright® ME-100CS, Sunbright® ME-100AS, Sunbright® ME-100GS, Sunbright® ME-100HS, NOF), 20kDa linear PEG-aldehydes (e.g., Sunbright® ME-200AL, NOF), 20kDa linear PEG-NHS esters (e.g., Sunbright® ME-200CS, Sunbright® ME-200AS, Sunbright® ME-200GS, Sunbright® ME-200HS, NOF), and 20kDa Two-arm branched PEG-aldehydes containing two 10kDa linear PEG molecules: 20kDa PEG-aldehyde (e.g., Sunbright® GL2-200AL3, NOF), 20kDa two-arm branched PEG-NHS esters containing two 10kDa linear PEG molecules: 20kDa PEG-NHS esters containing two 10kDa linear PEG molecules (e.g., Sunbright® GL2-200TS, Sunbright® GL200GS2, NOF), 40kDa two-arm branched PEG-aldehydes containing two 20kDa linear PEG molecules: 40kDa PEG-aldehyde (e.g., Sunbright® GL2-400AL3), 40kDa two-arm branched PEG-NHS esters containing two 20kDa linear PEG molecules The product contains PEG-NHS esters (e.g., Sunbright® GL2-400AL3, Sunbright® GL2-400GS2, NOF), linear 30kDa PEG-aldehydes (e.g., Sunbright® ME-300AL), and linear 30kDa PEG-NHS esters.
[0166] As described above, PEG may be linked directly to the IL2 mutein or via a linker molecule. Suitable linkers generally include a "flexible linker" of sufficient length to allow some movement between the modified polypeptide sequence and the linked components and molecules. The linker molecule is generally about 6 to 50 atoms in length. The linker molecule can also be, for example, arylacetylene, an ethylene glycol oligomer containing two to ten monomer units, a diamine, a diacid, an amino acid, or a combination thereof. Suitable linkers can be readily selected and can be of any suitable length, such as 1 amino acid in length (e.g., Gly), 2, 3, 4, 5, 6, 7, 8, 9, 10, 10 - 20, 20 - 30, 30 - 50 or more than 50 amino acids in length. Examples of flexible linkers include glycine polymers (G) n , glycine - serine polymers, glycine - alanine polymers, alanine - serine polymers, and other flexible linkers. Glycine polymers and glycine - serine polymers are relatively structurally undefined and can thus serve as neutral tethers between components. Further examples of flexible linkers include glycine polymers (G) n , glycine - alanine polymers, alanine - serine polymers, glycine - serine polymers. Glycine polymers and glycine - serine polymers are relatively structurally undefined and may thus serve as neutral tethers between components. Multimers of these linker sequences (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10 - 20, 20 - 30, or 30 - 50) may be linked together to provide flexible linkers that can be used to conjugate heterologous amino acid sequences to the polypeptides disclosed herein.
[0167] Furthermore, such linkers may be used to link the IL2 mutein to additional heterologous polypeptide components described herein, and the heterologous amino acid sequences can be signal sequences and / or fusion partners, such as albumin, Fc sequences, and the like.
[0168] Acylation In some embodiments, the IL2 muteins of this disclosure may be acylated by conjugation with fatty acid molecules, as described in Resh (2016) Progress in Lipid Research 63: 120-131. Examples of fatty acids that can be conjugated include myristate, palmitate, and palmitoleic acid. Myristoylates are typically linked to an N-terminal glycine, but lysine can also be myristoylated. Palmitoylation is typically achieved by enzymatic modification of the -SH group of free cysteine, such as by DHHC proteins that catalyze S-palmitoylation. Palmitoleylation of serine and threonine residues is typically achieved enzymatically using PORCN enzymes.
[0169] Acetylation In some embodiments, IL-2 mutein is N-terminated by enzymatic reaction with an N-terminal acetyltransferase and, for example, acetyl-CoA. Alternatively or in addition to N-terminal acetylation, IL-2 mutein may be acetylated at one or more lysine residues by enzymatic reaction with, for example, a lysine acetyltransferase. See, for example, Choudhary et al. (2009) Science 325 (5942):834L2 ortho840.
[0170] Fc fusion In some embodiments, IL-2 fusion proteins may incorporate an Fc region derived from an antibody of an IgG subclass lacking the IgG heavy chain variable region. The “Fc region” can be a native or synthetic polypeptide homologous to the IgG C-terminal domain produced by the digestion of IgG with papain. IgG Fc has a molecular weight of approximately 50 kDa. Mutant IL-2 polypeptides may contain the entire Fc region or a smaller portion that retains the ability to extend the cyclic half-life of the chimeric polypeptide in which it forms a part. In addition, the full-length or fragmented Fc region may be a variant of the wild-type molecule; that is, they may contain mutations that may or may not affect the function of the polypeptide; and as further described below, native-type activity is not always required or desired. In certain embodiments, IL-2 mutein fusion proteins (e.g., IL-2 partial agonists or antagonists described herein) include an IgG1, IgG2, IgG3, or IgG4 Fc region. The exemplary Fc region may contain mutations that inhibit complement binding and Fc receptor binding, or it may be soluble, i.e., it may bind to complement or lyse cells via another mechanism such as antibody-dependent complement lysis (ADCC).
[0171] In some embodiments, IL2 muteins contain a functional domain of an Fc-fusion chimeric polypeptide molecule. Fc-fusion conjugates have been shown to increase the systemic half-life of biologics, thus allowing biologic products to require less frequent administration. Fc binds to neonatal Fc receptors (FcRn) in endothelial cells lining blood vessels. Upon binding, the Fc-fusion molecule is protected from degradation and re-released into circulation, allowing it to circulate for a longer period. This Fc binding is thought to be the mechanism by which endogenous IgG retains its long plasma half-life. Recent Fc-fusion technologies annex a single copy of a biologic to the Fc region of an antibody to optimize the pharmacokinetic and pharmacodynamic properties of the biologic compared to conventional Fc-fusion conjugates. The “Fc region” useful for preparing Fc fusions can be a native or synthetic polypeptide homologous to the IgG C-terminal domain produced by the digestion of IgG with papain. IgG Fc has a molecular weight of approximately 50 kDa. IL2 muteins may provide smaller fragments that retain the ability to extend the cyclic half-life of the entire Fc region, or of the chimeric polypeptide in which it constitutes a portion. In addition, the full-length or fragmented Fc region can be a variant of the wild-type molecule. In a typical presentation, each monomer of the dimeric Fc harbors a heterologous polypeptide, which may be the same or different.
[0172] In some embodiments, when IL2 mutein is administered in the form of an Fc fusion, particularly when the polypeptide chains conjugated to each subunit of the Fc dimer are different, the Fc fusion may be manipulated to have a "knob-into-hole modification." Knob-into-hole modifications are well described by Ridgway, et al. (1996) Protein Engineering 9(7):617-621 and U.S. Patent No. 5,731,168 issued on March 24, 1998. Knob-into-hole modification refers to a modification at the interface between two immunoglobulin heavy chains in the CH3 domain, where: i) an amino acid residue in the CH3 domain of the first heavy chain is replaced with an amino acid residue having a larger side chain (e.g., tyrosine or tryptophan), creating a protrusion ("knob") from the surface; and ii) an amino acid residue in the CH3 domain of the second heavy chain is replaced with an amino acid residue having a smaller side chain (e.g., alanine or threonine), thereby creating a cavity ("hole") within the interface in the second CH3 domain, within which the protruding side chain ("knob") of the first CH3 domain is accommodated by the cavity in the second CH3 domain. In one embodiment, the "knob-into-hole modification" includes amino acid substitution T366W and optionally amino acid substitution S354C in one antibody heavy chain, and amino acid substitution T366S, L368A, Y407V and optionally Y349C in the other antibody heavy chain. Furthermore, the Fc domain may be modified by introducing cysteine residues at positions S354 and Y349, which results in a stabilizing disulfide crosslink between the two antibody heavy chains in the Fe region (Carter, et al. (2001) Immunol Methods 248, 7-15). The knob-into-hole configuration is used to promote the expression of a first polypeptide (e.g., IL2 mutain) on a first Fc monomer with a "knob" modification and a second polypeptide on a second Fc monomer with a "hole" modification to promote the expression of a heterodimer polypeptide conjugate.
[0173] The Fc region can be "soluble" or "insoluble," but is typically insoluble. Insoluble Fc regions typically lack a high-affinity Fc receptor binding site and a C1q binding site. The high-affinity Fc receptor binding site of mouse IgG Fc contains a Leu residue at position 235 of IgG Fc. Therefore, the Fc receptor binding site can be inhibited by mutation or deletion of Leu235. For example, substitution of Leu235 with Glu inhibits the ability of the Fc region to bind to the high-affinity Fc receptor. The mouse C1q binding site can be functionally disrupted by mutation or deletion of the Glu318, Lys320, and Lys322 residues of IgG. For example, substitution of Glu318, Lys320, and Lys322 with Ala residues prevents IgG1 Fc from directing antibody-dependent complement lysis. In contrast, the soluble IgG Fc region possesses a high-affinity Fc receptor binding site and a C1q binding site. The high-affinity Fc receptor binding site contains a Leu residue at position 235 of IgG Fc, and the C1q binding site contains Glu318, Lys320, and Lys322 residues of IgG1. Soluble IgG Fc has wild-type residues or conserved amino acid substitutions at these sites. Soluble IgG Fc can target cells for antibody-dependent cell-mediated cytotoxicity or complement-dependent cell lysis (CDC). Suitable mutations for human IgG are also known (see, e.g., Morrison et al., The Immunologist 2: 119-124, 1994; and Brekke et al., The Immunologist 2: 125, 1994).
[0174] In certain embodiments, the amino-terminus or carboxyl-terminus of IL2 mutein of this disclosure can be fused with an immunoglobulin Fc region (e.g., human Fc) to form a fusion conjugate (or fusion molecule). Fc fusion conjugates have been shown to increase the systemic half-life of biologics, thus allowing for a lower administration frequency of the biologic product. Fc binds to neonatal Fc receptors (FcRn) in endothelial cells lining blood vessels, and upon binding, the Fc fusion molecule is protected from degradation and re-released into circulation, thus maintaining the molecule in circulation for a longer period. This Fc binding is thought to be the mechanism by which endogenous IgG retains its long plasma half-life. Recent Fc-fusion technologies ligate a single copy of a biologic with the Fc region of an antibody to optimize the pharmacokinetic and pharmacodynamic properties of the biologic compared to conventional Fc-fusion conjugates.
[0175] In some embodiments, the Fc domain monomer comprises at least one mutation compared to the wild-type human IgG1, IgG2, or IgG4 Fc region described in U.S. Patent US10259859B2, the entire teaching of which is incorporated herein by reference. As disclosed therein, the Fc domain monomer is (a) One of the following amino acid substitutions compared to wild-type human IgG1: T366W, T366S, L368A, Y407V, T366Y, T394W, F405W, Y349T, Y349E, Y349V, L351T, L351H, L351N, L351K, P353S, S354D, D356K, D356R, D356S, E357K, E357R, E357Q, S364A, T366E, L368T, L368Y, L368E, K370E, K370D, K370Q, K392E, K392D, T394N, P395N, P396T, V397T, V397Q, L398T, D399K, D399R, D399N, F405T, F405H, F405R, Y407T, Y407H, Y407I, K409E, K409D, K409T, or K409I; or (b)(i) N297A mutation compared to the human IgG1 Fc region; (ii) L234A, L235A, and G237A mutations compared to the human IgG1 Fc region; (iii) L234A, L235A, G237A, and N297A mutations compared to the human IgG1 Fc region; (iv) N297A mutation compared to the human IgG2 Fc region; (v) A330S and P331S mutations compared to the human IgG2 Fc region; (vi) A330S, P331S, and N297A mutations compared to the human IgG2 Fc region; (vii) S228P, E233P, F234V, L235A, and delG236 mutations compared to the human IgG4 Fc region; or (viii) S228P, E233P, F234V, L235A, delG236, and N297A mutations compared to the human IgG4 Fc region Includes.
[0176] In some embodiments, the Fc domain monomer is (a) One of the following amino acid substitutions compared to wild-type human IgG1: T366W, T366S, L368A, Y407V, T366Y, T394W, F405W, Y349T, Y349E, Y349V, L351T, L351H, L351N , L351K, P353S, S354D, D356K, D356R, D356S, E357K, E357R, E357Q, S364A, T366E, L368T, L368 Y, L368E, K370E, K370D, K370Q, K392E, K392D, T394N, P395N, P396T, V397T, V397Q, L398T, D39 9K, D399R, D399N, F405T, F405H, F405R, Y407T, Y407H, Y407I, K409E, K409D, K409T, or K409I Includes; (b) The Fc domain monomer is (i) N297A mutation compared to the human IgG1 Fc region; (ii) L234A, L235A, and G237A mutations compared to the human IgG1 Fc region; (iii) L234A, L235A, G237A, and N297A mutations compared to the human IgG1 Fc region; (iv) N297A mutation compared to the human IgG2 Fc region; (v) A330S and P331S mutations compared to the human IgG2 Fc region; (vi) A330S, P331S, and N297A mutations compared to the human IgG2 Fc region; (vii) S228P, E233P, F234V, L235A, and delG236 mutations compared to the human IgG4 Fc region; or (viii) S228P, E233P, F234V, L235A, delG236, and N297A mutations compared to the human IgG4 Fc region further comprising.
[0177] In some embodiments, the polypeptide exhibits a reduction in phagocytosis in a phagocytosis assay as compared to a polypeptide having a wild - type human IgG Fc region. In some embodiments, the Fc domain monomer is linked to a second polypeptide comprising a second Fc domain monomer to form an Fc domain dimer.
[0178] Chimeric polypeptide / fusion protein In some embodiments, the IL2 mutein can comprise a functional domain of a chimeric polypeptide. The IL2 mutein fusion proteins of the present disclosure can be easily produced by recombinant DNA methodology known in the art by constructing a recombinant vector comprising a nucleic acid sequence encoding the IL2 mutein in - frame with a nucleic acid sequence encoding a fusion partner at either the N - terminus or C - terminus of the IL2 mutein, which sequence may further comprise a nucleic acid sequence encoding a linker or spacer polypeptide in - frame.
[0179] In some embodiments, IL2 mutein is conjugated (chemically or as a fusion protein in the case of polypeptide agents such as antibodies or vaccines) to further chemical or biological agents, including therapeutic compounds such as biological agents (e.g., etanercept), monoclonal antibodies, anti-inflammatory, antibacterial, or antiviral compounds, or other agents useful for treating autoimmune diseases. Antibacterial agents include aminoglycosides such as gentamicin; antiviral compounds such as rifampicin, 3'-azido-3'-deoxythymidine (AZT), and acyclovir; antifungal agents such as azoles including fluconazole; plyre macrolides such as amphotericin B and candicidine; and antiparasitic compounds such as antimony drugs. IL2 mutein can be conjugated to further cytokines, such as CSF, GSF, GMCSF, TNF, erythropoietin, immunomodulators or cytokines, such as interferons or interleukins, neuropeptides, reproductive hormones, such as HGH, FSH, or LH, thyroid hormones, neurotransmitters, such as acetylcholine, hormone receptors, such as estrogen receptors. Nonsteroidal anti-inflammatory drugs, such as indomethacin, salicylate acetate, ibuprofen, sulindac, piroxicam, and naproxen, as well as anesthetics or analgesics. Radioisotopes, including those useful for both imaging and therapy, are also included.
[0180] IL-2 mutein may also be conjugated with corticosteroids (including, but not limited to, prednisone, budesonide, and prednisolone), Janus kinase inhibitors (including, but not limited to, tofacitinib (Xeljanz®)), calcineurin inhibitors (including, but not limited to, cyclosporine and tacrolimus), mTor inhibitors (including, but not limited to, sirolimus and everolimus), and IMDH inhibitors (including, but not limited to, azathioprine, leflunomide, and mycophenolates). IL-2 mutein may also be conjugated with biologics such as abatacept (Orencia®) or etanercept (Enbrel®). IL-2 muteins also include anti-CD25 antibodies (e.g., daclizumab and basiliximab), anti-VLA-4 antibodies (e.g., natalizumab), anti-CD52 antibodies (e.g., alemtuzumab), anti-CD20 antibodies (e.g., rituximab, ocrelizumab), anti-TNF antibodies (e.g., infliximab and adalimumab), anti-IL-6R antibodies (e.g., tocilizumab), anti-TNFα antibodies (e.g., adalimumab (Humira®), golimumab, and infliximab), and anti-integrin-α4β7 antibodies (e.g., bacilizumab). It can be conjugated to therapeutic antibodies such as dolizumab, anti-IL-17a antibodies (e.g., brodalumab or secukinumab), anti-IL-4Rα antibodies (e.g., dupilumab), anti-RANKL (e.g.) antibodies, IL-6R antibodies, anti-IL-1β antibodies (e.g., canakinumab), anti-CD11a antibodies (e.g., ephalizumab), anti-CD3 antibodies (e.g., muromonab), anti-IL5 antibodies (e.g., mepolizumab, reslizumab), anti-BLyS antibodies (e.g., belimumab); and anti-IL-12 / IL-23 antibodies (e.g., ustekinumab).
[0181] IL-2 mutain also contains HSV vaccine, Bordetella pertussis vaccine, Escherichia coli vaccine, multivalent pneumococcal vaccine, such as Prevnar® 13 pneumococcal vaccine, diphtheria toxoid, tetanus toxoid and pertussis vaccine (combined vaccines, such as Pediatrix® and Pentacel®), varicella vaccine, and Haemophilus influenzae vaccine. It can be conjugated to influenza B (HIB) vaccine, human papillomavirus (HPV) vaccine, e.g., Garasil®, polio vaccine, leptospirosis vaccine, respiratory disease combination vaccine, Moraxella vaccine, and attenuated live or dead virus products, e.g., bovine respiratory disease vaccine (RSV), human influenza vaccine, e.g., Fluzone® and tetravalent Fluzone®, feline leukemia vaccine, infectious gastroenteritis vaccine, and rabies vaccine.
[0182] The IL-2 mutein of this disclosure can be chemically conjugated to such further active substances using well-known chemical conjugation methods. Bifunctional crosslinking reagents, such as homofunctional and heterofunctional crosslinking reagents known in the art, can be used for this purpose. The type of crosslinking reagent to be used depends on the properties of the molecule to be coupled to the IL-2 mutein, which can be readily determined by those skilled in the art. Alternatively or additionally, the IL-2 mutein and / or molecule intended to be conjugated may be chemically derived, and as a result, these two can be conjugated in separate reactions known in the art.
[0183] Flag tag In other embodiments, IL2 mutein may be modified to include a further polypeptide sequence that functions as an antigen tag, such as a FLAG sequence. The FLAG sequence is recognized by a biotinylated, highly specific anti-FLAG antibody as described herein (see, e.g., Blanar et al. (1992) Science 256:1014 and LeClair, et al. (1992) PNAS-USA 89:8145). In some embodiments, the IL2 mutein polypeptide further includes a C-terminal c-myc epitope tag.
[0184] His tag In some embodiments, the IL2 mutein of the present invention (including the IL2 mutein fusion protein) is expressed as a fusion protein having one or more transition metal chelate polypeptide sequences. Incorporation of such transition metal chelate domains facilitates purified immobilized metal affinity chromatography (IMAC), as described in Smith et al., U.S. Patent No. 4,569,794, issued February 11, 1986. Examples of transition metal chelate polypeptides useful for carrying out the present invention are described in Smith et al., as stated above, and Dobeli et al., U.S. Patent No. 5,320,663, issued May 10, 1995, the full teachings of which are incorporated herein by reference. Specific transition metal chelate polypeptides useful for carrying out the present invention consist of 3 to 6 consecutive histidine residues. (SEQ ID NO: 98) For example, 6-histidine peptide (His)6 (SEQ ID NO: 99) It is a peptide containing [the specified element], and is often referred to as the "His tag" in this field.
[0185] Targeting section: In some embodiments, IL2 mutein is provided as a fusion protein having a polypeptide sequence ("targeting domain") to facilitate selective binding to specific cell types or tissues expressing cell surface molecules that specifically bind to such targeting domain. In some embodiments, the targeting domain is an antibody (particularly a single-domain antibody, scFv, or VHH) or ligand that specifically binds to a surface protein of a protein selected from the group consisting of BLyS, CD11a, CD20, CD25, CD3, CD52, IgEIL-12 / IL-23, IL-17a, 1L-1β, IL-4Rα, IL-5, IL-6R, integrin-α4β7, RANKL, TNFα, VEGF-A, and VLA-4.
[0186] Preparation of IL2 mutain IL2 muteins can be produced by conventional methodologies for constructing polypeptides, including recombinant synthesis or solid-phase synthesis.
[0187] Chemical synthesis: In addition to generating mutant polypeptides through the expression of nucleic acid molecules modified by recombinant molecular biological techniques, the target IL-2 mutein can be chemically synthesized. Chemically synthesized polypeptides are routinely produced by those skilled in the art. Chemical synthesis involves the direct synthesis of peptides by chemical means of the protein sequence encoding the IL-2 mutein exhibiting the described properties. This method allows for the incorporation of both native and non-native amino acids at positions affecting the interaction between IL2 and CD25, CD122, and CD132.
[0188] In some embodiments, the IL2 muteins of this disclosure can be prepared by chemical synthesis. The chemical synthesis of IL2 muteins may proceed via liquid or solid phase. Solid-phase peptide synthesis (SPPS) allows for the incorporation of non-natural amino acids and / or peptide / protein backbone modifications. Various forms of SPPS available for the synthesis of the IL2 muteins of this disclosure are known in the art (e.g., Ganesan A. (2006) Mini Rev. Med. Chem. 6:3-10; and Camarero et al., (2005) Protein Pept Lett. 12:723-8). During the chemical synthesis process, alpha-functional groups and any reactive side chains may be protected by acid-unstable or base-unstable groups that are stable under conditions for linking amide bonds but can be readily cleaved without damaging the formed peptide chain.
[0189] In solid-phase synthesis, N-terminal or C-terminal amino acids can be coupled to a suitable support material. A suitable support material is one that is inert to the reagents and reaction conditions for the stepwise condensation and cleavage reactions of the synthesis process and does not dissolve in the reaction medium used. Examples of commercially available support materials include styrene / divinylbenzene copolymers and / or polyethylene glycols modified to have reactive groups; chloromethylated styrene / divinylbenzene copolymers; hydroxymethylated styrene or aminomethylated styrene / divinylbenzene copolymers; and the like. Sequential coupling of protected amino acids can be carried out, typically using an automated peptide synthesizer, according to conventional methods in peptide synthesis.
[0190] At the end of solid-phase synthesis, the peptide is cleaved from the support material while simultaneously cleaving the side-chain protecting groups. The resulting peptide can be purified by a variety of chromatographic methods, including but not limited to hydrophobic adsorption chromatography, ion exchange chromatography, partition chromatography, high-performance liquid chromatography (HPLC), and reversed-phase HPLC.
[0191] Recombinant production: Alternatively, the IL2 mutein of this disclosure is produced by recombinant DNA technology. In a typical implementation of recombinant polypeptide production, a nucleic acid sequence encoding the desired polypeptide is incorporated into an expression vector suitable for the host cell in which expression will be achieved, and the nucleic acid sequence is functionally ligated to one or more expression regulatory sequences encoded by the vector and functional in the target host cell. If a secretory leader sequence (signal peptide) is incorporated into the polypeptide, the recombinant protein may be recovered after disruption of the host cell or from the cell culture medium. The recombinant protein may be purified and concentrated for further use, including incorporation. Methods for the recombinant production of IL2 polypeptides are known in the art and are described in Fernandes and Taforo, U.S. Patent No. 4,604,377, issued on 5 August 1986. Methods for the recombinant production of IL2 mutein are described in Mark et al., U.S. Patent No. 4,512,584, issued on 21 May 1985, and Gillis, U.S. Patent No. 4,401,756, issued on 30 August 1983. All of these teachings are incorporated herein by reference.
[0192] Construction of the nucleic acid sequence encoding IL2 mutain In some embodiments, IL-2 mutein is produced by a recombinant method using a nucleic acid sequence encoding IL-2 mutein (or a fusion protein containing IL-2 mutein). Alternatively, the nucleic acid sequence encoding the desired IL-2 mutein can be synthesized by chemical means using an oligonucleotide synthesizer.
[0193] Nucleic acid molecules are not limited to sequences that encode polypeptides; they may also include some or all of the non-coding sequences that exist upstream or downstream of the coding sequence (e.g., the coding sequence for IL-2). Those skilled in molecular biology are familiar with routine procedures for isolating nucleic acid molecules. They can be produced, for example, by processing genomic DNA with restriction endonucleases or by polymerase chain reaction (PCR). Consequently, nucleic acid molecules are ribonucleic acid (RNA), which can be produced, for example, by in vitro transcription.
[0194] Nucleic acid molecules encoding IL2 mutain (and its fusions) may contain sequences different from the natural sequence or sequences found in nature, but due to the degeneracy of the genetic code, they encode the same polypeptide. These nucleic acid molecules may consist of RNA or DNA (e.g., genomic DNA, cDNA, or synthetic DNA, e.g., those produced by phosphoramidite-based synthesis), or combinations or modifications of nucleotides within these types of nucleic acids. In addition, nucleic acid molecules may be double-stranded or single-stranded (i.e., sense strand or antisense strand).
[0195] Nucleic acid sequences encoding IL2 mutain may be obtained from various commercial sources that provide customized nucleic acid sequences. Amino acid sequence variants of the IL2 polypeptide for producing the IL2 mutain of this disclosure are prepared by introducing appropriate nucleotide changes into the coding sequence based on the genetic code known in the art. Such variants represent insertions, substitutions, and / or specific deletions of residues as described herein. Any combination of insertions, substitutions, and / or specific deletions is made to arrive at the final construct if the final construct has the desired biological activity as defined herein.
[0196] Methods for constructing DNA sequences encoding IL-2 mutain and expressing those sequences in a suitable transformed host include, but are not limited to, the use of PCR-assisted mutagenesis techniques. Mutations consisting of deletions or additions of amino acid residues to the IL-2 polypeptide can also be performed using standard recombination techniques. In the case of deletions or additions, the nucleic acid molecule encoding IL-2 is optionally digested with a suitable restriction endonuclease. The resulting fragment can be expressed directly or further manipulated, for example, by ligating it with a second fragment. Ligation may be facilitated if the two ends of the nucleic acid molecule contain complementary nucleotides that overlap each other, but blunt-end fragments can also be ligated. Nucleic acids produced by PCR can also be used to generate a variety of mutant sequences.
[0197] The IL-2 mutein of this disclosure may be recombinantly produced not only directly, but also as a fusion polypeptide with heterologous polypeptides, such as a signal sequence, or with other polypeptides having specific cleavage sites at the N-terminus or C-terminus of mature IL-2 mutein. Generally, the signal sequence may be a component of the vector or part of a coding sequence inserted into the vector. The selected heterologous signal sequence is preferably a sequence that is recognized and processed by the host cell (i.e., cleaved by a signal peptidase). In some embodiments, the signal sequence is a signal sequence originally associated with IL-2 mutein (i.e., a human IL-2 signal sequence). The inclusion of the signal sequence depends on whether it is desirable for the recombinant cells from which IL-2 mutein is produced to secrete IL-2 mutein. If the selected cells are prokaryotic cells, it is generally preferable that the DNA sequence does not encode the signal sequence. If the selected cells are eukaryotic cells, it is generally preferable that the signal sequence encodes, and it is most preferable that a wild-type IL-2 signal sequence is used. Alternatively, not only signal sequences from other mammalian species, such as secretory polypeptides of the same or related species, but also viral secretory leaders, such as the herpes simplex gD signal, may be appropriate. If the recombinant host cell is a yeast cell such as Saccharomyces cerevisiae, an alpha junction factor secretory signal sequence may be employed to achieve extracellular secretion of IL2 mutein into the culture medium, as described in Singh, U.S. Patent No. 7,198,919B1, issued April 3, 2007.
[0198] When expressing IL-2 mutein as a chimeric protein (for example, a fusion protein containing IL-2 mutein and a heterologous polypeptide sequence), the chimeric protein can be encoded by a hybrid nucleic acid molecule comprising a first sequence encoding all or part of IL-2 mutein and a second sequence encoding all or part of the heterologous polypeptide. For example, the target IL-2 mutein described herein is tagged with a hexa-histidine tag to facilitate the purification of the protein expressed in bacteria. (SEQ ID NO: 99) It can be fused to a hemagglutinin tag to facilitate the purification of the protein expressed in eukaryotic cells. The first and second should not be understood as limitations on the orientation of the elements of the fusion protein, and heterologous polypeptides can be ligated to the N-terminus and / or C-terminus of IL2 mutein. For example, the N-terminus may be ligated to a targeting domain and the C-terminus to a hexa-histidine tag. (SEQ ID NO: 99) It may be connected to the refining handle.
[0199] A reverse-translated gene can be constructed using the full-length amino acid sequence of the polypeptide (or fusion / chimera) to be expressed. A DNA oligomer containing the nucleotide sequence encoding IL-2 mutaine can be synthesized. For example, several small oligonucleotides encoding a portion of a desired polypeptide can be synthesized and then ligated. Individual oligonucleotides typically contain a 5' or 3' overhang for complementary assembly.
[0200] Codon optimization: In some embodiments, the nucleic acid sequence encoding IL2 mutein may be “codon-optimized” to enhance expression in specific host cell types. Techniques for codon optimization in a wide variety of expression systems, including mammalian, yeast, and bacterial host cells, are well known in the art, and online tools are available to provide codon-optimized sequences for expression in a wide variety of host cell types. For example, see Hawash, et al (2017) 9:46-53 and David Hacker, ed. Recombinant Protein Expression in Mammalian Cells: Methods and Protocols See Mauro and Chappell in (Human Press New York). Additionally, there are various web-based online software packages available free of charge to assist in the preparation of codon-optimized nucleic acid sequences.
[0201] Construction of expression vectors: After assembly (by synthesis, site-directed mutagenesis, or other means), the nucleic acid sequence encoding IL-2 mutain will be inserted into an expression vector. A variety of expression vectors are available for use in various host cells, and they are typically selected based on the host cell for expression. An expression vector typically contains, but is not limited to, one or more of the following: an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Vectors include viral vectors, plasmid vectors, integration vectors, etc. Plasmids are an example of non-viral vectors.
[0202] To promote the efficient expression of recombinant polypeptides, the nucleic acid sequence encoding the polypeptide sequence to be expressed is functionally ligated to a functional transcriptional and translational regulatory sequence in a selected expression host.
[0203] Selection marker: Expression vectors typically contain a selection gene, also known as a selection marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selection medium. Host cells not transformed with a vector containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, such as ampicillin, neomycin, methotrexate, or tetracycline; (b) compensate for nutritional deficiencies; or (c) supply essential nutrients unavailable from the complex medium.
[0204] Regulatory array: The expression vector for IL2 mutein described herein contains a regulatory sequence recognized by a host organism and functionally ligated to the nucleic acid sequence encoding IL2 mutein. The terms “regulatory sequence,” “regulatory sequence,” or “expression regulatory sequence” are used interchangeably herein and refer to promoters, enhancers, and other expression regulatory elements (e.g., polyadenylation signals). See, for example, Goeddel (1990) in Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego CA USA). Regulatory sequences include those that direct the constitutive expression of a nucleotide sequence in many types of host cells and those that direct the expression of a nucleotide sequence only in specific host cells (e.g., tissue-specific regulatory sequences). It will be recognized by those skilled in the art that the design of an expression vector can depend on factors such as the selection of host cells to be transformed, the desired level of protein expression, and so on. A variety of factors understood by those skilled in the art should be considered when selecting an expression regulatory sequence. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the actual DNA sequence encoding the target IL-2 mutain, particularly with respect to its potential secondary structure.
[0205] promoter: In some embodiments, regulatory sequences are promoters, and these are selected, for example, based on the cell type whose expression is being sought. A promoter is an untranslated sequence located upstream (5') of the start codon of a structural gene (generally within about 100–1000 bp) that controls the transcription and translation of a specific nucleic acid sequence to which it is functionally linked. Such promoters are typically divided into two classes: inductive promoters and constitutive promoters. Inductive promoters are those that initiate an increased level of transcription from controlled DNA in response to certain changes in culture conditions, such as the presence or absence of nutrients or temperature changes. A large number of promoters recognized by a diverse range of potential host cells are well known.
[0206] The T7 promoter can be used in bacteria, the polyhedrin promoter in insect cells, and the cytomegalovirus promoter or metallothionein promoter in mammalian cells. Furthermore, in higher eukaryotes, tissue-specific and cell-type-specific promoters are widely available. These promoters are so named because they can direct the expression of nucleic acid molecules in a given tissue or cell type within the body. Those skilled in the art are well aware of numerous promoters and other regulatory elements that can be used to direct nucleic acid expression.
[0207] Transcription from vectors in mammalian host cells can be controlled, for example, from the genomes of viruses such as polyomaviruses, fowlpox viruses, adenoviruses (e.g., human adenovirus serotype 5), bovine papillomavirus, aerosarcoma viruses, cytomegaloviruses, retroviruses (e.g., mouse stem cell viruses), hepatitis B viruses, and most preferably simian virus 40 (SV40), by heterogeneous mammalian promoters, such as actin promoters, PGK (phosphoglycerate kinase), or immunoglobulin promoters, or heat shock promoters, provided that such promoters are compatible with the host cell line. Early and late promoters of the SV40 virus can be conveniently obtained as SV40 restriction fragments that also contain the SV40 virus origin of replication.
[0208] Enhancer: Transcription in higher eukaryotes is often increased by inserting enhancer sequences into vectors. Enhancers are typically cis-acting DNA elements, usually around 10–300 bp in length, that act on promoters to increase their transcription. Enhancers are relatively orientation and position-independent and can be found not only at the 5' and 3' positions of the transcription unit, within introns, but also within the coding sequence itself. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, alpha-fetoprotein, and insulin). However, typically, enhancers derived from eukaryotic viruses will be used. Examples include the SV40 enhancer at the late side of the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer at the late side of the origin of replication, and the adenovirus enhancer. Enhancers can be spliced into the coding sequence in the expression vector at the 5' or 3' position, but are preferably located at the 5' site of the promoter. Expression vectors used in eukaryotic host cells also contain sequences necessary for transcription termination and mRNA stabilization. Such sequences are typically obtained from the 5' untranslated region, and sometimes the 3' untranslated region, of eukaryotic or viral DNA or cDNA. Constructing a suitable vector containing one or more of the above components employs standard techniques.
[0209] In addition to sequences that promote the transcription of inserted nucleic acid molecules, vectors may contain origins of replication and other genes encoding selection markers. For example, the neomycin resistance (neoR) gene confers G418 resistance to cells expressing it, thus enabling phenotypic selection of transfected cells. Additional examples of marker or reporter genes include beta-lactamase, chloramphenicol acetyltransferase (CAT), adenosine deaminase (ADA), dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase (HPH), thymidine kinase (TK), lacZ (encoding beta-galactosidase), and xanthine guanine phosphoribosyltransferase (XGPRT). Those skilled in the art can easily determine whether a given regulatory element or selection marker is suitable for use in a particular experimental context.
[0210] The proper assembly of the expression vector can be confirmed by nucleotide sequencing, restriction mapping, and the expression of a suitable bioactive polypeptide in a host.
[0211] Host cell: The disclosure further provides prokaryotic or eukaryotic cells containing and expressing a nucleic acid molecule encoding IL-2 mutein. The cells of the disclosure are transfected cells, i.e., cells into which a nucleic acid molecule, such as a nucleic acid molecule encoding a mutant IL-2 polypeptide, has been introduced by recombinant DNA technology. Progeny of such cells are also considered to be within the scope of the disclosure.
[0212] Host cells are typically selected according to their compatibility with the chosen expression vector, the toxicity of the product encoded by the DNA sequence of the present invention, their secretory characteristics, their ability to correctly fold polypeptides, their fermentation or culture requirements, and the ease of purifying the product encoded by the DNA sequence. Suitable host cells for cloning or expressing DNA in the vectors herein are prokaryotic cells, yeast cells, or higher eukaryotic cells.
[0213] In some embodiments, recombinant IL-2 mutain or its bioactive variants can also be produced in eukaryotes, such as yeast cells or human cells. Suitable eukaryotic host cells include insect cells (examples of baculovirus vectors available for protein expression in cultured insect cells (e.g., Sf9 cells) include the pAc series (Smith et al. (1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-39)); yeast cells (examples of vectors for expression in yeast S. cerevisia include pYepSec1 (Baldari et al. (1987) EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123), and pYES2 (Invitrogen Corporation, San Diego, This includes pCDM8 (Seed (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6:187:195)).
[0214] Examples of useful mammalian host cell lines include mouse L cells (LM[TK-], ATCC#CRL-2648), monkey kidney CV1 cell line transformed with SV40 (COS-7, ATCC CRL 1651); human embryonic kidney cell line (HEK293 or HEK293 cells subcloned for growth in suspension culture); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells / -DHFR (CHO); mouse Sertoli cells (TM4); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1 587); human cervical cancer cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); and human liver cells (Hep G2, HB). Examples include 8065); mouse mammary tumors (MMT 060562, ATCC CCL51); TRI cells; MRC5 cells; FS4 cells; and human hepatocellular carcinoma cell line (Hep G2). In mammalian cells, the regulatory function of expression vectors is often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, and simian virus 40.
[0215] IL-2 mutein can be produced in prokaryotic hosts such as the bacterium Escherichia coli, or in eukaryotic hosts such as insect cells (e.g., Sf21 cells), or mammalian cells (e.g., COS cells, NIH 3T3 cells, or HeLa cells). These cells are available from many sources, including the American Cell Culture Lineage Preservation Organization (Manassas, Va.). When selecting an expression system, the only question is whether the components are compatible with each other. Those skilled in the art can make such a decision. Furthermore, if guidance is needed in selecting an expression system, those skilled in the art may consult Ausubel et al. (Current Protocols in Molecular Biology, John Wiley and Sons, New York, NY, 1993) and Pouwels et al. (Cloning Vectors: A Laboratory Manual, 1985 Suppl. 1987).
[0216] In some embodiments, the resulting IL-2 mutein may or may not be glycosylated depending on the host organism used to produce the mutein. If bacteria are selected as the host, the produced IL-2 mutein will likely not be glycosylated. On the other hand, eukaryotic cells will likely glycosylate the IL-2 mutein, though perhaps not in the same way that native IL-2 is glycosylated.
[0217] For further expression systems for both prokaryotic and eukaryotic cells, see Chapters 16 and 17 of Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, NY). See also Goeddel (1990) in Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, Calif).
[0218] Transfection: The expression construct can be introduced into host cells to produce the IL-2 mutein disclosed herein or its bioactive form. The vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, NY) and other standard molecular biology laboratory manuals.
[0219] To facilitate the transfection of target cells, target cells may be directly exposed to nonviral vectors under conditions that promote the uptake of nonviral vectors. Examples of conditions that promote the uptake of foreign nucleic acids by mammalian cells are well known in the art and include, but are not limited to, chemical means (e.g., Lipofectamine®, Thermo-Fisher Scientific), high salt levels, and magnetic fields (electroporation).
[0220] Cell culture: Cells can be cultured in conventional nutrient media modified to be suitable for inducing promoters, selecting transformants, or amplifying genes encoding desired sequences. Mammalian host cells can be cultured in a variety of media. Commercial media such as Ham's F10 (Sigma), Minimum Essential Medium ((MEM), Sigma), RPMI 1640 (Sigma), and Dulbecco's Modified Eagle Medium ((DMEM), Sigma) are suitable for culturing host cells. Any of these media may be supplemented as needed with hormones and / or other growth factors (e.g., insulin, transferrin, or epidermal growth factor), salts (e.g., sodium chloride, calcium, magnesium, and phosphates), buffers (e.g., HEPES), nucleosides (e.g., adenosine and thymidine), antibiotics, trace elements, and glucose or equivalent energy sources. Any other necessary nutritional supplements may also be included in appropriate concentrations that would be known to those skilled in the art. The culture conditions, such as temperature and pH, are those previously used in host cells selected for expression and will be obvious to those skilled in the art.
[0221] Recombinant protein recovery: Recombinantly produced IL2 mutein polypeptide can be recovered from the culture medium as a secreted polypeptide if the secretion leader sequence is adopted. Alternatively, IL2 mutein polypeptide can also be recovered from host cell lysates. Protease inhibitors, such as phenylmethylsulfonyl fluoride (PMSF), may be used during the recovery step from cell lysates to inhibit proteolysis during purification, and antibiotics may be included to prevent the growth of exogenous contaminants.
[0222] purification: Various purification steps are known in the art, such as affinity chromatography. Affinity chromatography utilizes highly specific binding sites normally present on biomolecules to separate molecules according to their ability to bind to specific ligands. Covalent bonding links the ligand to an insoluble porous support medium, thereby separating and purifying a second species from a mixture by clearly presenting the ligand on a protein sample and using the natural specific binding of one molecular species. Antibodies are commonly used in affinity chromatography. Size selection steps may also be used, such as gel filtration chromatography (also known as size exclusion chromatography or molecular sieve chromatography) to separate proteins according to their size. In gel filtration, the protein solution passes through a column packed with a semipermeable porous resin. The semipermeable resin has a pore size range that determines the size of the proteins that can be separated by the column.
[0223] IL-2 mutein produced by transformed hosts can be purified according to any suitable method. Various methods for purifying IL-2 are known. For example, see Current Protocols in Protein Science, Vol 2. Eds: John E. Coligan, Ben M. Dunn, Hidde L. Ploehg, David W. Speicher, Paul T. Wingfield, Unit 6.5 (Copyright 1997, John Wiley and Sons, Inc). IL-2 mutein can be isolated from inclusion bodies produced in Escherichia coli, or from conditioned media of mammalian or yeast cultures producing a given mutein, using cation exchange, gel filtration, and / or reversed-phase liquid chromatography.
[0224] Substantially purified forms of recombinant polypeptides can be purified from expression systems using routine biochemical procedures and used, for example, as therapeutic agents as described herein.
[0225] The biological activity of IL-2 mutein can be assayed by any suitable method known in the art, and may be evaluated in a substantially purified form, or as a cell lysate, or as a portion of cell culture if a secretory leader sequence is employed for expression. Such activity assays include CTLL-2 proliferation, induction of phospho-STAT5 (pSTAT5) activity in T cells, PHA-blast proliferation, and NK cell proliferation.
[0226] formulation Mutein can be administered to mammals for therapeutic purposes. Administration may be intravenous, as a bolus, or as a continuous infusion over a period of time. Alternative routes of administration include intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, intra-sacral, subarachnoid, oral, topical, or inhalation routes. IL2 mutein can also exert not only local but systemic therapeutic effects when appropriately administered via intratumoral, peritumoral, intralesional, intranodular, or perilesional routes, or into the lymphatic system.
[0227] In some embodiments, the subject IL-2 mutein and / or nucleic acid can be incorporated into a composition comprising a pharmaceutical composition. Such a composition typically comprises a polypeptide or nucleic acid molecule and a pharmaceutically acceptable carrier. The pharmaceutical composition is formulated to be compatible with its intended route of administration and is suitable for therapeutic uses in which IL-2 mutein will be administered to subjects requiring treatment or prevention.
[0228] Parenteral formulations : The variant IL-2 polypeptides of the present invention may be administered orally, but they are more likely to be administered via parenteral routes. Examples of parenteral administration include, for example, intravenous, intradermal, subcutaneous, transdermal (topical), transmucosal, and rectal administration. Parenteral formulations, including solutions or suspensions used for parenteral administration, may include vehicles, carriers, and buffers. Pharmaceutical formulations for parenteral administration include sterile aqueous solutions (if water-soluble) or dispersions, and sterile powders for the immediate preparation of sterile injections or dispersions.
[0229] Carrier The carrier contains sterile diluents such as water for injection, saline solution, fixative oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of coating agents such as lecithin, in the case of dispersions by maintaining the required particle size, and by the use of surfactants, such as sodium dodecyl sulfate. For intravenous administration, suitable carriers include physiological saline solution, bacteriostatic water, Cremophor EL® (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS).
[0230] cushioning agent The term buffering agent includes buffers such as acetates, citrates, or phosphates, and agents for adjusting tonicity, such as sodium chloride or dextrose. pH can be adjusted using acids or bases such as monosodium phosphate and / or disodium phosphate, hydrochloric acid, or sodium hydroxide (e.g., pH approximately 7.2 to 7.8, e.g., to 7.5).
[0231] dispersionGenerally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other required components from the components listed above. In the case of sterile powders for the preparation of sterile injection solutions, preferred preparation methods are vacuum drying and freeze-drying, which yield a powder of the active component plus any further desired components from its previously sterile filtered solution.
[0232] Preservatives Pharmaceutical formulations for parenteral administration should be sterile and fluid to facilitate easy syringe passage. They should be stable under manufacturing and storage conditions and protected from contamination. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as active agents like benzyl alcohol or methylparaben; antioxidants like ascorbic acid or sodium bisulfite; chelating agents like ethylenediaminetetraacetic acid; parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and others. Sterile solutions can be prepared by incorporating the required amount of the active compound into a suitable solvent along with one or a combination of the components listed above, and then, if necessary, by sterile filtration.
[0233] Isotonic agent In many cases, it would be preferable to include an isotonic agent, such as sugar, polyalcohol, such as mannitol, sorbitol, or sodium chloride, in the composition.
[0234] Oral compositionOral compositions, if used, generally contain an inert diluent or food carrier. For oral therapeutic administration, the active compound may be incorporated with an excipient and used in the form of tablets, lozenges, or capsules, such as gelatin capsules. Oral compositions may also be prepared using a liquid carrier for use as a mouthwash. Pharmaceutically compatible binders and / or auxiliary substances may be included as part of the composition. Tablets, pills, capsules, lozenges, etc. may contain the following components: binders, e.g., crystalline cellulose, tragacanth gum, or gelatin; excipients, e.g., starch, or lactose; disintegrants, e.g., alginic acid, Primogel®, or corn starch; lubricants, e.g., magnesium stearate, or Sterotes®; flow enhancers, e.g., colloidal silicon dioxide; sweeteners, e.g., sucrose, or saccharin; or flavoring agents, e.g., peppermint, methyl salicylate, or orange flavoring, or any compound of similar nature.
[0235] Inhalation preparations When administered by inhalation, the target IL-2 mutein, or the nucleic acid encoding it, is delivered in the form of an aerosol spray from a pressurized container or a dispenser containing a suitable propellant, such as carbon dioxide, or from a nebulizer. Such methods include those described in U.S. Patent No. 6,468,798.
[0236] Mucous membranes and percutaneous tissueSystemic administration of the target IL-2 mutein or nucleic acid can also be done via mucosal or transdermal means. For mucosal or transdermal administration, a permeation agent suitable for the permeation barrier is used in the formulation. Such permeation agents are generally known in the art and include, for example, detergents, bile salts, and fusidic acid derivatives for mucosal administration. Mucosal administration can be achieved by the use of nasal sprays or suppositories for rectal delivery (e.g., using conventional suppository bases such as cocoa butter and other glycerides) or retained enemas. For transdermal administration, the active compound is formulated into ointments, plasters, gels, or creams, as is generally known in the art, and may incorporate permeation enhancers such as ethanol or lanolin.
[0237] Sustained-release formulations and depot formulations In some embodiments, IL-2 mutein is administered as a formulation to provide sustained release of the IL-2 mutein active ingredient. Examples of sustained-release formulations of injectable compositions can be brought about by including an active ingredient that delays absorption, such as aluminum monostearate and gelatin, in the composition. In one embodiment, the target IL-2 mutein or nucleic acid is prepared together with a carrier that protects the mutant IL-2 polypeptide from rapid elimination from the body, and is a controlled-release formulation, for example, comprising an implanter and a microencapsulation delivery system. Biodegradable biocompatible polymers such as ethylene vinyl acetate, polyacid anhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Such formulations can be prepared using standard techniques. The materials are also commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposome suspensions (containing liposomes that target monoclonal antibodies against viral antigens to infected cells) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
[0238] Administration of nucleic acid encoding IL-2 mutain (gene therapy)In some embodiments, the compound (target IL-2 mutein or nucleic acid) may also be administered by transfection or infection using methods known in the art, including, but not limited to, those described by McCaffrey et al. (Nature 418:6893, 2002), Xia et al. (Nature Biotechnol. 20: 1006-1010, 2002), or Putnam (Am. J. Health Syst. Pharm. 53: 151-160, 1996, erratum at Am. J. Health Syst. Pharm. 53:325, 1996). In some embodiments, IL-2 mutein is administered to the subject by administration of a pharmaceutically acceptable formulation of a recombinant expression vector. In one embodiment, the recombinant expression vector is a viral vector. In some embodiments, the recombinant vector is a recombinant viral vector. In some embodiments, the recombinant viral vector is a replication-deficient adenovirus derived from recombinant adeno-associated virus (rAAV) or recombinant adenovirus (rAd), particularly human adenovirus serotype 3 and / or 5. In some embodiments, the replication-deficient adenovirus has one or more modifications to the E1 region that interfere with the virus's ability to initiate the cell cycle and / or apoptotic pathway in human cells. The replication-deficient adenovirus vector may optionally include a deletion in the E3 domain. In some embodiments, the adenovirus is a replicable adenovirus. In some embodiments, the adenovirus is a replicable recombinant virus engineered to selectively replicate in lymphocytes.
[0239] In one embodiment, an IL2 mutein formulation is provided in accordance with the teachings of Fernandes and Taforo, U.S. Patent No. 4,604,377, issued on August 5, 1986, and Yasui et al., U.S. Patent No. 4,645,830, the teachings of which are incorporated herein by reference.
[0240] Parenteral preparations may be encapsulated in glass or plastic ampoules, disposable syringes, or multi-dose vials. In one embodiment, the formulation is provided in a pre-filled syringe for parenteral administration.
[0241] How to use This disclosure further provides a method for treating subjects suffering from a disease, disorder, or condition by administering a therapeutically effective dose of the IL-2 mutein of this disclosure (or a recombinant virus encoding IL-2 mutein, or nucleic acid encoding IL-2 mutein). In the treatment of such diseases, the IL-2 mutein of this disclosure may incorporate modifications to provide advantageous properties, such as reduction of vasoleap syndrome. Disorders to which treatment with the IL-2 mutein of this disclosure (including pharmaceutically acceptable formulations containing IL-2 mutein and / or a recombinant virus encoding such IL-2 mutein, or an encoding nucleic acid molecule) may be applicable include viral infections (e.g., AIDS, influenza, chronic HCV, chronic B, C, or D viral hepatitis), and Helicobacter pylori. Pylori infection, HTLV, organ rejection, graft-versus-host disease, autoimmune thyroid disease, multiple sclerosis, allergies, asthma, neurodegenerative diseases including Alzheimer's disease, systemic lupus erythematosus (SLE), autoinflammatory diseases, inflammatory bowel disease (IBD), Crohn's disease, diabetes including type 1 or type 2 diabetes, inflammation, autoimmune diseases, atopic diseases, paraneoplastic autoimmune diseases, chondritis, arthritis, rheumatoid arthritis, juvenile arthritis, juvenile rheumatoid arthritis, polyarticular juvenile rheumatoid arthritis, systemic juvenile rheumatoid arthritis, juvenile rheumatoid arthritis This includes, but is not limited to, inflammatory or autoimmune diseases such as ankylosing spondylitis, juvenile enteroarthritis, juvenile reactive arthritis, juvenile Reiter syndrome, SEA syndrome (seronegative, enthesopathy, arthropathy syndrome), juvenile dermatomyositis, juvenile psoriatic arthritis, juvenile scleroderma, juvenile systemic lupus erythematosus, juvenile vasculitis, oligoarthritis, polyarthritis, systemic rheumatoid arthritis, ankylosing spondylitis, enteroarthritis, reactive arthritis, Reiter syndrome, and SEA syndrome (seronegative, enthesopathy, arthropathy syndrome).
[0242] Other examples of proliferative and / or differentiation disorders to which treatment with IL-2 mutein (including pharmaceutically acceptable formulations comprising IL-2 mutein and / or a nucleic acid molecule encoding said IL-2 mutein, including recombinant viruses encoding said IL-2 mutein) as disclosed herein include, but are not limited to, cutaneous disorders. Cutaneous disorders may involve abnormal activity of cells or groups of cells or layers in the dermis, epidermis, or subcutaneous tissue layers, or abnormalities at the dermal-epidermal junction. For example, cutaneous disorders may involve abnormal activity of keratinocytes (e.g., hyperproliferative basal keratinocytes and basal keratinocytes), melanocytes, Langerhans cells, Merkel cells, immune cells, and other cells found in one or more of the epidermal layers, such as the basal layer (germ layer), spinous layer, granular layer, slender layer, or stratum corneum. In other embodiments, the disorder may involve abnormal activity of dermal cells found in the cortex, for example, the papillary or reticular layer, such as endothelial cells, fibroblasts, and immune cells (e.g., mast cells or macrophages).
[0243] Examples of skin disorders include psoriasis, psoriatic arthritis, dermatitis (eczema), e.g., exfoliative dermatitis or atopic dermatitis, pityriasis rubra pilaris, pityriasis rosea, parapsoriasis, pityriasis lichenoid, lichen planus, lichen patella, ichthyosis-like skin diseases, keratosis, skin diseases, alopecia areata, pyoderma gangrenosum, vitiligo, bullous pemphigoid (e.g., ocular scarring bullous pemphigoid or bullous bullous pemphigoid), urticaria, porokeratosis, rheumatoid arthritis with hyperproliferation and inflammation of epithelial-associated cells covering the joint capsule; dermatitis such as seborrheic dermatitis and photodermatitis; seborrheic keratosis, senile keratosis, actinic keratosis, photo-induced keratosis. This includes keratosis, and keratosis such as follicular keratosis; acne vulgaris; keloids and prevention of keloid formation; nevi; warts, including condyloma or genital warts, and human papillomavirus (HPV) infections such as sexually transmitted warts; vitiligo; lichen planus; and keratitis. Skin disorders may include dermatitis, such as atopic dermatitis or allergic dermatitis, or psoriasis.
[0244] The compositions of this disclosure (including pharmaceutically acceptable formulations comprising IL2 mutein and / or a nucleic acid molecule encoding said IL2 mutein, including a recombinant virus encoding said IL2 mutein) may also be administered to patients who have (or may have) psoriasis or psoriatic disorders. The term “psoriasis” is intended to have its medical meaning, namely a disease affecting the skin, producing raised, thickened, scaly, and non-scarring lesions. The lesions are typically well-defined erythematous papules covered with overlapping, shiny scales. The scales are typically silvery-white or slightly milky white. Nail complications often occur, resulting in punctate depressions, separation, thickening, and discoloration of the nails. Psoriasis is sometimes associated with arthritis, which can impair the limbs. Keratinocyte hyperplasia, along with epidermal inflammation and reduced keratinocyte differentiation, is a key feature of epidermal hyperplasia in psoriasis. Several mechanisms have been proposed to explain the keratinocyte hyperplasia that characterizes psoriasis. Cellular immune disorders are also significant in the pathogenesis of psoriasis. Examples of psoriatic disorders include chronic quiescent psoriasis, plaque psoriasis, moderate to severe plaque psoriasis, plaque psoriasis, guttate psoriasis, erythrodermic psoriasis, generalized pustular psoriasis, annular pustular psoriasis, or focal pustular psoriasis.
[0245] In certain embodiments, the subject IL-2 muteins described herein, functioning as IL-2 antagonists, are useful for the treatment of one or more conditions, where the inhibition of one or more IL-2 and / or IL-15-dependent functions is useful. In certain embodiments, the IL-2 muteins described herein are used for the treatment of one or more diseases or conditions, where the inhibition of CD122 / CD132 heterodimerization and downstream signaling is useful (e.g., GVDH or leukemia). In one embodiment, the method of treatment is a method for the treatment of graft-versus-host disease (GVHD). In some embodiments, the treatment includes administering a therapeutically effective dose of IL-2 mutein (including pharmaceutically acceptable formulations comprising IL2 mutein and / or encoding nucleic acid molecules, including recombinant viruses encoding said IL2 mutein) to a subject having GVHD.
[0246] Combinations of IL-2 mutein and additional therapeutic agents for autoimmune diseases: This disclosure provides the use of IL2 mutain of this disclosure in combination with one or more additional active agents ("adjunct agents") in the treatment of autoimmune diseases. As used herein, the term "adjunct agents" includes agents that can be administered or introduced separately, for example, that can be formulated separately for separate administrations (for example, they may be provided as kits), and / or therapies that can be administered or introduced in combination with IL2 mutain.
[0247] As used herein, the term “in combination with” when used in relation to the administration of multiple active substances to a subject refers to the administration of a first active substance and at least one further (i.e., second, third, fourth, fifth, etc.) active substance to the subject. For the purposes of the present invention, if the biological effect resulting from the administration of the first active substance persists in the subject at the time of administration of the second active substance, then one active substance (e.g., IL2 mutein) is considered to be administered in combination with the second active substance (e.g., a therapeutic autoimmune antibody such as Humira®), and as a result, the therapeutic effects of the first and second active substances overlap. For example, while therapeutic antibodies (e.g., adalimumab in the treatment of Crohn's disease) are sometimes administered every two weeks by IV infusion, IL2 mutein of this disclosure may be administered more frequently, for example, daily, by BID, or weekly. However, if the administration of the first active agent (e.g., etanercept) provides a long-term therapeutic effect, and the administration of the second active agent (e.g., IL-2 mutein) provides its therapeutic effect while the therapeutic effect of the first active agent is still present, then the second active agent is considered to be administered in combination with the first active agent, even if the first active agent is administered at a time significantly later (e.g., several days or weeks) than the administration of the second active agent. In one embodiment, one active agent is considered to be administered in combination with the second active agent if the first and second active agents are administered simultaneously (within 30 minutes of each other), concurrently or sequentially. In some embodiments, the first active agent is considered to be administered "simultaneously" with the second active agent if the first and second active agents are administered within approximately 24 hours, preferably within approximately 12 hours, preferably within approximately 6 hours, preferably within approximately 2 hours, or preferably within approximately 30 minutes. The term "in combination" should also be understood to apply to situations where the first and second active agents are co-formulated as a single pharmaceutically acceptable formulation and the co-formulation is administered to the subject. In certain embodiments, for example, if one active agent is administered before one or more other active agents, IL2 mutein and the co-active agent are administered or applied sequentially.In other embodiments, for example, when two or more active ingredients are administered simultaneously or nearly simultaneously, IL2 mutein and the adjunct active ingredient are administered simultaneously; the two or more active ingredients may exist as two or more separate formulations, or they may be combined into a single formulation (i.e., concurrent formulation). Whether the active ingredients are administered sequentially or simultaneously, they are considered to be administered in combination for the purposes of this disclosure.
[0248] In some embodiments, the adjuvant is one or more adjuvant selected from the group consisting of corticosteroids (including, but not limited to, prednisone, budesonide, and prednisolone), Janus kinase inhibitors (including, but not limited to, tofacitinib (Xeljanz®)), calcineurin inhibitors (including, but not limited to, cyclosporine and tacrolimus), mTor inhibitors (including, but not limited to, sirolimus and everolimus), IMDH inhibitors (including, but not limited to, azathioprine, leflunomide, and mycophenolate), biologics such as abatacept (Orencia®) or etanercept (Enbrel®), and therapeutic antibodies. Examples of therapeutic antibodies that may be administered as adjuvant in combination with IL2 mutein of this disclosure in the treatment of autoimmune diseases include anti-CD25 antibodies (e.g., For example, daclizumab and basiliximab), anti-VLA-4 antibodies (e.g., natalizumab), anti-CD52 antibodies (e.g., alemtuzumab), anti-CD20 antibodies (e.g., rituximab, ocrelizumab), anti-TNF antibodies (e.g., infliximab and adalimumab), anti-IL-6R antibodies (e.g., tocilizumab), anti-TNFα antibodies (e.g., adalimumab (Humira®), golimumab, and infliximab), anti-integrin-α4β7 antibodies (e.g., vedolizumab), anti This includes, but is not limited to, IL-17a antibodies (e.g., brodalumab or secukinumab), anti-IL-4Rα antibodies (e.g., dupilumab), anti-RANKL antibodies, IL-6R antibodies, anti-IL-1β antibodies (e.g., canakinumab), anti-CD11a antibodies (e.g., efalizumab), anti-CD3 antibodies (e.g., muromonab), anti-IL5 antibodies (e.g., mepolizumab, reslizumab), anti-BLyS antibodies (e.g., belimumab); and anti-IL-12 / IL-23 antibodies (e.g., ustekinumab).
[0249] Many therapeutic antibodies are approved for clinical use in the treatment of autoimmune diseases. Table 4 provides examples of antibodies approved by the U.S. Food and Drug Administration (FDA) for use in subjects with autoimmune diseases, which may be administered in combination with IL-2 mutein (and optionally further adjuvants) as an adjuvant for the treatment of the indicated autoimmune diseases.
[0250] (Table 4) TIFF0007875121000013.tif182159TIFF0007875121000014.tif200159
[0251] The aforementioned antibodies, useful as auxiliary agents in carrying out the methods of this disclosure, may be administered alone, or in the form of any antibody-drug conjugate (ADC) comprising the antibody, a linker, and one or more drugs (e.g., 1, 2, 3, 4, 5, 6, 7, or 8 drugs), or in a modified form (e.g., PEGylation).
[0252] In some embodiments, the adjuvant is a vaccine. The IL2 mutain of the present invention may be administered to a subject in combination with a vaccine as an adjuvant to enhance the immune response to the vaccine, in accordance with the teachings of Doyle et al., U.S. Patent No. 5,800,819, issued September 1, 1998. Examples of vaccines that can be combined with the IL2 mutein of the present invention include HSV vaccine, Bordetella pertussis, Escherichia coli vaccine, pneumococcal vaccines including polyvalent pneumococcal vaccines such as Prevnar® 13, diphtheria, tetanus and pertussis vaccines (including combination vaccines such as Pediatrix® and Pentacel®), varicella vaccine, Haemophilus influenzae type B vaccine, human papillomavirus vaccines such as Garasil®, polio vaccine, leptospirosis vaccine, respiratory disease combination vaccine, Moraxella vaccine, and attenuated live or dead virus products, such as bovine respiratory disease vaccine (RSV), polyvalent human influenza vaccine (e.g., Fluzone® and tetravalent Fluzone®), feline leukemia vaccine, infectious gastroenteritis vaccine, and rabies vaccine.
[0253] Dosage The dosage, toxicity, and therapeutic efficacy of such target IL-2 muteins or nucleic acid compounds can be determined by standard pharmaceutical procedures in cell culture or experimental animals. Data obtained from cell culture assays and animal studies can be used to establish dosage ranges for human use. Doses of such compounds are preferably within the range of circulating concentrations that include the ED50 for least tolerable toxicity. Doses may vary within this range depending on the form of administration employed and the route of administration used. For any compound used in the method of the present invention, the therapeutically effective dose can first be estimated from a cell culture assay. The dose can be set in an animal model to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound that achieves maximum symptom half-residual inhibition) as determined in cell culture. Using such information, a more accurate determination of a useful dose in humans can be made. Plasma levels can be measured, for example, by high-performance liquid chromatography.
[0254] As defined herein, the therapeutically effective dose (i.e., effective dosage) of the target IL-2 mutein depends on the selected polypeptide. For example, a single dose in the range of about 0.001 to 0.1 mg / kg patient body weight may be administered. In some embodiments, doses of about 0.005, 0.01, or 0.05 mg / kg may be administered. In some embodiments, 600,000 IU / kg may be administered (IU can be determined by a lymphocyte proliferation bioassay and expressed in International Units (IU) as established by the World Health Organization First International Standard for Interleukin-2 (Human)).
[0255] In some embodiments, the pharmaceutically acceptable forms of IL2 mutein of this disclosure are administered to subjects in accordance with the “low-dose” treatment protocols described in Klatzman et al., U.S. Patent No. 9,669,071 and No. 10,293,028B2, the full teachings of which are incorporated herein by reference. Further low-dose protocols are described in Smith, KA (1993) Blood 81(6): 1414-1423 and He, et al (2016) Nature Medicine 22(9): 991-993.
[0256] In accordance with another aspect of this disclosure, a method is provided for stimulating the immune system of an animal by administering the IL-2 mutein of this disclosure. The method is useful for treating medical conditions in which the host immune response is deficient. In treating a subject, a therapeutically effective dose of the compound (i.e., the active ingredient) is administered. The therapeutically effective dose refers to the amount of the active ingredient that produces improvement in the subject's symptoms or extension of survival. The effective dose will vary depending on the characteristics of the IL-2 mutein administered, the physical characteristics of the subject being treated, the nature of the disease or condition, etc. A single dose can range from about 50,000 IU / kg to about 1,000,000 IU / kg or more, more typically in the range of about 600,000 IU / kg. This may be repeated several times a day (e.g., 2-3 times a day) for several days (e.g., about 3-5 consecutive days), then repeated once or multiple times after a rest period (e.g., about 7-14 days). Therefore, the effective dose may include a single dose or multiple doses over a period of time (for example, individual doses of approximately 600,000 IU / kg, administered approximately 20 to 30 times, each over approximately 10 to 20 days).
[0257] The composition may be administered once or multiple times per week, including once every other day, from once or multiple times per day. Those skilled in the art will recognize that certain factors, including but not limited to the severity of the disease or disorder, previous treatments, the subject's overall health and / or age, and other pre-existing conditions, may influence the dosage and timing required to effectively treat the subject. Furthermore, treatment of the subject with a therapeutically effective dose of the subject IL-2 mutheine may include a single treatment or a series of treatments. In one embodiment, the composition is administered every 8 hours for 5 days, followed by a rest period of 2 to 14 days, e.g., 9 days, followed by another 5 days of administration every 8 hours. In another embodiment, the composition is administered every 2 days for at least 6 days, optionally at least 10 days, optionally at least 14 days, optionally at least 30 days, or optionally at least 60 days. Those skilled in the art will recognize that treatment may be extended for the treatment of chronic conditions and may prevent recurrence of symptoms of chronic diseases such as autoimmune diseases (e.g., psoriasis, IBD, etc.).
[0258] Pharmaceutical compositions may be contained in a container, pack, or dispenser along with instructions for administration.
[0259] Although compounds exhibiting toxic side effects may be used, care should be taken to design delivery systems that target such compounds to the affected tissue site in order to minimize potential damage to uninfected cells and thereby reduce side effects. The toxicity and therapeutic efficacy of IL-2 mutein can be determined by standard pharmaceutical procedures in cell culture or experimental animals. Using cell culture assays and animal studies, LD 50 (A lethal dose in 50% of the population) and ED 50 (A dose that is therapeutically effective for 50% of the population) can be determined. The dose ratio between toxic effects and therapeutic effects is the therapeutic index, and the therapeutic index is the ratio LD50. 50 / ED 50It can be expressed as follows. IL-2 variants exhibiting a large therapeutic index are preferred. Data obtained from these cell culture assays and animal studies can be used to determine a range of dosages suitable for human use. Doses of such variants are preferably ED with little or no toxicity. 50 It is within the range of circulating concentrations, including [specific component]. The dosage may vary within this range depending on various factors, such as the dosage form used, the route of administration utilized, and the patient's condition.
[0260] The effective therapeutic dose is initially IC 50 This can be estimated from cell culture assays by determining the IC. Then, the dose is set in an animal model and the IC determined in cell culture is obtained. 50 A circulating plasma concentration range including [specific values] can be achieved. Using this information, useful doses in humans can be determined more precisely. Plasma levels can be measured, for example, by HPLC. The exact formulation, route of administration, and dosage can be selected by an individual physician, taking into account the patient's condition.
[0261] The attending physician of a patient treated with IL-2 mutheine and optionally adjuvants will know when and how to terminate, interrupt, or adjust the administration due to factors such as toxicity or organ dysfunction. Conversely, the attending physician will also know to adjust the treatment to a higher level if the clinical response is insufficient (excluding toxicity). The size of the dose administered in the management of the disorder of interest will vary depending on the severity of the condition being treated, the route of administration, etc. The severity of the condition can be assessed in part by, for example, standard prognostic assessment methods. Furthermore, the dose and possibly the number of dosings will also vary according to the individual patient's age, weight, and response.
[0262] The IL-2 variants of the present invention may be administered to an individual alone as pharmaceuticals formulated to suit the delivery route and the condition being treated. Suitable routes may include oral, rectal, transdermal, vaginal, transmucosal, or intestinal administration; parenteral delivery including intramuscular, subcutaneous, and intrathecal injections, as well as subarachnoid, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections. For transmucosal administration, a permeabilizing agent suitable for the barrier to permeate is used in the formulation. Such permeabilizing agents are generally known in the art.
[0263] IL-2 variants can be manufactured as formulations with one or more pharmaceutically acceptable carriers or excipients, as is well known in the art. Techniques for formulation and administration can be found in "Remington's Pharmaceutical Sciences," (18th ed., Mack Publishing Co., Easton, Pa., 1990). Specific examples of IL-2 formulations are described in U.S. Patents No. 4,604,377 and No. 4,766,106. IL-2 variants can be formulated as liquids using carriers that may contain buffers and / or salts, such as phosphate-buffered saline. Alternatively, IL-2 variants can be formulated as solids using carriers or extenders such as lactose, binders such as starch, and / or lubricants such as talc or magnesium stearate, and optionally stabilizers.
[0264] kit The disclosure also considers pharmaceutical compositions, IL2 mutain, and kits comprising the pharmaceutical composition. The kit generally takes the form of a physical structure containing various components, such as those described below, which can be used, for example, to carry out the methods described above. The kit may include IL2 mutain in the form of a ready-to-use pharmaceutical composition suitable for administration to a subject, or in a form that requires preparation before administration, such as thawing, reconstitution, or dilution. If the IL2 mutain is in a form that needs to be reconstituted by the user, the kit may also include a sterile container providing a reconstitution medium, such as a buffer, a pharmaceutically acceptable excipient, etc.
[0265] The kit of this disclosure may further include one or more auxiliary substances in addition to the other components.
[0266] The kits of this disclosure can be designed for the conditions necessary to properly maintain the components contained therein (e.g., refrigeration or freezing).
[0267] The kit may further include a label or accompanying document containing identification information about its components and instructions for their use. Each component of the kit can be contained in an individual container, and all the different containers can be placed in a single package. The label or accompanying document may include manufacturer information such as lot number and expiration date. The label or accompanying document may, for example, be incorporated into the physical structure containing the components, contained separately within the physical structure, or affixed to the components of the kit (e.g., ampoules, syringes, or vials). The label or accompanying document may be provided in physical form or in computer-readable media. In some embodiments, the actual instructions are not present in the kit, and conversely, the kit provides means for obtaining instructions via an internet site, including by secure access by providing a password (or a scannable code such as a barcode or QR code on the container of IL2 mutein or the kit containing it) from a remote source in accordance with administrative regulations (e.g., HIPAA). [Examples]
[0268] The following examples are provided to illustrate specific aspects of the invention provided herein and should not be construed as limiting.
[0269] Example 1: Generation of the human IL2 expression vector pcDNA3.1 / hygro(+)-huIL2 Human IL2 DNA open reading frame ("ORF") (Genbank NM_000586.3) was synthesized (Life Technologies GeneArt Service, Carlsbad, CA), and the NheI restriction site was incorporated using the Platinum SuperFi II DNA polymerase kit (commercially available as catalog number 12361050, ThermoFisher), substantially following the manufacturer's protocol, with primers 5' TATAGTCAGCGCCACcCATGTACAGGATGCAACTCCTGTC 3'. (SEQ ID NO: 100) and primer incorporating the ApaI restriction site 5' TATAGGGCCCTATCAAGTCAGTGTTGAGATG 3' (SEQ ID NO: 101) The PCR was amplified using [specific method / tool]. The PCR fragments were visualized on a 1% agarose gel (item #54803, Lonza, Rockland, ME), excised from the gel, and purified according to the manufacturer's protocol using the QIAquick PCR purification kit (commercially available as catalog number 28106, Qiagen, Germany).
[0270] Purified PCR fragments and mammalian expression vector pcDNA 3.1 / hygro(+) (commercially available as catalog number V87020, ThermoFisher, Carlsbad CA) were digested with NheI and ApaI (commercially available as catalog numbers R0111S and R0114L, New England Biolabs, Ipswich, MA) restriction enzymes. The expression vectors were further processed using the Quick dephosphorylation kit (commercially available as catalog number M0508L, New England Biolabs) substantially according to the manufacturer's protocol. Using the Rapid DNA Ligation Kit (commercially available as catalog number 11635379001, Sigma Aldrich, St. Louis, MO) substantially in accordance with the manufacturer's protocol, PCR fragments were ligated into pcDNA 3.1 / hygro(+), transformed into One Shot TOP 10 Chemical Competent E. coli (commercially available as catalog number C404006, Life Technologies, Carlsbad, CA), plated on LB agar plates containing 100 ug / ml carbenicillin (commercially available as catalog number L1010, Teknova, Hollister, CA), and grown overnight at 37C.
[0271] The following day, individual bacterial colonies were fished out and used to initiate 3 ml bacterial cultures in LB broth (#10855-001, Life Technologies) containing 100 ug / ml ampicillin (commercially available as catalog number A9626, Teknova). The cultures were grown overnight at 37°C. The next day, E. coli were pelletized (6,000 rpm, 10 minutes, benchtop centrifuge, commercially available as catalog number 5424, Eppendorf, Hauppauge, NY), and the DNA expression vector was isolated using the QIAprep Spin Mimprep Kit (#27106, Qiagen). Plasmid DNA was validated by sequencing (MCLab, South San Francisco, CA).
[0272] Example 2. Generation of the human IL2 REH expression vector pcDNA3.I / hygro(+)-huIL2-REH An expression vector was assembled substantially in accordance with the instructions of Example 1, introducing three mutations (L38R, Q42E, and Q146H; all numbering is based on the numbering of the full-length human IL2 ORF NM_000586.3, i.e., the numbering of hIL2 when expressed with a signal peptide, rather than the 20-amino acid sequence of a mature hIL2 molecule) into human IL2 ORF. The following was the exception: The initial template DNA used for PCR was synthesized to contain the L38R (L18R in the mature protein), Q42E (Q22E in the mature protein), and Q146H (Q126H in the mature protein) mutations.
[0273] Example 3. Generation of the human IL2 REM expression vector pcDNA3.1 / hygro(+)-huIL2 REM Expression vectors containing three mutations (L38R, Q42E, and Q146M; all numbering is based on the numbering of the full-length human IL2 ORF NM_000586.3) were assembled exactly according to the description for human IL2 expression vectors in pcDNA3.1 / hygro(+), with the following exception: the initial template DNA used for PCR was synthesized to contain the L38R, Q42E, and Q146M mutations.
[0274] Example 4. Introduction of mutations or reverse mutations into pcDNA3.1 / hygro(+)-huIL2 and pcDNA3.1 / hygro(+)-huIL2 REH expression vectors. All mutations or reverse mutations (reverting mutations in pcDNA3.1 / hygro(+)-huIL2-REH to match wild-type human IL2 ORFs) were introduced into pcDNA 3.1 / hygro(+)-huIL2 or pcDNA3.1 / hygro(+)-huIL2-REH expression vectors using the Quik Change II site-directed mutagenesis kit (#200524, Agilent Technologies, Santa Clara, CA) substantially according to the manufacturer's protocol. Tables 5 and 6 describe the generated mutations, the templates into which the mutations were introduced, and the primer sets used to introduce the mutations. Plasmid DNA isolation and sequencing analysis were performed using the same protocol as for the generation of the pcDNA3.1 / hygro-huIL2 expression vectors, as well as the transformation of the Quik Change PCR reaction into E. coli.
[0275] (Table 5) Quik Change Mutagenesis TIFF0007875121000015.tif186154TIFF0007875121000016.tif198154TIFF0007875121000017.tif142154
[0276] (Table 6) hIL2 orthologous structures TIFF0007875121000018.tif62155TIFF0007875121000019.tif205155TIFF00078751210 00020.tif203155TIFF0007875121000021.tif205155TIFF0007875121000022.tif177155
[0277] Example 5. Transient transfection in HEK293 cells All expression vectors were transiently transfected into HEK293 cells (#CRL-1573, ATCC, Manassas, VA). Approximately 1E6 HEK293 cells were seeded in 2 ml of DMEM (#10569044, Life Technologies) supplemented with 10% fetal bovine serum (#SH30071.03, Fisher Scientific, Chicago, IL) in each well of a 6-well tissue culture plate and grown overnight at 37C and 5% CO2. The following day, cells were transfected using Lipofectamine 3000 reagent (#L3000150, Life Technologies) according to the manufacturer's protocol, with 2.5 ug of DNA, 5 ul of P3000 reagent, and 7.5 ul of Lipofectamine 3000 per transfection. Transfected cells were grown at 37C and 5% CO2 for 48–72 hours, after which the conditioned medium was collected.
[0278] Example 6. Protein expression analysis Protein expression was measured by ELISA using the human IL2 V-PLEX ELISA kit (#K151QQD-4, Mesoscale Diagnostics, Baltimore, MD) according to the manufacturer's protocol (transfected medium was initially diluted 1:4, then sequentially diluted 1:2). Plates were read using a Meso Quickplex SQ120 (Mesoscale Diagnostics) with the manufacturer's pre-programmed settings for this ELISA kit. Approximate expression levels in conditioned medium samples were calculated using the human IL2 standard included in the kit.
[0279] Example 7. Determination of IL2 activity (STAT5) on CD25- and CD25+ cells. After incubation for 2-3 days, supernatant samples from 293T cells containing soluble IL2 protein were prepared according to Example 5 above and added to YT cells (CD25NEG) and YT cells manipulated to constitutively express CD25 (YTCD25POS) for approximately 20 minutes. The induction level of phospho-STAT5 (pSTAT5) was measured by flow cytometry. The results of the pSTAT5 level induction factor are shown in Figure 2 of the attached drawing. The selectivity of the IL2 protein for the CD25 state was expressed by the elevation level of phospho-STAT5 (pSTAT5) in CD25+ YT cells. YTCD25 ) the level of phospho-STAT5 (pSTAT5) in CD25-negative YT cells YT The calculation was performed assuming division by ). The results of these experiments are shown in Figure 2 of the attached diagram.
[0280] As can be seen from the presented data, the IL2 mutein of this disclosure provides selective induction of pSTAT5 on CD25-positive cells and retains significant IL2 activity.
[0281] Example 8. Evaluation of orthologue activity in human T cell clone 3F8 A representative panel of hIL-2 muteins was evaluated for activity in CD4-positive human T cell clone 3F8 cells. Following two consecutive rounds of mixed lymphocyte reactions, CD4-positive T cell clone 3F8 was generated by activation of healthy donor PBMCs with EBV-transduced B cell line JY in single-cell cloning using limiting dilution as described (Yssel and Spits (2002) Current Protocols in Immunology 7.19.1 - 7.19.12). CD4-positive T cell clone 3F8 expresses CD25 and CD122, proliferates in response to IL-2, and produces IFNγ.
[0282] 3F8 cells were contacted with the supernatant from 293T cells transfected with hIL-2 mutein as follows: Yssel medium (Iscove modified Dulbecco's medium (ThermoFisher), 0.25% w / v human albumin (Sigma), 1%, penicillin / streptomycin (ThermoFisher), 1%, ITS-X insulin, transferrin, selenium (Gibco), 30 mg / L, transferrin (Roche), 2 mg / L, palmitic acid (Sigma), 1%, LA-OA-albumin linoleic acid, oleic acid (Sigma), 1%, human serum (Gemini)) (Yssel et al (1984) J Immunol Methods 72: 219 - Cells were grown at a rate of 200,000 cells / ml in a growth medium consisting of 227) along with 100,000 cells / well of 50 Gy-irradiated JY cells and 1,000,000 cells / ml of 40 Gy-irradiated allogeneic PBMCs. After 6 days of culture and subsequent expansion using 100 pM human IL-2, the cells were washed and seeded at a rate of 50,000 cells / well in 75 μl of growth medium in a clear-bottomed black 96-well plate (Costar). A 5-fold serial dilution of the transfected 293T cell supernatant was performed in the growth medium, and 75 μl of each dilution was added in pairs to the 3F8 cell plate with a final titration of 1:2 to 1:78125. The plates were transferred to a humidified incubator (ThermoFisher) and incubated at 37°C in 5% carbon dioxide for 3 days.
[0283] The plate was removed from the incubator, and 40 μl of the culture supernatant was collected in a 96-well flat-bottom plate (Costar). The supernatant from two pairs of wells was pooled. Cells were lysed by adding 100 μl of Celltiterglo (Promega) per well, as instructed by the manufacturer. The cell lysates were mixed on an orbital shaker (VWR Scientific) at 300 rpm for 2 minutes, and then allowed to stand at room temperature for 10 minutes. The luminescence of the 3F8 cell lysates was read as counts / second using an Envision 2103 Multilabel plate reader (Perkin Elmer).
[0284] The production of IFNγ in the culture supernatant was measured using the MSD IFNγ V-Plex kit (MSD K151QOD) according to the manufacturer's instructions. Briefly, an mAb-precoated MSD IFNγ assay plate was washed three times with 150 μL of Tris wash buffer, and the IFNγ standard was diluted in Diluent 2. The culture supernatant was diluted 1:1 with Diluent 2, and 50 μL of the sample and standard were added to the IFNγ assay plate. The plate was incubated on an orbital shaker (VWR Scientific) at 300 rpm and room temperature for 120 minutes. The plate was washed three times with Tris wash buffer, and 25 μL of 1× detection antibody from Diluent 3 was added to each well. The plate was incubated on an orbital shaker (VWR Scientific) at 300 rpm and room temperature for 60 minutes. The plate was washed three times with Tris washing buffer, 150 μL of 2× Read Buffer T was added to each well, and the luminescence signal was read using a Mesoscale Quickplex SQ120 instrument. The IFNγ concentration in the supernatant was calculated based on a standard curve using MSD software.
[0285] To compare the effects of each hIL-2 mutein on 3F8 cell proliferation and IFNγ production, CelltiterGlo values and IFNγ concentrations in cells treated with supernatant were compared to those obtained in control cells treated with growth medium alone, wild-type IL-2 transfection, or supernatant from human REK IL-2 transfection. Data from these experiments are shown in Table 7 and Figures 3A-3D. These data demonstrate a correlation between the proliferation-inducing activity of hIL-2 mutein and IFNγ production.
[0286] (Table 7) Proliferation and IFNγ production by human CD4-positive T cell clone 3F8 in response to hIL2 mutein TIFF0007875121000023.tif156150
Claims
1. The following IL2 mutein polypeptide, containing the amino acid sequence (SEQ ID NO: 97), selectively induces pSTAT5 in CD25-expressing cells compared to CD25-negative cells: (AA1) a -(AA2) b -(AA3) c -(AA4) d -(AA5) e -(AA6) f -(AA7) g -(AA8) h -(AA9) i -T10-Q11-L12-Q13-L14-E15-H16-L17-(AA18)-L19-D20-L21-(AA22)-M23-I24-L25-N26 -G27-I28-N29-N30-Y31-K32-N33-P34-(AA35)-L36-T37-(AA38)-(AA39)-L40-T41-F42-K 43-F44-Y45-M46-P47-K48-K49-A50-T51-E52-L53-K54-(AA55)-L56-Q57-C58-L59-E60-E61-E62-L63-K64-P65-L66-E67-E68-(AA69)-L70-N71-L72-A73-(AA74)-S75-K76-N77-F 78-H79-(AA80)-(AA81)-P82-R83-D84-(AA85)-(AA86)-S87-N88-(AA89)-N90-(AA91)-(AA92)-V93-L94-E95-L96-(AA97)-G98-S99-E100-T101-T102-F103-(AA104)-C105-E106- Y107-A108-(AA109)-E110-T111-A112-(AA113)-I114-V115-E116-F117-L118-N119-R12 0-W121-I122-T123-F124-(AA125)-(AA126)-S127-I128-I129-(AA130)-T131-L132-T133 During the ceremony: Each of a, b, c, d, e, f, g, h, and i is individually selected from 0 or 1; AA126 is H; and AA18 is R, and AA22 is R, Q (wild type), G, A, L, M, W, K, S, V, I, Y, H, N, D, T, or F; AA1 is either A (wild type, a=1) or deleted (a=0); AA2 is either P (wild type, b=1) or deleted (b=0); AA3 is either T (wild type, c=1) or deleted (c=0); AA4 is either S (wild type, d=1) or deleted (d=0); AA5 is either S (wild type, e=1) or deleted (e=0); AA6 is either S (wild type, f=1) or deleted (f=0); AA7 is either T (wild type, g=1) or deleted (g=0); AA8 is either K (wild type, h=1) or deleted (h=0); AA9 is either K (wild type, i=1) or deleted (i=0); AA35 is K (wild type); AA38 is R (wild type); AA39 is M (wild type); AA55 is H (wild type); AA69 is V (wild type); AA74 is Q (wild type); AA80 is L (wild type); AA81 is R (wild type); AA85 is L (wild type); AA86 is type I (wild type); AA89 is type I (wild type); AA91 is V (wild type); AA92 is type I (wild type); AA97 is K (wild type); AA104 is M (wild type); AA109 is D (wild type); AA113 is T (wild type); AA125 is C (wild type), A or S; AA130 is S (wild type).
2. The polypeptide according to claim 1, wherein a = 0.
3. A polypeptide according to claim 1 or 2, which is PEGylated.
4. The polypeptide according to any one of claims 1 to 3, wherein the polypeptide is PEGylated, and the PEG portion of the PEGylated polypeptide has a molecular weight of about 10 kD to about 70 kD.
5. A polypeptide according to any one of claims 1 to 4, which is a fusion protein.
6. The polypeptide according to claim 5, wherein the fusion protein comprises an Fc domain.
7. A nucleic acid encoding the polypeptide according to any one of claims 1 to 6.
8. The nucleic acid according to claim 7, which is DNA.
9. A recombinant expression vector comprising the nucleic acid according to claim 7 or 8.
10. The vector according to claim 9, which is a viral vector.
11. The vector according to claim 9, which is a nonviral vector.
12. A host cell transformed with the vector according to any one of claims 9 to 11.
13. A pharmaceutical formulation comprising a polypeptide according to any one of claims 1 to 6, a nucleic acid according to claim 7 or 8, or a vector according to any one of claims 9 to 11.
14. A pharmaceutical composition for treating autoimmune or inflammatory diseases, disorders, or conditions or viral infections in mammalian subjects, comprising a polypeptide according to any one of claims 1 to 6, a nucleic acid according to claim 7 or 8, or a vector according to any one of claims 9 to 11.
15. The pharmaceutical composition according to claim 14, used in combination with one or more adjuvants selected from the group consisting of corticosteroids, Janus kinase inhibitors, calcineurin inhibitors, mTor inhibitors, IMDH inhibitors, biologics, vaccines, and therapeutic antibodies.
16. The pharmaceutical composition according to claim 15, wherein the therapeutic antibody is an antibody that binds to a protein selected from the group consisting of BLyS, CD11a, CD20, CD25, CD3, CD52, IgEIL-12 / IL-23, IL-17a, IL-1β, IL-4Rα, IL-5, IL-6R, integrin-α4β7, RANKL, TNFα, VEGF-A, and VLA-4.
17. The aforementioned disease, disorder, or condition is a viral infection, such as Helicobacter pylori. Pylori infection, HTLV, organ rejection, graft-versus-host disease, autoimmune thyroid disease, multiple sclerosis, allergy, asthma, neurodegenerative diseases including Alzheimer's disease, systemic lupus erythematosus (SLE), autoinflammatory diseases, inflammatory bowel disease (IBD), Crohn's disease, diabetes, chondritis, arthritis, rheumatoid arthritis, juvenile arthritis, juvenile rheumatoid arthritis, juvenile rheumatoid arthritis, polyarticular juvenile rheumatoid arthritis, systemic juvenile rheumatoid arthritis, juvenile ankylosing spondylitis, juvenile enteroarthritis, juvenile reactive arthritis, juvenile Reiter's syndrome, SEA syndrome, juvenile dermatomyositis, juvenile psoriatic arthritis, juvenile scleroderma, juvenile systemic lupus erythematosus, juvenile vasculitis, oligoarticular rheumatoid arthritis, polyarticular rheumatoid arthritis, systemic Rheumatoid arthritis, ankylosing spondylitis, enteritis arthritis, reactive arthritis, Reiter's syndrome, SEA syndrome, psoriasis, psoriatic arthritis, dermatitis (eczema), exfoliative dermatitis or atopic dermatitis, pityriasis rubra pilaris, pityriasis rosea, parapsoriasis, pityriasis lichenoid, lichen planus, lichen styli, ichthyosis-like skin diseases, keratosis, skin diseases, alopecia areata, pyoderma gangrenosum, vitiligo, bullous pemphigoid, A pharmaceutical composition according to any one of claims 14 to 16, selected from urticaria, porokeratosis, rheumatoid arthritis; seborrheic dermatitis, photodermatitis; seborrheic keratosis, senile keratosis, actinic keratosis, actinic keratosis, follicular keratosis; acne vulgaris; keloids; nevi; warts, warts including condyloma or genital warts, and human papillomavirus (HPV) infection.